Fig. S1. - PNAS · 2019-08-22 · (A) Heat map of commonly changed targets from RPPA analysis on A375 cells treated with 2 μΜ palbociclib or 500 nM GSK3326595 for 6 days, Fold change

1

Supplementary Information for Regulation of PRMT5-MDM4 axis is critical in the response to CDK4/6 inhibitors in melanoma Shatha AbuHammad1, Carleen Cullinane1, 2, Claire Martin1, Zoe Bacolas1, Teresa Ward1, Huiqin Chen3, Alison Slater1, Kerry Ardley1, Laura Kirby1, Emily J. Lelliott1, 2, Keefe T. Chan1, 2, Natalie Brajanovski1, Lorey K. Smith1,2, Aparna D. Rao1, Margarete Kleinschmidt1, Ismael A. Vergara1,4, Anthony T. Papenfuss1, 2, 4, 16, 17, Peter Lau1,2, Prerana Ghosh1, Sue Haupt1, 5, Ygal Haupt1, 2, 5 , 8, Elaine Sanij1, 5, Gretchen Poortinga1, 2, 6, Rick B. Pearson1, 2, 7, 8, Hendrik Falk4, 9, 10, David Curtis12,

13, Paul Stupple9, 11, Mark Devlin1, 9, Ian Street4, 9,10, Michael A. Davies14, 15, Grant A. McArthur1, 2,

6,18* and Karen E. Sheppard1, 2, 7,18* Karen E. Sheppard [email protected] This PDF file includes:

Figs. S1 to S4 Tables S1 to S5 Captions for databases S1 to S4 References for SI reference citations

Other supplementary materials for this manuscript include the following:

Datasets S1 to S4

www.pnas.org/cgi/doi/10.1073/pnas.1901323116

2

Fig. S1. (A) Venn diagrams showing the number of upregulated and downregulated genes in A375AR and CHL1AR compared to their respective parental counterparts. Fold change ≥ 1.5 and adjusted P value < 0.05. (B-E) Heat maps showing RPPA analysis of changes in PI3K, RAS/MAPK, receptor tyrosine kinases and apoptosis targets in A375AR and CHL1AR compared to their parental counterparts.

3

Fig. S2. (A-D) Proliferation curves of the parental and acquired-resistant cell lines treated with 500 nΜ GSK3326595 (250nM HT144) or vehicle. Graphs are representative of two independent experiments. Error bars represent s.e.m for 3 technical replicates. (E) Bar graph showing relative expression of MTAP mRNA in the resistant cells compared to the parental counterparts. Error bars represent s.d for 3 biological replicates. (F) Western blots on melanoma cell lysates after 6-days treatment with 2 μΜ palbociclib. (G-J) Bar graph representing counts of DAPI-stained nuclei

4

treated as indicated for 14 days. Error bars represent s.d for 2 biological replicates, each with 3 technical replicates (K) Bar graph representing percentages of cell death in cells treated as indicated for 14 days. Error bars represent s.d for 2 biological replicates.

5

Fig. S3. (A) Heat map of commonly changed targets from RPPA analysis on A375 cells treated with 2 μΜ palbociclib or 500 nM GSK3326595 for 6 days, Fold change ≥ 1.2 or ≤ -1.2. (B) Heat map of targets in (A) in A375 and A375AR cells treated as shown for 6 days, Fold change ≥ 1.2 or ≤ -1.2. (C) Western blots validation of RPPA analysis on melanoma cell lysates treated with 2 μΜ palbociclib, 500 nM GSK3326595, or combination of both drugs for 6 days (D) Western blots on melanoma cell lysates after 6-days treatment with 2 μΜ palbociclib. (E-F) Proliferation curves of the acquired resistance cells treated with 2 μM palbociclib, 250 nM SNS-032, or combination of both drugs. Graphs are representative of two independent experiments. Error bars represent s.e.m for 3 technical replicates. (G) Proliferation curves of A375 cells expressing shRB1 or shControl treated with 2 μM palbociclib. Graphs are representative of two independent experiments. Error bars represent s.e.m for 3 technical replicates. Western blots confirm RB1 knockdown. (H) Images of colony forming assays of A375AR cells expressing shRB1 or shControl treated with

6

combination of 1 μM palbociclib and 500 nM GSK3326595 for 14 days, and after drug removal for 14 days. Representative of 2 biological replicates with 3 technical replicates each.

7

8

Fig. S4. (A-B) Bar graph showing the normalized enrichment score (NES) for Hallmark gene sets enriched in the in A375 cells treated with either 1 μΜ palbociclib or 500 GSK3326595 for 72 compared to control. Normalized enrichment score (NES) ≥ 3.00 or ≤ -3.00, FDR ≤ 0.01. (C) Images of colony forming assays of cells expressing shTP53 or shControl treated with a combination of 1 μM palbociclib and 500 nM GSK3326595 for 14 days, and after drug removal for 14 days. Representative of 2 biological replicates with 3 technical replicates each. (D) Fluorescent western blots on lysates from A375 and A375AR treated as indicated (see Table S3). (E) Western blots on lysates from A375AR cells expressing shCDK2 or shControl (see Table S5).

9

Table S1. Characteristics of melanoma cell lines

Mutation Cell line

CDKN2A BRAF NRAS NF1 TP53

Initial GI50 (nM)

GI50 after developing resistance (nM)

A375 Non-sense V600E WT WT WT 90 278

HT144 Deletion V600E WT Non-sense WT 29 653

C002 Deletion WT Q61K WT WT 37 730

CHL1 STOP WT WT WT H193R 144 4456

C067 STOP WT WT Non-sense R282G 32 >10000

10

Table S2. Commonly upregulated genes in A375AR and CHL1AR.

Gene ID

Upregulated in A375AR

Upregulated in CHL1AR Gene Function

FC adj.P.Val FC adj.P.Val ADARB2 3.99 0.00171 1.57 0.000512253 RNA-editing enzyme.

ATOH8 2.82 0.00075 1.83 0.035778627 Transcription factor.

B3GALT2 2.49 0.00158 1.52 0.044111043 Glycosphingolipid biosynthesis.

C16orf45 2.10 6.78E-05 1.58 0.018756185 Uncharacterized protein.

C1S 5.34 0.00038 1.97 0.004985996 Complement and coagulation cascades.

CCNE1 1.63 0.00053 3.01 9.59E-08 Cell cycle,

CLU 1.80 0.00021 1.81 4.84E-05 Molecular chaperone. Cell adhesion. Programmed cell death.

CPVL 1.60 0.00099 2.29 0.012391623 Enzyme protease.

FN1 3.31 0.00074 3.41 1.97E-07 PI3K-Akt signaling pathway. ECM-receptor interaction.

FOLH1 10.24 0.00048 1.96 7.89E-05 Metabolic pathways.

H19 5.52 8.09E-05 1.68 0.003871376 Long noncoding RNA

JAG1 1.74 0.00587 1.76 0.000915205 Notch signaling pathway

LIMCH1 1.66 0.0004 1.54 0.002445258 Focal adhesion. Cell migration.

MYEF2 1.84 0.00032 2.23 1.20E-05 Single-stranded DNA binding factor.

NLRP1 1.58 0.0318 1.72 4.85E-05 NOD-like receptor signaling pathway.

NR0B1 4.55 0.00033 1.96 0.022038907 Orphan nuclear receptor - dominant-negative regulator of transcription of other nuclear receptors

NRCAM 3.57 6.04E-05 1.66 0.006018447 Cell adhesion molecules (CAMs).

PALM3 2.70 0.00063 2.16 0.00010988 ATP-binding protein – Toll-like receptor (TLR) signaling.

PCDHA6 1.65 0.00062 1.64 0.000808463 Potential calcium-dependent cell-adhesion protein.

PCDHB15 2.16 0.00822 1.73 0.000830049 Potential calcium-dependent cell-adhesion

protein. PCDHGA10 1.89 0.00645 1.70 0.000217953 Potential calcium-dependent cell-adhesion

protein. PCDHGA3 2.26 0.01381 2.20 0.01028841 Potential calcium-dependent cell-adhesion

protein.

PCSK1N 4.32 7.87E-05 1.54 0.002879012

PDE4B 3.03 0.00084 2.05 0.001962711 cAMP signaling pathway.

11

PDZRN3 2.44 0.02354 3.16 6.59E-05 E3 ubiquitin-protein ligase.

RBM11 7.20 0.00025 2.17 0.00675116 Tissue-specific splicing factor.

RNF152 3.01 0.0006 1.54 0.001088443 Lysosome-anchored E3 ubiquitin Negative regulator of the mTORC1 pathway

SEMA3C 1.63 9.36E-05 1.74 0.001147078 Axon guidance.

SERPINI1 2.10 0.01491 1.56 0.000200378 Serine proteinase inhibitor.

SLC9A7 2.22 0.00034 1.52 0.040644388 Sodium and potassium/ proton antiporter.

TCHH 1.82 0.03052 2.09 0.006634606 Intermediate filament-associated protein.

TSC22D3 2.36 0.00096 1.55 0.002806087 Transcriptional regulators.

TTYH2 1.66 0.00349 1.68 0.000152164 Glucocorticoid-Induced Leucine Zipper Protein.

VCAN 1.74 0.00994 2.33 4.30E-05 Cell adhesion molecules (CAMs).

12

Table S3. List of antibodies.

Antibody Source

Mouse monoclonal anti-actin (C4) antibody. Cat# ICN691002 Thermo Fisher Scientific

*Rabbit polyclonal anti-Histone H4R3 Dimethyl Symmetric (H4R3me2s) Antibody. Cat# A-3718-100

Epigentek

* Mouse Anti-Histone H4 antibody. Cat# ab17036 abcam

Rabbit monoclonal anti-p21 Waf1/Cip1 (12D1) antibody. Cat# 2947

Cell Signaling Technology

Mouse monoclonal anti-p53 (DO-1) antibody. Cat# sc-126 Santa Cruz Biotechnology

Rabbit polyclonal anti-PRMT5 antibody. Cat# 07-405 Millipore

Mouse monoclonal anti-tubulin alpha (dm1a) antibody. Cat# 05-829

Millipore

Rabbit polyclonal anti-HdmX/MDM4 antibody. Cat# A300-287A

Bethyl

Mouse monoclonal anti- RB1 (G3-245) antibody. Cat# 554136 BD Pharmingen

Rabbit polyclonal phosphor-RB-S807/811 antibody. Cat# 9308S Cell Signaling

Rabbit monoclonal CDK2 (H-298) antibody. Cat# sc-748 Santa Cruz Biotechnology

Rabbit polyclonal anti-MEP50 antibody. Cat# 2823S Cell Signaling

Rabbit polyclonal anit-CDK1/CDC2 p34 (H-297) antibody . Cat# sc-747

Santa Cruz Biotechnology

Rabbit polyclonal anit-CDK4 (C-22) antibody. Cat# sc-260 Santa Cruz Biotechnology

Rabbit polyclonal anti-CDK6 (C-21) antibody. Cat# sc-177 Santa Cruz Biotechnology

13

RPPA antibodies (MD Anderson Cancer Center RPPA Core Facility)

https://www.mdanderson.org/research/research-resources/core-facilities/functional-proteomics-rppa-core/antibody-information-and-protocols.html

* Specificity of H4R3me2s band against H4 was confirmed by fluorescent western blotting (Figure S4D)

14

Table S4. List of primers

Primer Source MDM4 specific primers (Alternative splicing analysis), forward: 5′-TGTGGTGGAGATCTTTTGGG-3′ (1)

MDM4 specific primers (Alternative splicing analysis), reverse: 5- GCAGTGTGGGGATATCGT-3′ (1)

CDKN1A (p21) specific primers (qPCR), forward: 5’GAGGCCGGGATGAGTTGGGAGGAG3’ (2)

CDKN1A (p21) specific primers (qPCR), reverse: 5’CAGCCGGCGTTTGGAGTGGTAGAA3’ (2)

MDM2 specific primers (qPCR), forward: 5’ TGAATCTACAGGGACGCCATC 3’ This paper

MDM2 specific primers (qPCR), forward: 5’ TCACTTACACCAGCATCAAGATCC 3’ This paper

15

Table S5 list of Recombinant DNA

Recombinant DNA Source

Plasmid: pMDLg/pRRE Addgene plasmid # 12251 (3)

Plasmid: pRSV-REV Addgene plasmid # 12253 (3)

Plasmid: pCMV-VSV-G Addgene plasmid # 8454 (4)

Plasmid: FH1t, shRNA targeting sequence: MDM4 Forward: 5′-TCCC ACAGTCCTTCAGC TATTTCAT TTCAAGAGA ATGAAATAGCTGAAGGACTGT TTTTTC 3′

(2, 5)

Plasmid: FH1t, shRNA targeting sequence: MDM4 reverse: 5′-TCGAGAAAAA ACAGTCCTTCAGCTATTTCAT TCTCTTGAA ATGAAATAGCTGAAGGACTGT-3′

(2, 5)

Plasmid: FH1t, shRNA targeting sequence: shMdm4Wobble (non-targeting) Forward: 5′-TCCC ACCGTCCGCAAGCTATGTCAT TTCAAGAGA ATGACATAGC TTGCGGACGGT TTTTTC-3′

(2, 5)

Plasmid: FH1t, shRNA targeting sequence: shMdm4Wobble (non-targeting) Reverse: 5′-TCGAGAAAAA ACCGTCCGCAA GCTATGTCAT TCTCTTGAA ATGACATAGCTTGCGGACGGT-3′.

(2, 5)

**Plasmid: pGIPZ, shRNA targeting sequence: CDK2#1: AAGATTTTAGTAAAGTTGT

Thermo Scientific Decode Pooled Lentiviral shRNA Screening Library

16

**Plasmid: pGIPZ, shRNA targeting sequence: CDK2 #2: AGGATGAACAATTATATTT


Plasmid: pGIPZ, shRNA targeting sequence: TP53 #1: CCACTACAACTACATGTGTAA


Plasmid: pGIPZ, shRNA targeting sequence: TP53 #2: CCGGCGCACAGAGGAAGAGAA


Plasmid: pGIPZ, shRNA targeting sequence: RB1 #2: GTGATTTCATTTCAGTTAA


Plasmid: pGIPZ, shRNA targeting sequence: RB1 #2: TCGATATCTACTGAAATAA


Plasmid: pGIPZ, shRNA targeting sequence: p21 #2: ACCAGCATGACAGATTTCT


Plasmid: pGIPZ, shRNA targeting sequence: p21 #2: AGTTTGTGTGTCTTAATTA


Plasmid: pGIPZ, Non-targeting shRNA sense sequence: ATCTCGCTTGGGCGAGAGTAAG


* Specificity of the reagent to CDK2 was confirmed by measuring levels of CDK1,4,6 (Figure S4E)

17

Captions for databases S1 to S4 Dataset S1 A375AR_GSEA_RECTOME. Reactom gene sets enriched in A375AR compared to A375 cells. Dataset S2 CHL1AR_GSEA_RECTOME. Reactom gene sets enriched in CHL1AR compared to CHL1 cells. Dataset S3_A375AR_GESA_GO. GO gene sets enriched in A375AR compared to A375 cells. Dataset S4 CHL1AR_GSEA_GO. GO gene sets enriched in CHL1AR compared to CHL1 cells. References 1. M. Dewaele et al., Antisense oligonucleotide–mediated MDM4 exon 6 skipping

impairs tumor growth. Journal of Clinical Investigation 126, 68-84 (2015). 2. S. Haupt et al., Targeting Mdmx to treat breast cancers with wild-type p53. Cell

Death Dis 6, e1821 (2015). 3. T. Dull et al., A third-generation lentivirus vector with a conditional packaging

system. J Virol 72, 8463-8471 (1998). 4. S. A. Stewart et al., Lentivirus-delivered stable gene silencing by RNAi in

primary cells. RNA 9, 493-501 (2003). 5. M. J. Herold, J. van den Brandt, J. Seibler, H. M. Reichardt, Inducible and

reversible gene silencing by stable integration of an shRNA-encoding lentivirus in transgenic rats. Proceedings of the National Academy of Sciences of the United States of America 105, 18507-18512 (2008).

Documents

Fig. S1. - PNAS · 2019-08-22 · (A) Heat map of commonly changed targets from RPPA analysis on A375 cells treated with 2 μΜ palbociclib or 500 nM GSK3326595 for 6 days, Fold change