FFFFAMILY POULTRY COMMUNICATIONS · México, E-mail: Coordinator, INFPD | Coordonnateur du RIDAF | Coordinador del RIDAF Dr. E. Fallou Guèye, Livestock

i

FFFFFFFFAAAAAAAAMMMMMMMMIIIIIIIILLLLLLLLYYYYYYYY PPPPPPPPOOOOOOOOUUUUUUUULLLLLLLLTTTTTTTTRRRRRRRRYYYYYYYY CCCCCCCCOOOOOOOOMMMMMMMMMMMMMMMMUUUUUUUUNNNNNNNNIIIIIIIICCCCCCCCAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNSSSSSSSS

CCCCCCCCOOOOOOOOMMMMMMMMMMMMMMMMUUUUUUUUNNNNNNNNIIIIIIIICCCCCCCCAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNNSSSSSSSS EEEEEEEENNNNNNNN AAAAAAAAVVVVVVVVIIIIIIIICCCCCCCCUUUUUUUULLLLLLLLTTTTTTTTUUUUUUUURRRRRRRREEEEEEEE FFFFFFFFAAAAAAAAMMMMMMMMIIIIIIIILLLLLLLLIIIIIIIIAAAAAAAALLLLLLLLEEEEEEEE

CCCCCCCCOOOOOOOOMMMMMMMMUUUUUUUUNNNNNNNNIIIIIIIICCCCCCCCAAAAAAAACCCCCCCCIIIIIIIIOOOOOOOONNNNNNNNEEEEEEEESSSSSSSS EEEEEEEENNNNNNNN AAAAAAAAVVVVVVVVIIIIIIIICCCCCCCCUUUUUUUULLLLLLLLTTTTTTTTUUUUUUUURRRRRRRRAAAAAAAA FFFFFFFFAAAAAAAAMMMMMMMMIIIIIIIILLLLLLLLIIIIIIIIAAAAAAAARRRRRRRR

Volume|Volumen 21 Number|Numéro|Número 1 January|Janvier|Enero – June|Juin|Junio 2012

PPuubblliisshheedd bbyy | PPuubblliiééeess ppaarr | PPuubblliiccaaddoo ppoorr INTERNATIONAL NETWORK FOR FAMILY POULTRY DEVELOPMENT

RÉSEAU INTERNATIONAL POUR LE DÉVELOPPEMENT DE L'AVICULTURE FAMILIALE

RED INTERNACIONAL PARA EL DESARROLLO DE LA AVICULTURA FAMILIAR www.infpd.net

www.fao.org/ag/againfo/themes/en/infpd/home.html

FFaammiillyy PPoouullttrryy CCoommmmuunniiccaattiioonnss ((FFPPCC)) |CCoommmmuunniiccaattiioonnss eenn AAvviiccuullttuurree FFaammiilliiaallee ((CCAAFF)) |CCoommuunniiccaacciioonneess eenn AAvviiccuullttuurraa FFaammiilliiaarr ((CCAAFF))

EEddiittoorr--iinn--CChhiieeff,, FFPPCC | ÉÉddiitteeuurr--eenn--CChheeff,, CCAAFF | EEddiittoorr PPrriinncciippaall,, CCAAFF

Dr. Jean Claude Fotsa, Mankon Polyvalent Research Station, P.O.Box: 125 Bamenda, Republic of Cameroon, E-mail: <[email protected]> and <[email protected]>

AAssssoocciiaattee EEddiittoorr,, FFPPCC | ÉÉddiitteeuurr aassssoocciiéé,, CCAAFF | RReeddaaccttoorraa AAssoocciiaaddaa,, CCAAFF

Pr. Johnson Oluwasola Agbede, Dept. of Animal Production and Health, Federal University of Technology, P.M.B. 704, Akure, Nigeria, E-mail: <[email protected]>

SSppaanniisshh ttrraannssllaattoorr | TTrraadduucctteeuurr eenn EEssppaaggnnooll |TTrraadduuccttoorr eenn EEssppaaññooll

Mr. Mario Chanona Farrera, Av. Juan Crispin No. 455, Col. Plan de Ayala, C.P. 29,020, Tuxtla Gutierrez, Chiapas, México, E-mail: <[email protected]>

CCoooorrddiinnaattoorr,, IINNFFPPDD | CCoooorrddoonnnnaatteeuurr dduu RRIIDDAAFF | CCoooorrddiinnaaddoorr ddeell RRIIDDAAFF

Dr. E. Fallou Guèye, Livestock Production Systems Branch (AGAS), Animal Production and Healt Division. FAO, Viale delle Terme di Caracalla, 00153 Rome, Italy, E-mail: <[email protected]> or <[email protected]>

IInntteerrnnaattiioonnaall EEddiittoorriiaall BBooaarrdd | CCoommiittéé ÉÉddiittoorriiaall IInntteerrnnaattiioonnaall | CCoommiittéé ddee rreeddaacccciióónn IInntteerrnnaacciioonnaall

Pr. J.O. Agbede, Department of Animal Production and Health, The Federal University of Technology, Akure, Nigeria ● Dr. R.G. Alders, International Rural Poultry Centre, Kyeema Foundation, Qld, Australia / Lubango, Angola ● Dr. B. Bagnol, International Rural Poultry Centre, Kyeema Foundation, Australia and Mozambique ● Prof. J.G. Bell, United Kingdom ● Prof. A. Cahaner, Hebrew University of Jerusalem, Rehovot, Israel ● Prof. Aureliano Júarez Caratachea, Universidad Michoacana de San Nicolás de Hidalgo, Tarimbaro, Michoacán, México ● Dr. J.C. Fotsa, Mankon Polyvalent Research Station, Bamenda, Cameroon ● Dr. E.F. Guèye, Livestock Production Systems Branch, FAO, Rome, Italy ● Dr. Q.M.E. Huque, Bangladesh Livestock Research Institute, Dhaka, Bangladesh ● Dr. S. Pousga, Université Polytechnique de Bobo-Dioulasso, Burkina Faso ● Prof. R.A.E. Pym, University of Queensland, St Lucia Queensland, Australia ● Dr. P.C.M. Simons, World’s Poultry Science Association, Beekbergen, The Netherlands ● Prof. E.B. Sonaiya, Obafemi Awolowo University, Ile-Ife, Nigeria ● Dr. O. Thieme, FAO Animal Production and Health Division, Rome Italy ● Dr. M. Tixier-Boichard, Institut National de la Recherche Agronomique, Jouy-en-Josas, France ● Dr. H.M.J. Udo, Wageningen Agricultural University, Wageningen, The Netherlands ● Dr. L. Waldron, World’s Poultry Science Journal, Feilding, New Zealand

The views expressed by the various authors in Family Poultry Communications do not necessarily reflect the official position and

policies of the Food and Agriculture Organization of the United Nations (FAO).

Les opinions exprimées par les différents auteurs dans Communications en Aviculture Familiale ne reflètent pas nécessairement la

position et les politiques de l’Organisation des Nations-Unies pour l’Alimentation et l’Agriculture (FAO).

Las opiniónes expresadas por los diferentes autores en Comunicaciones en Avicultura Familiar no necesariamente reflejan la

posición y las políticas oficiales de la Organización para la Agricultura y la Alimentación de los Naciones Unidas (FAO).

ISSN 0796-9295

ii

CONTENTS | SOMMAIRE | CONTENIDO EDITORIAL | ÉDITORIAL | EDITORIAL ............................................................................................................................ 1

From Newsletter to Journal - J.C. Fotsa .................................................................................. 1

Du Bulletin d’Informations à une Revue - J.C. Fotsa ............................................................... 2

De Periodico A Revista - J.C. Fotsa .......................................................................................... 3

ORIGINAL ARTICLES | ARTICLES ORIGINAUX | ARTICULOS ORIGINALES .................................................................... 4

État des lieux des parasitoses intestinales chez les poules commerciales dans le département de

l’Atlantique : cas d’Abomey-Calavi, Ouidah et Toffo - T.J. Dougnon, A.P. Edorh, P. Tobada & M.

Gbeassor ................................................................................................................................ 4

Effect of wet feeding on performance of guinea fowl - H.K. Dei, T. Tindan & A. Mohammed ..... 11

Performance of family poultry in Haiti and challenges of a husbandry support program - V.P.

Nchinda, O. Thieme & N.I. Ogali ........................................................................................... 15

Effect of pinioning on growth and behaviour of guinea fowl - H.K. Dei & S.S. Fuseini ............. 25

SHORT COMMUNICATIONS| BREVES COMMUNICATIONS | COMUNICACIONES BREVES ........................................ 29

Promotion of Rural Poultry Production in India - Satish J. Manwar ........................................ 29

NEWS | NOUVELLES | NOTICIAS .................................................................................................................................. 36

A new INFPD Executive Committee - E.B. Sonaiya ................................................................. 36

Un nouveau Comité Exécutif du RIDAF - E.B. Sonaiya ........................................................... 36

Un nuevo Comité Ejecutivo del RIDAF - E.B. Sonaiya ............................................................. 37

INSTRUCTIONS TO AUTHORS | RECOMMANDATIONS AUX AUTEURS | INSTRUCCIONES PAR AUTORES .................. 38

Instructions to authors .......................................................................................................... 38

Recommandations aux auteurs .............................................................................................. 40

Instrucciones para autores .................................................................................................... 44

Family Poultry Communications | Communications en Aviculture Familiale | Comunicaciones en Avicultura Familiar, Vol.21, No.1 1/46

Editorial | Éditorial | Editorial From Newsletter to Journal

It is the pleasure of the new Editorial Board members to release this first edition of the journal after it has metamorphosed from a Newsletter to a substantive journal, Family Poultry Communications (FPC). While we like to apologize for the delay, it may be necessary to mention here that the delay, though not deliberate, was necessary in order to perfect and ensure regular releases under this new breath. Members of the Editorial Board clearly realize that the attainment of standards is a journey, and not a destination! Consequently, we are open to suggestions and opinions aimed at adding value to the Family Poultry Communications.

It is estimated that the world food requirements by the year 2050 will no doubt double that of 2012. An important part of these requirements will come from the developing countries and thus it is imperative that smallholding farmers, especially those keeping family poultry, are given their place in food security developmental programmes. Therefore, research findings that could be of interest to the local farmers must be promoted with a view, not only to increasing family protein intake to abate protein deficiency among the vulnerable groups but also to providing employment opportunities and income generation among the resource poor. In addition, practical ways of solving some emerging developmental problems such as genetics, nutrition, management and diseases confronting family poultry in developing world’s needs to be documented. Family Poultry Communications, the official publication of the International Network for Family Poultry Development (INFPD), is expected to be a veritable medium for channeling all the relevant information to the outside world. The Editorial board is therefore ready to meet this Herculean task, thanks to God’s help.

In this issue, you will find both reports on research findings and reviews which are aimed at improving poultry production. We ensured that the instructions to authors,which we included in this edition, are respected by all those who submitted their manuscripts to Family Poultry Communications. We invite all potential contributors to follow these Instructions.

We would like to appreciate the efforts of Dr. El Hadji Fallou Guèye, the current INFPD Coordinator and former Editor-in-Chief of the INFPD Newsletter who is also one of our French language translators for papers in English and of Mr. Mario Chanona Farrera our Spanish language translator who both help to maintain the interest of our readers in these languages. I am particularly grateful to Prof. Agbede Johnson Oluwasola, Deputy Editor-in-Chief for his invaluable help by working so hard alongside with the Editorial Board to surmount the inevitable challenges of launching this edition of the Journal, Family Poultry Communications. We express our sincere gratitude to the reviewers for the sacrifice they have been making in reviewing the many manuscripts submitted for publication and making the necessary corrections. I would also like to thank FAO and especially Dr. Olaf Thieme for his interest and support to INFPD. I offer my sincere thanks to Prof. Emmanuel Babafunso Sonaiya, INFPD co-founder and former Coordinator, for his efforts to build the foundation on which we stand in this moment of history. Dr. Fotsa Jean Claude, Editor-in-Chief, Family Poultry Communications Mankon Polyvalent Research Station, P.O.Box 125 Bamenda, Republic of Cameroon, E-mail: <[email protected]>

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~


Du Bulletin d’Informations à une Revue

C'est avec un plaisir pour les nouveaux membres du comité Editorial de sortir cette première édition du journal après qu’il soit muté du Bulletin d’Informations à une Revue: Communications en Aviculture Familiale (CAF). Même si nous tenons à nous excuser pour le retard, il peut être nécessaire de mentionner ici que le retard, non délibéré, était nécessaire afin de se perfectionner et d'assurer une parution régulière sous ce nouveau souffle. Les membres du Comité Editorial sont bien conscients qu’arriver aux normes et standards est un long processus et non une destination ! Par conséquent, des suggestions et opinions pouvant permettre des améliorations de Communications en Aviculture Familiale seront les bienvenues.

On estime que les besoins alimentaires mondiaux à l’horizon 2050 seront sans aucun doute le double de ceux de 2012. Une importante part de ces besoins viendra des pays en développement. Il est donc de ce fait impératif que les petits fermiers, en particulier les aviculteurs familiaux se taillent la place qui est la leur dans les programmes de développement pour la sécurité alimentaire. Par conséquent, les résultats des recherches prouvant leur utilité auprès des aviculteurs locaux devront être encouragés ayant en vue, non seulement de rehausser la consommation familiale en protéines et réduire ainsi les carences protéiques chez les plus vulnérables, mais aussi d’augmenter les possibilités d’emploi afin d’accroitre les revenus chez les plus démunis. En outre, les moyens les plus pragmatiques pour résoudre certains problèmes émergents de développement comme la génétique, la nutrition, la gestion et le contrôle des maladies affectant l’aviculture familiale dans le monde en développement demande une bonne documentation. En tant que publication officielle du Réseau international pour le développement de l'aviculture familiale (RIDAF), les Communications en Aviculture Familiale devraient être une véritable interface de relai de toutes les informations pertinentes vers le monde extérieur. Le Comité Editorial est par conséquent prêt pour affronter cette tâche d’Hercule par la grâce de Dieu.

Dans cette édition, vous trouverez à la fois les résultats des recherches et une brève communication dont le but est d’améliorer la production avicole. Nous avons veillé à ce que les recommandations aux auteurs, que nous avons pris le soin d’inclure dans cette édition, soient respectées par tous ceux qui ont soumis leurs manuscrits au Journal Communications en Aviculture Familiale. Nous invitons tous les potentiels contributeurs de suivre ces Recommandations.

Je tiens à apprécier les efforts déployés par Dr. El Hadji Fallou Guèye, l’actuel Coordonnateur du RIDAF et ancien Editeur-en-Chef du Bulletin RIDAF et qui se trouve aussi être l'un de nos traducteurs en langue française pour les articles en Anglais et le M. Mario Chanona Farrera qui est notre Traducteur en langue espagnole afin de prendre en compte les intérêts des lecteurs dans ces langues respectives. Je suis particulièrement reconnaissant envers le Prof. Agbede Johnson Oluwasola, Rédacteur-en-Chef Adjoint pour l’aide ô combien inestimable qu’il a apportée au comité Editorial en levant les difficultés qui auraient pu empêcher la sortie de cette édition de Communications en Aviculture Familiale. J’exprime ici ma profonde gratitude aux relecteurs pour l’esprit de sacrifice qu’ils ont fait montre en évaluant les nombreux manuscrits soumis pour publication tout en leur apportant les corrections nécessaires. Je voudrais également remercier la FAO et surtout le Dr. Thieme Olaf pour le soutien au RIDAF. Je présente mes sincères remerciements au Prof. Emmanuel Babafunso Sonaiya pour, co-fondateur et ancien Coordonnateur du RIDAF, pour ses efforts soutenus pour bâtir le socle sur lequel nous nous tenons en ce moment précis de l’histoire. Dr. Fotsa Jean Claude Editeur-En-Chef de Communications en Aviculture Familiale (CAF) Station Polyvalente de Recherche Agricole de Mankon, B.P. 125 Bamenda, République du Cameroun, E-mail<[email protected]>

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~


De Periodico A Revista

Es un placer para todos los miembros del consejo editorial el presentar a la primera publicación de la metamorfosis sufrida por nuestro periódico a una revista más sustancial, Family Poultry Comunications (FPC), (comunicados de avicultura familiar). También deseamos presentar una disculpa por el retraso, que aunque no ha sido deliberado, si ha sido necesario para darle nuevo aliento a nuestros comunicados. Nuestro consejo editorial ve claramente que los logros se obtienen atraves de la jornada y no como una meta. En consecuencia, estamos abiertos a opiniones, y sugerencias que le den mayor valor a los Comunicados de Avicultura Familiar.

Se estima que para el año 2050, las necesidades de alimento serán de el doble que para el año 2012. Una parte importante de este requerimiento será para los países en desarrollo, por eso es importante que los pequeños productores y muy en especial aquellos que manejan aves, tengan un lugar para su seguridad alimentaria dentro de los programas de apoyo para el desarrollo de la avicultura familiar. Por esto, los hallazgos dentro de las investigaciones que puedan ser de interés para los productores locales, deben de ser promovidas con una visión no solo para incrementar el consumo de proteínas y abatir esta deficiencia dentro de los grupos más vulnerables, sino también para proveer empleo, oportunidades de generar ingresos para resarcir la pobreza. Además, el encontrar formas prácticas de resolver los problemas de genética, alimentación, manejo, atención de enfermedades, todo esto debe de ser documentado en los países en desarrollo. Los Comunicados de Avicultura Familiar, publicación oficial de la Red Internacional para el Desarrollo de la Avicultura Familiar (RIDAF), (INFPD) por sus siglas en inglés, se espera sean el medio para canalizar toda la información relevante hacia el mundo exterior. El consejo editorial se encuentra listo para esta tarea titánica con la ayuda de Dios.

En esta revista, vamos a encontrar ambos, reportes sobre hallazgos de investigaciones, asi como reportes que nos permiten obtener mejoras en la producción avícola. Les aseguramos que las contribuciones de los autores que incluimos en esta edición, son respetuosas de todos aquellos que enviaron sus manuscritos a Comunicados de Avicultura Familiar. Invitamos a todos los potenciales colaboradores para que sigan este camino.

Deseamos agradecer el esfuerzo del Dr. Fallou Gueye, el actual coordinador del (RIDAF) y editor en jefe del periódico INFPD (RIDAF), quien además es el traductor oficial al idioma Frances de los documentos recibidos en Inglés y al MVZ. Mario Chanona Farrera nuestro traductor al Español, con el afán de tener lectores en estos idiomas. Yo estoy particularmente agradecido con el Pfr.Agbede Johnson Oluwasola editor en jefe por su invaluable ayuda, el ha estado trabajando arduamente con el consejo editorial, para superar los desafíos inevitables para la realización de esta revista. Expreso mi sincero agradecimiento a quienes revisaron todos los manuscritos enviados para esta publicación y hacerles las correcciones necesarias. Asi también deseo agradecer a la FAO, en especial al Dr. Olaf Thieme por su interés y apoyo al RIDAF. Ofresco mi agradecimiento al Prof. Emmanuel Baba Funso Sonaya, co-fundador del RIDAF y principal coordinador, por su esfuerzo en construir la fundación en la que nos encontramos en este momento de la historia. Dr. Fotsa Jean Claude. Editor en Jefe de Comunicaciones de Avicultura Familiar (CAF) Estación de investigaciones polivalentes de Mankon, P.O. Box 125 Bamenda, República de Camerún. E-mail: <[email protected]>

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~


Original articles | Articles originaux | Articulos Originales État des lieux des parasitoses intestinales chez les poules commerciales dans le département de l’Atlantique : cas d’Abomey-Calavi, Ouidah et Toffo T.J. DOUGNON1*, A.P. EDORH2, P. TOBADA1 & M. GBEASSOR3 1. Ecole Polytechnique d’Abomey-Calavi (EPAC), Département de Productions Animales, Laboratoire de

Recherches en Biologie Appliquée (LARBA), Université d’Abomey-Calavi (UAC), 01 BP 2009 Cotonou, Bénin

2. Département de Biochimie et de Biologie Cellulaire, Université d’Abomey-Calavi (UAC), 01 BP 526 Cotonou, Bénin.

3. Faculté des Sciences, Université de Lomé, BP 1515 Lomé, Togo. *Auteur pour correspondance: Tél.: 00(229) 97396411/90084371 e-mail: [email protected] Résumé La production avicole est en plein essor au Bénin. Cependant, elle est confrontée à d’énormes contraintes parmi lesquelles les parasitoses intestinales occupent une place de choix. Cette étude de la parasitose intestinale a été faite chez les poules commerciales élevées au sol et en cage pendant la phase pré-ponte et ponte dans le département de l’Atlantique au Bénin. Le parasitisme interne, évalué par les œufs par gramme (OPG) de parasites, était plus élevé au sol qu’en cages avec les résultats suivants : 32,6 ± 9,14 contre 42,3 ± 00 pour Ascaridia et 590,7 ± 42,23 contre 79,9 ± 40,8 pour les coccidies. Le parasite Capillaria est plus abondant en cages qu’au sol avec des valeurs respectives de 6,2 ± 1,25 contre 3,3 ± 1,67. Les poules sont moins parasitées en phase pré-ponte que durant la période de ponte: 1,3 ± 0,33 contre 3,3 ± 1,67 pour le parasite Capillaria ; 5,2 ± 1,18 contre 32,6 ± 3,14 pour Ascaridia. En ce qui concerne les coccidies, le phénomène est inverse avec une valeur de 3237,6 ± 429,91 pendant la phase pré-ponte contre 590,7 ± 42,23 pour la phase ponte. La présence des vers ronds et des coccidies dans les exploitations de poules pondeuses de souche commerciale fait suite à un programme de déparasitage inadéquat et par conséquent nécessite un renforcement des capacités des aviculteurs dans ce domaine précis afin de lever cette contrainte. Mots-clés : Parasitoses intestinales, poulets commerciaux, Bénin. State of intestinal parasitosis of commercial chickens in the Atlantic Division: case study of Abomey, Ouidah and Toffo Abstract Poultry production is booming in Benin. However, it faces numerous constraints, including the intestinal parasitism which plays a major role. This study about internal parasitism was carried out in laying hens kept under different management systems (floor, cages) during the pre-laying and laying phases in the Atlantic Department, Benin. Internal parasitism, assessed through eggs per gram (EPG) parasites, was higher on floor than in cages with the following results: 32.6 ± 9.14 vs 42.3 ± 00 for Ascaridia and 590.7 ± 42.23 versus 79.9 ± 40.8 for coccidia. Regarding the Capillaria parasite, the difference is not significant even if the value of 3.3 ± 1.67 in the floor is lower than 6.2 ± 1.25 obtained in cages. Internal parasitism is less noticeable in the pre-laying phase than in the laying phase with the following values: 1.3 ± 0.33 versus 3.3 ± 1.67 for the Capillaria parasite; 5.2 ± 1.18 vs 32 , 6 ± 3.14 for Ascaridia. With regard to coccidia, the situation is reversed with a value of 3237.6 ± 429.91 during the pre-laying phase compared with 590.7 ± 42.23 during the laying phase. The presence of roundworms and coccidia in imported laying hen flocks requires the training of farmers in the poultry sector. Keywords: Intestinal parasitosis, commercial chickens, Atlantic, Benin.


Condición de Parasitosis Interna en Gallinas Comerciales en Division Atlantic: Estudio de caso de Abomey, Ouidah y Toffo Resumen En un estudio realizado durante la etapa de desarrollo de gallinas de postura importadas en el Depatamento Atlantico de Bénin, se evaluaron la cantidad de huevos por gramo (EPG) de heces, en las etapas de pre-postura y postura, bajo los sistemas de manejo en piso y en jaula. Fueron encontradas, mayores cantidades de parásitos internos en las aves de piso que en las de jaula, encontrándose los siguientes resultados. 32.6 ± 9.14 vs. 42.3± para Ascaridia; y 590.7 ± 42.23 vs. 79.9 ± 40.8 para Coccidia. Con respecto a Capillaria la diferencia no fue significativa aún cuando el valor de 3.3 ± 1.67 en el piso fue más bajo que el de 6.2 ± 1.25 obtenido en las jaulas. Los parásitos internos fueron menos presentes en la etapa de pre-postura que en la etapa de postura, con los siguientes valores: 1.3 ± 0.33 vs. 3.3 ± 1.67 para la Capillaria; 5.2 ± 1.18 vs. 32.6 ± 3.14 para las Ascaridias. Con respecto a las Coccidias el valor es al revéz con 3237.6 ± 429.91 durante la pre-postura, comparado con 590.7 ± 42.23 durante la fase de postura. La presencia de Ascarides y de Coccidias en gallinas importadas requiere de un entrenamiento en los avicultores. Palabras Clave: Parásitos Intestinales, Gallinas Comerciales, Atlantic, Bénin. Introduction

La poussée démographique en République du Bénin favorise la demande toujours croissante en protéines d’origine animale. Pour pallier le déficit alimentaire, l’élevage des animaux à cycle court, surtout de la volaille revêt une importance capitale. Cependant, l’explosion de la filière avicole ces dix dernières années est confrontée à certaines contraintes. En effet, en 1991, les mortalités annuelles de poussin en élevage avicole au Cameroun étaient évaluées à 90% (Amayene, 1991). Outre les maladies infectieuses, ces mortalités sont attribuées aux maladies parasitaires notamment celles dues aux parasites gastro-intestinaux (Ikeme, 1971). A. galli est le plus prévalent et le plus abondant nématode chez les oiseaux de basse-cour au Nigeria (Ikeme, 1971) et le second après Heterakis spp. à Dschang au Cameroun (Mpoame et Essomba, 2000). Selon Chrysostome et al. (1995), les risques sanitaires constituent le principal frein au développement de l’aviculture au Bénin. Les dégâts économiques liés aux parasitoses dues aux helminthes, protozoaires et ectoparasites occupent une place non négligeable dans le non-décollement de la filière. La lutte efficace, rationnelle et permanente contre les parasitoses impose une meilleure connaissance des parasites mis en cause dans le contexte avicole béninois. Malgré les travaux de Mpoame et al. (2003) au Cameroun et de Oloukounlé (2003) au Bénin, la volaille continue de payer un lourd tribut aux parasitoses gastro-intestinales d’où l’importance de la présente étude dans les élevages de poulets importés dans l’Atlantique : Abomey-Calavi, Ouidah et Toffo. Matériel et méthodes

L’étude a été réalisée dans le Département de l’Atlantique du Bénin de Juin à Août 2011. Les fermes avicoles d’Abomey-Calavi, Ouidah et Toffo, ont été explorées en vue d’un prélèvement coprologique (Figure 1).

Dans chaque commune, il a été ciblé au hasard cinq fermes aussi bien pour la phase pré-ponte que pour la phase de ponte puis les systèmes d’élevage (sol, cages). Seules les fermes dont l’effectif de poules commerciales est supérieur ou égal à 100 têtes ont été prises en compte. Ainsi, 500 sujets ont été visés aussi bien pour chaque phase que pour chaque système d’élevage. La recherche des parasites du tube digestif a été réalisée en effectuant quatre (04) séries de prélèvements. Deux séries de prélèvement ont été réalisées par mois, une série la première quinzaine et une autre la deuxième quinzaine du même mois, ceci durant deux mois successifs. Les techniques utilisées sont les suivantes :


Figure 1 : Localisation des zones de prélèvement de fientes de poules commerciale Prélèvement des fientes

En ce qui concerne le prélèvement de fientes chez les sujets au sol, des papiers de ciment ont été disposés sous des

paniers où étaient enfermées 4 poules à la veille. Ainsi, les fientes les plus fraîches possibles et sans corps étrangers étaient récupérées le lendemain matin à sept heures. Quatre paniers étaient installés à cet effet dans les coins de chaque poulailler. S’agissant des sujets en batterie, des sacs de jute étaient attachés sous les cages de ponte pour la récupération des fientes fraîches.


Identification des parasites internes Les œufs des parasites sont été identifiés selon la méthode de Thiempont et al. (1995) et Soulsby (1982).

L’analyse du taux de réduction a été évaluée selon la formule ci-après: TDR = [(T0 – T1)*100] / [T0] TDR = Taux de réduction T0 = Taux d’infestation au début essai T1 = Taux d’infestation à la fin essai Analyses statistiques

Les données sur les charges parasitaires et les OPG ont été soumises à l’analyse de variances (ANOVA) selon le modèle de Kendall et al. (1970) basé sur la moyenne des carrés. Les moyennes ont été comparées suivant la méthode de la PPDS lorsqu’elles présentaient des différences significatives. Résultats

Comparaison de deux phases d’élevage pour les OPG de chaque parasite interne chez les poules commerciales dans la zone d’Abomey-Calavi. La présence des parasites Capillaria et Ascaridia au cours de l’élevage à Abomey – Calavi est manifeste en phase de ponte (4,1 ± 1,12 pour Capillaria et 55,6 ± 16,68 pour Ascaridia). Ces parasites sont absents en phase pré-ponte. Par contre les ookystes sont plus présents en phase pré-ponte la différence étant significative au seuil de 0,05 (Tableau 1).A Ouidah, le parasitisme est également élevé en phase de ponte pour les parasites Capillaria (2±0,2) et Ascaridia (10,2 ± 1,25) par rapport à la phase de pré-ponte. Mais les ookystes sont plus présents en phase de pré ponte (3774,2 ±89,58) (p≤0,05) (Tableau 2). Tableau 1 : Comparaison des OPG de chaque parasite interne chez les poules importées selon la phase d’élevage

dans la zone d’Abomey-Calavi. Phases d’élevage

OPG Capillaria Ascaridia Ookyste

Pré-ponte Oa Oa 4028,66 ± 303,37a Ponte 4,10 ± 1,12b 55,6 ± 16,68b 194,5 ± 85,21b Probabilité 0,004 0,008 0,007 Les valeurs moyennes suivies de lettres différentes au niveau de la même colonne sont significativement différentes (P≤0.05). Tableau 2: Comparaison des OPG de chaque parasite interne chez les poules importées selon la phase d’élevage

dans la zone de Ouidah. Phases d’élevage

OPG Capillaria Ascaridia Ookyste

Pré-ponte Oa Oa 3774,3 ±89,58a Ponte 2 ± 0,2b 10,3 ± 1,25b 194,5 ± 85,21 b probabilité 0,003 0,005 0,007 Les valeurs moyennes suivies de lettres différentes au niveau de la même colonne sont significativement différentes (P≤0.05).

A Toffo, le parasite Capillaria (3,9±0,55) et Ascaridia (114,6 ± 5,87) sont plus présents pendant la phase de ponte qu’en phase de pré-ponte (Tableau 3). Mais les ookystes sont manifestement plus présents en phase pré-ponte (2453,7 +/- 82,21) (p≤0,05).


Tableau 3 : Comparaison des OPG de chaque parasite interne chez les poules importées selon la phase d’élevage dans la zone de Toffo.

Phase d’élevage OPG Capillaria Ascaridia Ookyste

pré-ponte 0a 2 ± 2a 2453,8 ± 82,21b Ponte 3,9± 0,55b 114,7±5,87b 51 ± 02,75b probabilité 0,001 0,003 0,005 Les valeurs moyennes suivies de lettres différentes au niveau de la même colonne sont significativement différentes (P≤0.05).

De la même façon, des comparaisons des systèmes d’élevage (sol, cages) ont été effectuées. Le parasitisme est plus accentué au niveau de la ville d’Abomey-Calavi notamment pour les parasites Capillaria (4,1±1,12), Ascaridia (42,3±10) et les ookystes (194,5± 45,21) pour le système d’élevage au sol comparé au système d’élevage en batterie (p≤0,05) (Tableau 4). Tableau 4: Comparaison des OPG de chaque parasite interne chez les poules importées selon le système

d’élevage dans la zone d’Abomey-Calavi. Phase d’élevage OPG

Capillaria Ascaridia Ookyste Sol 4,1 ± 1,12a 42 ,3 ± 10a 194,5 ± 45,21b Cages 0b 12, 6 ± 9,14b 0b probabilité 0,002 0,002 0,004 Les valeurs moyennes suivies de lettres différentes au niveau de la même colonne sont significativement différentes (P≤0.05).

Au niveau de la ville d’Ouidah, les parasites, Capillaria (25±0,5), Ascaridia (20,2±0,25) et les ookystes sont significativement plus présents au sol (272,5 ±16,38) qu’en batterie (p≤0,05) (Tableau 5). Au niveau des élevages avicoles de Toffo, le système en batterie n’a pas enregistré de parasites Capillaria (3,9±0,55) et Ascaridia (114,6 ± 5,87). Tableau 5: Comparaison des OPG de chaque parasite interne chez les poules importées selon le système

d’élevage dans la zone de Ouidah. Phase d’élevage OPG

Capillaria Ascaridia Ookyste Sol 25 ± 0,5a 20,3 ±0,25a 272,5 ± 16,38a Cages 2,00 ± 0,2b 4 ±0,4b 09 ± 0,96b probabilité 0,003 0,002 0,005 Les valeurs moyennes suivies de lettres différentes au niveau de la même colonne sont significativement différentes (P≤0.05).

Les ookystes seuls sont significativement présents en batterie (10,9 ± 02,75) (Tabeau 6). Les poules sont généralement plus parasitées au sol qu’en batterie parasitisme avec un taux de 2,3 ± 0,67% pour Capillaria; 4± 2,31% pour Ascaridia et 79,8±1,8 pour les coccidies (Tableau 7). Tableau 6 : Comparaison des OPG de chaque parasite interne chez les poules importées selon le système

d’élevage dans la zone de Toffo. Phase d’élevage OPG

Capillaria Ascaridia Ookyste Sol 3,9 ± 0,55a 114,7 ±5,87a 179 ± 12,97a Cages 0b 0b 10,9 ± 02,75b probabilité 0,006 0,008 0,006 Les valeurs moyennes suivies de lettres différentes au niveau de la même colonne sont significativement différentes (P≤0.05).


Tableau 7 : Comparaison des OPG des trois types de parasites selon les phases d’élevage dans la zone d’étude. Phase d’élevage OPG

Pré-ponte Pondeuses au sol Pondeuses en cages Capillaria 4,3 ± 0,33a 20,3 ± 0,25a 2,3 ± 0,67a Ascaridia 5,2 ±1,18a 32,6± 9,14b 4 ± 2,31c Ookyste 3237, 6 ± 42,91a 590,7± 2,23b 79,9 ± 1,8c Probabilité 0,007 0,006 0,003 Les valeurs moyennes suivies de lettres différentes au niveau de la même colonne sont significativement différentes (P≤0.05). Discussion

L’importance de la présente étude réside dans le fait que malgré l’éclosion de plusieurs élevages avicoles urbains et périurbains, pour satisfaire la demande élevée en œufs de consommation et de viande de poulets, un fossé béant persiste entre l’offre et la demande (Aliou, 2001). Cette situation justifie l’importation massive des produits de volailles pour combler le vide créé par la faible production de volailles au niveau national (N’Noume, 2000). L’amélioration de la production nationale de volaille passe par un état des lieux des systèmes d’élevage, des phases de production afin d’identifier les contraintes de gestion technique. Il s’agira alors de mettre en place de bonnes pratiques de conduite surtout sur le plan sanitaire notamment en matière de contrôle des parasites internes.

En ce qui concerne les phases d’élevage (pré-ponte et ponte) à travers les OPG de chaque parasite interne, l’infestation due aux Capillaria et Ascaridia est toujours plus élevée pendant la phase ponte que pendant la phase pré-ponte au niveau de chaque élevage. Il y a cependant des différences parfois très significatives comme le cas d’Abomey-Calavi avec le parasite Ascaridia et plus importante encore dans la zone de Toffo. Cette situation s’explique dans la mesure où les risques d’infestation sont plus élevés pendant la phase ponte.

La plupart d’éleveurs de poules pondeuses ne maîtrisent pas la gestion technique de l’élevage ; ils tiennent rarement des fiches de suivi qui leur permettraient de rentabiliser leur entreprise. Sur le plan financier, les crédits mis en place au profit des aviculteurs sont parfois prohibitifs : au-delà de 20% comme taux d’intérêt généralement remboursable dès le premier mois qui suit la mise en place du crédit. La conséquence est le manque de soutien financier pendant la phase de production des poules ; ceci engendre un mauvais entretien surtout sur le plan sanitaire de ces animaux. Le ramassage des fientes de poulets dans les poulaillers ponte au sol, mal entretenus, est la source de multiplication de germes pathogènes et surtout de parasites. Ce risque s’accroît avec l’humidité provoquée par les mauvais dispositifs d’abreuvement des pondeuses. Ces résultats confirment les conclusions de Petit (1991) attestant le mauvais entretien des poulaillers comme étant le facteur primordial du développement du parasitisme dans les élevages des régions tropicales

Même si les résultats sont pour la plupart sans grande importance statistiquement, les OPG obtenus sont en général plus élevés pour l’élevage au sol comparé à celui pratiqué en batterie. Quand les poulets sont élevés en hauteur, ils ne sont pas en contact avec la litière souillée ; ils sont donc beaucoup plus à l’abri du parasitisme. L’insuffisance d’hygiène dans l’élevage avicole favorise l’éclosion des parasites puisque les poulets élevés au sol ingèrent beaucoup plus facilement des œufs de parasites. Ceci pose le problème du choix du système d’élevage. Le système d’élevage en cages offre de multiples avantages. Cependant le coût onéreux pour cet investissement contraint les aviculteurs à opter généralement pour l’élevage au sol dans les pays tropicaux (Jourdain, 1990). La gestion des fientes dans les cages constitue aussi un sérieux problème environnemental chez les quelques rares aviculteurs qui optent pour ce système d’élevage. Par ailleurs, les installations avicoles ne sont pas souvent réalisées par des professionnels. Même si les poules sont à l’abri des parasites, les conditions sont beaucoup plus favorables au développement de virus et bactéries aviaires dans les exploitations avicoles qui disposent d’un système d’élevage en cages en République du Bénin. Conclusions

L’étude menée sur les parasitoses gastro-intestinales dans le Département de l’Atlantique a révélé : – L’existence des helminthoses dues à deux nématodes (Ascaridia, Capillaria) avec la présence des ookystes surtout

en phase de pré-ponte. – Les poules élevées en cages sont moins parasitées que celles élevées au sol. – La formation des aviculteurs devient une nécessité en vue de l’adoption d’un calendrier prophylactique adéquat. Ceci

constitue la solution aux contraintes sanitaires auxquelles est confrontée l’aviculture dans le département de l’Atlantique.


Impact

Le poulet béninois et les œufs contribuent respectivement à 2,4% et 1,4% dans la formation du chiffre d’affaire agricole du Bénin. Cependant, ce secteur est confronté à d’énormes problèmes sanitaires dont les parasitoses gastro-intestinales. La présente étude établit un état des lieux de ces affections dans le Département de l’Atlantique qui représente la plus grande zone en aviculture commerciale au Bénin. De l’analyse des résultats, il ressort que l’ascaridiose, la capillariose et surtout les coccidies viennent au premier plan surtout au niveau du système d’élevage au sol. Il urge d’améliorer le système d’élevage en matière d’élevage de poulets commerciaux. Ceci passe nécessairement par la mise en place de crédits adéquats et spécifiques à l’élevage avicole. Les producteurs, les provendiers, les vendeurs d’intrants et de produits finis avicoles, les techniciens pourront en tirer profit pour l’épanouissement de cette filière avicole au Bénin. Références bibliographiques ALIOU, Y. (2001) Contribution à l’étude des caractéristiques dominantes de gestion technique des exploitations

avicoles commerciales des grandes agglomérations au Sud-Bénin. Mémoire de fin d’études au Collège Polytechnique Universitaire (CPU). Université d’Abomey-Calavi (UAC), Abomey-Calavi. 67 p.

AMAYENE, P. (1991) Comparaison de quelques paramètres de production et de croissance de poulets locaux du Cameroun à ceux de la race Rhode Island Red. Mémoire de fin d’étude, Centre Universitaire de Dschang, Cameroun. 62 p.

CHRYSOSTOME, C.A.A.M., BELL, J.G., DEMEY, F. and VERHULST, A. (1995) Seroprevalence to three diseases in village chickens in Benin. Preventive Veterinary Medecine 22 : 257-261.

IKEME, M.M. (1971) Effects of different levels of nutrition and continuing dosing of poultry with Ascaridia galli eggs on the subsequent development of parasite populations. Parasitology 63: 233-250.

JOURDAIN, I. (1990) L’aviculture en milieu tropical. Revue avicole, Paris, France. 147 p. KENDALL, M.G. & YSIDRO, F. (1970) Studies in the history of Statistics and probability, London. 257-263. MPOAME, M. & ESSOMBA, L.I. (2000) Essai de traitement contre des parasitoses gastro-intestinales du poulet avec

les décoctions aqueuses de graines de papaye (Carica papaya). Revue Elev. Méd. Véd. Pays trop. 53 (1) : 23-25. MPOAME, M., TEGUIA, A. & AKOA, E.J.M. (2003) Evaluation de l’efficacité des extraits aqueux de graines de

papaye (Carica papaya) dans le traitement de la coccidiose cæcale à Eimeria tenella chez le poulet de chair. Tropicultura 21(3): 153-156.

N’NOUME, L. (2000) La filière poulet dans le Sud-Bénin : Etat des lieux. Mémoire de fin de cycle CPU/UNB, Abomey-Calavi. 56 p.

OLOUKOUNLÉ, M. (2003) Effet comparatif de citrate de Pipérazine et des Graines de Papaye sur Ascaridia galli chez les poules pondeuses ″ISA BROWN″. Mémoire de fin d’études au Lycée Agricole Mèdji de Sékou, Allada, Bénin. 67 p

PETIT, F. (1991) Manuel d’aviculture en Afrique. Rhône Mérieux, Paris, France. 74 p. SOULSBY, E.J.L. (1982) Helminths, arthropods and protozoa of domesticated animals. Baillière Tindall, London. 205

p. THIEMPONT, D., ROCHETTE, F., VANPARUS, Q.F.J. (1995) Le diagnostic des verminoses par examen

coprologique. 2ème édition. Janssen Research Foundation. Beerse Belgique, p. 29.

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~


Effect of wet feeding on performance of guinea fowl H.K. DEI 1, T. TINDAN and A. MOHAMMED Department of Animal Science, Faculty of Agriculture, University for Development Studies, P.O. Box TL1882, Tamale, Ghana. 1Corresponding author: [email protected] Abstract Guinea fowls (Numida meleagris) are increasingly kept under intensive management. An 8-week feeding trial was conducted to determine the effect of wet feeding on growth performance. Two experimental diets (dry and wet) with 6 replicates each using a completely randomized design were tested from 6 to 14 weeks of age. Each replicate consisted of 5 unsexed keets of mean initial live weight of 280 g/bird that were placed in deep-litter pens (1m x 1m). The wet mash was prepared daily by addition of 1.3 parts of water to 1 part of dry feed. Feed and water were provided ad libitum. Growth data were analysed by one factor analysis. Wet feeding reduced (P≤0.01) daily mean feed intake [dry feed = 67.2 versus wet feed = 59.7 g/bird], but improved (P≤0.01) gain/feed ratio [dry feed = 0.245 versus wet feed = 0.295] that resulted in higher (P≤0.05) daily mean live-weight gain [dry feed = 16.4 versus wet feed = 17.6 g/bird] and live-weight at 14 weeks of age [dry feed = 919 versus wet feed = 984 g/bird]. It is concluded that wet feeding has the potential to improve growth of guinea fowl. Keywords: Guinea fowl; wet feed; growth performance Effet de l'alimentation humide sur la performance de la pintade Résumé Les pintades (Numida meleagris) sont de plus en plus élevées en système intensif. Un essai de nutrition a été mené pendant 8 semaines afin d’évaluer l’influence d’une alimentation fraiche sur les performances de croissance des pintades. Pour se faire, deux types de rations expérimentales (sèche et humide) ont été distribués de 6 à 14 semaines d’âge suivant un dispositif complètement randomisé; chaque ration ayant 6 répétitions. Chaque répétition consistait en 5 pintadeaux non sexés, chacun ayant un poids initial moyen de 280 g et tous les animaux élevés sur litière profonde de 1m3 (1m x 1m). La ration fraiche a été préparée en ajoutant quotidiennement 1,3 part d'eau à 1 part d'aliment sec. Les animaux ont été nourris et abreuvés ad libitum. Les données de croissance ont été soumises à une analyse de variance unidimensionnelle. Les principaux résultats montrent la réduction significative (P≤0,01) de la consommation journalière de l’aliment frais [aliment sec = 67,2 par rapport à l’alimentation humide = 59,7 g/sujet], mais a un effet améliorateur (P≤0,01) du ratio gain/aliment [aliment sec = 0,245 comparés aux aliments frais = 0,295] ce qui accroit (P≤0,05) le gain de poids journalier [aliment sec = 16,4 par rapport à l’aliment frais = 17,6 g/sujet] et le poids vif à 14 semaines d'âge [aliment sec = 919 par rapport à l’aliment frais = 984 g/sujet]. Il est conclu que la distribution d’une alimentation fraiche pourrait améliorer la croissance de la pintade. Mots clés: Effet thermique, contrôle alimentaire, croissance, poulet. Efecto de la Dieta Húmeda en el Desempeño de las Gallinas de Guinea. Resumen Se ha incrementado el mantener bajo manejo intensivo a las gallinas de Guinea (Numida meleagris) . Un estudio de 8 semanas sobre su alimentación, se realizó para determinar el efecto de la dieta húmeda sobre el desempeño en el crecimiento. Dos dietas exprimentales (seca y húmeda) con 6 repeticiones bajo un diseño aleatorio de cada una, fue probado de las 6 a las 14 semanas de edad. Cada replicación consistió en lotes de 5 aves sin sexar, colocadas en un espacio de (1m x 1m x 1m). La masa húmeda se preparó agregándole 1.3 partes de agua a 1 parte de alimento seco, diariamente, el alimento y el agua se proporcionaron ad libitum. Los datos sobre el crecimiento se analizaron por análisis de un factor. La dieta húmeda, redujo (p≤0.01) la ingesta diaria (dieta seca 67.2 v.s. dieta húmeda 59.7 gr. por ave, pero mejoró (P≤ 0.01) la conversión alimenticia (dieta seca 0.245 vs dieta húmeda 0.295), esto resultó en una mayor ganancia de peso diaria (dieta seca 16.4 vs. 17.6 gr. por ave de la dieta húmeda) y el peso vivo a las 14 semanas de edad (dieta seca 919 vs. dieta húmeda 984 gr. por ave) se concluye que la dieta húmeda tiene potencial para mejorar el crecimiento de las gallinas de Guinea.


Palabras Clave: Gallinas de Guinea, dieta húmeda, desempeño en el crecimiento. Introduction

Intensive rearing of guinea fowls (Numida meleagris) has proved to be profitable as well as important in ensuring food security in sub-Saharan Africa (Guerne-Bleich et al., 2005). Thus there has been a gradual shift from scavenging to intensive rearing. Guinea fowls by their nature can waste a lot of feed when they scoop with their beak during feeding (Nsoso et al., 2003). Wet feeding may curtail feed wastage as well as ensure efficiency of feed utilisation, since feed alone constitutes major cost in poultry production. Other advantages of wet feeding include reduction in dust in intensive houses (Forbes, 2003) and, most importantly, improvement in growth performance of broiler chickens, particularly under hot climatic conditions (Mai, 2007; Awojobi et al., 2009; Dei and Bumbie, 2009) as well as enhanced efficiency of feed utilisation in growing ducks (Forbes, 2003). However, it is not known how wet feeding would influence growth performance of guinea fowls.

This study was undertaken to determine the effects of wet feeding on performance of guinea fowls kept in confinement. Materials and methods Study site and experimental birds

The study was conducted between September and December 2010 at Nyankpala in the Northern Region of Ghana, which is located in the Guinea Savanna zone. One hundred (100) day-old keets of guinea fowl (Pearl variety) were brooded in a deep-litter house for six weeks on a starter mash (Table 1) that contained 238 g/kg crude protein (CP) and 12.6 MJ/kg metabolisable energy (ME). At six weeks of age, sixty unsexed keets of similar live weights were selected and divided into 12 groups of 5 keets with mean live weight of 280 g/bird. Two treatments (dry and wet mashes) were tested. Each treatment was replicated 6 times using a completely randomized design. A grower diet (Table 1) based on maize and fishmeal that contained 200 g/kg CP and 12.5 MJ/kg ME was used. The wet mash was prepared daily by addition of 1.3 parts of water to 1 part of dry feed as recommended by Yalda and Forbes (1995) for chicken. The birds were housed in deep litter pens (1m x 1m) with floor space of 0.15 m2/bird. Feed and water were given ad libitum and light was provided 24 h from 6 to 14 weeks of age. Table 1: Composition of the guinea fowl diets (g/kg) Ingredient Starter diet (0-6 weeks) Grower diet (6-14 weeks) Maize (Zea mays) 600 620 Fishmeal (660 g/kg CP) 150 100 Soybean meal 150 130 Wheat bran 70 120 Oyster shell 10 15 Dicalcium phosphate 15 10 Vitamin/trace mineral premix* 3 2.5 Salt 2 2.5 Calculated nutrient composition (g/kg) Crude protein Lysine Methionine Methionine+Cystine Calcium Phosphorus

238.0 13.4 4.9 8.3

14.5 9.5

200.0 11.2 4.0 7.3

13.0 7.6

Metabolisable energy (MJ/kg) 12.6 12.5 *Composition of vitamin/trace mineral premix per kg diet: vitamin A (retinyl acetate), 5.2 mg; vitamin D3

(cholecalciferol), 0.125 mg; vitamin E (DL-alpha-tocopherol), 100 mg; vitamin K3 (menadione), 5 mg; vitamin B1(thiamine), 2 mg; vitamin B2 (riboflavin), 9 mg; vitamin B3 (Niacin), 50 mg; vitamin B5 (Calcium pantothenate), 25 mg; vitamin B6 (pyridoxine), 7 mg; vitamin B8 (biotin), 0.3 mg; vitamin B9 (folic acid), 3 mg; Vitamin B12

(cyanocobalamin), 0.24 mg; Fe (FeSO4), 90 mg; Cu (CuSO4), 5 mg; Mn (MnO), 120 mg; Co (CoSO4), 1 mg; Zn (ZnSO4), 100 mg; I (Ca(IO3)2), 2 mg; and Se (Na2SeO3), 0.4 mg.


Data collection and analysis Feed intake was measured weekly by subtracting the left-over feed at the end of the week from the amount of feed

provided. Wet feed left-over was dried to the same dry matter of the dry mash before feed intake was determined. Plastic feeding troughs were used. Water intake was not measured in this study. Live weights of birds in each replicate were measured weekly by weighing the five birds in replicate as a batch using a digital electronic scale (Jadever JPS-1050), and the weekly live weight gain was calculated. Feed conversion efficiency was defined as live weight gain per unit feed consumed. Data collected were analyzed using GenStat 8th edition (Lawes Agricultural Trust, 2005). Results

Table 2 shows the effect of wet feeding on performance of guinea fowl. Wet feeding reduced (P≤0.01) daily mean feed intake; but improved (P≤0.01) feed conversion efficiency that resulted in higher (P≤0.05) live-weight at 14 weeks of age. Table 2: Effects of wet feeding on feed intake and growth performance of guinea fowls (6-14 weeks of age)

Variable Dry Mash Wet Mash SED P

Mean feed intake (g/bird/day) 67.2 59.7 2.19 0.007

Mean weight gain (g/bird/day) 16.4 17.6 0.481 0.036

Mean live-weight at 14 wk (g/bird)

919.0 984.0 27.00 0.036

Mean gain/feed ratio 0.245 0.295 0.0091 0.001

SED-Standard error difference, P-Probability Discussion

It is known that addition of water to feed improves production levels of poultry even under normal environmental conditions (Scott, 2003; Shariatmadari and Forbes, 2005; Awojobi et al., 2009). One of the favourable effects of wet feed on growth of birds has been attributed to improvement in feed digestibility (Forbes, 2003). Also, guinea fowls are known to waste feed through their feeding behaviour (Nsoso et al., 2003); thus wetting the feed might curtail feed wastage.

There was no mortality in both treatment groups. Studies involving broiler chickens did not show any effect of wet feeding on mortality (Dei and Bumbie, 2011), since there was no daily left-over of the wet feed.

Wet feeding presents a major limitation under large-scale poultry production and automated systems. However, there are possibilities of overcoming this in the light of technological advancements in the poultry equipment manufacturing industry. For example, Thorne et al. (1989) developed an automated wet feeding system for laying hens that allowed the use of high-moisture by-products. Also, guinea fowls are reared on a small-scale under the traditional system of management that does not require automatic feeding. Thus wet feeding could be quite useful for small-scale or backyard poultry producers. Conclusion

In this study, wet feeding improved growth performance of guinea fowl; therefore it should be practised by guinea fowl producers. Impact

Wetting of feed is a practice whereby some water is added to the feed prior to giving it to chickens. It has the benefit of improving feed digestibility, reduction in feed wastage due to dustiness, and their growth. This study shows that wet feeding of guinea fowls can reduce the amount of feed they consume as well as increase their utilisation of feed with increase in growth performance. These findings are, particularly, useful to backyard or small-scale producers of guinea fowls, who can easily practise wet feeding to increase productivity of their birds. References AWOJOBI, H.A., OLUWOLE, B.O., ADEKUNMISI, A.A. and BURAIMO, R.A. (2009) Performance of finisher

broilers fed wet mash with or without drinking water during wet season in the tropics. International Journal of


Poultry Science 8: 592-594. DEI, H.K. and BUMBIE, G. (2011) Effect of wet feeding on growth performance of broiler chickens in a hot climate.

British Poultry Science 52: 82-85. FORBES, J.M. (2003). Wet foods for poultry. Avian and Poultry Biology Reviews 19: 175-193. GUERNE-BLEICH, E., RHISSA, Z. and MACK, S. (2005) The FAO special programme for food security: livestock

diversification- a case study in Chad. World’s Poultry Science Journal 61: 23-30. LAWES AGRICULTURAL TRUST. (2005) GenStat 8th ed. Rothamsted Experimental Station, Harpenden, UK. NSOSO, S.J., SEABO, G.M., KGOSIEMANG, J., MOLATLHEGI, S.J., MOKOBELA, M., CHABO, R.G. and

MINE, O.M. (2003) Performance of progeny of wild and domesticated guinea fowl (Numida meleagris) in Southern Botswana. South African Journal of Animal Science 33: 46-51.

SARIATMADARI, F. and FORBES, J.M. (2005) Performance of broiler chickens given whey in the food and/or drinking water. British Poultry Science 46: 498-505.

SCOTT, T.A. and SILVERSIDES, F.G. (2003) Defining the effects of wheat type, water inclusion level, and wet diet restriction on variability in performance of broilers fed wheat-based diets with added water. Canadian Journal of Animal Science 83: 265-277.

THORNE, D.H.M., VANDEPOPULIERE, J.M. and LYONS, J.J. (1989). Automated high moisture diet feeding system for laying hens. Poultry Science 68: 1114-1117.

YALDA, A. Y. and FORBES, J.M. (1995). Food intake and growth in chickens given food in the wet form with and without access to drinking water. British Poultry Science 36: 357-369.

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~


Performance of family poultry in Haiti and challenges of a husbandry support program V.P. NCHINDA 1 *, O. THIEME 2 & N.I. OGALI 3 1 Institute of Agricultural Research for Development, Box 80, Bamenda, Cameroon; Tel.: (+237) 77 69 36 55 2FAO, Animal Production and Health Division, Rome, Italy 3Veterinary Research Centre, Kenya Agricultural Research Institute- Muguga North, P.O. Box 32, 00905, Kikuyu, Kenya; Tel.: (+254) 722 625 385 * Corresponding author: [email protected] Abstract Family poultry has long been recognized as a way to address problems of food insecurity and poverty. For these reasons family poultry development has been at the centre of the development agenda in Haiti. The country is dominated by poverty hence international and national support to improve family poultry husbandry is a measure geared towards improving food security and alleviating poverty. A husbandry support programme was implemented in Haiti that consisted of introducing exotic cock species, training on disease control and management, construction of coops and technical support from extension workers. Community vaccinators were also trained and vaccination campaigns organized to control Newcastle disease. The present study assesses the contribution of this family poultry support programme to the performance of family poultry units and challenges for achieving success. Based on a quasi-experimental survey design, primary data were collected from 132 respondents. Analysis of the data revealed that the average number of eggs laid per crossbred hen (14.25) was significantly higher (P<0.001) than those laid by local hens (10.48). The crosses had a better body weight but were not significantly different as far as broodiness and raising of chicks are concerned. These positive results can be attributed to the support provided, but several challenges such as bird mortality, poor hygienic conditions, management practices and lack of inputs (vaccines, drugs, feed) still impede the performance of family poultry in Haiti. Significant improvements could be achieved by a sustainable vaccination system, adopting appropriate bio-security practices coupled with regular follow-up and timely access to inputs. Keywords: Traditional Poultry Husbandry, support, impact and difficulties Performance de l'aviculture familiale en Haïti et les défis d'un programme d’appui en élevage avicole élevage Résumé L'aviculture familiale a été considérée depuis des temps jadis comme un moyen de lutte contre l’insécurité alimentaire et la pauvreté. C’est pour cette raison que l’amplification de l'aviculture familiale a été au centre des efforts de développement en Haïti. Le pays a été dominé par la pauvreté et a par conséquent bénéficié du soutien aussi bien international que national pour améliorer l’aviculture familiale comme étant un moyen visant à améliorer la sécurité alimentaire et réduire la pauvreté. Un programme d’appui à l’élevage avicole a été mis en place en Haïti consistant à introduire les coqs améliorés, mettre en place une formation en gestion et contrôle de maladies, la construction de poulaillers et l’appui technique de la part des agents de vulgarisation. Les agents communautaires de vaccination ont été également formés en même temps que des campagnes de vaccination contre la maladie de Newcastle ont été organisées. La présente étude évalue la contribution de ce programme avicole familial de soutien à l’amélioration des performances des unités familiales avicoles et les défis à palier pour leur réussite. Sur la base d’une enquête quasi-expérimentale, les données primaires ont été collectées auprès de 132 répondants. L'analyse des données a révélé que le nombre moyen d'œufs pondus par poule croisée (14,25) était significativement plus élevé (p<0,001) que ceux pondus par des poules locales (10.48). Les croisés avaient un poids corporel plus lourd mais n’ont pas présenté une différence significative en rapport avec l’aptitude à la couvaison et le suivi des poussins élevés. Ces résultats positifs peuvent être attribués à l'appui fourni, mais plusieurs défis tels que la mortalité des oiseaux, les mauvaises conditions d'hygiène, la gestion et le manque d'intrants (vaccins, médicaments, aliment) constituent une entrave à l'aviculture familiale en Haïti. Des améliorations significatives pourraient être réalisées à travers un système de vaccination soutenue, l’adoption de


mesures de biosécurité appropriées couplées à un suivi régulier et à un accès en temps opportun d’intrants. Mots-clés: Aviculture Familiale, Apport, Impact, Contraintes Desempeño de la Avicultura Familiar en Haití y sus Desafios en la Implementación de los Apoyos para los Programas.

Resumen La avicultura familiar ha sido ampliamente reconocida como un instrumento para atacar los problemas de seguridad alimentaria y pobreza. Por esta razón se ha empleado como el centro de la agenda para el desarrollo en Haití. El país esta sumido en la pobreza y se hace un esfuerzo local e internacional para apoyar y mejorar la crianza de aves, como una medida que les brinde una mejora en la seguridad alimentaria y alivio de la pobreza. Un programa de apoyos a la crianza de aves se implementó en Haití, en el que se consideró la introducción de razas exóticas, capacitación en la prevención de enfermedades, manejo, construcción de gallineros y asistencia técnica por medio de extensionistas. Se capacitaron a vacunadores comunitarios y se implementaron campañas de vacunación contra la enfermedad de Newcastle. El presente estudio resalta la contribución del apoyo a la avicultura familiar en su desempeño como unidades avícolas familiares y sus desafíos para obtener éxito. Basados en una encuesta casi experimental, se obtuvieron los primeros datos de 132 encuestados. El análisis de estos datos reveló que el promedio de huevos obtenidos por gallina con cruzamiento de raza fue de (14.25) por echada y fue significativamente superior (P≤0.001) a las gallinas locales (10.48). Las aves cruzadas dieron mejor peso corporal pero no tuvieron una diferencia significativa en la crianza y cuidado de los pollitos. Estos resultados positivos fueron atribuidos al apoyo brindado, pero existen muchos desafíos como son la mortalidad de las aves, la higiene, las prácticas de manejo, la falta de insumos tales como vacunas, medicamentos y alimento; esto suele impedir el desempeño de la avicultura familiar en Haití. Una mejoría significativa puede lograrse estableciendo un sistema sostenido de vacunación, adoptando prácticas de bioseguridad, aunado a un continuo y oportuno acceso a los insumos. Palabras Clave: Crianza avícola tradicional, apoyo, impacto, dificultades. Introduction

Haiti is a densely populated and poverty stricken country on an island in the Caribbean. The poverty incidence is severe and affects all categories of persons in particular women and children. Family poultry rearing, essentially with chickens, is a major livestock activity that is practised by 95% of the rural households in Haiti (MARNDR, 2007) and is an important source of income and protein for many households.

Family poultry is recognized as one of the entry points to address the problems of malnutrition, food insecurity, low income and poverty as a whole. The resulting income and intake of poultry meat and eggs can contribute to improve the educational and nutritional status of children (Pitt et al., 2003). Gawande et al. (2007) and Dei et al. (2009) argue that family poultry is a profitable venture and Njue et al. (2006) reported positive net margins in Kenya following a vaccination intervention on family poultry. Family poultry is thus considered a tool for livelihood improvement and poverty alleviation (Dolberg, 2007; Fasina et al., 2007; Sharma, 2007) which motivated the Government of Haiti to adopt a family poultry improvement programmes (MARNDR, 2010) that was supported by the Food and Agriculture Organization of the United Nations (FAO). The interventions in Haiti included vaccination campaigns to reduce bird mortality, introduction of exotic cock species, training of farmers on disease control and management, construction of coops and technical support from extension workers and community vaccinators. Nchinda et al. (2011) concluded that these interventions had a net positive impact on the income and food security needs of participating farmers. The present study is providing additional information about the impact of the family poultry support programme in Haiti on the flock performance and identifies difficulties that were faced during implementation. Such information will be important for accountability, policy formulation and future interventions for the development of the sector.


Materials, methods and data sources Study area

The study was carried out in the Artibonite and South departments of Haiti and five council areas of these two departments were chosen purposively to include and capture departmental differences, effects of the husbandry systems diversity and of the introduced innovations (Vaccination/vaccinators, housing and introduction of exotic cocks). The council areas in the South department included Chantal, Toberck and Arniquet and in Artibonite they included Petit Rivière and Marchand Dessalines. Data collection and analysis

Secondary sources used include project documents, reports from FAO offices (Haiti and Rome), internet and stakeholder institutions in Haiti - the National Program for Food Security (NPFS) coordination unit, VETERIMED and GERMALOT. Primary data were collected by the first author from individual respondents, groups, project drop outs and key informants with the aid of structured questionnaires and a local assistant. Direct observations were also used to collect information that could not be captured either by group discussions or questionnaires. Primary data were collected from 59 (44.7%) newly recruited and 73 (55.3%) previous project participants. Newly recruited project participants were farmers that had been selected for the on-going project phase but had not yet been provided the support offered by the project in terms of improved cocks, training and feed hence they are considered as the control group. The previous project participants (treatment group) were beneficiaries of the previous two phases of the poultry support program some 2-8 years ago. The data collection covered three council areas in the South department including Chantal, Toberck and Arniquet and the two council areas of Petit Rivière and Marchand Dessalines in the Artibonite department. The surveyed persons included 83 (63%) male and 49 (37%) female beneficiaries.

Collection of data on flock characteristics includes the numbers of chicks, pullets, exotic and local cocks. Collected performance data include the number of eggs laid by each hen, clutch size, eggs hatched/clutch/hen, chicks raised per hen, number of surviving chicks at maturity and number of clutches per hen/year. The challenges faced in the development of family poultry were also identified and prioritized by farmers during group discussions. Data were analysed using STATA version 10. Descriptive statistics were used to characterize the family poultry performance in the study areas. The T-test statistics method was used to determine mean differences in flock characteristics and performance between the old project participants (treatment group) and the newly recruited (control group). Limitations

A limitation of this study is the cross-sectional nature of the collected data. The longitudinal picture of the intervention could not be covered. However, some previously collected family poultry husbandry data were used to triangulate the findings. Results and discussions Flock size and seasonality

The analysed primary data showed that on average respondents had 3 cocks, 7 hens, 5 cockerels, 13 chicks and 6 pullets (Figure 2). This puts the total number of birds reared by each household at an average of 34 with a cock-to-hen ratio of 3:7. Apart from the number of hens and cocks, the number of chicks, pullets and cockerels at the disposal of the farmers at the time of the survey (September, 2010) were higher than the nine months’ average recorded in 2007 by the field technicians of MARNDR (Figure 1).


Figure 1: Average household chicken flock size in Artibonite and South Departments of Haiti.

NB: Constructed based on survey data (2010) and statistics from MARNDR (2007)

However, this comparison might be biased as the 2007 figures are averages taken over a period of nine months and

under different management, health and climatic conditions (cyclones, rainfall and dry season). The flock size changes from one month to the other. For instance, the numbers of cocks in September 2007 were six as opposed to 3 in February of that same year. The flock size is lower between the months of March and April as could be seen on Figure 2. A number of compelling findings were noticed upon analysis of the data collected by the MARNDR workers over a period of nine months. First, the months of June and July stand out to be months when the total flock size increases by 30-50%. This percentage increase falls progressively and stagnates in September. The increase or decrease in flock size could be explained by disease outbreak (April and November), consumption and sales made by the households. For instance, April and November are known periods for Newcastle disease outbreaks as testified by key informants contacted and farmers during group discussions. Mortality is highest in July following the increase in flock size with an average of 13 birds lost due to predators. Also, the flock size starts reducing in the month of September because the farmers make most of their sales (5 birds) in June, July and August as they have to provide for the school needs of their children. It was also established during group discussions that December is also one of the peak moments when farmers make most of their sales. December is a period when birds are sold at relatively better prices as the demand is high because of the festivities at the end of the year.

The analysis of the number of birds at the disposal of recently recruited and old participants show no significant differences even though the number of each category of birds owned by the latter was slightly higher than that of the former (Table 1).

However, this was a cross-sectional survey and the dynamic nature of the flock size over the year must be kept in mind. The coops, with a mean size of 16.1m2

, were under exploited as they did not house the potential number of birds let alone being entirely used for the purpose for which they were intended.

13.2

8.8

6.1

4.9 5.1

3.5

6.6

9.2

2.6

4.4

0.0

2.0

4.0

6.0

8.0

10.0

12.0

14.0

Mean num

ber of birds

Chicks Pullets Cockerels Hens Cocks

2010

2007

:


Figure 2: Monthly flock size variations of 155 households in the South Department of Haiti, 2007.

NB: Constructed based on survey data (2010) and nine months’ family poultry statistics from MARNDR (2007)

Table 1: Flock characteristics of recently recruited and old project participants

Description

Newly recruited participants (n=45) Old participants(n=65) Mean Std. Dev. Min - Max Mean Std. Dev. Min - Max

Number of chicks 12.72 8.82 1-38 13.46 10.07 1-42 Number of pullets 6.24 4.63 1-18 5.95 5.01 1-28 Number of cockerels 6.00 5.03 1-22 4.63 3.82 1-16 Number of hens 6.49 4.20 1-18 6.75 5.05 1-26 Number of cocks 2.45 2.57 1-14 2.62 1.89 1-9

Innovation, rearing system, feeding and vaccination

A major innovation for the family poultry farmers was the introduction of cocks from exotic breeds that are well known for better body weight and egg production. Table 2 shows the types and number of cocks distributed in the two Departments among them Plymouth Rock, Rhode Island Red (RIR), Leghorn and their crosses.


Table 2: Types of cocks provided as support to participants in the two departments

Type of cock support

Artibonite South Total Freq. Percent Freq. Percent Freq. Percent

None 14 40.0 21 60.0 35 26.5 Plymouth Rock 13 43.3 17 56.7 30 22.7 Rhode Island Red (RIR) 2 100 0 - 2 1.5 Leghorn x RIR cross 0 - 40 100 40 30.3 Plymouth, Leghorn and RIR 0 - 4 100 4 3.0 Local Naked-neck 0 - 2 100 2 1.5 Local non described 19 100 0 - 19 14.4 Total 48 36.4 84 63.6 132 100

These types of cocks and their progeny were essentially reared following the scavenging system alongside local

birds owned by the respondents. In the South department few of the farmers received cocks from three different breeds namely Plymouth Rock, Leghorn and RIR. The technicians who took part in the recent and previous phases of the project confirmed that in addition to exotic breeds, local cocks were also selected and distributed in the Artibonite department. During the investigation these were 14.4% of the respondents. Meanwhile, 26.5% of the respondents did not receive any of the types of cocks provided as support to participants.

In addition to the distribution of cocks from exotic and selected local breeds other support interventions included awareness training on poultry health to reduce mortality, small assistance for construction of chicken coops, 5 kilograms of concentrate to feed the distributed exotic or local cocks and vaccination campaigns organised by community vaccinators. The influence of these interventions on management practises compared to the new project participants without these interventions are shown by Table 3.

Table 3: Indicators of management by new and old beneficiaries

Variable Newly recruited participants

Old project participants Significance level

Obs. Mean Std. Dev.

Obs. Mean Std. Dev.

Number of birds vaccinated in the past year

37 10.9 2.5 51 21.9 2.4 ***

Number of birds lost due to predators

36 10.9 2.4 51 15.0 2.8 N.S.

Expenditure on medication, vaccination and feed (US$)

57 39.1 3.0 70 43.8 3.3 N.S.

Expenditure on medication and vaccination only (US$)

36 1.3

2.9 51 2.9

3.0 ***

Expenditure for coop construction (US$)

54 62.3 3.5 68 78.2 2.5 N.S.

*** Significant at P<0.001; N.S. stands for Not significant

The significantly (P<0.001) higher number of birds (21.9) vaccinated per year by the old project participants compared to the newly recruited beneficiaries (10.9) show that the project participants recognise the importance of vaccination. As the average cost of vaccination per bird is approximate USD 0.13 for both groups, the total expenses related to medication and vaccination is thus also significantly different. The results indicate that poultry producers can pay for vaccination services if an adequate system is put in place, as it was the case with paid vaccination services provided by some trained community vaccinators and private institutions like VERTERIMED. In addition to medication and vaccination fees, the surveyed farmers also spend money to buy feed.

On a general note, the average number of birds vaccinated by each respondent over the past one year was 16.3. An average of $41.6 were spent for medication, vaccination and feed put together. On the other hand, medication and vaccination accounted for an average of $2.1 and coop construction expenses stood at $78.1. The birds of 62% of the respondents spent the night in the coops constructed for this purpose under the impulsion of the project. However, 31% of the respondents still have their birds sleeping on tree tops despite their investment made to provide the birds with


shelter. They used the coops for purposes other than the one for which they were intended. A small proportion (7%) led their chickens stay overnight in their homes.

The average expenditure for medication, vaccination and feed by respondent in the department of Artibonite was USD 35.2 hence less than in the South (USD 45.6) (Table 4). Annual vaccination and medication expenses put together were small as the latter stood at $4 for Artibonite and $1.3 for the South departments, respectively. The average number of birds vaccinated by each of the respondent was approximately the same for both departments unlike the coop construction expenses that were higher for the Artibonite’s respondents (Table 4). Table 4: Indicators of management by department

Description Artibonite South Overall

Obs. Mean Std. Dev.

Obs. Mean Std. Dev.

Obs. Mean Std. Dev.

Number of birds vaccinated 23 24.6 2.6 65 14.1 2.5 88 16.3 2.6 Number of birds lost by predation 28 13.6 2.4 59 13.0 2.8 87 13.2 2.7 Expenditure on medication, vaccination and feed (USD)

45 35.2 4.3 82 45.6 2.5 127 41.6 3.1

Expenditure on medication and vaccination (USD)

23 4.0 3.4 64 1.6 2.8 87 2.1 3.2

Expenditure on coop construction 45 90.3 2.8 77 61.3 2.9 121 78.1 2.3 Performance of family poultry production

The collected data show that the average number of eggs laid by the cross-breed hens (14.25) is significantly higher than the number laid by the local hens (10.48) which corresponds to a 36% increase (Table 5). This increase was also confirmed in discussions with groups and key informants. Moreover, the weight and size of eggs laid by the cross-breed hens appear to be bigger than those of the local hens. These eggs have a better market value especially for hatching purposes. Some farmers often buy these eggs for hatching as they consider them “improved” with birds resulting thereof having better body weight than those from the local eggs. Table 5: Performance data of improved and rustic hens (n=108).

Trait Improved Hens Local Hens Diff. Significance level Mean Std. Err. Std. Dev. Mean Std. Err. Std. Dev.

Total number of eggs laid per hen per clutch

14.25 0.73 5.31 10.48 0.21 2.16 0.59 ***

Eggs incubated per clutch

9.22 0.32 2.24 8.86 0.22 2.30 0.36 N.S.

Number of eggs hatched/clutch/hen

7.25 0.32 2.25 7.51 0.20 2.05 -0.26 N.S.

Number of chicks raised per hen (0-2 months)

5.68 0.42 2.86 5.75 0.21 2.18 -0.07 N.S.

Number of surviving pullets (≥ 2 months

4.47 0.33 2.26 4.92 0.20 2.08 -0.45 N.S.

Clutches per hen/year 3.38 0.15 1.06 3.52 0.11 1.18 -0.14 N.S. *** Significant at P<0.001, N.S.: Not Significant

Despite the significant difference in the number of eggs laid per cycle, the clutch size (eggs covered) is approximately the same for both the local and cross-breed hens. The number of eggs hatched and chicks raised show no significant differences between these two categories of birds. Similarly, the numbers of clutches per hen each year as well as the number of chicks raised show no significant differences. This is appeasing as the perception by the farmers is that “improved hens are better layers than local ones whereas local hens are better hatchers than improved hens”. This is why some farmers prefer to have the eggs from cross-breed hens hatched by the local hens. Similarly, a few others rather rear the cross-breed hens as layers and hatch eggs by using broody local hens. Though it is not yet prominent, this is not strange as reported by Sørensen (in FAO, 2010) who argues that hatchability, high egg yield and


broodiness are antagonistic traits. Chickens bred for high egg production are losing their ability to become broody. Consequently, if the cross-breed hens are reared for high egg production, thoughts might need to be given to incubation facilities. It may be necessary to capitalise on this to provide alternative means of incubation as the cross-bred hens provide the household with a greater number of eggs at a similar hatchability level as the local hens.

A comparison of the different genetic groups raised in the two departments shows that the performance of the local hens in Artibonite is better than in the South department (Table 6). This is particularly the case for the number of eggs laid per local hen, the clutch size and the number of eggs hatched which are all significantly different (P<0.001). The number of annual clutches per local hens is also significantly higher (P<0.05) in Artibonite than in the South department (Table 6). This is in line with the findings of Garcia-López et al. (2007) who argued that Creole hens in Haiti have a good potential to supply animal protein in terms of meat and eggs to rural areas.

Performance differences across geographical boundaries in Assam (India) were reported by Gawande et al. (2007). The causes for the difference were partly explained by the management system that differs across the regions. The authors also reported that higher body weight of cocks and hens were also responsible for better performance. These were also the observations made in the field for this study with the birds in Artibonite showing better body weights than those of the South department. Table 6: Mean Departmental differences in the performance of local and cross-breed hens.

Trait Artibonite South Sign. level Performance of local hens Obs. Mean Std.

Err. Std. Dev.

Obs. Mean Std. Err.

Std. Dev.

Number of eggs laid per hen/clutch 46 11.5 0.4 2.8 64 9.9 0.2 2.0 ***

Clutch size (eggs) per broody hen 46 10.5 0.5 3.1 64 8.0 0.2 1.7 ***

Number of eggs hatched/clutch/hen 46 8.5 0.4 2.6 65 7.0 0.2 1.8 ***

Number of clutches per hen/year 46 4.2 0.4 2.8 65 3.3 0.1 0.9 *

Number of chicks raised per hen 46 6.2 0.4 2.6 65 5.5 0.2 2.0 N.S. Number of surviving chicks to maturity 5.3 0.4 2.7 65 4.8 0.2 1.7 N.S. Performance of crossbred hens (exotic cock x local hen) Number of eggs laid by hens/clutch 19 17.1 1.3 5.6 37 12.9 0.8 4.6 0.00a Clutch size (eggs) per broody hen 15 10.6 0.7 2.6 36 8.5 0.3 1.8 0.00a Number of eggs hatched/clutch hen 15 8.1 0.8 3.0 35 6.9 0.3 1.7 0.07a Number of clutches per hen/year 14 3.9 0.6 2.2 37 3.4 0.2 1.0 0.31a Number of surviving chicks to maturity 13 6.5 1.0 3.6 37 5.4 0.4 2.5 0.24a Number of chicks raised per hen 13 5.2 0.9 3.1 36 4.4 0.3 2.0 0.27a a Too small (n) for any meaningful difference and conclusion ; *** Significant at P<0.001, *Significant at P<0.05

Meaningful conclusions could not be drawn regarding differences between departmental boundaries for the crossbred population because the observations were too few.

Nevertheless, it must be noted that farmers are conscious that the crosses between exotic and local hens have a rapid growth and maturity history, better body weight, sell at better prices and lay more eggs than the rustic chickens. However, people still have a preference for rearing local hens because these resist to diseases, pests and rains, have a better taste, “eat everything”, are good at brooding and raising chicks, lay nutritive eggs and far reaching longevity compared to the crossbred hens.. Challenges of family poultry husbandry

The major challenge that hampers improvement in the family poultry husbandry in Haiti is the mortality of birds. This is principally due to Newcastle Disease (ND) and other diseases like Gumboro. The Newcastle disease outbreaks occur in the project area repeatedly in April and November each year. As vaccines and their proper storage facilities are not readily available at the grassroots level it is difficult for the trained community vaccinators or specialised services of the MARNDR to make prompt and timely vaccination campaigns. Birds are therefore lost in larger numbers due to diseases in addition to losses due to predators. This discourages farmers from increasing their flock size as they fear that the losses from disease outbreak and predators’ attacks cannot be controlled by them.

Natural disasters are also responsible for some of the losses incurred in family poultry farming in Haiti. The


country and areas of intervention are exposed to natural disasters such as cyclones, hurricanes and floods. Coops must be solid enough to withstand these natural disasters that impede family poultry husbandry in Haiti.

Difficulties to improve management have increasingly been recognized as a major handicap (Sharma, 2007) in improving family poultry through the introduction of exotic cocks. This is also one of the major problems faced by the participants of the chicken farming program in Haiti. For instance, the birds are regularly left to scavenge around or sleep on tree tops despite the fact that coops have been constructed and rehabilitated to shelter these birds. Furthermore, the bio-security measures are not followed as the coops have multiple uses and are not disinfected hence loss of birds occur.

Access to inputs and particularly vaccines, drugs and commercial feed are stumbling blocks to the development of family poultry in the areas of intervention and in Haiti in general. Feed, in particular if supplied from the Dominican Republic, is expensive and not readily available. Birds therefore survive essentially on the scavengeable resource base and supplementation with grains. To improve feeding Garcia-López et al. (2007) advocate for further research into the use of local feed resources as an alternative to commercial feed.

The problem of marketing of chicken was also raised by the farmers as a limiting factor to the sub-sector. Despite a preference by consumers for local chicken meat and eggs, the marketing of these products face serious competition from the products that are imported from the Dominican Republic and the United States of America and that are cheaper (Laroche and Awono, 2008).

The introduction of exotic chicken breeds to the farmers improved the number of eggs laid by the crossbred hens. However, farmers are aware that this type of chickens may not be good at incubation and raising of chicks and they maintain local hens for this purpose. This highlights the need to consider incorporating an appropriate artificial hatching technology to the innovation package. Financial resources are required to fully adopt the suggested technology package which may be a limiting factor for poor farmers and those who have no access to financial resources. Conclusion and recommendations

The objectives of this study was to assess the impact of a family poultry support programme on the flock performance of family poultry (chicken) in the South and Artibonite departments of Haiti and to identify challenges that may impede the development of family poultry sector in the country. The introduction of exotic cocks in farmers’ flocks in Haiti significantly improved on the number of eggs laid. The average number of eggs laid per cross-breed hen was significantly higher (36%) than those laid by local hens under the scavenging system. This surplus of eggs provides opportunities for more consumption and sale. The crossbred birds had a better body weight. Similar results were reported by Sharma in Uganda after Kuroiler chickens from India were introduced to farmers in that country (Fotsa and Ngeno, 2011). In Haiti, this innovation to backyard poultry was shown to be of economic and food security importance to participants (Nchinda et al., 2011).

However, the crosses with exotic breeds were not different from the rustic birds as far as broodiness and raising of chicks are concerned. Though this was not observed, it is worth noting that hatchability, high egg yield and broodiness are antagonistic traits. Chickens bred for high egg production lose their ability to become broody. The exotic cocks were introduced to the scavenging production system without controlling birds to intermingle with local chicken. Crossbreeding was thus not controlled and a risk of genetic erosion of the local genetic biodiversity would be unavoidable in the long run.

Meanwhile, farmers were successfully inculcated the culture of vaccinating their fowls and paying for such services that were provided by trained community vaccinators. Nevertheless, bird mortality was still a measure problem to backyard poultry in Haiti. Measures should be taken to reduce the primary constraint which happens to be bird mortality through the institution of a sustainable vaccination system, ensure that farmers adopt appropriate bio-security and management practices, provide regular follow-up as well as ease access to inputs (vaccines, drugs, feed). Impact

This article shows how join technical assistance of the Haitian Government and the Food and Agriculture Organization of the United Nations increased the average number of eggs laid by local hens by up to 36% together with the size of eggs and the body weight of birds under a scavenging system. The paper also shows how weaknesses of backyard poultry could be turned into exploitable opportunities by the national and international community to alleviate poverty in developing countries by way of family poultry. It highlights investment opportunities for stakeholders interested in poultry vaccination, input supply and technical backup.


Acknowledgements The authors are very grateful to the Food and Agriculture Organisation (FAO) of the United Nations and the International Fund for Agricultural Development (IFAD) for financing the studies. Special thanks go to all the collaborators in the Ministry of Agriculture (Haiti) and the FAO Representation in Haiti and Headquarters (Rome) for supporting and assisting the assessment process especially under a very challenging working environment. References DEI, H.K., ALIDU, I,. OTCHERE, E., O, DONKOH., A., BOA-AMPONSEM, K., and ADAM, I (2009)

Improving the brooding management of local guinea fowl (Numida meleagris). Family Poultry Vol. 18 (1&2):3-8 DOLBERG, F. (2007) Poultry production for livelihood improvement and poverty alleviation. In: O. Thieme and D.

Pilling, eds. Proceedings of the International Conference Poultry in the Twenty-first Century: avian influenza and beyond, held 5–7 November 2007, Bangkok, Thailand. Rome. http://www.fao.org/Ag/againfo/home/events/bangkok2007/docs/part3/3_1.pdf

FAO (2010) Chicken genetic resources used in smallholder production systems and opportunities for their development, by P. Sørensen. FAO Smallholder Poultry Production Paper No. 5. Rome.

FASINA, F.O., WAI, M.D., MOHAMMED, S.N. and ONYEKONWU, O.N. (2007) Contribution of poultry production to household income: a case of Jos South Local Government in Nigeria. Family Poultry Vol. 17 (1&2):30-34.

FOTSA, J.C. and NGENO, K. (2011) Activity Report, Pan-African Conference on the launch of the Kuroiler chicken in Uganda. Family Poultry Vol. 20 (2):40-47.

GARCIA-LOPEZ, J.C., SUAREZ-OPORTA, M.E., HERRERA-HARO, J.G., PINOS-RODRIGUEZ, J.M. and ALVAREZ-FUENTES, G. (2007) Egg components, lipid fraction and fatty acid composition of Creole and Plymouth Rock x Rhode Island Red crossed hens fed with three diets. Family Poultry Vol. 17(1&2):47-56

GAWANDE, S.S., KALITA, N., BARUA, N. AND SAHARIA, K.K. (2007) Indigenous chicken farming in rural conditions of Assam, India. Family Poultry Vol. 17(1&2):15-29

LAROCHE, D.C and AWONO, C . (2008) Evolution of urban chicken consumption in Southern countries: a comparison between Haiti and Cameroon, 12th Congress of the European Association of Agricultural Economists (EAAE).

MINISTÈRE DE L’AGRICULTURE, DES RESSOURCES NATURELLES ET DU DÉVELOPPEMENT RURAL (MARNDR) 2007 Colloque National sur la problématique des Micro, Petites et Moyennes Entreprises du secteur agro-industriel, Caribe Convention Center, 11-12 May 2007. http://veterimed.org.ht/colloque/acte_final_MPME.pdf

MINISTÈRE DE L’AGRICULTURE, DES RESSOURCES NATURELLES ET DU DÉVELOPPEMENT RURAL (2010) Plan national d’Investissement Agricole de l’Haiti.

NCHINDA, V.P., THIEME, O., ANKERS, P., CRESPI, V. and ARISTE, S. (2011) Food security and economic importance of family poultry (chicken) husbandry program in Artibonite and South departments of Haiti. Livestock Research for Rural Development. Volume 23, Article #201. Retrieved, from http://www.lrrd.org/lrrd23/9/nchi23201.htm

NJUE, S.W., KASIITI, J.L. and GACHERU, S.G. (2006) Assessing the Economic Impact of Commercial Poultry Feeds Supplementation and Vaccination against Newcastle Disease in Local Chickens, In Kenya. In: Improving farmyard poultry production in Africa: Interventions and their economic assessment. Proceedings of a final research coordination meeting organized by the Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture and held in Vienna, 24–28 May 2004. Pages 116-124. http://www-pub.iaea.org/mtcd/publications/pdf/te_1489_web.pdf

PITT, M., SHAHIDUR, R.K., OMAR, H.C. and MILLIMET, D. (2003) Credit programmes for the poor and the Health Status of Children in Rural Bangladesh. International Economics Review 44(1): 87-118. http://dx.doi.org/10.1111/1468-2354.t01-1-00063

SHARMA, R.K. (2007) Role and relevance of rural family poultry in developing countries with special reference to India. Family Poultry Vol. 17 (1&2): 35-40.

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~


Effect of pinioning on growth and behaviour of guinea fowl H.K. DEI 1 and S.S. FUSEINI Department of Animal Science, Faculty of Agriculture, University for Development Studies, P.O. Box TL1882, Tamale, Ghana 1Corresponding author: [email protected] Abstract Guinea fowls are nervous and flighty at least disturbance, thus difficult to handle in confinement. Attempts to handle them with ease include cutting or extraction of flight feathers and pinioning. The objective of this study was to assess the effect of pinioning on growth and behaviour of guinea fowl during the growing period, 8-16 weeks of age. Eighty four keets of equal sexes at 8 weeks of age were randomly divided into 6 groups of 14 birds each. Mean initial live-weight per bird per group was 548 g. Each group was assigned to one of the two treatments (control and pinioned wings) in completely randomized design. Pinioning was carried out humanely at 8 weeks of age. Birds were kept in deep litter pens and fed mash grower diet that contained 200 g/kg CP and 12.5 MJ/kg ME. Feed and water were given ad libitum and light was provided 24 h. Data were collected on growth variables. Feed cost was computed. Behaviours of both treatments were observed. Growth data were analysed by ANOVA using ‘GENSTAT’. Birds pinioned consumed less (P≤0.001) feed. Live weight gains and feed efficiencies were similar (P≥0.05) in both treatments. Pinioning had reduced (P≤0.001) feeding cost, and feed cost per kilogram gain was 3% less (P≥0.05) than that of the non-pinioned group. Also pinioned birds exhibited docile demeanour. Keywords: Guinea fowl; pinioning; growth performance, behaviour Résumé Les pintades sont toujours nerveuses et sont sujets à des vols perturbateurs et par conséquent, difficiles à élever dans un système intensif. Pour les maitriser, il est indispensable d’exécuter la coupe ou l’extraction des plumes de vol et les rémiges primaires. Cette étude a été initiée dans le but d’évaluer l’effet des rémiges primaires sur la croissance et le comportement de la pintade pendant la période de croissance située entre 8 et 16 semaines d’âge.. Quatre-vingt-quatre pintadeaux de deux sexes ont été subdivisés au hasard en 6 groupes de 14 sujets chacun. Le poids initial moyen par sujet et par groupe a été de 548g. Chaque groupe a été soumis aux deux traitements témoins (ayant les ailes garrottés) de façon totalement randomisé. La coupe des rémiges est faite à 8 semaines d’âge de manière soignée et respectueuse de l’éthique animal. Les sujets ont été élevés sur litière profonde et recevaient un aliment élevage ayant 200 g/kg PB, 12,5 MJ/kg EM. Les animaux ont été nourris et abreuvés à volonté et la lumière était assurée 24h sur 24 h. Les données de croissance ont été collectées et le coût des aliments a été calculé. Les comportements des animaux soumis aux deux traitements sont observés. Les données de croissance ont été analysées en utilisant le logiciel 'GENSTAT ». La consommation des pintades garrottées a été significativement (P ≤0,001) inférieure comparée à celle des autres traitements. Le gain de poids et l’indice de consommation ont été similaires (P≥ 0,001) dans les deux traitements. L’influence des rémiges primaires a été permis la réduction des coûts alimentaires de 3%avait réduit (P ≤0,001) les coûts d'alimentation par 3% de moins (P ≥0,05) le coût de l'alimentation par la prise de poids par rapport au groupe non-garrotté. Les pintades garrottées présentent un comportement de docilité. Mots clés : Pintade, Rémige primaire, Croissance, Comportement

Qué Efecto Tiene el Atar a las Gallinas de Guinea en su Crecimiento y en su Comportamiento. Resumen Las gallinas de Guinea son muy nerviosas y vuelan ante cualquier perturbación. Así es muy complicado su manejo en confinamiento. En el intento para poder manejarlas se ha probado cortarles las plumas de vuelo así como atarles las alas. El objetivo de este estudio es determinar el efecto de atar a las aves en su desarrollo y su comportamiento, durante el periodo de crecimiento de las 8 a las 16 semanas de edad. 84 aves de 8 semanas de edad fueros tomadas al azar y se


dividieron en 6 grupos de 14 aves cada uno. El promedio de peso inicial por ave de cada grupo fue de 548 gr. Cada grupo fue asignado a alguno de los dos tratamientos, el control y el de alas atadas de manera totalmente al azar. El atado se llevó a cabo a las 8 semanas de edad. A las aves se les alojó en compartimentos y se alimentaron con una fórmula de 20% PC. y 12.5 Mj/Kg. EM. El alimento y el agua se proporcionaron a libre acceso y la luz fue de 24 Hs. Se recabaron los datos sobre crecimiento y costo de alimentación. Se observó el comportamiento de ambos tratamientos . Los datos sobre el crecimiento se analizaron mediante ANOVA empleando GENSTAT . Las aves atadas consumieron menos alimento(P ≤0.001). La ganancia de peso y la conversión fueron similares (p≤ 0.05) en ambos tratamientos. El lote atado redujo el costo de alimentación ( P ≤ 0.001), y fue 3% más bajo en la conversión alimenticia (P≤ 0.05) comparado con las aves sin atar. Así también las aves atadas se mostraron más dóciles. Palabras Clave: Gallinas de Guinea, Atar, desempeño de crecimiento, comportamiento. Introduction

The domesticated helmeted guinea fowl (Numida meleagris) is known to be nervous and flighty at least disturbance. This behaviour is a way of survival in the wild by avoiding predators (Witter et al, 1994); since they rely on fast take-off as a means of escape. The energy required for jumping and flight shortly after take-off is very high, which is beyond the power generating capacity of the leg and flight muscles (Askew et al, 2001; Henry et al, 2005). According to Bowlin and Wikelski (2008), flying requires more energy than walking. This may demand extra feed for more energy for flight, body maintenance and production (Dei and Nsoah, 2009). Thus removal of flight feathers may not only conserve energy for productive functions, but also render birds flightless and docile for easy care and handling.

Methods such as cutting and extraction of flight feathers of local guinea fowl only render the bird flightless temporary. Therefore taming birds this way will require frequent catching which may be quite stressful. Thus it is opined that rendering birds permanently flightless by pinioning will be more appropriate despite welfare issues involved. Animal activists frown on causing pain to animals that may compromise their welfare. However, the pinioning procedure is such that less pain will be inflicted on the birds, particularly when they are very young. This study was undertaken to assess the effect of pinioning on performance and behaviour of local guinea fowls kept in confinement. Materials and methods

The local helmeted pearl guinea fowl (Numida meleagris) was used for the study. Eighty four keets of equal sexes at 8 weeks of age were obtained from the Animal Research Institute, Nyankpala Station, Tamale. They were randomly divided into 6 groups and there were 14 birds (7 males, 7 females) in each replicate group. Mean initial live weight per bird per group was 548 g. Each group was assigned to one of the two treatments (intact wings or control and pinioned wings) in a Completely Randomized Design. Pinioning was carried out humanely at 8 weeks of age (i.e. amputation of the wings at the carpal joints to remove the part that holds the flight or primary feathers used for flying). In this study, both wings were pinioned to see if birds would be able to learn to fly again using the secondary feathers. The normal procedure is to pinion one wing. The birds were kept in deep litter pens (2.3m x 2.1m) with a floor space of 0.35 m²/bird. They were fed grower mash (200 g CP/kg, 12.5 ME MJ/kg). Feed and water were given ad libitum and light was provided 24 h. Data were collected on feed intake, live weight gain, feed conversion rate, feed cost and behavioural changes. Feed intake and live weight of birds were weighed at weekly intervals in batches using electronic digital scale (Jadever JPS-1050). Birds in both treatments were monitored for any behavioural changes such as nervousness and ease of handling throughout the study as well as when they were able to attempt flying again. Growth data were analysed by GENSTAT 8th edition (Lawes Agricultural Trust, 2005). Results

Birds pinioned consumed less (P≤0.001) feed, but had similar (P≥0.05) live weight gains and feed efficiencies as their control counterparts (Table 1). Pinioning reduced (P≤0.001) feed cost, but 3% less (P≥0.05) feed cost per kilogram gain compared to non-pinioned group. Birds pinioned exhibited docile demeanour (Table 2) and were generally easy to manage in confinement.


Table 1: Effects of pinioning on growth performance and feeding cost of local guinea fowls (9-16 weeks of age) Variable Non-pinioned Pinioned SED Probability

Feed intake (g/bird/day) 88.57 79.72 0.661 <0.001 Live weight gain (g/bird/day) 9.86 8.38 0.668 >0.05 Final live weight (g/bird) 1,100 1,018 34.6 >0.05 Final live weight minus flight feather weight (g/bird)

1,085 1,018 33.7 >0.05

Gain/feed ratio 0.112 0.105 0.0080 >0.05 Mean feed cost (GH¢/bird) Mean feed cost per gain (GH¢/kg)

2.91 2.65

2.62 2.58

0.022 0.081

<0.001 >0.05

SED-standard error of difference Table 2: Characteristic behaviours of pinioned local guinea fowls Characteristic Non-pinioned Pinioned Degree of flying at least disturbance High Low Level of aggression High Low Frequency of running around in pen More Less Degree of noise-making More Less Level of agitation by human presence High Low Level of docility Low High Level of timidity High Low Discussion

Feed has been recognised as a major cost item of poultry production, thus any reduction in feed intake with consequent decrease in feed cost would have considerable effect on profitability. Thus significant reduction (P≤0.001) in feed intake by pinioned birds (Table 1) suggests the importance of rendering these birds flightless for economic reasons. Even though surgical cost of the birds and labour cost of catching the birds for surgical operations were not taken into consideration in this study, it was envisaged that such costs might be minimal.

It appeared that the reduction in activity factor of pinioned birds had favourable effects on their feed requirements and nutrient utilisation. Hence, favourable growth performance of these birds although a slight dip in weight gain was observed (Table 1); probably due to decline in feed intake. Several studies have shown that guinea fowls spend a lot of energy on jumping and flight activities (Askew et al., 2001; Henry et al., 2005; Bowlin and Wikelski, 2008) and removal of flight feathers is beneficial in conserving energy for productive functions (Dei and Nsoah, 2009).

Generally, pinioning had a beneficial effect of ameliorating aggressiveness and nervousness in these semi-domesticated birds. Thus they exhibited docile demeanour compared to their control counterparts (Table 2). For instance, pinioned birds were less noisy, less timid, calmed during feeding or hot periods, and flew about less and more accommodating of human presence. Dei and Nsoah (2009) observed similar behaviour characteristics in local guinea fowls when their flight feathers were extracted. According to Brodbeck (2005), if the wild behaviour of indigenous guinea fowls is not tamed, it would be difficult to catch or handle them and they often sustain injuries. Also, Apple et al. (1995) noted that fright causes stress which in birds induces flight and this in turn causes metabolic changes that adversely affect productivity in farm animals.

Local farmers have recognised the importance of rendering guinea fowls flightless by cutting their flight feathers in order to tame them. This is done whenever the farmer suspects no threat of predation. However, the difficulty of catching these birds periodically to cut the flight feathers after regrowth makes pinioning (i.e. permanent flightlessness) a better option. It was observed in this study that pinioning both wings made the birds to somehow regain their ability to fly again though flight could not be sustained for long.


Conclusion

This study showed that pinioning had no adverse effect on birds’ growth performance. This method of permanent flightlessness had economic benefits as well as taming of birds for easy handling. It is therefore recommended that farmers should pinion local guinea fowls kept under the intensive system of management without compromising their welfare. Impact

Pinioning is a simple surgical procedure of removing the flight feathers of guinea fowls to make them permanently flightless. This is done to curb wild behaviour exhibited by them that makes them difficult to catch or handle in confinement. This study shows that pinioning will not adversely affect growth performance of the local breed of guinea fowl. It is beneficial in reducing feeding cost, as well as taming of them that makes their handling quite easy. Both reduction in feed cost and taming are important for intensive rearing of the local guinea fowls. References APPLE, J.E., DIKEMAN, M.E., MINTON, J.E., MURPHY, R.M., FREDDE, M.R., LEITH, D.E. and UNRAH,

J.A. (1995) Effects of restraint and isolation stress and epidural blockage on endocrine and blood metabolite status, muscle glycogen depletion and incidence of dark cutting longissimus muscle in sheep. Journal of Animal Science 73: 2295.

ASKEW, G.N., MARSH, R.L. and ELLINGTON, C.P. (2001) The mechanical power output of the pectoralis muscle of blue-breasted quail (Coturnix chinensis) during take-off. Journal of Experimental Biology 204: 3601-3619.

BOWLIN, M.S. and WIKELSKI, M. (2008) Pointed wings, low wing loading and calm air reduce migratory flight cost in songbirds. PLOS One 3 (6): 2154.

BRODBECK, F. (2005) Guinea fowl culture. Wildlife Society of Malawi Sustainable Management of Indigenous Forest Project Report, National Headquarters, Limbe, Malawi, pp 7-9.

DEI, H.K. and NSOAH, J.K. (2009) Effects of removing flight feathers on growth performance of local guinea fowl (Numida meleagris). Proceedings of the 16th Ghana Society of Animal Production, Kumasi, Ghana, pp. 131-134.

HENRY, H.T., ELLERBY, D.J. and MARSH, R.L. (2005) Performance of guinea fowl (Numida meleagris) during jumping requires storage and release of elastic energy. Journal of Experimental Biology 208: 3293-3302.

LAWES AGRICULTURAL TRUST. (2005) GenStat 8th ed. Rothamsted Experimental Station, Harpenden, UK. WITTER, M.S., CUTHILL, I.C. and BOSNER, R.H. (1994) Experimental investigations of mass-dependent

predation risk in the European Starling (Sturnus vulgaris). Animal Behaviour 48: 201-222.

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~


Short Communications| Brèves Communications | Comunicaciones Breves

Promotion of Rural Poultry Production in India

SATISH J. MANWAR Department of Poultry Science, College of Veterinary & Animal Sciences, Udgir, Dist. Latur, Maharashtra – 413517, India E-mail: <[email protected]>

Summary In India, poultry rearing is an integral part of the rural farming system. However, the 70% of the nearly 44 billion eggs and 1.6 billion broilers per annum are consumed in urban and semi urban areas and the rural consumption is quite low, mainly due to the poor availability of eggs and poultry meat. Non-descript native fowl are used in this production system which has acquired considerable adaptability to local climatic conditions. Usually, investment is low in this system and it is not economically viable given the high mortality and low productivity of the reared chicks. The strategies for the success of backyard poultry production include use of improved breeds, improved feeding practices, housing, health and biosecurity, developmental programmes, protection from predators, training, extension and information system, marketing, developing a suitable bird for backyard poultry along with diversification in poultry production. The eggs and meat of backyard chicken is much more highly valued and they are equivalent to ‘Organic eggs or chicken’ with prices being 50-100 % higher. Therefore, increased backyard production would result in a positive impact on women empowerment, household food security and income generation. For development to take place attention needs not only to be on the producer but as much on the establishment of an enabling environment which provide access to essential inputs like vaccination, feed, micro finance and good market access for other inputs and outputs. Key words: Rural poultry, Constraints, Strategies Résumé

En Inde, l’aviculture fait partie intégrante du système de production rurale. Cependant, 70% de près de 44 milliards d'œufs et 1.6 milliard de poulets de chair sont consommés annuellement en zones urbaines et péri urbaines; la consommation rurale est très faible à cause principalement d’un faible approvisionnement de ces zone en œufs et en poulets. La poule locale non décrite native est celle qui est la plus utilisée dans ce système de production à cause de sa grande capacité d’adaptation aux conditions climatiques locales. Habituellement, ce système requiert un faible investissement à la base mais n’est pas économiquement rentable étant donné la forte mortalité et une faible productivité des poussins élevés. Les stratégies pour le succès de la production de basse-cour comprennent l'utilisation de races améliorées, l’utilisation des aliments équilibrés, l’habitat, les soins vétérinaires et la biosécurité, les programmes de développement, la lutte contre les prédateurs, la formation, la vulgarisation le système d'information, la commercialisation, la mise sur pied d’une volaille adaptée à la basse-cour suivie d’une diversification de la production avicole. La viande de poulet et les œufs issus de la basse-cour sont plus valorisés et équivalent à des «œufs biologiques » ou poulet coutant 50-100% plus chers. Par conséquent, l’accroissement de la production avicole de la basse-cour se traduirait par un impact positif sur l'autonomisation des femmes, la sécurité alimentaire des ménages et la génération de revenus. Pour que le développement soit effectif, une attention ne sera pas seulement portée sur le producteur mais aussi bien sur la mise en place d’un environnement propice permettant des intrants essentiels tels que la vaccination, l’aliment, la micro-finance et un bon accès au marché des autres intrants et extrants.

Mots clés: Volaille rurale, Contraintes, Stratégies.


Resumen

En la India, la cría de aves de corral es una parte integral del sistema de producción rural. Sin embargo, el 70% de los casi 44 billones de huevos y 1.6 billones de pollos de engorda por año se consumen en las zonas urbanas y semi-urbanas, y el consumo en las zonas rurales es muy bajo, debido principalmente a la poca disponibilidad de huevo y carne avícola. En estos sistemas de producción se utilizan aves nativas, las cuales han adquirido una gran adaptabilidad a las condiciones climáticas locales. Por lo general, en estos sistemas la inversion es baja y no es economicamente viable, dada la alta tasa de mortalidad y la baja productividad de los pollos criados. Las estrategias para que la producción de aves de traspatio tenga éxito incluyen el uso de razas mejoradas, mejoramiento de las prácticas de alimentacion, alojamiento, salud y bioseguridad, programas de desarrollo, proteccion de los depredadores, capacitación, sistemas de extención e información, marketing, desarrollo de una ave adecuada para el sistema de traspatio junto con una diversificación en la producción avícola. El huevo y la carne de aves de traspatio son mucho mas valuados y son equivalentes a los ¨Huevos Orgánicos¨ ó a los pollos cuyos precios son 50-100% mas altos. Por lo tanto, un aumento en la producción de traspatio se traduciría en un impacto positivo en el apoderamiento de la mujer, seguridad alimentaria y generacion de ingresos. Para que el desarrollo se lleve a cabo, se necesita atención no solo en el productor si no en la creación de un entorno favorable que provea el acceso a insumos esenciales como vacunas, alimento, micro finanzas y un buen acceso al mercado para otras entradas y salidas. Palabras clave: avicultura rural, restricciones, estrategias. Introduction

In spite of the fact that India enjoys 3rd position in egg production and 4th in broiler production in the world, the

consumption of eggs and meat is far below the global average of per capita consumption per annum. The Indian Council of Medical Research has recommended consumption of 180 eggs and 10.8 kg poultry meat per person per annum. At present, most of our poultry production units are located near urban areas, catering to urban needs and when a fraction of this production reaches the villages, it costs the rural consumer at least 50% more than what it costs the urban consumers. The higher price and low availability of poultry products to the rural consumer leads to lower consumption and thereby deficiency of quality protein in their diet.

Poultry rearing is an integral part of the rural farming system. However, the 70% of the nearly 44 billion eggs and 1.6 billion broilers per annum are consumed in urban and semi urban areas and the rural consumption is quite low, mainly due to the poor availability of eggs and poultry meat. Poultry production in rural areas and hills is still unorganized and on small scale. The private sector is not inclined to go to the rural areas because of the commercial nature of the poultry egg and meat production. As a result the percentage of native backyard birds in the total poultry population has dropped from 50% about 30 years ago to about 10% now. The eggs and meat of backyard chicken is much more highly valued and they are equivalent of ‘Organic eggs or chicken’ with prices being 50-100 % higher. Therefore, increased backyard production would result in a positive impact on women empowerment, household food security and income generation.

In extensive backyard rearing system, the family members, especially the women take care of the poultry, which are very small in numbers, averaging 20 birds per family (Khan and Manwar, 2007). There is no commercial application here as there is hardly any surplus left for marketing. The major inputs required for this sector are locally adaptable improved variety of stocks with better productivity and low mortality, health care, trainings and extension. Formation of self-help groups, societies, cooperatives etc. will increase awareness about nutrition and also help the farmers realize surplus production through proper technological adoption, thus adding to their income as a supplementary source.

Management of poultry has been associated with women for various historical and social factors. With the recent emphasis on gender in development activities, there has been a tendency for poultry production to be seen as means of reaching women’s group. With targeted training, gender based constraints such as poor access to information by women, division of labour/heavy workloads and fewer roles in decision making in the household are envisaged to be overcome. This also has been shown to lead to their greater empowerment if they are able to participate as poultry advisors, extension workers for providing advice and support to other poultry owners.

Backyard poultry farming is a family enterprise generally practiced by rural women and the contributions of women clearly highlight their articulation of activities in poultry farming where women must be recognized as potent human resource. The backyard poultry farming can be converted into a highly profitable venture by imparting rural


women with skills for scientific rearing of backyard poultry and at the same time keeping the input cost low by using locally available environment friendly resources. The native chicken thus produced will be a cheap and constant source of quality protein in the form of eggs and meat for the villagers. More importantly it will lead to empowerment of women in rural areas and the overall socio- economic status of rural families will be elevated.

Present status

Non-descript native fowl are used in this production system which has acquired considerable adaptability to local climatic conditions. The free range birds obtain their feed from scavenging. They scavenge on worms, hunt bugs, stones, grit, green leafy vegetables and household waste, etc. Usually, investment is low in this system and birds are reared without any sophisticated house and kept in open throughout the day. The native birds have a marked resistance to many diseases and are efficient mothers. They incubate their eggs and give protection to their young chicks till they are able to protect themselves.

The women in rural areas already make significant contributions to rural households by looking after family, livestock and poultry. Poultry rearing has also been seen as a popular activity among the rural people who have been associated with it since ages. The preference of consumers for indigenous birds, liking for colored plumage and tinted eggs and traditional wisdom of raising the birds has also helped in in situ propagation of local birds. Unfortunately, low productivity has become the stamp of this rural backyard poultry, leading to lower returns. Moreover, there is no commercial application in this system of farming as there is hardly any surplus left for marketing. The main reason for it is that poultry owners did not receive any training in backyard poultry farming.

Therefore, to give the necessary impulsion to the rural women empowerment programme in general, poultry may be used as an effective tool with some crucial technological applications like increasing the productivity and decreasing the mortality rates, etc. The major inputs required for this sector are locally adaptable improved variety of stocks with better productivity and low mortality, health care, trainings and extension. This can be a successful venture if the women constitute self-help groups; co-operatives, etc. to increase awareness about nutrition and surplus production through proper technological adoption, thus adding to their income as a supplementary source. So, backyard poultry farming initiation on scientific guidelines has vast income and employment generation potential for the rural women. Lack of understanding of backyard poultry farming makes it difficult to design and implement poultry based development programmes that benefit rural people. An appropriate strategy is necessary in backyard poultry farming for empowerment of rural women and to have stress-free birds free from harmful residues. Constraints

The tribal and backward community populations have been traditionally rearing chicks, which is not economically viable given the high mortality and low productivity of the reared chicks. Low productivity is mainly caused by unscientific feeding that leads to susceptibility of birds to different infectious diseases, nutritional deficiencies and metabolic disorders. The poultry birds, especially of meat type at high altitude are highly susceptible to ascites and sudden death syndrome. In ascites, excess amount of ascitic fluid (combination of lymph and blood plasma) accumulate in the body cavity that often leads to mortality. The other important constraints in backyard poultry farming include (Rao and Thomas, 1984; Balaraman and Kaul, 1985; Singh and Pani, 1986; Singh and Johari, 1990; Rangnekar and Rangnekar, 1996; Dana, 1998; and Saha, 2003): � High hatching mortality and attack of predators � Non-availability of suitably developed breeds that can be adopted well at different height, cold temperature � Extreme climatic conditions like cold and low oxygen pressure, shortage of space and difficulties in housing owing

to extreme cold climate. � Scarce availability of good quality feedstuffs suitable for poultry feeding. � Lack of awareness among people on economic potentiality of poultry production. � Inadequate or lack of proper health cover, vaccines, medicines, hatcheries, availability of quality feed and

organized marketing. � Unhygienic and complaints by neighbourer � Lack of financial support


Strategies

Backyard poultry farming by and large is a low input or no input venture and is characterized by indigenous night shelter, scavenging system, with little supplementary feeding, natural hatching of chicks, poor productivity of birds, local marketing and no health care practice. Its importance in national economies, nutritional status and incomes of developing countries has been recognized (FAO, 1987). In many developing and underdeveloped countries backyard poultry production is mainly based on traditional extensive poultry production system which contributes up to 90 % of the total poultry products. In India, Desai (1996) reported successful rural poultry farming projects involving women, who led to increased production and empowering of women through provision of training and credit. Backyard poultry farming fulfills a wide range of purposes: provide meat and eggs, food for special festivals, chicken for traditional ceremonies, pest control and petty cash, utilizes minimum inputs, requires minimum human attention, and causes less environmental pollution along with ensuring nutritional security, subsidiary income to buy more food, send children to school and augment assets to ensure financial security. The strategies for the success of backyard poultry production are discussed hereunder (Manwar and Singh, 2007):

1. Improved breeds

The indigenous birds although low in productivity but are highly resistant to diseases, adaptable to adverse climatic conditions and able to produce even under low input systems. The government of India has supported backyard poultry farming which has resulted in release of some important backyard poultry varieties viz. Vanaraja, Gramapriya, Giriraja, CARI Nirbheek, Krishna-J, etc., for benefit of rural farmers. China is the highest egg producing and second highest chicken meat producing country in the world. The most of the poultry is in the form of the backyard poultry or in unorganized sector and this sector is not over dependent upon the imported germplasm unlike India. In India also there are many types, breeds and strains of indigenous poultry which are well adapted to their environment. There is need for their genetic improvement in order to improve their productivity within their local environment and also to make use of the improved indigenous birds in crossing with imported exotic birds and conserve the desirable genes (e.g. for disease resistance) of the indigenous breed for future breeding. 2. Improved feeding practices

Availability of feed is the major constrain in high altitude poultry feeding. Certain grains, pulses and oil seeds are grown in hilly areas. Some amount of grain and it’s by products can be made available. Moreover, certain by products are also available from fruit industry. During the dry season, poultry can quickly develop vitamin deficiency because of the scarcity of the succulent vegetables in the range. There is a need to supplement their scavenging with sources of minerals and vitamins. Most of the materials available for scavenging are not concentrated enough in terms of energy because they contain lot of crude fiber. Therefore, scavenging poultry should be supplemented with the energy sources such as maize, sorghum and millets in the morning or late in the evening. Birds scavenge during the day mostly for protein (insects, worms, larvae, etc.), minerals (stones, grits, and shells) and vitamins (leafy greens) in between the meals. It is very important to know the amount of scavengeable feed available in a village and to monitor the effect of seasons on it. The recommended policy is to identify and use locally available feed resources to formulate diets that are balanced. There has been less use of fertilizers and pesticides on hills, and their use for poultry feeding with little supplement of deficient nutrients will certainly promote production of organic chicken and eggs. 3. Housing of birds

Majority of the poultry owners keep the birds in houses prepared by using locally available materials viz. wood, mud, broken bricks, tiles, wire net, etc. Proper housing must not only provide an environment that moderates environmental impact but must provide adequate ventilation for birds to lay eggs, as well as to feed and sleep in comfort and security. Thus, construction of proper housing using cheap, durable, locally available resources and skills can go a long way in improving village chicken production.

Depending upon the agro climatic conditions the house designing should be done to get optimum production from the high yielding birds. The hilly areas like J and K have a low temperature problem. During the winter, temperature at certain places may go below 00C. Hence, efforts are to be made to provide the warmth. Seal the house from three sides using gunny bags, one side which does not face the direction of the cold winds should be kept open for ventilation. This side must face south and rest three i.e. north, east and west be closed. During winter, keep the house full to its capacity. This provides more heat. Direct draft should be controlled to ensure comfort of birds during winter. Birds are more comfortable at slightly higher temperature and low humidity than at reverse. Cross ventilation is essential for


controlling humidity. There should be cross ventilation all along the two sides of poultry house. This will remove excess of moisture and undesirable gases and will also help in keeping the litter dry. 4. Poultry health and biosecurity

The requirement of health coverage is as crucial to the rural/small scale sector as ......?. The major diseases of backyard poultry in India that have been identified are Newcastle disease (ND), Infectious bursal disease (IBD), or Gumboro, Marek’s disease (MD), Fowl typhoid, cholera, mycoplasmosis and coccidiosis. Among all these diseases ND is the most devastating disease of backyard chickens. Commercial sector may be at risk from free range rural flocks due to their lack of biosecurity measures and rural production may succumb to commercial methods like indiscriminate use of vaccines even when they are not needed. Cold chain and thermo stable vaccines are other requirement, which shall be considered. Biosecurity measures should be followed in light of HPAI in neighbouring countries and other exotic diseases and any imports shall be scrutinized.

5. Developmental programmes

When compared to the agriculture and other livestock, poultry has definitely an edge. Because, it is not much dependent on monsoon unlike agriculture and it requires less land and can be established on waste lands such as drought prone and alkaline soils. The developmental interventions required are primary production at village level (viz. Parent stock unit, Mini hatcheries, Feed mixers, Sale counters, Chick brooding units) for input supply along with marketing and health care services. This will also help in generating employment in rural areas. Village poultry programme in Bangladesh have trained more than 20,000 poultry workers responsible for vaccinating village chickens. In India also this practice is to be encouraged. Vaccination against ND increases chick survival rate by 100%.

6. Protection from predators

Predators such as snakes, rats, dogs, cats, etc. causes high mortality. Prevention can be considered through proper housing and shelter. Hunting, poisoning, trapping and use of the natural enemies of the predators are the available methods. Predators can be repelled by specific plants. For example, sliced garlic put in the house of the birds to repel the snakes from the birds.

7. Training, extension and Information system

The role of the poultry owners in a family largely depends on the type and size of the family. The time available with the members of the household largely depends on the number of members as well as the type of family. In a medium family size the women folk of the household can easily take up backyard poultry farming as it is an enterprise with low demand on time and labour. Its success lies in the training of farmers and training shall be undertaken at large scale to give technical information about farming, mostly basic chick rearing and create awareness about benefits of poultry with respect to economics and nutritive value of egg products. It should also include taking up diversified farming. Seminars and workshops involving farmers from block to state level at regular intervals will also help create awareness about poultry farming.

8. Marketing:

The rural produce shall be given wide publicity for its near-organic and non-synthetic nature. This will help create a niche market for the rural products.

9. Developing a suitable bird for backyard poultry

Poultry keeping in backyard gives very high return as the investment is very low. Our country needs to have a bird suitable to rural, poor, small and marginal farmers, who are deprived of technical know-how and other inputs for poultry rearing. Native birds have � Better adaptability to local harsh conditions and possess the ability to survive, produce and reproduce on low plane

of nutrition and sub-optimal management. � The inputs required are very small as they scavenge their feed requirements and are raised with little veterinary care

owing to high disease resistance � Low cholesterol level in eggs and meat � All the local breeds show broodiness and hatch their own chicks making the system auto generating. � They possess the ability to protect themselves and their young ones from predators. � Dual purpose birds will be most suitable.


� Colored plumage pattern � Eggs and meat from local breeds are sold at a premium price as people have a preference for eggs and meat of

indigenous poultry compared to those realize from farm-bred chickens.

10. Alternative poultry species Diversification is target in terms of giving special focus on new species. Alternative poultry species such as ducks,

Japanese quails, Turkeys, Guinea fowls, Emu and ostrich should be encouraged. In order to overcome the constraints there is a need for creating awareness, providing knowledge and proper planning and implementation of strategies for backyard poultry farming to make it a rural poultry revolution for poverty alleviation in rural India. The future strategies are highlighted and discussed here under. • There is a dire need of imparting basic training to the women to take up poultry activity and give them the needed

confidence to successfully rear the birds. An extension activity for transfer of technology from the lab to the farmers’ doorstep has to be intensified.

• Since the backyard poultry farming is managed largely by the women in the family the scientific training imparted to them on rearing of poultry in their backyards will benefit their families.

• Though the backyard poultry farming does not require any sophisticated management but the importance regarding night shelters, cleaning equipment and general hygiene needs to be imparted to the farmers.

• Cheaply built sheds made of local materials like mud, thatch and bamboo which may house 15-20 birds with reasonable floor space can economize the housing. Sheds must be built so that they may prevent birds from predators.

• Breeding policy for backyard poultry aims at increased production of eggs and poultry meat by increasing productivity of native poultry birds and introduction of new species of poultry bird like turkey, guinea fowl for diversity in the meat type poultry.

• Proper feeding and other improved managemental practices will also help improve the productivity of the birds. • Number of the birds kept under this system of farming depends upon the feed resource availability in the range. If

grass and worms are in abundance the number of the birds may be increased. • Poultry health and bio-security are two of the most alarming challenges for both the rural and commercial set up.

Health coverage to the birds in the rural areas needs a deep health service delivery system not adequate presently, to counter the high mortality rates particularly in birds of young age.

• Special emphasis is needed for marketing of rural poultry produce coming from the backyard and small flocks. • Since most of the small holder poultry farmers are poor, government should extend assistance to improve the poultry

farming system like selective breeding and multiplication of local poultry breeds for supply to the villagers by the government poultry farm.

• All the poultry stocks should he vaccinated against the most common killer diseases like Ranikhet Disease (RD) and Fowl Pox. Small packs of R.D. vaccine containing preferably 50 or less doses of the vaccine to be made available to reduce wastage and make it economical for farmers.

• Extension support for health care, input supply, market linkages and other aspects should be readily available at village level.

Conclusion

By having a holistic approach to backyard poultry development, taking into account technical as well as organizational approach, it is possible within a relatively short period to develop poultry production systems based upon locally available resources, which may help the rural women in developing their skills and creating a sustainable income with very few inputs. For development to take place attention needs not only to be on the producer but as much on the establishment of an enabling environment which provides access to essential inputs like vaccination, feed, micro-finance and good market access for other inputs and outputs. Impact

Backyard poultry farming plays an important role in rural economy. In addition to supplementary income, the village poultry have nutritional, cultural and social values. The rural poultry farmers have poor knowledge about feeding, breeding and management practices, which led to poor performance of the birds. Therefore, extension


programmes should be strengthened so that the farmers become more knowledgeable and skilful about the new technologies as well as the recommended practices and can maximize the productivity and consequently the income. The on-farm training of rural poultry owners is also necessary so as to bring about changes in their practices. India has tremendous potential in organic poultry because of the existence of traditional backyard system. Therefore, there is need to follow suitable approach and technology for the development of backyard system of poultry rearing which, in turn, can be changed to a successful organic venture.

References

BALARAMAN, S. and KAUL, P.N. (1985) Adoption of improved practices by traditional fisherman in Kerala. Indian Journal of Extension Education, 21: 80-88.

DANA, S.S. (1998) Animal husbandry practices among Santal and Lodha tribes of Medinipur district of West Bengal. Ph.D. Thesis, Division of Extension Education, IVRI, Izatnagar.

FAO (1987) Report on the expert consultation on rural poultry development in Asia, Dhaka, Bangladesh, 23–28 March 1987. Animal Production and Health Division Publication. No. 274415. Rome.

KHAN, A. and MANWAR, S.J. (2007). Backyard Poultry Production for Rural Women Empowerment: Present Scenario and Future Strategies, Proc. National Seminar organized by the SKUAST-K, Srinagar, India, pp: 69-72.

MANWAR, S.J. and SINGH, Y. (2007). Strategies for promoting Backyard Poultry Production for Women Empowerment and Nutritional Security, National Seminar organized by the SKUAST-K, Srinagar, India pp: 79-83.

RANGNEKAR, D. and RANGNEKAR, S. (1996) Traditional poultry production system - A need for fresh look from rural development perspective. XX World's Poultry Congress, New Delhi, 2-5 Sept., pp: 405-408.

RAO, G. V. and THOMAS, P.C. (1984) The breed characteristics of Kadaknath breed of indigenous chicken. Avian Research, 68: 55-57.

SAHA, D. (2003) Status of rural poultry production in North 24 Parganas district of West Bengal. M.V.Sc. Thesis, Division of Extension Education, IVRI, Izatnagar.

SINGH, D. P. and JOHARI, D. C. (1990) Kadaknath the native fowl needs to be conserved. Indian Farming, March, 1990, pp: 29-32.

SINGH, D.P. and PANI, P.K. (1986) Aseel's background and foreground. Poultry Guide, Feb., 1986, pp: 53-60.

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~


News | Nouvelles | Noticias

A new INFPD Executive Committee Preparatory to the next biennial General Meeting of International Network for Family poultry Development (INFPD) that will hold during the XXIV World’s Poultry Congress (WPC) in Salvador - Bahia, Brazil, there was a need to elect new officers to run the INFPD for the next 4 years. Knowing well that majority of us may not be able to attend the WPC, it was agreed by the Executive Committee that all members should be given the opportunity to nominate (and be nominated) and to elect officers for INFPD for the next 4 years (2012 – 2016). Therefore an electronic consultation was run from 23 September 2011 to 23 December 2011 in order to allow all INFPD members to cast their votes. The deadline for the election was extended three times in order to get at least 50% of our members voting to make the elections credible. Hundred sixty-four (164) votes were cast as of December 24, 2011. Results of the elections were released on January 2012 and are presented in the table below as follow: Post Candidates Votes Results Coordinator E. Fallou Guèye (Senegal) Elected Secretary Md. A. Saleque (Bangladesh) Elected Editor-in-Chief, FPC* Jean-Claude Fotsa (Cameroon) Elected Deputy Editor-in-Chief, FPC* J. Oluwasola Agbede (Nigeria) Elected Ex-Officio Brigitte Bagnol (Mozambique/South Africa) Elected

*FPC: Family Poultry Communications Thank you very much for active participation. Let me wish you all a very productive Year 2012. Prof. E. B. Sonaiya Dept. of Animal Science, Obafemi Awolowo University, Ile-Ife 220005, NIGERIA. E-mail: <[email protected]>, Tel: (+234) 803 719 7378 Past Co-ordinator, International Network for Family Poultry Development. Un nouveau Comité Exécutif du RIDAF Dans le cadre des activités préparatoires à la prochaine Assemblée Générale biannuelle du Réseau International pour le Développement de l'Aviculture Familiale (RIDAF) qui se tiendra lors de la XXIVème Congrès Mondial de l’Aviculture (CMA, ou World’s Poultry Congress) qui se tiendra à Salvador- Bahia au Brésil, il a été nécessaire d’élire de nouveaux dirigeants du RIDAF. Sachant bien que la majorité d'entre nous peut ne pas pouvoir participer à ce congrès, le comité exécutif a décidé que la possibilité soit donnée à tous les membres de nommer (et d’être nommés) et d’élire les dirigeants du RIDAF pour un mandat de 4 ans (2012 – 2016). Ainsi, une consultation électronique a été organisée du 23 septembre 2011 au 23 décembre 2011 afin de permettre à tous les membres du RIDAF d’effectuer leurs votes. La date-limite pour l’élection a été reportée à trois reprises afin d’obtenir au moins 50% de nos membres votant pour rendre les élections crédibles. Cent soizante qutre (164) votes ont été enregistrées à la date du 24 decembre 2011. Les résultats proclamés en Janvier 2012 ont été présentés comme ci-dessous indiqués: Poste Candidats Résultats Coordonnateur E. Fallou Guèye (Sénégal) Élu Secrétaire Md. A. Saleque (Bangladesh) Élu Éditeur en Chef, CAF* Jean-Claude Fotsa (Cameroun) Élu Éditeur en Chef Adjoint, CAF* J. Oluwasola Agbede (Nigeria) Élue Ex officio Brigitte Bagnol (Mozambique/Afrique du Sud) Élue

*CAF: Communications en Aviculture Familiale


Je vous remercie beaucoup pour votre participation active. Permettez-moi de vous souhaiter tous une très productive Année 2012. Prof. E. B. Sonaiya Dept. of Animal Science, Obafemi Awolowo University, Ile-Ife 220005, NIGERIA. E-mail: <[email protected]>, Tel: (+234) 803 719 7378 Ancien Coordonateur, Réseau International pour le Développement de l’Aviculture Familiale.

Un nuevo Comité Ejecutivo del RIDAF

En preparación a la próxima Asamblea General bienal de la Red Internacional para el Desarrollo de la Avicultura Familiar (RIDAF) que celebrará durante el XXIV Congreso Mundial de Avicultura (CMA ó World´s Poultry Congress) en la Bahia-Salvador, Brasil, había la necesidad de elegir a nuevos oficiales para funcionar el RIDAF. Sabiendo bien que la mayoría de nosotros puede no poder atender al WPC, fue convenido por el Comité Ejecutivo que todos los miembros deben tener la oportunidad de nominar (y ser nominado) y de elegir a los oficiales para RIDAF por los 4 próximos años (2012 - 2016). Por lo tanto se realizó una consulta electrónica del 23 de septiembre de 2011 al 23 de diciembre de 2011, para permitir que todos los miembros de RIDAF emitan sus votos. El plazo para la elección era tres épocas extendidas para conseguir por lo menos el 50% de nuestros miembros que votaban para hacer las elecciones creíbles. Cientos sesenta y cuatro (164) votos fueron emitidos el día 24 de diciembre de 2011. Los resultados anunciados en enero de 2012 se muestran a continuación: Posición Candidatos Resultados Coordinador E. Fallou Guèye (Senegal) Elegido Secretario Md. A. Saleque (Bangladesh) Elegido Editor en Jefe, CAF* Jean-Claude Fotsa (Cameroun) Elegido Suplente de Editor en Jefe, CAF* J. Oluwasola Agbede (Nigeria) Elegido Ex-Oficio Brigitte Bagnol (Mozambique/Sudáfrica) Elegido

*CAF: Comunicaciones en Avicultura Familiar

Muchas Gracias por la activa participación. Déjeme desearle todo un año 2012 muy productivo.

Prof. E. B. Sonaiya Dept. of Animal Science, Obafemi Awolowo University, Ile-Ife 220005, NIGERIA. E-mail: <[email protected]>, Tel: (+234) 803 719 7378 Coordinador del pasado, Red Internacional para el Desarrollo de la Avicultura Familiar.

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~


Instructions to authors | Recommandations aux auteurs | Instrucciones par autores

Instructions to authors The following formatting instructions must be followed carefully. Authors are responsible to ensure the correct formatting before the submission of the manuscripts of their papers. Manuscripts that do not meet the requirements will not be considered. Contents Family Poultry Communications (FPC) publishes reviews and original papers on all aspects of family poultry science, reports on the development of family poultry production from all over the world, reports from conferences, seminars, symposia and known scientific working groups, as well as book reviews, news and a listing of forthcoming events of the INFPD (International Network for Family Poultry Development) and other relevant organisations. An original paper must be based on relevant research and development activities. It must at least have the following sections: Introduction, materials and methods, results, discussion and conclusions. A review paper should be comprehensive within the area defined by its title, the structure should be logical and the citations should be subjected to critical appraisal just like the methodology and statistical analyses of results. When preparing a review paper, sound deductive and constructive processes should be used to produce valid, useful and clearly presented conclusions. It is encouraged to use appropriate figures, tables, formulas and illustrations. The objective must always be to produce a worthwhile addition to the body of available literature. Preparation of manuscript Submitted papers, which will be subject to scrutiny by independent referees and editorial revision, should normally not exceed 8-10 pages (or approximately 6000 words) including tables, illustrations and references. Longer papers can be accepted but it is advisable for authors to contact the editor before submission. Papers should be presented in Word format, in an A4 layout, using Times New Roman 12 point font, line spacing must be double, margins 2.5 cm and with consecutive line numbering (continuous over pages) along the left margin. Pages must be numbered in the upper right-hand corner. The first page of the manuscripts should contain the following features: Title : Directly relating to the topic of the paper. Name(s) and postal address(es) of author(s). E-mail address of the corresponding author. Abstract should be 100-300 words and be translated into the two other official languages (English, French and/or Spanish). Keywords: Up to 8 Use of italics Latin phrases, e.g. in vivo, et al. should be italicised. Species names should be italicised only if the full name is used (e.g. Chlamydia psittaci) or if suffixed by “spp” (Gossypium spp.) when referring to multiple or undefined species. The first part of the species name has to be capitalised, and the second in lower case, without exception (e.g. Eimeria tenella, Trichomonas gallinarum). All references to bacterial, animal or plant family names must be formatted as regular text (e.g. “chickens belong to the family of phasianidae”). Note: Provide a paragraph of no more than 150 words explaining to INFPD’s non-specialists the importance of your research findings. These points will be published at the end of the article under the sub-section "Impact" References Authors must be careful when citing references, especially regarding the formatting (bold, italicised, etc.) and giving the full names of the publication that should not be abbreviated (give full journal title, no abbreviation!). References must include only those cited in the body of the text. Reference to previous work must concern those relating to the topic of the paper and should be cited in the text with the


author’s name and the year of publication in parentheses, e.g. “Guèye (1998) found that…” or as “Sonaiya and Agbede (2002) confirmed the recent conclusions of Fotsa et al. (2012) showing...” In the references list, references must be sorted in alphabetical order of the surnames of the first author with all authors cited. The full name of journals should be written including the first and last page numbers of the papers concerned: GUÈYE, E.F. (2009) Paper title. Journal Title Vol. (Nr) : page numbers (see examples below). Examples GUÈYE, E.F. (2009) The role of networks in information dissemination to family poultry farmers. World’s Poultry

Science Journal 65 (1): 115-124. AGBEDE, J.O., KLUTH, H. and RODEHUTSCORD, M. (2009) Studies on the effects of microbial phytase on

amino acid digestibility and energy metabolisability in caecectomised laying hens and the interaction with the dietary phosphorus level. British Poultry Science 50 (5): 583-591.

GUNARATNE, S.P., CHANDRASIRI, A.D.N., HEMALATHA, W.A.P.M. and ROBERTS, J.A. (1993) The feed resource base for scavenging village chickens in Sri-Lanka. Tropical Animal Health and Production 26: 249-257.

FOTSA, J.C. (2012) Genetic diversity of Indigenous Chickens in Cameroon. Bulletin of Animal Health and Production in Africa 60 (1): 63-70.

ACAMOVIC, T., SINURAT, A., NATARAJAN, A., ANITHA, K., CHANDRASEKARAN, D., SHINDEY, D., SPARKS, N., ODUGUWA, O., MUPETA, B. and KITALYI, A. (2005) Poultry. In: Livestock and Wealth Creation: Improving the Husbandry of Animals Kept by Resource-poor People in Developing country (Owen, E., Kitalyi, A., Jayasuriya, N. & Smith, T., Eds.). Nottingham University Press, England, pp: 301-324.

CAMACHO, E.M., LIRA T.I., RAMÍREZ, C, LÓPEZ, P.R. y ARCOS, G. J. (2006) La avicultura de traspatio en la costa de Oaxaca, México. Ciencia y Mar 28: 3 – 11.

DESSIE, T. (1996) Studies on village poultry production systems in the Central Highlands of Ethiopia. MSc Thesis, Swedish University of Agricultural Science, Uppsala, Sweden.

The author/s is/are totally responsible to ensure the accuracy and the correct citation of the references. The editors of FPC cannot take any responsibility for incorrect citations. Tables, line drawings and photographs Titles of figures and tables must be brief with enough information for it to be understood far away from the text. Tables can be displayed inside the text. Larger tables can be put in separate pages at the end of the paper, while their approximate location will be indicated in the text. All tables should follow the specific “table” creation function in Word software, and, tabs and spaces should not be used. Tables spacing must be appropriate, and column headings as brief as possible, with a self-explanatory legend, if required. Statistical significances between means in columns or rows must be indicated by superscript letters, and accompanied by a standard statement underneath the table or figure, e.g. “Means with different superscript letters in the same row (or column) are significantly different at P < 0.05”. Graph figures should be created as Excel charts that will be sent in a separate file along with the text. Bitmap or picture files of graphs or tables will not be accepted. The use of photographs must be discussed directly with the editor for final submission format. Line drawings should be sent in a separate file, must be scanned black and white, and each image should be accompanied by legend and reference. Scanned photographs with larger memory size (> 1 MB) should be sent as individual attachments. Images resolution should be 250 dpi for black / white images and 300 dpi for colour images at the printed image size. Adobe Illustrator, CorelDraw or PowerPoint can be used to submit drawings. Footnotes Where the utilisation of footnotes is essential, they should be indicated by asterisks (*), daggers (†) and double daggers (‡) in that order. However, footnotes must be avoided wherever possible. Footnotes must be located at the bottom of the page on which it is referred to and separated from the main text by a horizontal line above the footnote. Footnotes to table must be placed underneath the table to which they refer.


Revising your articles When submitting a revised version of your paper in response to the referee’s comments, you should accompany it with detailed changes made suitable for transmission to the referee. Where changes have been in response to the referee’s remarks, it is important to mention this and indicate where they can be found. It is strongly requested to send in a second copy of your paper with the changes marked or underlined. Recommendations The referee’s comments must be taken into consideration. Please make sure that you send the revised copy of your paper and not simply the original version again. By complying with the following guidelines, you will be assisting the FPC’s editors and reviewers who give their time to review manuscripts. If you carefully prepare your manuscript, this is a tremendous help given to the editors of FPC that save their time and enhance the publication process. Appeal of decision The editors of Family Poultry Communications (FPC) will welcome the appeal of decision made by authors who would like to do so. This should be done by e-mail with a detailed explanation for the purpose of appealing decision of the editors. Proofs The senior author will be provided with page proofs and will be responsible to contact the possible co-authors in checking the proofs. Typesetting errors only may be corrected at this level while additional matter and alterations may be accepted only at the indulgence of the Editors. Therefore, it is the responsibility of the author(s) to ensure the correct submission format required. Within 07 days of receipt, proofs must be corrected and returned. Submission of papers Papers must be submitted in one of the three INFPD working languages (English, French and Spanish) with abstract translated into the other two languages by e-mail to the Editors of Family Poultry Communications, Dr. Jean-Claude Fotsa and/or Pr. Oluwasola Johnson Agbede. Back volumes Back issues of Family Poultry Communications are available at the following link: www.fao.org/ag/againfo/themes/en/infpd/newsletters.html

Editor-in-Chief: Dr. Jean-Claude Fotsa, Mankon Polyvalent Research Station, Institute of Agricultural Research for

Development (IRAD), P. O. Box: 125, Bamenda, Republic of Cameroon E-mail: <[email protected]>

Deputy Editor-in-Chief: Pr. Oluwasola Johnson Agbede, Department of Animal Production and Health, Federal University of Technology, P.M.B. 704, Akure, Nigeria E-mail: <[email protected]>

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Recommandations aux auteurs Les instructions de mise en forme doivent être suivies attentivement. Les auteurs ont la responsabilité d’assurer la mise en forme correcte avant la soumission des articles. Les articles non conformes aux instructions seront retournés. Contenu Le Journal Communications en Aviculture Familiale (CAF) publie des articles originaux ainsi que ceux de synthèse sur tous les aspects de la science de l’aviculture familiale. Le bulletin publie aussi des rapports sur le développement de la production en aviculture familiale à travers le monde entier, des rapports de conférences, séminaires, symposia, ateliers, des rapports de groupes de travaux scientifiques constitués, ainsi que des manuels de synthèse, des nouvelles, des notes d’informations provenant des associations, en même temps qu’une liste des événements futurs concernant le RIDAF (Réseau International pour le développement de l’Aviculture Familiale) et autres organisations pertinentes. Un article


original soumis pour publication doit se porter sur les activités de recherche et de développement. Il doit comporter les grandes sections suivantes: Introduction, matériels et méthodes, résultats, discussion et conclusion. Un article de synthèse doit être exhaustif dans le domaine défini par le titre, la structure doit être logique et les citations doivent être sujettes à des révisions critiques, tout comme la méthodologie et l’analyse statistique des résultats. En préparant un article de synthèse, des déductions et des démarches constructives doivent être employées afin d’aboutir à des conclusions valides, utiles et clairement présentées. Il est encouragé d’utiliser des figures, tableaux, formules et illustrations appropriés. L’objectif est toujours d’apporter une contribution appréciable à la littérature déjà disponible. Préparation du manuscrit Les articles soumis, qui seront sujets à une évaluation minutieuse par des évaluateurs spécialisés indépendants ainsi qu’une révision de l’équipe éditoriale ne doivent normalement pas dépasser l’équivalent de 8-10 pages du bulletin (ou approximativement 6000 mots), y compris les tableaux, les illustrations, et les références bibliographiques. Des articles plus longs peuvent être acceptés mais il est préférable de contacter l’éditeur avant leur soumission. Les articles doivent être présentés sous le logiciel Word, avec une feuille de dimension A4, en utilisant la police Times New Roman de traille 12, l’interligne doit être double, les marges à 2,5 cm et avec une numérotation consécutive des lignes (en continue au delà des pages), le long de la marge gauche. Les pages doivent être numérotées à droite et en haut. La première page des manuscrits doit contenir les informations ci-après: Titre : Doit être directement lié au thème de l’article Nom(s) et adresse(s) postale(s) de(s) auteur(s) Adresse électronique de l’auteur pour correspondance. Le résumé doit comporter 100-300 mots et sera traduit dans les deux autres langues officielles (Anglais, Français et/ou Espagnol) Mots clés: Jusqu’à 8 mots. Utilisation des italiques Les expressions latines telles que in vivo, et al. doivent être écrites en italique. Les noms d’espèces ne doivent être en italique que si le nom entier est utilisé (p.ex. Chlamydia psittaci) ou bien si accompagné du suffixe “spp” (Gossypium spp.) lorsqu’il fait référence à des espèces indéfinies ou multiples. La première partie du nom d’espèce doit être en majuscule, et la seconde en minuscule, sans exception (p.ex. Eimeria tenella, Trichomonas gallinarum). Toutes références à des noms de familles pour les bactéries, les animaux ou les végétaux doivent apparaître sous une forme identique au texte régulier (p.ex. “les poules appartiennent à la famille des phasianidaes”) Important Prévoir un paragraphe d’au plus 150 mots expliquant aux non spécialistes du RIDAF l’importance de vos résultats trouvés. Ces points seront publiés sous le sous-titre ‘Impact’ à la fin de l’article. Références bibliographiques Les auteurs prendront les précautions lors de la citation des références, en particulier pour ce qui concerne la mise en forme (gras, italique, etc.) et en donnant le nom entier de la publication qui ne doit pas être abrégée (écrivez les noms des journaux en entier, pas d’abréviation!). Les références bibliographiques listées ne comprendront que celles citées dans le corps du texte. Les références concernant les travaux antérieurs doivent tenir compte de celles qui sont en relation avec le thème de l’article. Elles doivent être citées dans le texte par le nom de l’auteur suivi de l’année de publication entre parenthèses, p.ex. “Guèye (1998) a trouvé que… ” ou “Sonaiya et Agbede (2002) ont confirmé les récentes conclusions de Fotsa et al. (2012) montrant...” Dans la liste des références, les différents travaux doivent être classés par ordre alphabétique du nom de famille du premier auteur, tous les auteurs devant être cités. Le nom du journal doit être écrit en entier, y compris les numéros de la première et de la dernière page de l’article concerné:


GUÈYE, E.F. (2009) Titre de l’article. Nom du journal Vol. Nr : numéros des pages (voir l’exemple ci-dessous). Exemples GUÈYE, E.F. (2009) The role of networks in information dissemination to family poultry farmers. World’s Poultry

Science Journal 65: 115-124. AGBEDE, J.O., KLUTH, H. and RODEHUTSCORD, M. (2009) Studies on the effects of microbial phytase on




BONKOUNGOU, G.F.X. (2002) L’amélioration de l’élevage traditionnel de la volaille locale en zone Sahélienne du Burkina Faso. Proceedings of the 10th International Conference of AITVM, Copenhagen, Denmark, pp. 207-217.

FAO (2004) Economie de la production. Dans: Production en Aviculture Familiale (Sonaiya, E.B. & Swan, S.E.J., Eds.). Production et Santé Animale, Rome, Italie, pp. 82-82.

HODGETTS, B. (1981) Dealing with dirty hatching eggs. MAFF Information for Flock Farms and Hatcheries: Hatch Handout No.17.

CAMACHO, E.M., LIRA T.I., RAMÍREZ, C., LÓPEZ, P.R. y ARCOS, G. J (2006) La avicultura de traspatio en la costa de Oaxaca, México. Ciencia y Mar 28: 3 – 11.

BOUSSINI, H. (1995) Contribution à l’étude des facteurs de mortalité des pintadeaux au Burkina Faso. Thèse de Médecine Vétérinaire, EISMV, Dakar, Sénégal.

Le(s) auteur(s) est(sont) pleinement responsable(s) de la véracité et la correcte citation des références bibliographiques. Les éditeurs n’endossent aucune responsabilité sur les citations bibliographiques inexactes. Tableaux, dessins et photos Les titres des figures et tableaux doivent être brefs avec assez d’informations les rendant compréhensibles en dehors du texte. Les tableaux peuvent être insérés dans le texte. Les tableaux plus larges peuvent être placés séparément à la fin du document sur de nouvelles pages et leur emplacement approximatif sera indiqué dans le texte. Tous les tableaux doivent suivre la fonction spécifique de création de “tableau” du logiciel Word. En outre, les tabs et les espacements ne doivent pas être utilisés. Les espaces des tableaux doivent être appropriés, et les titres des colonnes aussi brefs que possible, avec une légende explicative, si nécessaire. Les signifiances statistiques entre les moyennes à l’intérieur des colonnes ou des lignes doivent être indiquées par des lettres en exposant, et accompagnées par une note explicative standard au bas du tableau ou de la figure concerné(e), p.ex. “Les moyennes ayant des lettres différentes en exposant sur la même ligne (ou colonne) sont significativement différentes à P < 0.05”. Les graphiques doivent être crées sous forme de diagramme Excel, et devront être envoyés sous fichier séparé, au moment de la soumission du texte. Les fichiers de graphiques et tableaux photographies ne seront pas acceptés. En cas d’utilisation d’images photos, discuter directement avec l’éditeur sur le format final à envoyé. Les dessins en ligne doivent être envoyés sous fichier séparé, et doivent être scannés en noir et blanc, et chaque image doit être accompagnée d’une légende et d’une référence. Les photos scannées dont la mémoire est supérieure à 1MB doivent être envoyées sous forme de fichiers attachés séparés. La résolution des images doit être de 250 dpi pour les images en noir et blanc et de 300 dpi pour les images en couleur à l’impression de l’image. Adobe Illustrator, CorelDraw ou PowerPoint peuvent être utilisés pour la soumission des dessins. Notes de bas de page Les notes de bas de page, en cas de nécessité, doivent être indiquées dans le texte par des astérisques (*), des croix (†) et des doubles croix (‡), dans cet ordre. Néanmoins, l’utilisation des notes de bas de page doit être évitée, à chaque fois que c’est possible. Dans le manuscrit, une note de bas de page doit être placée au bas de la même page où elle est indiquée, et doit être séparée du reste du texte par une ligne horizontale. Les notes de pieds de page relatives à un tableau doivent être placées immédiatement sous le tableau concerné.


Révision des articles Lors de la soumission d'une version révisée de votre manuscrit en réponse aux observations de relecteurs, vous voudriez bien l'accompagner des corrections détaillées apportées pour être transmises aux relecteurs. Si des changements ont été en réponse aux remarques du relecteur, il est important de le mentionner et indiquer où les retrouver. Il est fortement recommandé d’envoyer une deuxième version de votre manuscrit portant les modifications marquées ou soulignées. Recommandations Les commentaires du relecteur doivent être pris en considération. Veuillez, s'il vous plaît, vous assurer que la copie révisée de votre manuscrit a été envoyée et pas simplement l’envoi à nouveau de la version originale. En vous conformant aux instructions aux auteurs, vous aiderez les Editeurs et relecteurs de CAF qui donnent de leur temps pour éditer les manuscrits. Si vous préparer soigneusement votre manuscrit conformément à ces recommandations, vous aurez aidé les Editeurs des CAF à économiser de leur temps pour se consacrer à l’amélioration du processus de publication de vos articles. Appel de la décision Les éditeurs de Communications en Aviculture familiale (CAF) admettront l'appel aux décisions par ceux des auteurs qui le souhaiteraient. Dans ce cas, vous voudrez bien le faire par courrier électronique muni des explications détaillées des raisons pour lesquelles vous faites appel aux décisions des éditeurs. Epreuves Les observations et corrections sur le manuscrit seront renvoyées à l’auteur principal qui aura la responsabilité de les partager avec les éventuels co-auteurs de l’article pour leur prise en compte. À ce stade, seules les petites erreurs de frappe pourront être corrigées. Des changements majeurs sur le document pourront être acceptés sur indulgence de l’éditeur. Par conséquent, le(s) auteur(s) doi(ven)t s’assurer d’envoyer la version finale de l’article, mis en forme selon le format requis. Le manuscrit doit être corrigé et envoyé dans les 7 jours suivant la réception des observations et corrections. Soumission des articles Les manuscrits doivent être soumis dans l’une des trois langues de travail du RIDAF (Anglais, Français et Espagnol), par email, aux éditeurs de Communications en Aviculture Familiale, Dr. Jean-Claude Fotsa et/ou Pr. Oluwasola Johnson Agbede. Anciens numéros Les anciens volumes de Communications en Aviculture Familiale sont disponibles sur le site: www.fao.org/ag/againfo/themes/en/infpd/newsletters.html

Éditeur-en-Chef: Dr. Jean-Claude Fotsa, Station Polyvalente de Recherches de Mankon, Institut de Recherche

Agricole pour le Développement (IRAD), B.P. 125, Bamenda, Cameroun E-mail: <[email protected]>

Éditeur-en-Chef Adjoint: Pr. Oluwasola Johnson Agbede, Dept. of Animal Production and Health, Federal University of Technology, P.M.B. 704, Akure, Nigeria E-mail: <[email protected]>

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~


Instrucciones para autores Las siguientes instrucciones de formato deben seguirse con mucha precaución. Los autores son responsables y deben asegurarse de que el formato sea el correcto antes de enviar sus trabajos. Los manuscritos que no llenen los requerimientos no serán considerados. Contenido Comunicaciones de Avicultura Familiar publica revisiones, trabajos originales de todos los aspectos de la ciencia avícola familiar, reportes sobre el desarrollo de la producción avícola familiar de todas partes del mundo, reportes de conferencias, seminarios, simposios y equipos de trabajo científico conocidos, al igual que revisiones de libros, noticias y un listado de próximos eventos de la Red Internacional para el Desarrollo de la Avicultura Familiar (INFPD- International Network for Family Poultry Development) y otras organizaciones relevantes. Los trabajos originales deben basarse en investigaciones relevantes y actividades de desarrollo. Debe por lo menos tener las siguientes secciones: Introducción, materiales y métodos, resultados, discusión y conclusiones. Un artículo de revisión debe ser integral en el ámbito definido por su título, la estructura debe ser lógica y las citas sujetas a evaluación crítica al igual que la metodología y el análisis estadístico de los resultados. En la preparación de un documento de revisión, el toque deductivo y procesos constructivos deben ser utilizados para producir conclusiones válidas, útiles y puedan ser presentadas con claridad. Se alienta a utilizar las figuras apropiadas, tablas, fórmulas e ilustraciones. El objetivo siempre debe ser producir una adición valiosa para el cuerpo de la literatura disponible. Preparación del manuscrito Trabajos enviados, los cuales serán sujetos a escrutinio por árbitros independientes y revisión editorial, normalmente no deben exceder 8-10 páginas (o aproximadamente 6000 palabras) incluyendo tablas, ilustraciones y referencias. Trabajos más extensos pueden ser aceptados pero se sugiere a los autores contactar al editor antes de enviar los trabajos. Los trabajos deben ser en formato Word, en un diseño A4, usando letra Times New Roman 12, doble espacio, márgenes de 2.5 cm y con número de línea consecutivo (continuo sobre páginas) de lado del margen izquierdo. Las páginas deben ser numeradas en la esquina superior derecha. La primera página del manuscrito debe tener las siguientes características: Titulo: d irectamente relacionado con el tema del trabajo Nombre(s) y dirección(es) postal de los autor(es) Correo electrónico del autor correspondiente Resumen: debe ser de 100-300 palabras y traducido a las otras dos lenguas oficiales (Inglés, Francés y/o Español). Palabras clave: hasta 8 palabras Uso de itálicas Frases en Latin, por ejemplo, in vivo, et al. deben estar en itálicas. Nombres de Especie deben ser en itálicas solo si se utiliza el nombre completo (p.e. Chlamydia psittaci) o si se utiliza el sufijo por ¨spp¨(Gossympium spp.) cuando se refiere a múltiples o especies indefinidas. La primera parte del nombre de la especie debe ser con letra mayúscula, y la segunda en minúscula, sin excepción (p.e. Eimeria tenella, Trichomonas gallinarum). Todas las referencias a nombres de la familia de origen animal, bacteriana o planta deben tener el formato de texto normal (por ejemplo, "los pollos pertenecen a la familia de phasianidae"). Nota: Proporciona un párrafo de no mas de 150 palabras explicando a la INFPD que no son especialistas, la importancia de los hallazgos de tu investigación. Estos puntos serán publicados al final del artículo en la sub-sección ¨Impacto¨ Referencias Los autores deben tener cuidado cuando citan las referencias, especialmente con respecto al formato (negritas, itálicas, etc.) y anotar el nombre completo de la publicación que no debe ser abreviado (anotar el titulo completo de la revista, no abreviaciones!). Se deben de incluir solo las referencias citadas en el cuerpo del texto. La referencia a trabajos anteriores sólo podrán referirse a las relacionadas con el tema del artículo y deben ser citadas en el texto con el nombre del autor y el año de publicación entre paréntesis, p.e. ¨Gueye (1998) encontró que…¨ o como ¨Sonaiya y Agbede (2002) confirmaron la reciente conclusión de Fotsa et al. (2012) mostrando…¨ En la lista de referencias, las referencias deben estar ordenadas por orden alfabético de los apellidos del primer autor


con todos los autores citados. El nombre completo de las revistas debe ser escrito con los números de página inicial y final de los documentos de que se trate: GUEYE, E.F. (2009) Titulo del trabajo. Titulo de la revista Vol. (Nr) : número de páginas (ver ejemplos abajo) Ejemplos GUÈYE, E.F. (2009) The role of networks in information dissemination to family poultry farmers. World’s Poultry

Science Journal 65 (1): 115-124. AGBEDE, J.O., KLUTH, H. and RODEHUTSCORD, M. (2009) Studies on the effects of microbial phytase on




ACAMOVIC, T., SINURAT, A., NATARAJAN, A., ANITHA, K., CHANDRASEKARAN, D., SHINDEY, D., SPARKS, N., ODUGUWA, O., MUPETA, B. and KITALYI, A. (2005) Poultry. In: Livestock and Wealth Creation: Improving the Husbandry of Animals Kept by Resource-poor People in Developing country (Owen, E., Kitalyi, A., Jayasuriya, N. & Smith, T., Eds.). Nottingham University Press, England, pp: 301-324.

CAMACHO, E.M., LIRA T.I., RAMÍREZ, C, LÓPEZ, P.R. y ARCOS, G. J. (2006) La avicultura de traspatio en la costa de Oaxaca, México. Ciencia y Mar 28: 3 – 11.

DESSIE, T. (1996) Studies on village poultry production systems in the Central Highlands of Ethiopia. MSc Thesis, Swedish University of Agricultural Science, Uppsala, Sweden.

El autor / s es / son totalmente responsables de garantizar la exactitud y la correcta citación de las referencias. Los editores del FPC no pueden asumir ninguna responsabilidad por las citas incorrectas. Tablas, dibujos lineales y fotografías Los títulos de las figuras y tablas deben ser breves con información suficiente para que se entienda muy lejos del texto. Las tablas pueden aparecer dentro del texto. Tablas más grandes se pueden poner en páginas separadas al final del artículo, mientras que su ubicación aproximada se indica en el texto. Todas las tablas deben seguir la función de creación específica "tabla" de software en Word, y, las tabulaciones y espacios no deben ser utilizados. El espaciamiento de las tablas debe ser adecuado, y los encabezados de columna lo más breve posible, con una leyenda fácil de entender, si es necesario. Significancias estadísticas entre las medias de las columnas o filas deben indicarse por letras en superíndice y acompañado de una declaración estándar por debajo de la tabla o figura, por ejemplo, "Medias con diferentes superíndices en la misma fila (o columna) son significativamente diferentes a P <0.05." Figuras gráficas deben ser creadas como gráficos de Excel que se pueden enviar en un archivo separado junto con el texto. Archivos de Bitmap o imágenes de gráficos o tablas no serán aceptados. El uso de fotografías debe ser discutido directamente con el editor para el formato de presentación final. Los dibujos deben ser enviados en un archivo separado, deben ser escaneados en blanco y negro, y cada imagen debe ir acompañada de la leyenda y la referencia. Fotografías escaneadas con un tamaño de memoria más grande (> 1 MB) deberán enviarse como archivos adjuntos individuales. La resolución de las imágenes debe ser de 250 dpi para imágenes en blanco y negro y 300 dpi para imágenes a color del tamaño de la imagen impresa. Adobe Illustrator, CorelDraw o PowerPoint pueden ser utilizados para enviar los dibujos. Pie de página Cuando la utilización de las notas es esencial, deben ser indicadas por un asterisco (*), dagas (†) y dagas dobles (‡) en ese orden. Sin embargo, las notas deben evitarse siempre que sea posible. Notas al pie deben estar situadas en la parte inferior de la página en la que se hace referencia y separadas del texto principal por una línea horizontal por encima de la nota. Notas al pie de la tabla deben ser colocadas debajo de la tabla a la que se refieren. Revisión de sus artículos Al presentar una versión revisada de su trabajo en respuesta a los comentarios del árbitro, deberá ser acompañado con las modificaciones detalladas realizadas para su transmisión al árbitro. Cuando los cambios han sido en respuesta a las declaraciones del árbitro, es importante mencionar esto e indicar dónde se pueden encontrar. Se ruega encarecidamente enviar una segunda copia de su documento con los cambios marcados o subrayados.


Recomendaciones Los comentarios del árbitro deben ser tomados en consideración. Por favor, asegúrese de enviar la copia revisada de su papel y no simplemente la versión original de nuevo. Al cumplir con las siguientes pautas, usted estará ayudando a los editores de la FPC y críticos que toman su tiempo para revisar los manuscritos. Si prepara cuidadosamente su manuscrito, es una gran ayuda que le da a los editores de la FPC y que les permite ahorrar tiempo y mejorar el proceso de publicación. Apelación de la decisión Los editores de Family Poultry Communications (FPC) dan la bienvenida a las apelaciones acerca de la decisión hecha por los autores que deseen hacerlo. Esto se debe hacer por correo electrónico con una explicación detallada del propósito por el cual se esta apelando la decisión de los editores. Pruebas El autor principal contará con pruebas de imprenta y será responsable de contactar a los posibles coautores en la verificación de las pruebas. Errores de composición tipográfica sólo podrán ser corregidos en este nivel mientras que la materia adicional y modificaciones sólo podrán ser aceptados con la indulgencia de los editores. Por lo tanto, es responsabilidad del autor(s) asegurar el formato correcto de presentación requerido. Dentro de 07 días de recepción, las pruebas deben ser corregidas y devueltas. Presentación (envío) de trabajos Los trabajos deben ser enviados en uno de los tres idiomas de trabajo de la INFPD (Inglés, Francés y Español) con los resúmenes traducidos a los otros dos idiomas por correo electrónico a los Editores de Family Poultry Communications, Dr. Jean-Claude Fotsa y/o Pr. Oluwasola Johnson Agbede. Volúmenes anteriores Las ediciones anteriores de Family Poultry Communications están disponibles en el siguiente link: www.fao.org/ag/againfo/themes/en/infpd/newsletters.html

Editor-en-Jefe: Dr. Jean-Claude Fotsa, Mankon Polyvalent Research Station, Institute of Agricultural Research for

Development (IRAD), P. O. Box: 125, Bamenda, Republic of Cameroon Correo electronico: <[email protected]>

Suplente Editor-en-Jefe: Pr. Oluwasola Johnson Agbede, Department of Animal Production and Health, Federal University of Technology, P.M.B. 704, Akure, Nigeria Correo electronico: <[email protected]>

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Documents

FFFFAMILY POULTRY COMMUNICATIONS · México, E-mail: Coordinator, INFPD | Coordonnateur du RIDAF | Coordinador del RIDAF Dr. E. Fallou Guèye, Livestock