THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1992 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 267, No. 2, Issue of January 15, pp. 1123-1128,1992 Printed in U.S.A.

Extensive Editing of Both Processed and Preprocessed Maxicircle CR6 Transcripts in Trypanosoma brucei”

(Received for publication, July 25, 1991)

Laurie K. Read$, Peter J. Myler, and Kenneth Stuart4 From the Seattle Biomedical Research Institute, Seattle, Washington 98109-1651

Transcripts from several genes encoded in the Try- panosoma brucei maxicircle genome are altered by posttranscriptional uridine insertion and deletion through a process called RNA editing. We find that transcripts from the CR6 gene are extensively edited by addition of 132 uridines and deletion of 28 uridines to produce a fully edited mRNA 47% larger than un- edited mRNA. Two open reading frames (ORFs) and their initiation and termination codons are created by editing of CR6 mRNA. Both ORFs specify small, hy- drophobic proteins with no homology to proteins in three databases. Both unedited and edited CR6 tran- scripts are more abundant in bloodstream form than in procyclic form parasites. cDNA clones spanning both CR6 and the downstream NADH dehydrogenase sub- unit 6 (ND5) gene were isolated, indicating that mature CR6 and ND6 transcripts arise from a common pre- cursor. Sequencing of these cDNAs revealed 37 nucle- otides of overlap between the 3’ end of CR6 and the 6’ end of ND6. In addition, the CR6 portion of many of these molecules was extensively edited, indicating that RNA editing can precede precursor processing. These results provide the first clear demonstration of poly- cistronic transcription of maxicircle genes, and suggest new mechanisms by which both RNA editing and pre- cursor processing may regulate maxicircle gene expression.

The mitochondrial DNA of kinetoplastids (kDNA)’ is or- ganized into an unusual catenated network containing two unrelated types of circular DNA. Each network consists of 20-50 identical maxicircles which encode mitochondrial rRNAs and components of the respiratory system, and thou- sands of heterogeneous minicircles which encode guide RNAs (gRNAs). Many transcripts from maxicircle genes are post- transcriptionally modified by specific uridine addition and deletion through a process called RNA editing (1-3). Editing

* This work was supported in part by National Institutes of Health Grant AI14102. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ Supported by National Institutes of Health Postdoctoral Fellow- ship 1 F32 AI08491-01.

I A Burroughs Wellcome Scholar in Molecular Parasitology. To whom correspondence should be addressed Seattle Biomedical Re- search Institute, 4 Nickerson St., Seattle, WA 98109-1651. Tel.: 206- 284-8846; Fax: 206-284-0313.

The abbreviations used kDNA, kinetoplast DNA; gRNA, guide RNA, ORF, open reading frame; ND5, NADH dehydrogenase subunit 5; BF, bloodstream form; PF, procyclic form; PCR, polymerase chain reaction; MOPS, 3-(N-morpholino)propanesulphononic acid; DK, dyskinetoplastic mutants; SDS, sodium dodecyl sulfate; kb, kilobases.

can be quite extensive, producing more than 50% of the protein coding sequence of some mRNAs (4-6). In addition, editing frequently creates initiation (5-8) and termination (4-6) codons in transcripts lacking them and eliminates in- ternal frameshifts (7, 9), producing potentially translatable mRNAs. Thus, editing appears to regulate gene expression at the RNA level.

Regions of the mitochondrial genome encoding extensively edited transcripts can be predicted based on their pronounced G uersus C strand bias (3). Six small G uersus C biased regions of the genome from which RNA is transcribed were previously identified and named CR1-6 (10). The CR1 transcript (now called ND8) has recently been shown to be extensively edited and to encode a putative iron-sulfur protein thought to be a component of respiratory complex 1.’ CR2,4, and 5 mRNAs are also highly edited, although the fully edited sequences have not been determined for all of these transcript^.^. ‘ In this report, we present the fully edited sequence of the CR6 mRNA. Extensive editing of the CR6 transcript produces initiation and termination codons and two open reading frames (ORFs), both of which predict small, hydrophobic proteins. Fully edited CR6 transcripts are more abundant in bloodstream form (BF) Trypanosomu brucei which lacks a complete oxidative phosphorylation system than in procyclic forms (PFs) which do possess a complete oxidative phos- phorylation system. In addition, extensive editing of CR6 mRNA is observed in transcripts spanning both the CR6 and downstream NADH dehydrogenase subunit 5 (ND5) genes. This provides the first evidence for polycistronic transcription of maxicircle genes, and indicates that editing can precede mRNA precursor processing and polyadenylation.

MATERIALS AND METHODS

Cell Culture, Mitochondriul Isolation, and RNA Extraction-T. brucei brucei clone IsTaR 1 from stock EATRO 164 and Leishmania tarentohe promasitgotes (UC strain) were grown as previously de- scribed (11, 12). Mitochondria were isolated from 0.5-2.0 X 10” cells by the method of Harris et al. (13) and stored frozen at -70 “C until RNA extraction. RNA was isolated from either total cells or mito- chondria by the acid guanidinium-phenol-chloroform method (14).

Oligonucleotide Probes and Primers-The following oligonucleo- tides were used in this study and their location and orientation relative to CR6 sequence are shown in Fig. 1. Restriction sites incorporated at their 5’ ends are underlined. Oligonucleotides TbCR6-1 and TbCR6-6 are the same sense as the mRNA, while

Souza, A. E., Myler, P. M., and Stuart, K. (1992) Mol. Cell. Biol.,

L. K. Read and K. Stuart, unpublished observations. in press.

‘A. E. Souza, R. A. Corell, and K. Stuart, unpublished observa- tions.

1123

1124

50 40 30 20 10

aTbCR6-5 I1 I I I I I I I I I I I I I I I I IIII I I I I I I I I I I I I I f I I I l l 1 ) I 1 I I I I I I I I I I

U C A U U * U U U * U U * U L G A * * . G G G U G G u G G ~ ~ - G ~ ~ G A u u ~ C C C ~ g ~ G * ~ ~ * ~ ~ ~ * ~ ~ u U * U * C A * C G * k U A u f f i U * ~ u ~ G A + U U U A G A ~ [ ~ ] ' FIG. 1. T. brucei CR6 consensus edited mRNA sequence, potential gRNA sequences, and location of

oligonucleotides. Potential editing sites (i.e. sites between non-U residues) are numbered proceeding 3' to 5' starting at the furthest 3' non-U, non-A residue. Upper case letters, bases present in the DNA sequence; u, uridines added; and asterisks, encoded uridines deleted by editing. Sequences at the 3' and 5' termini which are unedited in the consensus sequence are shaded. 5' and 3' nucleotides present in a minority of cDNAs are shown in brackets. The 3' region indicated by the barred line is present in two alternate sequences (see "Results"). Sequences corresponding to oligonucleotides the same sense as (b) or complementary to (4) RNA are underlined. Potential gRNA sequences are shown 3' to 5' below the mRNA beginning with an RYAYA sequence (underlined; see text); Watson-Crick base pairs (I), G:U base pairs (:), and mismatches between mRNA and gRNAs (-) are shown.

TbCR6-2, TbCR6-4, TbCR6-5, and TbND5-1 are complementary to mRNA.

TbCR6-1 (5"unedited)

TbCR6-2 (middle-edited)

TbCR6-4 (5"edited)

TbCR6-5 (3"edited)

TbCR6-5 (5"edited)

TbND5-1 (5"never edited)

KS

ZR

XSC-dT,,

B-dGm

CGGGAAACTAAAGTAAAAACGCG

CGGGAAAAAAAACAACGCAACAACATCCAAAC

CGGGAAATAAAACAAAACGTAAACAACAAC

CTCTTCTAAACGATGTTTCTTTAACC

GTTGTGTITACGTTTTGTTTTATTTG

CCTACCAAACATAAATGAACCTGATATAAACCC

CGAGGTCGACGGTATCG

CGGTGGCGGCCGCTCTA

GACTCGAGTCGACATCGATmTTTTTTTTTITTT

CC"

PCR Amplification and cDNA Cloning-cDNAs were produced, am- plified by the polymerase chain reaction (PCR; 15), and cloned by previously described strategies (5 , 6). Briefly, 20 pg of total PF RNA was C-tailed using poly(A) polymerase as previously described: hy- bridized with 100 ng of B-dGlo, and first-strand cDNA was synthe- sized using Moloney murine leukemia virus reverse transcriptase (Superscript; Bethesda Research Laboratories) according to manu-

30 cycles of PCR carried out with 300 nM each of B-dGlo and TbCR6- facturer's instructions. 10-25% of this product was then amplified by

1 in a Perkin-Elmer Thermocycler using AmpliTaq DNA polymerase (Perkin-Elmer/Cetus) according to the manufacturer's instructions. Each cycle used denaturation at 94 "C for 1 min, annealing at 45 "C (first four cycles) or 50 "C (following 26 cycles) for 0.5 min, and extension at 72 "C for 1 min. In subsequent experiments, cDNA was synthesized from 1 pg of PF mitochondrial RNA using XSC-dT17, and the first-strand dC-tailed using terminal deoxynucleotidyl trans- ferase according to the manufacturer's instructions (BRL). This cDNA was PCR-amplified using either TbCR6-2 or TbCR6-4 and B- dG,,. For CR6/ND5 transcripts, XSC-dT1,-primed cDNA from BF or PF total RNA was PCR-amplified with TbCR6-6 or TbCR6-1 and TbND5-1 using 30 cycles with 45 "C annealing. CR6/ND5 products were then filled in and kinased, and BamHI linkers (BRL) added as described previously (16). PCR products were digested with appro- priate restriction enzymes, size-selected on 1.5% agarose gels, trans- ferred to NA45 paper (Schleicher and Schuell), eluted by two 2-min incubations in 1 M NaC1; 0.1 mM EDTA; 20 mM Tris-HC1, pH 8.0, a t

' G. J. Bhat, A. E. Souza, J. E. Feagin, and K. Stuart, submitted for publication.

room temperature, and ligated into pBluescript I1 SK-. The ligation mixture was used to transform Escherichia coli DH5a F'IQ competent cells (Life Technologies, Inc.). Recombinants were identified by col- ony PCR with the vector-specific primers, KS and ZR, and sequenced by the dideoxy chain termination method using Sequenase (United States Biochemical) according to manufacturer's instructions. The resulting sequences were analyzed using DNASTAR (Madison, WI) and ESEE (E. Cabot, University of Rochester).

Gel Electrophoresis, Hybridization, and RNase H Digestion-10 pg of total or 2 pg of poly(A)+ RNA per lane was electrophoresed in 1.5% agarose gels containing 0.66 M formaldehyde and 20 mM MOPS, pH 7.0 (17). Oligo(dT)-directed RNase H cleavage of RNA was performed as described? RNA was transferred to Nytran (S&S) by capillary transfer. Probes were synthesized by PCR using a plasmid containing a maxicircle fragment spanning the CR6 gene (pTKHR38 18) as template and TbCR6-1 and TbCR6-5 primers (unedited probe), or recombinant plasmid from a highly edited clone as template and TbCR6-6 and TbCR6-2 primers (edited probe). Reactions were as described above except that 40 cycles were performed, dATP was reduced to 1 p ~ , and 50 pCi of [a-32P]dATP (Du Pont-New England Nuclear NEG-012a; 800 Ci/mmol) was included. Filters were prehy- bridized in 5 X SSPE (1 X SSPE = 90 mM NaCl; 10 mM NaH2P04; 1 mM EDTA); 1% SDS; 150 pg/ml herring sperm DNA; 10 X Den- hardt's solution at 65 "C for at least 5 h, hybridized at 65 "C overnight in 5 X SSPE; 1% SDS, and washed five times (5 min each) in 6 X SSPE, 1% SDS at room temperature and once for 3 min at 65 "C in 1 X SSPE, 1% SDS.

RESULTS

Editing of the CR6 Transcript-We are able to isolate cDNA clones which are unedited in their 5' ends and edited to varying degrees in their 3' ends due to the general 3' to 5' progression of editing (19). To obtain CR6 clones of this class, cDNA was synthesized by B-dGlo priming of C-tailed total PF RNA, and PCR amplified using B-dGlo and an unedited 5' primer (TbCR6-1). Of 14 clones sequenced which were generated using this strategy, all were partially edited; none of the clones corresponded to completely unedited CR6 se- quence. Based on the consensus 3"edited sequence of these clones, another oligonucleotide probe was prepared and used to isolate additional clones which were edited further 5' using anchor PCR of dC-tailed cDNA. A third probe was then prepared to isolate clones edited at their extreme 5' ends. The fully edited CR6 sequence was determined from the consensus sequence of a total of 39 cDNA clones.

Editing of a Preprocessed mRNA 1125

The nucleotide sequence of the fully edited CR6 transcript is 325 nucleotides long (considering the most prevalent 5' and 3' ends; see below), and differs from the genomic sequence only in addition or deletion of uridines (Fig. 1). 132 uridines are added at 63 sites, and 28 uridines are removed from 14 sites by RNA editing, resulting in a transcript 47% larger than the corresponding DNA sequence. Editing of the CR6 transcript creates two continuous ORFs of 82 and 51 amino acids (Fig. 2A). The smaller ORF is totally encompassed by the larger, but in a different reading frame. Both ORFs are bounded by AUG initiation codons and UAG termination codons which are created by editing.

Some sequence microheterogeneity was observed at the 5' end of the CR6 transcript (Fig. 1). Of 25 clones in which the 5' end was determined, 19 began with the sequence CUAAUA. Three clones began further 3' (two at UAAUA; one at AUA) and three began further 5' (two at UCCUAAUA; one at AUCCUAAUA). The polyadenylation site appears to be the 3'-most U in a run of five Us (Fig. 1). Determination of the polyadenylation sites of many edited mRNAs is ambiguous due to their occurrence in Am-rich regions and to the pres- ence of Us in the poly(A) tail of many of these transcripts (6).* Indeed, 8 of 13 CR6 clones in which the 3' end of the transcript was determined contained Us in various positions within the poly(A) tail. However, 10 of the 13 clones match the DNA sequence downstream of the 3'-most editing site only through the run of five Us, suggesting that these Us are

+2.42

" P

-2.42 10 20 30 40 50 60 70 80

Amino acids

C

+3.1S /

- 10 20 30 40 50

Amino acids

FIG. 2. Deduced protein sequences from the two edited CR6 ORFs. A , translation of reading frames 1 and 2 shown below consen- sus edited CR6 mRNA sequence. AUG initiation and UAG termina- tion codons for ORF Lare double-underlined and those for ORF 2 are single-underlined. B, hydropathy plot of the protein predicted by CR6 ORFl using the Kyte-Doolittle program (33). The potential mem- brane spanning domain is shown as a region above a value of 1.6 (dotted line). C, hydropathy plot of the protein predicted by CR6 ORF 2.

encoded. Three of the 13 clones match the DNA sequence three or four nucleotides 3' of the major apparent polyade- nylation site, but for reasons described above, it cannot be determined if these few nucleotides are encoded or added posttranscriptionally. The 3' untranslated region of three of 13 clones contained an alternate sequence, AGA***- TAGAATATAAGATATGTTTTT, to that presented in Fig. 1 (see barred region). This class of transcripts was not ex- amined by RNA sequencing, so its abundance is unknown. Alternate sequences have been previously described for the coding region of the ND7 transcript (6). Given the most common 3"untranslated region sequence and 5' and 3' ends, 32 nucleotides at the 5' end and 15 nucleotides at the 3' end of the mature CR6 transcript are unedited. Editing was ob- served in some clones slightly 5' to the 5'-most editing site of the final transcript; such transcripts may undergo re- editing to produce the mature sequence?

Two sequences which could encode gRNAs (20) comple- mentary (allowing G-U base pairing) to edited CR6 sequence were identified by a computer search of minicircle and maxi- circle sequences (Fig. 1). One such sequence (gCR6[64]) is complementary to 40 nucleotides of edited sequence near the middle of the CR6 transcript. Complementarity of this gRNA would extend to 44 nucleotides if a C-A mismatch was allowed (see below). A second potential gRNA (gCR6[100]) encoded between inverted repeats on the Tb201 minicircle (21) is complementary to edited sequence slightly upstream of the region specified by the first gRNA. The second gRNA is complementary to 42 nucleotides of edited sequence with the exception of two apparent mismatches, a C-A and a G-G base pair. However, since the Tb201 minicircle was sequenced from a different T. brucei isolate than that used in the studies presented here, it is possible that the corresponding minicircle of the EATRO 164 strain does not contain these mismatches. Both potential CR6 gRNAs contain at their 5' ends the proposed gRNA transcription initiation signal (22), 5'-

Deduced CR6 Amino Acid Sequence-The two ORFs cre- ated by editing of the CR6 mRNA specify 82 and 51 amino acid proteins with calculated molecular masses of 9737 and 6096 daltons, respectively (Fig. 2 A ) . In the case of the longer ORF, the 5' and 3' untranslated regions are 53 and 26 nucleotides, respectively. 66- and 103-nucleotide 5'- and 3'- untranslated regions, respectively, would be present if the shorter ORF were translated. Presuming that fully edited CR6 mRNA is translated, we find it likely that the 82-amino acid protein is the resulting product since 1) the long 3'- untranslated region present if the shorter reading frame were translated, although not unprecedented (5), is uncommon in T. brucei mitochondrial transcripts (6): and 2) the codon usage of the longer ORF is significantly more like that of other T. brucei mitochondrial genes3 than is that of the shorter one. However, we cannot rule out that either both reading frames or exclusively the shorter one is translated.

The hydropathic profiles of both amino acid sequences predicted by the edited CR6 sequence are presented in Fig. 2. The predicted 82 amino acid sequence (Fig. 2B) reveals a generally hydrophobic protein with one potential membrane- spanning domain between amino acids 45 and 63. The 51- amino acid protein predicted by the shorter reading frame is also highly hydrophobic, with a potential membrane-associ- ated domain at its carboxyl terminus (Fig. 2C). No homology to known proteins was detected for either ORF in searches of GenPept and SWISS-PROT databases using FASTA (23) or

Koslowsky, D. J., Bhat, G. J., Read, L. K., and Stuart, K. (1991)

RYAYA-3 '.

Cell, in press.

1126 Editing of a Preprocessed mRNA

in a search of PLSEARCH (Dana-Farber Cancer Institute and School of Public Health, Harvard University; 24).

Northern Analysis of CR6 Transcripts-Northern analysis of total and poly(A)+ T. brucei RNA reveals heterogeneous CR6 transcripts (Fig. 3). These transcripts are of mitochon- drial origin as shown by their absence in dyskinetoplastic mutants (DK) lacking mitochondrial DNA (25). A PCR- synthesized probe complementary to 179 bases of unedited CR6 sequence hybridizes in Northern blots to a smear of transcripts ranging from 230 nucleotides, approximately the size of the unedited CR6 mRNA, to 300 nucleotides (Fig. 3A). The larger transcripts presumably represent molecules which are edited in their 3', but not 5' ends. Unedited transcripts are present in both BF and PF parasites, but are slightly more abundant in BF. In addition, a 2.05-kb transcript hybridizes with the unedited probe in BF and is likely a preprocessed transcript as discussed below.

A PCR-synthesized probe complementary to 137 bases of edited CR6 sequence hybridizes to two distinct size classes of transcripts, averaging 350 and 500 nucleotides (Fig. 3, A and B ) . Again, the heterogeneous transcripts within each size class are probably partially edited molecules. The two major size classes of CR6 transcripts result from differences in the length of their poly(A) tails as demonstrated by their convergence into one band after RNase H digestion in the presence of oligo(dT) (Fig. 3B). Such differential polyadenylation is com- mon in T. brucei maxicircle transcripts: although its signifi- cance is unknown. Edited CR6 mRNA is significantly more abundant in BF than PF parasites. BF RNA also contains a 2.05-kb band which hybridizes with edited CR6 probe. Al- though the 2.05-kb band appears absent in poly(A)+ RNA, it became visible using both edited and unedited probes upon overexposure of the autoradiogram. Neither the edited nor

A Total Poly A+

E U E u 2.' kb B p B P D B P D B P

1.4

0.2'

B

RNaseH - + + Oligo dl - - +

kb B P D B P D B P D

0.50- 8 0.35- z .. a.

FIG. 3. Northern blot analysis of CR6 RNAs. A, blot showing total (10 pgllane) and poly(A)+ (2 pg/lane) 2'. brucei RNA probed with an edited ( E ) and unedited (U) CR6 PCR-synthesized probes; BF ( B ) , P F (P), and DK (D). The blot was first probed with the edited probe and then stripped and probed with the unedited probe. BRL RNA size standards are indicated on the left. The 2.05-kb precursor transcript (see "Results") is indicated by an arrowhead. The increased abundance of unedited RNA in BF is obscured in this autoradiogram because the amount of PF RNA loaded was somewhat greater than the amount of BF RNA. B, RNase H digestion of 2'. brucei BF ( B ) , PF (P), and DK (D) RNA in the presence of oligo(dT). RNA samples (10 pg each) were untreated, treated with RNase H alone, or treated with RNase H in the presence of oligo(dT) before electrophoresis on a 1.5% formaldehyde-agarose gel and blotting as indicated. The blot was probed with the same edited probe shown in A. The two size classes of CR6 RNA are indicated.

the unedited probe hybridizes with RNA from the related kinetoplastid L. tarentolae (data not shown).

Editing of Preprocessed CR6/ND5 Transcripts-The 3' end of the CR6 gene shares 37 bases in common with the 5' end of the downstream ND5 gene' (Fig. 4). The predominant ND5 transcript, which is 1850 nucleotides in length, is preferen- tially expressed in BF parasites (26) and is apparently un- edited (7). Hybridization of both unedited and edited CR6 probes with a 2.05-kb transcript in BF (Fig. 3A) led us to investigate whether an RNA molecule containing transcripts from both CR6 and ND5 genes was present in T. brucei RNA.

First-strand cDNA was synthesized from both BF and PF RNA using XSC-dTI7. cDNA was amplified by PCR with an oligonucleotide complementary to the nucleotide 65-97 bases from the 5' end of the ND5 transcript (TbND5-1) and a CR6 oligonucleotide identical to either unedited or edited RNA (TbCR6-1 and TbCR6-6, respectively). Amplification of cDNA from both life cycle stages with TbCR6-1 resulted in a smear of products ranging from 275 (about the size of pre- dicted unedited RNA between the two primers) to 330 base pairs. These PCR products hybridized on Northern blots with end-labeled TbCR6-5, which is complementary to the 3' re- gion of unedited CR6 (data not shown). The larger products of this amplification likely represent molecules in which the CR6 region is partially edited. Two products, with apparent sizes of 220 and 350, were produced by PCR with the edited oligonucleotide TbCR6-6 using cDNA from both BF and PF RNA. Both bands were relatively homogeneous in size, the larger one corresponding approximately to the size expected for PCR products containing edited CR6 sequence. Northern blots of these products probed with end-labeled oligonucleo- tide (TbCR6-2) complementary to edited CR6 message just downstream of TbCR6-6 showed a signal exclusively in the region of the upper band (data not shown).

CR6/ND5 PCR products from both life cycle stages and produced using both combinations of primers were gel-puri- fied, cloned into pBluescript I1 SK- by addition of BamHI linkers (16) and sequenced. In the case of products produced with TbCR6-6, only the upper band was gel-purified. The sequence of three clones produced using unedited TbCR6-1 primer from both BF and PF was as expected, containing unedited CR6 sequence, the overlap between the CR6 and ND5 genes, and the ND5 sequence 5' of the TbND5-1 primer. This sequence corresponds to the maxicircle DNA sequence in this region (Figs. 1 and 4). When cDNA amplified using the primer complementary to edited CR6 (TbCR6-6) was sequenced, it became apparent that TbCR6-6 had frequently misprimed due to the overall G/U richness of the edited transcript, with just one of 11 clones sequenced havingprimed in the expected place. Most molecules were primed 122 nucle- otides downstream of the region to which TbCR6-6 was designed to hybridize. Two other mispriming sites, one slightly further 5' and the other slightly 3' to the major mispriming site were also present. The mispriming was no doubt the cause of the second, smaller band obtained by PCR with this primer as described above. The larger, correctly primed products must have been highly disfavored during cloning, possibly being toxic to the cells, as the gel-purified material which was cloned had been selected for the larger product. Nevertheless, the sequences of all products amplified with ND5 and edited CR6 primers reveal molecules containing both extensively edited CR6 sequence, including the region shared by CR6 and ND5, and 5' ND5 sequence exclusive of the overlap region (Fig. 4). While four of the CR6/ND5 molecules are fully edited, the remaining seven clones contain

' J. E. Feagin and K. Stuart, unpublished observations.

Editing of a Preprocessed mRNA 1127 DNA* G G G A C l G G A G A G A A A GAG CCGTTCGA GCCCAG CCGG MCCGACG G A G A G C l l C T f l l G A A 14 A M G GGA G GCG G G G A GG AG A Gll CRbe G t t G t t G t t t A C ~ G ~ t t t G t t t t A t t t G t t t t A t G t t A t t A t A t G A G t C C G ~ ~ C G A t t G C C C A G t t C C G G t M C C G A C G t G t A t t G t A t G C k ~ C ~ ~ ~ ~ G t A t t t t A t t l A t A t ~ t t t t G t t t G G A t G t t G C G t t G t ~ t t t t t t G t t G t t t t A t t G G t t t A G t t A t G ~ ~

C Y 7 G t ~ G t t G t t t A C ' G t t t t G t t t t A t t t G t t t t A t G t t A t t A t A t C r G t C C G ~ ~ C G ~ ~ ~ G C C C A G t t C C G G t M C C G A C G ~ G t A t t G t A t G C ~ a C ~ ~ * ~ G t A t t t t A t t l A t A t M t t t t G t t t G G A t G t t G C G t t G t t t t t t t t G t t G t t t t A ~ t G G t t ~ t t A t G "

CN4 G t t G t t G t t t A C * G t t t t G t t t t A t t t G

C U P ' G t t G t t G t t t A C ' G t t t t G t t t t A t t t G

t t G t t t t A C t G G f t t A G t t A t G ~ '

CN21B G t t G t t G t t t A C * G t t t t G t t t t A t t t G

t t t A G t t A t G * *

C U I 7 G t t G t t G t t t A C ' G t t t t G t t t t A t t t G

t t t A G t t A t G "

C H I 0 G T t G t t G t t t A C * G t t t t G t t t t A t t t G

t t t A G t t A t G * '

CW290 G t t G t t G t t t A C ~ G t t t t G t t t t A t t t G

C t t A G t t A t G "

CN5 G t t G t t G t t t A C ' G t t t t G t t t t ~ t t t G

t t t A G t t A t G * *

5 '

CRb 3 '

4 DNA' T C I A A A A G A l l l G G G l G G GG G G I A C C C T l l G T l l l G G T T M AG A A A C A l C G T l l A G M G A G A l l l l A G I A T M G A l A l G l l T l l MlAllllllllAllllllAlAAlGlllGGGlllAlAlCAGGllCAlllAlGlllGGlAGG ND5 A l C G l l l A G M G AGAlllTAWI AlMGAlAJlllll MTAllllTlllAllllTlAlMlGlllGGGlllAlAlCAGGllCAlllAlGlllGGlAGG CRbe T U t t A t t tAttAtAGA"'GGG1GGtGG t t t t G t t G A t t t A C C C ' * ' G ' * ~ * G t G * l M AG t A t t A t A W~CG**lAttGtMGt~A+l\GI.TTTICAfLITMOITAlGlllllIMl1 C Y 7 T C A t t A tttAttAtAWL...GGGlGGtGG ttttGttGAtttACCC.'.G*"G t G ' l M AG t A t t A t A CA'CG'~lAttGtMGttAGA~lllAG~~AlMGAlAlGlllll MlAllTllTlTAlTTlllAl~AlGlllGGGlllAlAlCAGGll~lllAlGlllGG~AGG CN4 T C A t t A t t t A t t A t A G A ~ * ~ G G G l G G t G G ttttGttCrtttACCC*"G~8..G t G ' T M AG C A t t A t A CA~CG"lAttGtMGttAGIIT"nllc)lt*TUG*T*TGlllll Ml~iJlTlllTAlTTlTlAlMlGlllGGGlllAlAlCAGGllCAlllAlGlllGGlAGG CN3** T C A t t A t t t A t t A t A ~ ~ * ~ G G G l G G C G G t t t t G t t G A t t t * C C C ~ ~ ~ G ~ ~ * * G tGVM AG U t t A t A C A ~ C G ~ ~ T A t t G t M G t t A G A ~ l l l A G A t A l M ~ l A l G l l l l l MlAlllllTllATTllllAlMlGlllGGGlllAlAlCAGGll~lllAlGlllGGlAGG CN29B l C A t t ~ ~ i , ~ A t t A t A G h ~ 8 ~ G G G l G G ~ G G ~ ~ G t t W L t t t A C C C ~ ~ ~ G ~ * ~ ~ G t G * T M AG t A t t A t A CA'CG**lAttGtMGttAGA~lllAGAtAlMGAlAlGllCll MlAllll1TllATlllll~lMlGlllGGGlllAlAlCAGGllCAlllAlGlllGGlAGG CW210 lCltt~~AttAtACr.*'GGGlGGCGG t t t t G f t G A t t t A C C C ~ * ~ G ~ * ~ ~ G tG*lM AG C A t t A t A CA~CG~'TAttGtMGttACr~lllAGAtAlMGAlAlGlllll MlAllllllllAllllllAlMlGlllGGGlllAl~lCAGGllCAlllAlGlllGGlAGG CNlU T U t t A t t t A t t A t A C r 8 ~ * G G G l G G t G G t t t t G t t G A t t t A C C ~ " ~ ~ ~ G ~ l M ~ A ~ ~ t t A t ~ ~ ~ C ~ * ~ ~ * l A t t G t M G t t A G A ~ l l l ~ G A t A l M G A l A l G l l l l l MlAllllllll~llllllAlMlGlllGGGlll~lAlCAGGllCAlllAlGlllGGlAGG CY17 TCAttA t t tAttAtAGA."GGGTGGtGG ttttGttGAtttACCP"*G'..'G t G * l M AG t A t t A t ~ ~ ~ C A ~ C G ~ ~ l A t t G t M G t t A G ~ ~ l l l A G h , ~ ~ A l M G A l A l G l l l l l MlAllllllflAflllllAlMlGlllGGGlllAlAlCAGGllCAlllAlGlllGGlAGG cws AtttACCC***G'***G C G V M AG t A t t A t A CA*CG'~TAttGtMGt~AGA~lllAG~~AlMGAlAlGlllll M7AlllTllllAlClTllAlMlGlllGGGlllAlAlCAGGllCAlllAlGlllGGlAGG

FIG. 4. Comparison of CR6/ND5 precursor mRNA sequences with DNA, CR6-edited mRNA (CRGe), and ND5 mRNA sequences. t , uridines added by editing (u nucleotides in mRNA are represented as ts -for comparison with cDNAs); asterisks, encoded uridines removed by editing. Edited regions matching neither unedited nor fully edited sequence are shaded. The ND5 mRNA 5' end and the CR6 mRNA 3' end are indicated with arrows. CR6 UAG termination codons for ORFs 1 and 2 (see Fig. 2) are double- and single-underlined, respectively. The ND5 AUG initiation codon and the TbCR6-6 and TbND5-1 primers are also underlined. The TbCR6-6 primer is aligned with the region to which it was designed to hybridize; gaps are introduced in cDNAs when mispriming occurred (see text). *, this sequence corresponds to both the maxicircle DNA sequence and the RNA sequence of the three clones obtained bv PCR amDlification using the unedited CR6 primer (TbCR6-1) and TbND5-1. **, three other clones having this sequence were isolated. -

some partially edited regions6 matching neither unedited nor fully edited sequence, suggesting that editing of the CR6 portion of these transcripts was in progress when the RNA was isolated.

DISCUSSION

We show here that transcripts from the CR6 gene of T. brucei are extensively edited throughout their length by both uridine insertion and deletion. The extent of editing observed is similar to that in the T. brucei COIII, A6, ND7, and ND8 (CR1) transcripts in which the protein coding sequence is essentially created by editing (4-6).' As with all edited tran- scripts reported to date, T. brucei CR6 contains sequence at both its 3' and 5' ends which is not edited. The unedited 3' region is presumably requirvd to form a duplex with the 5' end of the initiating gRNA (20). It is interesting to note that the 5"unedited regions of all extensively edited transcripts studied so far range from 30 to 35 nucleotides (4-6).' This suggests that the editing machinery requires at least this number of nucleotides 5' to the region being edited, possibly due to steric considerations.

Two gRNAs which could direct editing of the CR6 tran- script were identified. One of these gRNAs contains two apparent mismatches with the 42 nucleotide edited sequence to which it would be expected to hybridize. gRNAs with apparent mismatches have been previously described for the T. brucei ND8 (CRl)* and Crithidia fascicuEata MURF 3 and CYb (27) transcripts, and a C:A mismatch in the latter was confirmed by primer extension. It is difficult to reconcile such gRNA-mRNA mismatches with the strictly 3' to 5' mismatch recognition model of editing proposed by Blum et al. (20). However, if editing occurs at regions of low thermodynamic stability followed by progressive realignments of gRNA and mRNA until the duplex of highest possible thermodynamic stability is formed, as we have proposed,6 gRNA-mRNA mis- matches could be tolerated.

Creation of two ORFs and their initiation and termination codons by editing of CR6 mRNA suggests that fully edited CR6 transcripts are translated. If so, we favor translation of the longer of the two ORFs which specifies a hydrophobic,

TABLE I Overlap of T. brucei maxicircle genes on the same strand 3' end of" 5' end ofb Nucleotides

ND7 COIII 33 (unedited) 34 (ND7 only edited) 44 (COIII only edited) 45 (both ed)

COIII CYb 1 con MURF 2 At least 10" CR4 COI 42 (unedited)

33 (CR4 edited)

39 (CR6 edited) CR6 ND5 37 (unedited)

3' ends based on polyadenylation sites as determined by cDNA sequencing, with the exception of COII whose 3' end is based on the termination codon and which could overlap the edited region of MURF 2. Polyadenylation sites are defined as the 3' most nucleotide in the RNA sequence which matches the DNA sequence.

5' ends based on RNA sequencing.

9737-dalton protein for reasons of codon usage and 3'-un- translated region length. Production of anti-CR6 peptide an- tibodies for both ORFs followed by identification of the mo- lecular weight of the protein(s) with which they react in mitochondrial lysates will shed light on the identity of the putative protein product(s) of the CR6 gene. Both unedited and edited CR6 transcripts are significantly more abundant in BF than in PF parasites. This pattern of developmental regulation may provide insight into the function of the puta- tive CR6 protein product. The other T. brucei maxicircle transcripts described so far which are upregulated in BF (ND5, ND7, and ND8) are all homologous to subunits of the NADH dehydrogenase complex (respiratory complex I). BF T. brucei lack cytochromes and Krebs cycle enzymes, depend- ing primarily on glycolysis for energy production. Glycolysis is coupled to a mitochondrial alternate oxidase which regen- erates NAD+ from NADH through oxidation of ubiquinol to ubiquinone (28). It has been proposed that ND5, ND7, and ND8 proteins are associated with this alternate oxidase activ- ity? In addition, recent evidence indicates that complex I is

1128 Editing of a Preprocessed mRNA

present in intermediate and short stumpy BF, generating an electromotive force across the inner mitochondrial membrane which drives ATP production (29). Complex I from several species has been shown to consist of 20-30 subunits, many of which are small and probably hydrophobic, and have not been sequenced (30). Therefore, we suggest that the T. brucei CR6 gene may encode a protein homologous to one of the small complex I subunits or may be associated with complex I.

Precursor mRNA molecules containing both CR6 and ND5 sequences were detected in both BF and PF RNA. Putative precursor mRNAs have previously been detected on Northern blots of T. brucei mitochondrial RNA for several regions of the maxicircle (10). However, the cloning of cDNAs contain- ing both CR6 and ND5 sequence is the first clear demonstra- tion of polycistronic transcription of maxicircle genes. Small overlaps of protein-coding genes is known to occur in one or two regions of some mammalian mitochondrial genomes (31, 32). This type of organization appears to be the rule in the T. brucei mitochondrial genome, however, with transcripts de- scribed to date overlapping from l to 42 nucleotides in five different regions (Table I). This suggests that precursor cleav- age and/or polyadenylation can regulate gene expression at the RNA level, since formation of the 3‘ end of the 5’-most mRNA removes a portion of the 3’-most RNA, and vice versa. In some cases, only the 5”untranslated region of the 3’-most mRNA would be removed. However, in the case of CR6/ND5 and CR4/COI, 3’-end formation would remove a small portion of the putative coding sequences of ND5 and COI. (It should be noted that both ND5 and COI mRNAs have in frame AUGs less than 40 nucleotides downstream from the pre- sumed initiation codon, and it is not known which AUG actually serves as the initiation codon or if both can be used with production of a truncated protein from 5“truncated mRNA.) Likewise, formation of the 5’ ends of ND5 and MURF 2 eliminates a portion of the coding sequences of CR6 and COII, respectively. Even in instances in which the coding region of transcripts would be unaffected by precursor cleav- age, removal of 5’ or 3’ untranslated regions might be ex- pected to have a dramatic effect on regulation of mRNA translation or degradation. Indeed, it is likely that such trun- cated mRNAs are not translatable at all. An alternate possi- bility is that the 5’ and/or 3‘ ends of such truncated tran- scripts are regenerated by an uncharacterized mechanism, possibly involving resynthesis of the RNA from an RNA template or by transesterification of a small RNA molecule onto the truncated 5‘ or 3‘ end.

A further level of complication is introduced by editing of transcripts in the overlap region. With two exceptions, one or both mRNAs from every overlap region is known to be edited. This indicates another mechanism by which editing can reg- ulate gene expression at the RNA level. If editing precedes precursor cleavage, this could determine which mature tran- script is made. For example, editing of the 3’ end of the CR6 presumably results in an untranslatable or differently regu- lated ND5 transcript. Thus, if only one mature transcript can be made from a CR6/ND5 precursor, which transcript is made may simply depend on which process occurs first, editing or ND5 5’-end formation. If the latter occurs first, the CR6 transcript probably cannot be edited at all since the region to which the 3’-most gRNA duplexes would be lost. Interest- ingly, this gRNA-mRNA duplex region lies within a sequence

shared by CR6 and ND5, raising the question of why the mature ND5 transcript is not edited by this gRNA. We suspect that the inability to edit in this region is due to the lack of at least 30 nucleotides 5’ to the editing site which are present in all edited transcripts described to date and which appear to be required for the editing machinery. It is striking that PCR amplification of mature CR6 mRNA with unedited 5’ primer yielded no unedited transcripts, while amplification of CR6/ ND5 precursors with the same 5’ primer yielded only mole- cules in which the CR6 portion was completely unedited. This suggests that editing of cleaved CR6 transcripts may be facil- itated compared to editing of the corresponding precursor. Alternatively, editing of the 3‘ region of CR6 always precedes cleavage of the precursor. Investigation of the dynamics of editing and precursor processing will allow new insight into the role of these processes in regulation of maxicircle gene expression.

Acknowledgments-We thank Drs. G. J. Bhat, R. A. Corell, J. E. Feagin, H. U. Goringer, D. J. Koslowsky, G. R. Riley, H.-H. Shu, and A. E. Souza for helpful discussions and materials. We are also grateful to Tony Morales and Kenneth Wilson for excellent technical assist- ance.

REFERENCES 1. Simpson, L., and Shaw, J. (1989) Cell 57,355-366 2. Benne. R. (1990) Trends Genet. 6.177-181 3. Stuart; K. (1991) Trends Biochem. Sci. 16,68-72 4. Feagin, J. E., Abraham, J. M., and Stuart, K. (1988) Cell 53,413-422 5. Bhat, G. J., Koslowsky, D. J.. Feaein. J. E., Smilev, B. L.. and Stuart, K.

(1990) Cell 61,885-894

(1990) Cell 62,901-911

411

Acad. Sci. U. S. A. 85,539-543

and Tromp, M. C. (1986) Cell 46,819-826

4577-459fi

..

6. Koslowsky, D. J., Bhat, G. J., Perrollaz, A. L., Feagin, J. E., and Stuart, K.

7. Shaw, J. M., Feagin, J. E., Stuart, K., and Simpson, L. (1988) Cell 53,401-

8. Feagin, J. E., Shaw, J. M., Simpson, L., and Stuart, K. (1988) Proc. Natl.

9. Benne, R., van den Burg, J., Brakenhoff, J. P., Sloof, P., Van Boom, J. H.,

10. Feagin, J. E., Jasmer, D. P.. and Stuart, K. (1985) Nucleie Acids Res. 13 ,

11. Stuart, K., Gobright, E., Jenni, L., Milhausen, M., Thomashow, L., and

12. Simpson, L., and Braly, P. (1970) J. Protozool. 17 , 511-517 13. Harris, M. E., Moore, D. R., and Hajduk, S. L. (1990) J. Biol. Chem. 2 6 5 ,

. . . . . . .

Agabian, N. (1984) J. Parasitol. 70,747-754

1 1 3fi8-11 R7fi 14. Chomczynski, P., and Sacchi, N. (1987) Anal. Bwchem. 162,156-159 15. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G.

T., Mullis, K. B., and Erlich, H. A. (1988) Science 239,487-491 16. Bhat, G. J., Lodes, M. J., Myler, P. J., and Stuart, K. D. (1991) Nucleic

Acids Res. 19,398 17. Fourney, R. M., Miyakoshi, J., Day, R. S. 111, and Paterson, M. C. (1988)

Focus 10,5-7 18. Stuart, K. D., and Gelvin, S. B. (1982) Mol. Cell. Biol. 2,845-852

20. Blum, B., Bakalara, N., and Simpson, L. (1990) Cell 60,189-198 19. Abraham, J. M., Feagin, J. E., and Stuart, K. (1988) Cell 55,267-272

21. Rohrer, S. P., Michelotti, E. F., Torri, A. F., and Hajduk, S. L. (1987) Cell

22. Pollard, V. W., Rohrer, S. P., Michelotti, E. F., Hancock, K., and Hajduk,

23. Pearson, W. R., and Lipman, D. J. (1988) Proc. Natl. Acad. Sci. U. S. A.

24. Smith, R. F., and Smith, T. F. (1990) Proc. Natl. Acad. Sci.

25. Stuart, K., and Gelvin, S. R. (1980) Am. J. Trop. Med. Hyg. 29,1075-1081 26. Jaamer, D. P., Feagin, J. E., Payne, M., and Stuart, K. (1985) Mol. Cell.

Biol. 5,3041-3047 27. van der Spek, H., Arts, G.-J., Zwaal, R. R., van den Burg, J., Sloof, P., and

Benne, R. (1991) EMBO J. 10,1217-1224 28. Clarkson, A. B., Jr., Bienen, E. J., Pollakis, G., and Grady, R. W. (1989) J.

Biol. Chem. 2 6 4 , 17770-17776 29. Bienen, E. J., Saric, M., Pollakis, G., Grady, R. W., and Clarkson, A. B.,

Jr. (1991) Mol. Biochem. Parasttol. 45,185-192 30. Ragan, C. I. (1987) Curr. Top. Bioenerg. 15, l -36 31. Anderson, S., Bankier, A. T., Barrell, B. G., de Bmijn, M. H. L., Coulson,

A. R., Drouin, J., Eperon, I. C., Nierlicb, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. J. H., Staden, R., and Young, I. G. (1981)

- - - -. .

49,625-632

S. L. (1990) Cell 63,783-790

85,2444-2448

u. s. A. 87,118-122

32. Bibb, M. J., Van Etten, R. A., Wright, C. T., Walberg, M. W., and Clayton,

33. Kyte, J., and Doolittle, R. F. (1982) J. Mol. Biol. 1 5 7 , 105-132

Nature 290,457-465

D. A. (1981) Cell 26,167-180