Expression ofa laccase cDNAfromTrametes sp. AH28-2 in Pichia pastoris and mutagenesis of transformants bynitrogen ion implantation

Expressionofa laccase cDNAfromTrametes sp. AH28-2 inPichia pastoris andmutagenesis oftransformantsbynitrogenion implantationYuzhi Hong1, Yazhong Xiao1, Hongmin Zhou1, Wei Fang1, Min Zhang1, Jun Wang2, Lijun Wu2 &Zengliang Yu2

1School of Life Sciences & Modern Experiment Technology Center, Anhui University, Hefei, China and 2Key Laboratory of Ion Bioengineering,

Chinese Academy of Sciences, Hefei, China

Correspondence: Yazhong Xiao, School

of Life Sciences & Modern Experiment

Technology Center, Anhui University,

Hefei, 230039, China. Tel.: 186 0551

5108509; fax: 186 0551 5107408;

e-mail: [email protected]

Received 28 November 2005; revised 16

February 2006; accepted 19 February 2006.

First published online March 2006.

doi:10.1111/j.1574-6968.2006.00209.x

Editor: Diethard Mattanovich

Keywords

Trametes; laccase; Pichia pastoris; recombinant

expression; low-energy nitrogen ion

implantation.

Abstract

A laccase cDNA from Trametes sp. AH28-2 was expressed in Pichia pastoris, with

the highest expression level of 4.0 mg L�1 (1360 U mg�1). The apparent Km (24.6

mM) for ABTS (2,20-azinobis [3-ethylbenzothia-zoline-6-sulfonic acid]) and the

carbohydrate content of the recombinant laccase A (rLacA) are approximately

identical to those of the native LacA (nLacA). However, the two enzymes differed

in the pH optimum when both ABTS and guaiacol served as substrates. The

optimum pH for enzyme stability is 5.5 for rLacA. Thermal stability was also

investigated. The mutagenesis of rLacA utilizing low-energy nitrogen ion implan-

tation resulted in the isolation of a yeast clone that produced 7.7 mg L�1

(1085 U mg�1) of laccase, 92.5% more than the nonirradiated control (4.0 mg L�1).

Compared with rLacA, the mutant LacA (mLacA) with five amino-acid residue

changes in the coding sequence showed a slight change in its catalytic ability but

superior thermal stability.

Introduction

Laccases (benzenediol : oxygen oxidoreductase, EC1.10.3.2),

a family of blue multicopper oxidases, are capable of

oxidizing a wide range of aromatic compounds with con-

comitant reduction of molecular oxygen to water (Ullah

et al., 2000; O’Callaghan et al., 2002). Laccases are found in

highly evolved fungi and plants (Thurston, 1994), whereas

laccase-like activities have been found in some insects

(Thomas et al., 1989) and bacteria (Alexandre & Zhulin,

2000). The enormous potential of laccases as biological

catalysts for several industrial applications has been recog-

nized, including paper pulping/bleaching, bioremediation,

enzymatic removal of phenolic compounds in beverages,

enzymatic modification of fibers, dye-bleaching and biosen-

sors (Smith et al., 1997; Gianfreda et al., 1999; Abadulla

et al., 2000; Kulys & Vidziunaite, 2003).

The industrial application requires a large amount of

enzyme at low cost. However, the yield of laccase production

by most fungi is currently low. To increase laccase produc-

tion, researchers have used heterologous expression systems.

Pichia pastoris is a methylotrophic yeast that can be used to

express recombinant proteins under the control of the

strong alcohol oxidase promoter Aox1, which is tightly

regulated and induced by methanol (Cereghino & Cregg,

2000). Many strategies have been used to improve the

production of heterologous laccases and much progress has

been made in recent years (Hong et al., 2002).

Low-energy ion implantation has been successfully used

in biological systems (Huang et al., 1996; Vilaithong et al.,

2000; Yuan & Yu, 2003). The mutagenic effects exerted

by low-energy ion implantation on the plant and micro-

organism breeding were stronger and more effective than

those caused by other forms of mutagenesis, such as ultra-

violet rays, g-rays, lasers, neutrons and chemicals (Shao

et al., 1997; Chen et al., 1998; Xie et al., 2003). It has been

demonstrated that the ion beam could simultaneously

induce several effects such as energy deposition, momentum

transfer, mass deposition and electric charge exchange in the

implantation process (Huang et al., 1996; Zhao et al., 2001),

leading to highly efficient mutagenesis.

The white-rot fungus Trametes sp. AH28-2 has proven to

be an effective laccase producer, secreting multiple laccase

isozymes (Xiao et al., 2003, 2004). In this study, P. pastoris

FEMS Microbiol Lett 258 (2006) 96–101c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

was used to express the lacA gene from Trametes sp. AH28-2.

The recombinant laccase (rLacA) was characterized in

comparison with the native laccase (nLacA). Furthermore,

a Pichia transformant was mutagenized by low-energy

nitrogen ion beam implantation and the mutant laccase

(mLacA) was analyzed.

Materials and methods

Organisms and media

Trametes sp. AH28-2 is kept in the culture collection of

School of Life Sciences, Anhui University, China. The

Escherichia coli strain JM109 was obtained from Stratagene

(La Jolla, CA). The Pichia pastoris strain GS115 was obtained

from Invitrogen (Carlsbad, CA). All enzymes used to

manipulate RNA or DNA were obtained from Sino-Amer-

ican Biotechnology Co. (Beijing, China) or TAKARA Co

(Dalian, China).

All chemicals were of analytical grade. XH fermentation

medium contained per liter: 15 g glucose, 1.5 g L-asparagine,

1.0 g KH2PO4, 0.5 g MgSO4 � 7H2O, 0.1 g Na2HPO4 � 5H2O,

0.01 g CaCl2, 0.001 g FeSO4 � 7H2O, 0.028 g adenine, 0.002 g

CuSO4 � 5H2O and 50 mg vitamin B1. Buffered minimal

methanol (BMM), buffered minimal glycerol (BMG), mini-

mal dextrose (MD) and yeast extract-peptone-dextrose

(YPD) media were prepared according to the manual of the

Pichia Expression Kit (Invitrogen).

Cloning of the lacA cDNA in a yeastexpression vector

Trametes sp. AH28-2 was cultivated according to the meth-

od of Xiao et al. (2003, 2004) and induced by o-toluidine.

The mycelium was harvested at the peak of laccase activity in

cultures, frozen in liquid nitrogen and then ground to a fine

powder with a mortar and pestle. Total RNA was extracted

using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany).

The reverse transcription products of total RNA by M-

MLV reverse transcriptase (Promega, Madison, WI) were

used as templates for PCR. The specific sense primer (Ps:

AAAGAATTCGCCATTGGGCCCACCGCTGAC) and the

antisense primer (Pa: TTTGCGGCCGCCTGGTCGTTGA

CATCGAGCG) were designed based on the structural gene

of lacA (GenBank accession no. AF388910) and used to

amplify the lacA cDNA using Taq polymerase. The PCR

products were separated by electrophoresis in a 1.0%

agarose gel. A 1.5 kb product was purified using the DNA

Gel Extraction Kit (V-gene, Hangzhou, China), digested by

EcoRI and NotI, inserted into the pPIC9K vector (Invitro-

gen) and then transformed into E. coli JM109 competent

cells. Sequence analyses of the target expression vectors

(pPlacA) were performed to ensure the correct open reading

frames of the constructs.

Screening of laccase-producing clones

The pPlacA plasmid and the control vector pPIC9K were

linearized by SacI and transformed into P. pastoris GS115

competent cells by electroporation with a Genepulser II

apparatus (Bio-Rad, Hercules, CA). Positive clones were

selected by growth on histidine-deficient MD agar plates.

His1 transformants were washed with sterilized water and

transferred onto YPD plates containing 1.0 and 2.0 mg mL�1

G418 for screening multicopy clones. Several multicopy

clones obtained were spotted onto BMM (pH 6.0) agar

plates containing 0.1 mM CuSO4 and 0.2 mM ABTS (2,20-

azinobis [3-ethylbenzothia-zoline-6-sulfonic acid]). Lac-

case-producing clones were identified by the presence of a

dark green color around Pichia colonies.

Laccase activity assay

Laccase activity was determined in two ways. One was to

monitor the oxidation of ABTS by laccase spectroscopically

at 420 nm within 30 min at 30 1C. The reaction mixture in a

total volume of 3 mL contained 0.1 mL cell-free super-

natants at various dilutions and 0.5 mM ABTS in 100 mM

sodium tartarate buffer (pH 4.0). The other was to measure

the oxidation of guaiacol at 465 nm within 30 min at 25 1C.

The reaction mixture contained 1 mL laccase dilution, 1 mM

substrate and 50 mM succinic acid-NaOH buffer (pH 4.5).

One unit was defined as the amount of laccase that oxidizes

1 mmol substrate min�1. Assays were carried out in triplicate

for each sample and the mean values were obtained from

data with a standard deviation of less than 5%.

Production of rLacA

Ten multicopy transformants from the 1.0 and 2.0 mg mL�1

G418-YPD plates were inoculated into 10 mL BMG medium

in 100 mL Erlenmeyer flasks, and incubated at 30 1C on a

rotary shaker at 150 r.p.m. for 24 h until the OD600 nm in one

milliliter reached 5–10. After centrifugation at 3000 g for

5 min at room temperature, the cell pellets were resuspended

in 30 mL BMM media (pH 6.0, 0.1 mM CuSO4) to an

OD600 nm of about 1.0 in 150 mL flasks, cultivated at 20 1C

in the presence of 0.5% (volume in volume) methanol with

shaking at 150 r.p.m. Each sample was analyzed daily for

laccase activity and cell growth. All experiments were

performed in triplicate. One of the 20 transformants was

chosen at random to optimize the cultivation conditions,

such as the type of media, temperature, pH and concentra-

tions of CuSO4. Unless otherwise stated, 0.5% methanol was

added daily.

Characterization of enzymes

Both native and heterologous laccases were separated and

purified as described previously (Xiao et al., 2003). Protein

FEMS Microbiol Lett 258 (2006) 96–101 c� 2006 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

97Mutagenesis of heterologous laccase

concentration was tested using a BCA assay kit (Hyclone,

Pierce Rockford, IL). The molecular mass of the denatured

laccase was estimated by sodium dodecyl sulfate (SDS)

polyacrylamide gel electrophoresis (PAGE) using a 10%

polyacrylamide gel (Laemmli, 1970). The pH stability of

laccase was determined in 100 mM citrate-Na2HPO4 buffer

(pH 2.5–8.5, buffer A) and 100 mM glycine-NaOH buffer

(pH 8.0–10.5, buffer B) and thermal stability was assessed

between 20 and 70 1C using buffer A (pH 5.5). The pH

optimum for laccases was identified in buffer A using ABTS

and guaiacol as substrates and the temperature optimum

was investigated in the buffers used for laccase activity assay.

In addition, kinetic studies were performed at 30 1C by

measuring the initial velocity in 3 mL cuvettes with 1 cm

path length following the addition of the laccase to the

reaction. The initial rates were obtained from the linear

portion of the progress curve.

Mutagenesis by low-energy nitrogen ionimplantation

Low-energy nitrogen ion implantation was carried out at the

Key Laboratory of Ion Beam Bioengineering, Chinese Acad-

emy of Sciences. Cell cultures (200mL), grown in BMG

media at OD600 nm� 5, were evenly spread onto three

sterilized glass plates and air-dried for 30 min. These three

samples with a thin layer of cells were bombarded by pulse

nitrogen cations at the energy of 10 keV with doses of 10�,

40� and 100� (2.6� 1015) ions/cm2, respectively. The

pulse time was 5 s with pulse interval being 25 s and the

operating pressure in the target chamber was kept at c.

10�3 Pa.

The treated cells were washed off with 0.9% physiological

salt solution and grown on BMG plates at 30 1C for 2 days

after appropriate dilution. These clones were washed and

transferred on BMG plates for several rounds. The final cell

mixtures were grown at 20 1C for 5 days on BMM (pH 5.0)

plates containing 1 mM guaiacol and 0.2 mM CuSO4, with

200mL methanol being replenished daily. Clones with ru-

fous haloes were selected at random for submerged fermen-

tation at 20 1C in BMM (pH 6.0) media containing 0.3 mM

Cu21 and 0.2% (weight in volume, w/v) alanine. The

mutated LacA (mLacA) clones were sequenced and further

characterized.

Results

Cloning and heterologous expression of lacA

Sequence analysis showed that the cDNA sequence of lacA

was 1497 bp encoding a 499-amino acid mature protein and

identical to AF388910. The cDNA fragment was inserted

into the Pichia expression vector pPIC9K between EcoRI and

NotI sites, resulting in a 10.8 kb plasmid (pPlacA). The

expression cassette contained the leader sequence of a-factor

from Saccharomyces cerevisiae, lacA and the terminator.

His1 transformants were obtained from MD plates at a

frequency of less than 100 clones per mg DNA. YPD plates

containing 1.0 and 2.0 mg mL�1 G418 were further used to

select transformants with multicopy lacA. These transfor-

mants produced dark green haloes when spotted onto BMM

plates containing ABTS, suggesting that functional laccases

were expressed. In contrast, the green zones were not

observed from the control clones.

Optimization of growth conditions

Twenty transformants, 10 each from the 1.0 and

2.0 mg mL�1 G418-YPD plates, were cultured at 20 1C for

8 days in BMM media (pH 6.0) containing 0.1 mM CuSO4.

The laccase activities were nearly equal for these cultures

(data not shown), indicating that the gene copy number did

not appear to have an obvious impact on laccase synthesis.

One of the transformants, GS-lacAI, was randomly chosen

for further characterization.

The extracellular laccase yield was in direct proportion to

the amount of copper in the cultures. The laccase yield of

GS-lacAI was relatively low in the absence of copper and the

highest yield of laccase was obtained in the presence of

0.3 mM copper. However, the biomass of cultures decreased

slightly as the copper concentration increased.

The positive effect of alanine on the pH of cultures was

also observed in this study. The pH values of GS-lacAI

cultures were successfully maintained at 5.8–7.0 for more

than 14 days in the presence of 0.2–0.8% (w/v) alanine. In

the BMM medium (pH 6.0) supplemented with 0.2%

alanine and 0.3 mM CuSO4, the laccase output reached

5470 U L�1 after 13 days of cell culture. However, laccase

yields decreased with increasing concentration of alanine,

which could be due to the instability of heterologous laccase

protein at pH 6.5 or higher.

Molecular weight and Km

The calculated molecular mass of the mature protein,

deduced from the lacA cDNA, was 53 562, whereas the

molecular weight of nLacA determined by matrix-assisted

laser desorption ionization mass spectrum was 58 522 Da

(Xiao et al., 2003). The difference was due to the carbohy-

drate content of the enzyme. The rLacA expressed in Pichia

pastoris and the corresponding native enzyme (nLacA)

secreted by Trametes sp. AH28-2 were separately purified to

homogeneity by ion exchange and gel filtration chromato-

graphy. The apparent molecular weight of rLacA estimated

by SDS-PAGE (63 kDa) was nearly identical to that of nLacA

(62 kDa), indicating that the carbohydrate content of the

two laccases could be very similar. The apparent Km values

of nLacA and rLacA for ABTS, determined from the


98 Y. Hong et al.

Lineweaver–burk plot, were estimated to be 25.0 and 24.6

mM, respectively.

The pH and thermo-stability of laccases

An interesting result was that the optimum pH of rLacA for

substrates had a tendency of shift to acidity compared with

nLacA (Fig. 1). The optimum pH of nLacA for ABTS and

guaiacol were 3.0 and 4.5, respectively. However, the opti-

mum pH of rLacA for ABTS and guaiacol declined to 2.5

and 3.5, respectively. The effect of pH on enzyme stability

was investigated by keeping enzymes in buffers at 25 1C.

nLacA was stable at pH 3.0–10.0 (Table 1) and maintained

over 90% activity after incubation for a month at pH

7.0–9.0. In contrast, rLacA exhibited a pH optimum at 5.5

with a half-life of 117 h.

The optimal temperature for rLacA using ABTS as the

substrate was estimated to be 50 1C, which is identical to

that of nLacA (Xiao et al., 2003). The relative activity of

rLacA at 50 1C was 48.7%, 22.7%, 13.3%, 18.5% and 68.9%

more than that at 20, 30, 40, 60 and 70 1C, respectively. The

thermal stability of the two laccases was also investigated at

pH 5.5 at temperatures ranging from 20 to 70 1C. As shown

in Table 2, the half-life of enzyme activities of nLacA were

substantially longer than those of rLacA.

Isolation and characterization of mutant laccase

In order to improve the production or the physicochemical

characteristics of rLacA, low-energy N ion was used as a

mutagen to mutate the cells of GS-lacAI. The treated cells

were periodically cultivated on BMG plates more than six

times to ensure genetic stability. After being screened on

BMM (pH 5.0) plates containing 1 mM guaiacol, 13 clones

with dark rufous haloes, from each treatment with 10�,

40� and 100� (2.6� 1015) ions/cm2, respectively, were

randomly selected for submerged fermentation. Laccase

production of N ion-treated clones was nearly identical

between two batches of fermentation, indicating that these

clones were hereditably stable after prolonged passages in

culture. Although the growth rate of the treated transfor-

mants was similar to the nonirradiated control, the laccase

production of a majority of the treated clones was lower

than the control. Screening of the laccase production yielded

target clones that expressed more laccase than the control

clone. The high expression clones, one from each treated

group, showed laccase yields of 8324, 6037 and 5911 U L�1,

respectively, with a 52.2%, 10.4% and 8.1% increase over the

control (5470 U L�1). Among these, mutant 1 (laccase yield

of 8324 U L�1) was further characterized as described below.

The laccase (mLacA) from mutant 1 was purified and its

apparent molecular mass, as estimated by SDS-PAGE, was

63 kDa, identical to that of rLacA. The optimum pH and

temperature of mLacA for ABTS were pH 2.5 and 50 1C, the

same as rLacA. However, the apparent Km of mLacA (28.8

mM) was slightly more than that of rLacA (24.6mM) and the

relative specific activity of mLacA (1085 U mg�1) was less

than that of rLacA (1360 U mg�1). The half-life of mLacA

activity increased at all temperatures tested compared with

rLacA (Table 2).

To understand the difference in enzyme activity between

mLacA (mutant 1) and rLacA (GS-lacAI), DNA sequence

analysis was performed. Seven nucleotide changes were

identified in the coding sequence of mutant 1: 247 nucleo-

tides (nt) (AT ! GC), 394 nt (AT ! CG), 439 nt

(AT ! GC), 481 nt (AT ! GC), 486 nt (TA ! CG),

1244 nt (AT ! GC) and 1428 nt (AT ! CG). These

changes resulted in changes of amino acids at five sites: 83

(N ! D), 132 (T ! P), 147 (T ! A), 161 (T ! A) and

415 (Y ! C). It is not clear at present which change(s)

might have impacted enzyme activities observed in this

study.

100

Rel

ativ

e ac

tivity

(%

) 80

60

40

20

0

2 3 4 5pH

6 7

Fig. 1. Effects of pH on enzyme activities of both nLacA and rLacA

using 2,20-azinobis [3-ethylbenzothia-zoline-6-sulfonic acid] (ABTS) and

guaiacol as substrates. D, rLacA/ABTS; &, nLacA/ABTS; m, rLacA/

guaiacol; ’, nLacA/guaiacol.

Table 1. The half-life times of nLacA and rLacA at various pHs�

pH 2.5 3.0 4.0 5.0 5.5 6.0 7.0 8.0 8.0B 9.0B 10.0B

nLacA (days) 1.8 2.9 9.9 14.6 21 25 4 60 4 60 4 60 460 55

rLacA (h) 1.7 3.3 16.8 77.6 117 103 24.0 1.1 / / /

�nLacA and rLacA were incubated at 25 1C in buffer A (pH 2.5–8.0) and buffer B (pH 8.0–10.0). The superscript B indicates that enzyme was kept in

buffer B.



Discussion

It is of great benefit to develop an efficient system for the

heterologous expression of laccases, which have potential for

various environmental and industrial applications. The

Pichia pastoris system has often been used to express

proteins that require posttranslational modifications. We

used this system to express the lacA gene from Trametes sp.

AH28-2. The yield was c. 4.0 mg L�1, similar to the levels

previously reported in yeasts (3–5 mg L�1) and the relative

activity reached 1360 U mg�1, similar to the level

(1380 U mg�1) reported by Hong et al. (2002).

Previous work has suggested that the laccase gene lccT,

obtained from Panus rudis, was modified by adding five

amino-acid residues at the C-terminus in the coding se-

quence and the relative activity of the heterologous LCCT in

P. pastoris increased twofold in comparison with the corre-

sponding laccase without modification (Yang et al., 2003).

In this work, use of the a-factor signal peptide and the

termination sequence in pPIC9K vector added 12 additional

amino-acid residues (EAEAYVEF at the N-terminus and

AAAN at the C-terminus) to rLacA protein, resulting in a

1283.3 Da increase of the calculated molecular weight in

comparison with nLacA. The apparent Km (24.6mM) and

the optimal temperature (50 1C) of rLacA for substrate

ABTS are almost the same as those of nLacA. The optimal

pH of rLacA for substrates ABTS and guaiacol has a

tendency of shift to acidity compared with nLacA (Fig. 1),

and the heterologous laccase rLacA is stable at pH 2.5–6.0

(Table 1). It is not clear what caused the pH shift for optimal

enzyme activity. A difference in posttranslational modifica-

tions, such as glycosylation, between the filamentous fungi

and P. pastoris may be one of the explanations (Han & Lei,

1999). Nevertheless, these attributes indicate rLacA could be

utilized as an industrial enzyme.

The mutagenesis of the Pichia transformant GS-lacAI by

low-energy nitrogen ion beam implantation was designed to

generate mutant strains for higher laccase production. Out

of 39 clones selected, mutant 1 expressed laccase (mLacA) at

8324 U L�1, a 52.2% increase over the control (rLacA). In

comparison with the nonmutant rLacA, the apparent Km of

mLacA increased 17.2% to 28.8 mM and its relative activity

decreased 20.2% to 1085 U mg�1. The yield of mLacA

reached 7.7 mg L�1, a 92.5% increase over the GS-lacAI

control (4.0 mg L�1). The thermal stability of mLacA was

also enhanced (Table 2). Sequence analysis of mLacA

identified seven nucleotide changes including five sense

mutations. An attempt is being made to pinpoint the

mutations responsible for the altered biochemical behaviors

of laccases.

In conclusion, several physicochemical characters of a

rLacA expressed in P. pastoris changed in acidic conditions

in comparison with the nLacA. The success of generating

high-laccase-production strains by low-energy N ion im-

plantation underscores the importance of molecular evolu-

tion. Our study provided a viable strategy to improve

heterologous expression and enzyme activity of laccase.

Acknowledgements

We are grateful of Dr Changyou Chen for reviewing this

manuscript. This work was supported by grants from the

National Natural Sciences Foundation of China (30370045,

30470056), the Science & Technology Foundation of Distin-

guished Young Scholars of Anhui Province (04043048,

05023057) and the Innovative Research Team of 211 Project

in Anhui University (02203109).

References

Abadulla E, Tzanov T, Costa S, Robra KH, Cavaco-Paulo A &

Gubitz GM (2000) Decolorization and detoxification of textile

dyes with a laccase from Trametes hirsute. Appl Environ

Microbiol 66: 3357–3362.

Alexandre G & Zhulin IB (2000) Laccases are widespread in

bacteria. Trends Biotechnol 18: 41–42.

Cereghino JL & Cregg JM (2000) Heterologous protein

expression in the methylotrophic yeast Pichia pastoris. FEMS

Microbiol Rev 24: 45–66.

Chen Y, Lin ZX, Zou ZY, Zhang F, Liu D, Liu XH, Tang JZ, Zhu

WM & Huang B (1998) High yield antibiotic producing

mutants of Streptomyces erythreus induced by low energy ion

implantation. Nucl Instrum Methods Phys Sec B 140: 341–348.

Gianfreda L, Xu F & Bollag JM (1999) Laccases: a useful group of

oxidoreductive enzymes. Bioremediation J 3: 1–25.

Han Y & Lei XG (1999) Role of glycosylation in the functional

expression of an Aspergillus niger phytase gene (phyA) in Pichia

pastoris. Arch Biochem Biophys 364: 83–90.

Hong F, Meinander NQ & Jonsson L (2002) Fermentation

strategies for improved heterologous expression of laccase in

Pichia pastoris. Biotechnol Bioeng 79: 438–449.

Table 2. The half-life times of laccases at different temperatures�

Laccase 20 1C (days) 30 1C 40 1C 50 1C 60 1C 70 1C (min)

rLacA 7.0 25.0 h 6.6 h 32.3 min 6.4 min 0.9

mLacA / / 8.0 h 42.5 min 7.9 min 1.4

nLacA 36 days 13 days 3.3 days 18.9 h 2.2 h 5.1

�Enzymes were incubated at different temperatures in buffer A at pH 5.5. Samples were taken to examine their residual activity at certain interval time.


100 Y. Hong et al.

Huang WD, Yu ZL, Jiang ZY & Yang XH (1996) Study of mass

and energy deposit effects of ion implantation of NAA. Radiat

Phys Chem 48: 319–323.

Kulys J & Vidziunaite R (2003) Amperometric biosensors based

on recombinant laccases for phenols determination. Biosensors

Bioelectron 18: 319–325.

Laemmli UK (1970) Cleavage of structural proteins during the

assembly of the head of bacteriophage T4. Nature 227:

680–685.

O’Callaghan J, O’Brien MM, McClean K & Dobson ADW (2002)

Optimisation of the expression of a Trametes versicolor laccase

gene in Pichia pastoris. J Ind Microbiol Biotechnol 29: 55–59.

Shao CL, Wang XQ & Yu ZL (1997) Phosphate release from N1

ions irradiated 50-CMP nucleotide and its kinetics. Radiat Phys

Chem 6: 561–565.

Smith M, Thurston CF & Wood DA (1997) Fungal laccases: role

in delignification and possible industrial applications. Multi-

Copper Oxidases (Messerschmidt A, ed), pp. 201–224. World

Scientific, New Jersey, USA.

Thomas BR, Yonekura M, Morgan TD, Czapla TH, Hopkins TL &

Kramer KL (1989) A trypsin solubilised laccase from phrate

pupal integument of the tobacco hornworm, Manduca sexta.

Insect Biochem 19: 611–622.

Thurston CF (1994) The structure and function of fungal

laccases. Microbiology 140: 19–26.

Ullah MA, Bedford CT & Evans CS (2000) Reactions of

pentachlorophenol with laccase from Coriolus versicolor. Appl

Microbiol Biotechnol 53: 230–234.

Vilaithong T, Yu LD, Alisi C, Phanchaisri B, Apavatjrut P &

Anuntalabhochai S (2000) A study of low-energy ion beam

effects on outer plant cell structure for exogenous

macromolecule transferring. Surf Coatings Technol 128:

133–138.

Xiao YZ, Tu XM, Wang J, Zhang M, Cheng Q, Zeng WY & Shi YY

(2003) Purification, molecular characterization and reactivity

with aromatic compounds of a laccase from basidiomycete

Trametes sp. strain AH28-2. Appl Microbiol Biotechnol 60:

700–707.

Xiao YZ, Chen Q, Wu J, Hang J, Hong YZ, Shi YY & Wang YP

(2004) Selective induction, purification and characterization

of a laccase isozyme from the basidiomycete Trametes sp.

AH28-2. Mycologia 96: 26–35.

Xie CX, Yao JM, Pan RR, Wu LJ & Yu ZL (2003) Mutagenesis of

ion beam implantation and identification of two new

rifampicin resistance determining sites in rpoB gene in

Escherichia coli. Acta Microbiol Sin 43: 732–739.

Yang JQ, Tang GY, Dai HM, Liu G & Zhu HC (2003)

Expression and purification of the modified gene of

laccase from Panus rudis in Pichia pastoris. Lett

Biotechnol 16: 255–258.

Yuan CL & Yu ZL (2003) The grand process of low

energy ion beam in life sciences. China J Biotechnol 23:

57–61.

Zhao H, Li Y, Pei H & Zhang T (2001) Study on effect of

gentemicin producers mutagenized and breeded by N1

implanting. J Tianjin Inst Technol 17: 14–17.



Documents

Expression ofa laccase cDNAfromTrametes sp. AH28-2 in Pichia pastoris and mutagenesis of transformants bynitrogen ion implantation