Wageningen University

Laboratory of Molecular Biology

EVOLUTION OF EVOLUTION OF EVOLUTION OF EVOLUTION OF

CCAMK PROMOTERS CCAMK PROMOTERS CCAMK PROMOTERS CCAMK PROMOTERS

Student Nguyen Thi Thanh Van

Supervisors Dr. Ir. René Geurts

Ir. Arend Streng

Ir. Gerben Bijl

Ir. Rik op den Camp

August 2008 – February 2010

ACKNOWLEDGEMENT Doing my thesis at Laboratory of Molecular Biology has been such an exhirilating intellectual experience and a great contribution to my research endeavour. It is a pleasure to convey my gratitude to many people who greatly contributed to the making of this thesis. I gratefully thank my supervisor Dr. René Geurts for his valuable advice and critical comments. His dedication and insights into evolution has motivated all of his students, including me. I'd like to record my gratitude to Arend Streng for his daily supervision, technical guidance and his kindly encouragement from the very beginning till the final stage of my thesis. I especially want to thank Gerben Bijl for the intriguing hypothesis which makes the backbone of my thesis. Working with him was such a delightful learning experience. I am heartily thankful to Rik op den Camp for his important contribution and constructive remarks which have improved my critical thinking. I have learnt a lot from my supervisors and I'm thankful in every possible way. My deep gratitude goes to professor Ton Bisseling for the opportunity to work in his prestigious lab and his support for my coming internship. Last but not least, I'd like to thank everyone at Molbi for the friendly, supportive atmosphere and enjoyable moments during the last 6 months.

2

Summary Legume family and non legume Parasponia can establish symbiosis with nitrogen-fixing Rhizobia. Nod factor secreted by Rhizobia is perceived by the plant host and stimulates the formation of root nodules. This report focuses on genes encoding Ca2+/calmodulin-dependent protein kinases (CCaMKs) which are essential for regulation of nodulation. Medicago truncatula CCaMK (dmi3) mutant complementation by Populus trichocarpa (poplar) CCaMK was done in previous research and repeated in this thesis. In dmi3 mutant background, poplar CCaMK under control of MtDMI3 can restore functional nodule formation wheras poplar CCaMK driven by native promoter leads to infection abortion and retention of bacteria within infection threads. A conserved region in legume CCaMK promoter sequences was identified and it appears to be much less conserved in Populus. This finding triggers the question whether the differences in activity of Populus and Medicago CCaMK promoter a result of legume specific evolution of the CCaMK promoter or a result of gradual diversification. In attempting to answer this question, research was carried on non-nodulating legume Cercis and non-legume nodulating Parasponia which are phylogenetically between poplar and Medicago. Using the BAC library screening approach, 6 Cercis chinensis BACs and 2 Parasponia andersonii BACs containing CCaMK gene were identified. Multiple alignment shows similarity between CCaMK promoter sequences of Cercis and a number of legumes is higher than that of legumes and several non-legume species. In order to gain additional information of CCaMK role in Parasponia symbiotic signaling, A. rhizogenes-mediated RNAi was performed and this experiment should be repeated to gain more accurate results. To draw conclusion about CCaMK promoter evolution, further research need to be done. Two good candidates are apple and nodulating legume Chamaecrista, which is phylogenetically close to Cercis.

3

Table of Contents I. INTRODUCTION ................................................................................................................... 5

1. Nodule formation in Medicago truncatula...................................................................... 5

2. Nod factor signaling pathway in Medicago truncatula ....................................................... 6

3. Evolution of CCaMKs ..................................................................................................... 7

Research description ............................................................................................................. 8 II. RESULTS AND DISCUSSION ............................................................................................ 11

1. MtDMI3 complementation ............................................................................................. 11

2. Sequencing of Cercis chinensis CCaMK promoter .......................................................... 13

3. Parasponia CCaMK ...................................................................................................... 15 III. CONCLUDING REMARKS AND FUTURE WORKS ......................................................... 17 IV. MATERIALS AND METHODS .......................................................................................... 19

1. Study of Medicago truncatula dmi3 mutant infection phenotype ...................................... 19

2. Sequencing of Cersis chinensis CCaMK and Parasponia andersonii CCaMK ............. 20

3. A. rhizogenes – mediated RNAi of Parasponia CCaMK .............................................. 21 Appendix I - Preparation of Electro-competent Cells ................................................................... 25 Appendix II - BAC DNA Isolation ............................................................................................. 27 Appendix III - Conserved region of Cercis CCaMK gene ............................................................ 29 Appendix IV - Screening Of Bac LibraryAppendix V - Programs and Primers .............................. 30 Appendix V - Programs and Primers ............................................................................................. 31

PCR using proof reading enzyme ........................................................................................... 31

List of primers ....................................................................................................................... 32

DNA Sequence ..................................................................................................................... 32

4

I. INTRODUCTION Nitrogen is an essential plant nutrient and often a limiting factor of plant growth. Molecular

nitrogen (N2) is abundantly present in the atmosphere, around four-fifths overall. However, plants are not capable to metabolically process atmospheric nitrogen directly. Enzymatic

reduction of N2 to ammonia can be effectively performed by a group of microorganisms that posses the enzyme complex nitrogenase. The process is known as biological nitrogen fixation. Members of the legume family are renowned for their capability to establish symbiosis with nitrogen-fixing Rhizobia. In this symbiosis, nitrogen fixation takes place in a newly formed organ, the root nodule. 1. Nodule formation in Medicago truncatula Initial steps of the Rhizobia-legume symbiosis can be described as a two-way molecule conversation. The host plant releases chemical compounds called flavonoids that induce the expression of the bacterial nodD gene. NodD encodes a flavonoid inducible transcriptional regulator responsible for the activation of a number of nodulation (Nod) genes (Fisher, 1992) These genes encode enzymatic proteins required for the synthesis of the bacterial signaling molecule, named Nod factor, which is subsequently perceived by the plant and stimulates morphological changes of the plant roots (Perret, 2000). The basic structure of Nod factor consists of a backbone of 4 to 5 β-1,4- N-acetylglucosamines bearing a fatty acid on the non reducing sugar residue (Mylona et al, 1995). The synthesis of the backbone is catalyzed by the products of nodABC gene cluster. Nod factors of distinctive bacterial species can be different in regard to the number of glucosamine residues and the type of substitution at both ends of the molecule (Dénarié, 1996). Upon attachment of bacteria, the legume root hair will deform to a shepherd’s crook. This reorientation of the root hair growth direction can be induced either by intact bacteria or pure Nod factor (Esseling, 2003). Rhizobium entrapment in the curl and hydrolysis of plant cell wall are one of the first steps leading to the infection thread formation (Van Spronsen, 1994). Concurrently, redifferentiation of cortical cells resulting in the formation of the nodule primordium (Foucher, 2000). The infection thread subsequently transverses several cell layers to reach the primordial cells. Inside these cells rhizobia are released from the infection thread surrounded by a plant-derived membrane envelope called symbiosome (Brewin, 2004). The bacteria differentiate into a nitrogen-fixing bacteroid and the infected cell becomes fully packed by microsymbionts. M. truncatula nodules have peripheral vascular bundles and infected cells in the central tissue. They are indeterminate nodules, possessing persistent meristem at their apex. Due to the continuous activity of the meristem, central tissue forms different developmental zones including the meristem, the prefixation zone, the interzone, the nitrogen fixation zone and the senescent zone (Gualtieri, 2000).

5

2. Nod factor signaling pathway in Medicago truncatula The Nod factor plays a key role during the nodulation process. A great deal of effort has been invested in order to identify genes involved in perception of the Nod factor and subsequent signaling. Characterization of legume mutants, hampered in nodule formation, has led to the identification of a number of genes essential for early Nod factor signaling and nodule formation (Figure 1). Medicago truncatula Nod Factor Perception (MtNFP) is an essential part of Nod factor signaling pathway. It involves in root hair deformation, root hair curling, cortical cell division and transcriptional changes in response to Nod factor perception. MtNFP is a member of the lysine motif (LysM)-receptor like kinase family (Arrighi, 2006). Another LysM family receptor is LYK3 which is required for the root hair curling and the formation of the infection thread (Smit, 2007). Other genes controlling steps of Nod factor signaling cascade include DMI1, DMI2, DMI3 (DMI: Doesn’t make infection). These genes are also required for signaling pathway of the widespread arbuscular mycorrhizal (AM) symbiosis (Catoira, 2000). DMI2, localizing at the cell surface, is a leucine-rich-repeat receptor kinase required for tight root hair curling (Esseling, 2004). DMI1 is a ligand-gated K+ ion channel (Ané, 2004), localizing on the nuclear membrane (Riely, 2007). DMI3 encoding Ca2+/calmodulin-dependent protein kinase (CCaMK) is found to be essential for transcriptional changes in response to Nod factor (Lévy, 2004; Mitra, 2004). Downstream of DMI3 are two members of the GRAS - type transcription factor, nodulation signaling pathway 1 (NSP1) and NSP2. These transcription factors are crucial for all transcriptional changes induced in nodulation (Smit, 2005; Kalo, 2005). Besides being crucial in Nod factor signaling downstream of calcium oscillation, CCaMK also appears to be involved in a negative feedback of this response (Oldroyd, 2001). CCaMK is composed of a serine-threonine kinase domain, an autoinhibitory domain, a calmodulin-binding domain and a domain with three EF-hands (Patil, 1995). The EF-hand domains have a significant role in regulating autophosphorylation and calmodulin affinity. Upon binding to Ca2+, autophosphorylation is induced, resulting in the increase of affinity for CaM. Binding of CaM in turn activates substrate phosphorylation (Sathyanarayanan, 2000). CaM-binding/autoinhibition domain in MtDMI3 is predicted to be between residues 326 and 355. Removal of this domain leads to the autoactivation of the nodulation signaling pathway which results in the nodule formation in the absence of Nod factor or bacteria elicitation. This verifies the essential role of MtDMI3 in the regulation of nodulation and the activation of this protein is adequate for the induction of nodule morphogenesis (Gleason, 2006).

6

Figure 1. Downstream components of the Nod factor signal transduction system (Jones, 2007). 3. Evolution of CCaMKs CCaMKs are not only present in legumes, homologs of MtDMI3 have been identified in a number of non-legume species such as lily (Patil, 1995), tobacco (Liu, 1998), rice (International Rice Genome Sequencing Project, 2005), poplar (Tuskan, 2006), grapevine and apple. Since DMI3 is required for arbuscular mycorrhization, the presence of a DMI3 homolog in these species is expected. However, this finding does trigger the question whether or not CCaMK genes in legumes have underwent specific evolution in order to function in Nod factor signaling pathway. This question can be addressed by complementing the Medicago dmi3 mutant using a CCaMK encoding gene from a non-legume species. Study of CCaMK protein functionality in lily and rice show that non legume CCaMKs have the ability to interpret the rhizobial Nod factor signal and induce nodule morphogenesis (Gleason, 2006; Godfroy, 2006). Additional support is provided by experiments using Populus trichocarpa (poplar) CCaMK performed in Laboratory of Molecular Biology of Wageningen University. Poplar was selected as a non-legume model species for its available genome sequence and its phylogenetic distance to the Fabaceae family. It was found that poplar CCaMK under the control of MtDMI3 promoter could restore functional nodule formation in M. truncatula dmi3 mutant. Altogether, these results suggest that no specific evolution was needed for legume CCaMK to function in the signaling pathway of nodulation. To test whether adjustment in regulation of CCaMK expression is required for its functioning

in nodulation, poplar CCaMK under the control of poplar CCaMK promoter was used to

7

complement the M. truncatula dmi3 mutant. Nodule formation seems restored in complemented root but rhizobium bacteria are retained within infection threads. This result suggests CCaMK plays an important role in the release of bacteria from infection threads. Complementation of the M. truncatula dmi3 mutant using poplar CCaMK driven by either its native promoter or the MtDMI3 promoter will be repeated in this thesis. Experiments using promoter-GUS (beta-glucuronidase) fusion demonstrate strong induction of MtDMI3 promoter in nodules whereas no nodule specific induction can be found in case of the PtCCaMK promoter. Alignment of a number of legume CCaMK promoters was used to identify a conserved region within these promoter sequences. This region was cloned and its ability to complement M. truncatula dmi3 mutant was confirmed. This promoter region appears less conserved in poplar and several other non-legume species (Figure 2). Figure 2. Conserved promoter region in selected legumes in comparison with Malus domestica (apple), Vitis vinifera (grape), Populus trichocarpa (poplar), Carica papaya (papaya) and Ricinus communis (ricin). The differences in conservation suggests diversification of the region between legumes and non-legumes. The driving force behind this process however cannot be identified based on these sequences alone. Research description Based on data presented, the following research question has been formulated: Are the differences in activity of Populus and Medicago CCaMK promoter a result of legume specific evolution of the CCaMK promoter or a result of gradual diversification?

8

To answer this question, more research need to be done on CCaMK promoter of species that are phylogenetically between Medicago and Populus. These experiments include dmi3 complementation and investigation of the identified conserved region. An ideal candidate is Cercis, the redbud, which belongs to the subfamily Caesalpinoids of Fabaceae family (Figure 3). Many reports are in agreement that Cersis is non-nodulating legume (Allen, 1981). The object of interest is the C.chinensis CCaMK promoter which can be obtained via screening the available bacterial artificial chromosome (BAC) library. The BACs which contain the target insert will be used to construct subclone libraries. These new libraries will be used for identifying and sequencing of the target DNA region.

Malus domestica

Figure 3. Positions of major nodulating groups in Fabaceae, the non-nodulating legume Cersis, non legume poplar, apple and Parasponia. Tree adapted from Stéphane De Mita.

The second candidate is Parasponia which is the only non-legume known to form effective nitrogen-fixing symbiosis with genera Rhizobium and Bradyrhizobium (Trinick, 1988). Parasponia - rhizobia symbiosis posseses some distinguishable differences compared to the legume - rhizobia symbiotic relationship. Parasponia nodule structure resembles modified lateral roots, having a central vascular system surrounded by uninfected inner cortex and then infected tissue (Trinick, 1979; Becking, 1979 and Lancelle, 1984). After infection of the roots, bacteria proliferate rapidly and invade dividing cortical cells by the formation of infection-thread-like structures. Rhizobia are retained within the infection thread and develop into a nitrogen-fixing form, where after the whole unit is referred as fixation thread (Trinick, 1979; Lancelle, 1985).

9

The amounts of research spend on the symbiosis between Parasponia and rhizobia is moderate in comparison to the extensive research on the legume – Rhizobium symbiotic relationship. Poor germination of Parasponia seeds and high seedling mortality are two of the biggest problems. Davey et al (1993) has developed a micropropagation system for P. andersonii that has overcome these problems. This method has been successfully applied in Laboratory of Molecular Biology. Previous research show that Nod factor is crucial for entry of bacteria into the roots of legume (Relić, 1994). Broad-host-range Rhizobium species strain NGR234 which can nodulate at least 70 genera of legume (Price, 1992) was reported to be able to establishh symbiosis with non-legume Parasponia andersonii (Trinick, 1980). To examine the effect of Nod factor on Parasponia nodulation, the NGR234 nodABC mutant was used for inoculation of P. andersonii. It was found that Nod factor is essential for intercellular infection, intracellular fixation thread formation and nodule organogenesis in P. andersonii (Op den Camp and Qingqin, unpublished data). The current data suggests that pathway for bacterial entry is, at leat partly, conserved between legume and Parasponia. A construct containing constitutively active M. truncatula CCaMK*, lacking its autoregulatory domain (as described in Gleason, 2006), under the control of 35S promoter was introduced into micropropagated wild-type P. andersonii. Spontaneous nodules and an increase in lateral root formation was observed in roots transformed with p35S:CCaMK*. These findings indicate that CCaMK is essential for lateral root emergence and nodule morphogenesis in Parasponia. It also suggests that the signaling pathways underlying nodule organogenesis and lateral root formation in Parasponia has parallels to legume nodule organogenesis pathways. In order to obtain additional evidence of CCaMK-depending nodulation in Parasponia, silencing of CCaMK gene by Agrobacterium rhizogenes-mediated RNAi will be performed. A. rhizogenes-mediated RNAi is a powerful tool to silence genes not only in legumes such as M. truncatula but also in Lotus japonicus and Arabidopsis thaliana (Kumagai, 2003; Limpens, 2004). Constructs will be made containing a coding sequence of the target genes, cloned in both sense and antisense direction, separated by a short sequence called linker. RNA transcribed from this construct produces a hairpin structure, resulting in double-stranded RNA which is recognized and cleaved by nuclease DICER into 20-25 nucleotide small interfering RNAs (siRNAs). Subsequently, these siRNAs bind to RNA-induced silencing complex (RISC) which is responsible for degradation of the target mRNAs (Hannon, 2002). The fluorescent protein DsRED will be used for discrimination of transformed roots. Promoter of CCaMK gene is of interest to investigate the hypothesized conserved region. Furthermore, study of CCaMK promoter will provide explanation of the retention of bacteria within infection threads in Parasponia nodules. The target sequence will be acquired by screening the available P. andersonii BAC library.

10

II. RESULTS AND DISCUSSION 1. MtDMI3 complementation Poplar CCaMK gene driven by M. truncatula DMI3 promoter (MtDMI3.CCaMK) and poplar promoter (PtCCaMK.CCaMK) were examined in M. truncatula dmi3 mutant background. This experiment included positive and negative control which are an empty vector introduced into wild type(+) and dmi3 mutant(-) respectively. Co-transformation was done using A. rhizogenes and nodulation was induced by Sinorhizobium meliloti 2011. A. rhizogenes-mediated root transformation induced adventitious transgenic roots that are co-transformed with the gene of interest. The non-destructive selection marker DsRED gene which encodes a red fluorescent protein provides stable and reliable identification of genetically transformed roots. In this experiment, co-transformation efficiency was high with approximately 60% of the newly roots exhibiting red fluorescence. Table 1. Occurrence of nodules post inoculation by Sinorhizobium meliloti 2011

7 days 14 days 21 days

Construct Plant Transgenic Nodule Plant Transgenic Nodule Plant Transgenic Nodule Plant

background Root Root Root

pMtDMI3.PtCCaMK dmi3 mutant 105.0 0.0 22 90.0 5.0 17 170.0 84.0 30

pPtCCaMK.PtCCaMK dmi3 mutant 110.0 0.0 22 114.0 16.0 17 Nd Nd Nd

Empty vector Wild type 81.0 16.0 19 60.0 37.0 15 45.0 131.0 13

Results are the compilation of two independent experiments. Nd: not determined One week post inoculation, root nodules could be observed in wild type plants (Figure 4) while nodules were not visible on dmi3 mutants. After two weeks, some of the M. truncatula wild type nodules developed into typical long pink structures. At the same time, dmi3 mutant roots transformed by pMtDMI3.PtCCaMK formed functional nodules containing bacteria, shown by the expression of GFP (Figure 5). Infection patterns in nodules found on dmi3 mutants complemented by MtDMI3.CCaMK and wild type nodules are similar. Section of both nodules show infection threads in the infection zone and bacteria-filled cells in the fixation zone (Figure 6). Three weeks post inoculation, positive control plants formed a significant high amount of nodules, around 10 nodules per plant. On average 2-3 nodules could be observed per dmi3 mutant transformed by pMtDMI3.PtCCaMK.

11

Figure 6. Sections of nodule 3 weeks post inoculation. Left: Nodule on M. truncatula dmi3 mutant roots transformed by pMtDMI3.PtCCaMK. Right: Nodule on wild type roots transformed by empty vector.

12

Figure 4. Nodule on M. truncatula dmi3 mutant roots transformed by pMtDMI3.PtCCaMK construct. Left: bright field photo; Middle: transgenic root showing DsRed expression; Right: S.meliloti 2011 - GFP showing GFP expression.

Figure 5. Nodule on wild type roots transformed by empty vector. Left: bright field photo; Middle: transgenic root showing DsRed expression; Right: S.meliloti 2011 - GFP showing GFP expression.

Two weeks post inoculation, white and spherical structures were observed on M. truncatula dmi3 mutant roots transformed by pPtCCaMK.PtCCaMK. No infection threads and bacteria could be detected in these nodule-like structures. In previous research, poplar CCaMK under control of native promoter was reported to cause nodulation in dmi3 mutant. However, bacteria were retained within the infection threads. In this experiment, a more severe phenotype was found as cortical cell division was induced but the infection was aborted, leading to formation of non-functional nodules. Data on roots transformed by pPtCCaMK.PtCCaMK three weeks post inoculation were not obtained due to the small number of samples and relatively high mortality of plants.

Figure 7. Sections of nodule-like structures on M. truncatula dmi3 mutant roots transformed by PtCCaMK.PtCCaMK.

Three week post inoculation, functional nodules were found in the negative control (data not shown). It might have been that the dmi3 mutant seed batch was contaminated with A17 seed pods. In addition, on plants transformed with pMtDMI3.PtCCaMK construct, there was one non transformed root that formed nodules. This result might be either because of contamination of the seed batch or the roots were not homogeneously co-transformed.

In conclusion, this experiment confirmed that poplar CCaMK under control of MtDMI3 can restore functional nodule formation in M. truncatula dmi3 mutant. dmi3 mutant roots transformed with pPtCCaMK.PtCCaMK form non-functional nodule-like structures. Range of dmi3 mutant phenotypes complemented by poplar CCaMK driven by native promoter indicates that CCaMK plays a key role in control of rhizobial infection process and release of bacteria from infection thread.

2. Sequencing of Cercis chinensis CCaMK promoter

Degenerate primers for CCaMK of C. siliquastrum were designed based on CCaMK sequences in M. truncatula, L. japonica, and P. trichocarpa. It is predicted that Cercis CCaMK shares the calcium-dependent protein kinase domain with its orthologs (Figure 8). The forward primer is complementary to a region in exon 1 and the reverse primer hybridizes to a region in the exon 2.

13

Figure 8. Intron - exon structure of MtDMI3 and position of the predicted protein domains and motifs (Lévy, 2004).

A PCR experiment with degenerate primers on C. siliquastrum genomic DNA resulted in a 639 bp fragment which comprises 465 bp exhibiting 79%, 81% and 83% similarity to the first exons of poplar CCaMK, MtDMI3 and L. japonicus CCaMK (Appendix III). This sequence was used to design and construct an hybridization probe for screening of the C. chinensis BAC library. 7 BACs containing target sequence were identified to contain the CCaMK sequence. Since the BAC library is approximately 10 times coverage, it appears to have a unique copy of the target gene in the whole genome. 6 BAC DNAs were selected for purification using a general alkaline lysis method. Presence of CCaMK gene was confirmed by a PCR experiment on the BAC DNAs with specific primers.

Table 2. Position of BACs containing target sequence in C.chinensis BAC library

BAC number 1 2 3 4 5 6

Plate number 1 5 5 8 14 46

Well location A3 K6 P4 C24 B10 C3

Subclone libraries were made by digesting purified BAC DNAs with EcoRV and HindIII , digested fragments were subsequently cloned into pJET 1.2/blunt vector. Due to high level of contamination of E. coli genomic DNA, a very high percentage of E. coli DNA sequence was obtained. The BAC DNAs were again isolated from a newly grown culture using the Large Construct Purification kit from Qiagen. Obtained BAC DNAs were pure enough and of sufficient quality to be sequenced directly. Specific reverse primers were designed for subsequent sequencing of the BAC DNA. Around 1kb upstream of transcription site was acquired using this method (Appendix V).

Cercis promoter sequence was aligned with the available conserved promoter regions from legumes Medicago, Pisum, Lotus, Sesbania, Glycine and non legumes Malus, Vitis, Populus, Carica and Ricinus. This multiple alignment shows that the similarity between promoter sequences of Cercis and legumes is higher than that of non legumes and legumes (Figure 9). For example, the 5'-TTTGGCTAAATG-3' fragment is present only in legume CCaMK promoters but not in the reported non legumes. The 3’ end appears to be highly conserved among selected members of legume and non-legume with the exception of papaya. Therefore, the 5’ end is hypothesized to comprise the region that controls the rhizobial infection.

14

3. Parasponia CCaMK Screening of the P. andersonii BAC library A DNA fragment of Cercis CCaMK exon 1 data was used to design the probe for hybridization with filter containing P. andersonii BACs. Moderate to high levels of sequence identity between the hybridization probe from Cercis and the target gene from Parasponia should be sufficient to indentify BACs containing the required insert. Two BACs were identified to contain the CCaMK sequence (table 3) and can be used to obtain the gene of interest.

Table 3. Position of BACs containing target sequence in P.andersonii BAC library

BAC number 1 2

Plate number 60 67

Well location M14 H2

A. rhizogenes-mediated RNAi of P. andersonii CCaMK An RNAi construct was made containing 327 bp of the coding sequence of Cercis CCaMK,

cloned in both sense and anti-sense direction separated by a spacer. Binary vectors containing

15

Figure 9. Conserved promoter region in Cercis in comparison with selected legumes and Malus domestica (apple), Vitis vinifera (grape), Populus trichocarpa (poplar), Carica papaya (papaya) and Ricinus communis (ricin).

the inverted repeat construct and DsRED was introduced into A. rhizogenes MSU440. Successfully transformed bacteria were used to inoculate freshly cut hypocotyls of Parasponia shoots. Positive controls which are shoots transformed with binary vector containing only DsRED were included. Newly formed roots were visible 10 days after inoculation and red fluorescent roots were detected within 24 days. At least 1 co-transformed root could be observed per inoculated seedling. 48 days post inoculation, P. andersonii seedlings were transferred from square plates into perlite and have been grown in the green house. The number of lateral roots, the presence and number of nodules per plant and the structure of nodules can be examined 4 months after inoculation with Rhizobium NGR234. It is hypothesized that the silencing of CCaMK would lead to a severely decrease formation of lateral roots and nodules in genetically transformed roots. A. rhizogenes-mediated RNAi of P. andersonii CCaMK research is ongoing. Since exon 1 of CCaMK is highly conserved between Populus, Cercis, Lotus and Medicago, small interfering RNAs processed from Cercis sequence might be able to serve as guides for degradation of Parasponia CCaMK mRNAs. However, in order to gain more reliable and accurate data, this experiment should be repeated when the Parasponia CCaMK coding sequence is available.

16

III. CONCLUDING REMARKS AND FUTURE WORKS Hypothesized conserve promoter region comprises cis-regulatory elements that have been diverged between poplar (non-legume) and Medicago (legume). However, evolutionary mechanisms responsible for the divergence cannot be determined based on the available data. To answer the research question, further study need to be performed on CCaMKs in Cercis, apple and Chamaecrista: i) Complementation of MtDMI3 using CCaMK promoter; ii) Investigation of the CCaMK conserved promoter region in Chamaecrista. Apple (Malus domestica) is of interest because it would offer additional data of non-legume CCaMK promoter that is phylogenetically between poplar and Medicago (Figure 3). Moreover, the similarity between conserved region of CCaMK promoter of apple and legume is higher than that of poplar and legume. Chamaecrista, belonging to Caesalpinoids, would be an good candidate because of two reasons. First, it is phylogenetically close to Cercis and has the ability to form root nodules. Second, a variety of active N2-fixing zone structure in nodules from retention of bacteria within infection thread to typical legume infected cells has been observed in Chamaecrista. Nodules of Chamaecrista, thus, are considered to be at evolutionary transition from primitive to more advance forms (Naisbitt, 1992). It is hypothesized that similarity of conserved region in CCaMK promoter from Chamaecrista and nodulating legume would be higher than that of Cercis and nodulating legume.

Depending on the outcome of MtDMI3 complementation experiments, we have an indication

whether or not evolution of CCaMK promoter is specific or a result of gradual evolution. - It would fit the gradual evolution hypothesis if there is a gradient of complementation phenotypes from nodulating-legume Chamaecrista to non-nodulating apple: i) Chamaecrista CCaMK promoter restores fully functional nodulation in dmi3 mutant. ii) Nodulation of the mutants complemented by promoter from apple would be blocked in earlier stages than complemented by promoter from Cercis.

- The following findings would support specific evolution hypothesis:

o It would comply nodulating legumes - specific evolution if Chamaecrista CCaMK

promoter fully complement dmi3 mutant whereas CCaMK promoters from Cercis and apple could not restore full nodulation in dmi3 mutant.

o It would fit legume - specific evolution if CCaMK promoter from Chamaecrista and

Cercis could fully restore nodulation dmi3 mutant whereas apple CCaMK could not fully complement dmi3 mutant.

o If CCaMK promoters of Chamaecrista, Cercis and apple which is a non-legume could

fully complement dmi3 mutant, it needs to be verified if specific evolution has been occurred in Populus.

17

Concluding, Cercis CCaMK promoter sequence has been successfully obtained by screening BAC library and sequencing of BAC DNAs without making use of a subclone library. This method can be applied to attain target P. andersonii CCaMK sequence from the identified BACs. Further research on Parasponia CCaMK promoter could lead to supplementary information in the nature of bacterial release and in CCaMK regulation required for symbiotic signaling. In addition, research on RNAi of P.andersonii CCaMK should be repeated using Parasponia CCaMK coding sequence.

18

IV. MATERIALS AND METHODS 1. Study of Medicago truncatula dmi3 mutant infection phenotype Hairy root transformation of Medicago truncatula Seeds of M. truncatula wild type A17 and M. truncatula DMI3 mutant were sterilized by treating them with 96% sulphuric acid and bleach subsequently. The seeds were spread on Färheaus medium containing 0.9% Daichin agar. The plates were sealed completely with parafilm, packed in aluminum foil and stored upside down at 4oC for 48 hours. Afterwards, they were kept in the 21oC growth chamber for 24 hours. Seedlings were transferred to new Färheaus medium plates covering with half-round sterile filter. From now on, the plates were sealed two thirds with parafilm to allow gas exchange. The plants were exposed to light for 5 days. Two different constructs were used in this experiments. They are the Poplar CCaMK gene driven by M. truncatula promoter (MtDMI3.CCaMK) and Poplar CCaMK driven by poplar promoter (PlCCaMK.CCaMK). An empty vector (Cheap) was used as the control. These three vectors were transformed into A.rhizogenes MSU440 carrying the vector containing DsRed. In other to check whether the bacteria contains the desired vector, restriction analyses were performed. Bacteria were spread on LB plates containing 100µg/ml spectomycin and incubated at 28o for 48 hours to obtain a thick layer of cells. Hairy root transformation was done by cutting the hypocotyl of the Medicago seedlings and apply bacteria generously to the wound surface. The bacteria carrying the control vector was used to transform wild type seedlings, the bacteria containing MtDMI3.CCaMK and PtCCaMK.CCaMK were used to transform the DMI3 mutant seedlings. The plates were stored vertically at 21oC. After 6 days, the plant seedlings were transferred to emergence medium supplemented with 300µg/ml Cefotaxime covered with half-round filter. Another half-round filter was used to cover the wound surface. The plates again were stored vertically at 21oC. After 7 days, the plants were transformed to plates containing Färheaus medium with low nitrate supplemented with 300µg/ml Cefotaxime. A single colony of Sinorhizobium meliloti 2011 GFP was used to inoculate 5ml YEM liquid culture supplemented with 10µg/ml tetracycline. The culture was grown at 28o for 48 hours in an orbital shaker. Each of 5ml starter culture was used to inoculate a 1 liter erlenmeyer flask containing 250ml YEM liquid culture supplemented with 10µg/ml tetracycline. The flask was kept at 28o for 48 hours in an orbital shaker. Transgenic plants were selected by screening for DsRed expression in their roots under the fluorescent stereo macroscope. After 4 days on Färheaus medium with low nitrate, the selected transgenic plants were ready to transferred to inoculated perlite. The liquid culture of S.meliloti 2011 GFP was centrifuged for 10 minutes at 3500rpm. The pellet was resuspended in liquid Färheaus medium with low nitrate to get an OD of 0.05. 2 liters of cell suspension was mixed well with 1kg of perlite. The inoculated perlite was used to fill small plastic

19

buckets or plastic pots. The plants were dipped into a cell suspension with an OD of 0.1 before being put into the perlite. The buckets or trays were covered with plastic foil and kept in the 21oC growth chamber. The plastic foil was removed gradually after a few days. The number of nodules was determined after a period of 7 days on 7-10 plants from each of the different construct. The numbers of the root, red root, nodules and red nodules were counted with the fluorescent stereo macroscope. Tissue embedding of roots and nodules from selected plants were done using Technovit 7100 embedding. Thin plastic sections were cut using a microtome and the sections were fixed on microscope slides. These slides were stained with 0.5% toluidine blue in 45 seconds and wash with tap water in 1 minute. Slides were examined with a bright field light microscope and photos were taken with a Nikon digital photo camera. 2. Sequencing of Cersis chinensis CCaMK and Parasponia andersonii CCaMK Degenerate primers for CCaMK of C. siliquastrum were designed based on its orthologs in M. truncatula, L. japonica, and Populus trichocarpa using Primer3Plus (Untergasser, 2007). This primer pair were used for PCR performing on genomic DNA and cDNA of C. siliquastrum and PCR product was used to designed hybridization probe. BAC library screening Prior to hybridization the probe was prepared by diluting 200ng DNA in 25µl H2O in an eppendorf. The eppendorf was boiled for 3 minutes and put on ice, spinned down in a short time and kept on ice, subsequently. 8µl OLB mix, 1µl Klenow polymerase and 2µl (α32P) dNTPs were added subsequently. The mixture was incubated at 37oC for 90 minutes. After 45 minutes, prepare the blot by putting it in the round bottle and adding 25ml Church buffer (1%BSA, 1mM EDTA, 0,5M phosphate buffer and 7% SDS). After 90 minutes, the probe mixture was added to a Sephadex G50 column and TE was used to elute the probe. The two most radioactive fractions was boiled for 3 minutes, quickly put on ice and added to the buffer in the bottle containing the blot. The bottle was kept overnight at continuous rotation in a 60oC stove. In the next day morning, the blot was washed 2 times for 30 minutes at 60oC with 2xSSC + 0.1%SDS and 1xSSC respectively. The blot was carefully packed in plastic foil and exposed for 30 hours to a phosphor screen. Scanning was done using Molecular imager FX system and Quantity One software from BIORAD. BAC subclone libraries The BAC DNAs was isolated (see Appendix 3) and about 5µg DNA was used for digestion. Restriction enzymes which produce blunt ends was selected to digest the BAC DNA. The BACs were digested in a 30µl in total, containing 5µl DNA, 2µl enzyme, 4µl buffer and 19µl H2O. DNA fragments were purified using High Pure PCR Product Purification Kit (Roche). The blunt end fragments obtained from purification were randomly ligated into pJET 1.2/blunt using the GeneJetTM PCR Cloning Kit. The pJET 1.2/blunt vectors containing the BAC DNA fragments were transformed into E. coli electro-competent cells. After transformation, colony PCR were performed with specific primers to indentify vectors

20

containing gene of interest. Specific primers which produce approximately 200 bp products were designed based on the probe sequences. BAC DNA insert sequencing Specific reverse primers were designed for direct sequencing of the BAC DNA. Two primers were used for each sequencing to generate overlap. One was designed to be in the middle and the other was close to the end of the newly sequence data. The process was repeated until the target region was fully sequenced. 3. A. rhizogenes – mediated RNAi of Parasponia CCaMK Preparation of RNAi construct of Parasponia CCaMK Using a PCR approach, a short sequence of CCaMK were obtained and cloned in to pENTR/D TOPO according to the manufacturer protocol. The pENTR/D TOPO harboring DNA target and pDEST destination vector were used in Cloning – Classic LR - Reaction II according to Untergasser A. 2µl of DNA solution was used to transformed 50µl electro competent cells. Cell suspension was spread on LB plate containing 50µg/ml spectinomycin. Successful insertion of the DNA fragment from pENTR vectors into pDEST was confirmed by restriction analysis and sequencing. A.rhizogenes MSU440 were transformed with the vector of interest. Bacteria were spread on LB plates containing 100µg/ml spectomycin and

incubated at 28o for 2 nights.

A. rhizogenes – mediated transformation Parasponia surface-sterilized shoots were prepared by cutting over 1.0cm and were placed on EKM medium cover by sterile half-round filter. Transformed bacteria were applied on the wound surface of the plant. Small needle was used to make a few tiny holes on the stem in order to increase the transformation efficiency. The plates were sealed completely with parafilm and kept vertically in the 21oC growth cabinet. (This step is to prevent the overgrowth of bacteria leading to seedling’s damage). After 4 days, the plant seedlings were transferred to emergence medium supplemented with 300µg/ml Cefotaxime. Another half-round filter was used to cover the wound surface. The plates again were stored vertically at 21oC. After 5 days, the upper filters were removed and the plates were transferred into 28oC growth cabinet. After 14 days, the plants were transferred to WPM supplemented with 300µg/ml Cefotaxime. The plates were sealed completely with parafilm and kept vertically in the 28oC growth cabinet. Transgenic plants were selected by screening for DsRed expression in their roots under the fluorescent stereo macroscope. After 7 days on WPM, the plants were transferred into perlite in plastic buckets. The perlite was prepared by mixing with liquid EKM with double amount of nitrate 1kg of perlite : 2 liters of EKM. The number of plants per bucket should be 2-4. The buckets were covered with plastic foil and kept in the 28oC green house.

21

REFERENCE

1. Allen, O.N. and E.K. Allen. 1981. The Leguminosae: a source book of characteristics, uses and nodulation. The University of Wisconsin Press, Madison.

2. Arrighi, JF et al. 2006. The Medicago truncatula lysine motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes. Plant Physiol. 142: 265– 279.

3. Brewin NJ. 2004. Plant cell wall remodeling in the Rhizobium–Legume symbiosis. Crit. Rev. Plant Sci. 23:293–316.

4. Catoira R, Timmers ACJ, Maillet F, Galera C, Penmetsa RV, Cook D, Denarie J, and Gough C. 2001. The HCL gene of Medicago truncatula controls Rhizobium-induced root hair curling. Development 128:1507–1518.

5. Catoira, R., Galera, C., de Billy, F., Penmetsa, R. V., Journet, E. P., Maillet, F., Rosenberg, C., Cook, D., Gough, C., and Dénarié, J. 2000. Four genes of Medicago truncatula controlling components of a Nod factor transduction pathway. Plant Cell 12:1647-1666.

6. Dénarié J, Debelle F and Promé JC. 1996. Rhizobium lipo-chitooligosaccharide nodulation factors: signaling molecules mediating recognition and morphogenesis. Annu. Rev. Biochem 65:503-535.

7. Esseling JJ, Lhuissier FG and Emons AM. 2003. Nod factor-induced root hair curling: continuous polar growth towards the point of nod factor application. Plant Physiol. 132:1982–1988.

8. Esseling JJ, Lhuissier FG and Emons AM. 2004. A nonsymbiotic root hair tip growth phenotype in NORK-mutated legumes: implications for nodulation factor-induced signaling and formation of a multifaceted root hair pocket for bacteria. Plant Cell 16, 933–944.

9. Fisher RF and Long SR. 1992. Rhizobium-plant signal exchange. Nature 357: 655-660.

10. Foucher F and Kondorosi E. 2000. Cell cycle regulation in the course of nodule organogenesis in Medicago. Plant Mol. Biol. 43:773–786.

11. Gleason C, Chaudhuri S, Yang T, Mun˜oz A, Poovaiah BW and Oldroyd GED. 2006. Nodulation independent of rhizobia induced by a calcium-activated kinase lacking autoinhibition. Nature 441:1149-1152.

12. Godfroy O, Debellé F, Timmers , and Rosenberg C. 2006. A rice calcium- and calmodulin-dependent protein kinase restores nodulation to a legume mutant. Mol. Plant Microbe Interact. 19:495–501.

13. Gualtieri G and Bisseling T. 2000. The evolution of nodulation. Plant Molecular Biology 42: 181–194.

14. Hannon GJ. 2002. RNA interference. Nature 418:244-251. 15. International Rice Genome Sequencing Project. 2005. The map-based sequence of

the rice genome. Nature 436:793-800. 16. Jones KM, Kobayashi H, Davies BW, Taga ME, Walker GC. 2007. How rhizobial

symbionts invade plants: the Sinorhizobium-Medicago model. Nat Rev Microbiol. 5:619–633.

22

17. Kalo P, Gleason C, Edwards A, Marsh J, Mitra RM, Hirsch S, Jakab J, Sims S, Long SR, Rogers J, Kiss GB, Downie JA, Oldroyd GED. 2005. Nodulation signaling in legumes requires NSP2, a member of the GRAS family of transcriptional regulators. Science 308:1786–1789.

18. Kumagai H and Kouchi H. 2003. Gene silencing by expression of hairpin RNA in Lotus japonicus roots and roots nodules. Molecular plant-microbe interactions 8:663- 668.

19. Lancelle SA and Torrey JG. 1984. Early development of Rhizobium-induce root nodules of Parasponia rigida. II. Nodule morphogenesis and symbiotic development. Can J Bot 63: 25-35.

20. Lévy J, Bres C, Geurts R, Chalhoub B, Kulikova O, Duc G, Journet EP, Ané JM, Lauber E, Bisseling T, Dénarié J, Rosenberg C and Debellé F. 2004. A putative Ca2+ and calmodulin-dependent protein kinase required for bacterial and fungal symbioses. Science 303:1361-1364.

21. Limpens E, Ramos J, Franken C, Raz V, Compaan B, Franssen H, Bisseling T and Geurts R. 2004. RNA interference in Agrobacterium rhizogenes-transformed roots of Arabidopsis and Medicago truncatula. J Exp Bot 55: 983-992.

22. Liu Z, Xia M and Poovaiah BW. 1998. Chimeric calcium/calmodulin-dependent protein kinase in tobacco: differential regulation by calmodulin isoforms. Plant Molecular Biology 38: 889–897.

23. Ludwig MZ. 2002. Functional evolution of noncoding DNA. Current opinion in Genetics and Development 12: 634-639.

24. Mitra RM et al. 2004. A Ca2+/ calmodulin-dependent protein kinase required for symbiotic nodule development: Gene identification by transcript-based cloning. Proc. Natl Acad. Sci. USA 101:4701-4705.

25. Mylona P, Pawlowski K and Bisseling T. 1995. Symbiotic Nitrogen Fixation. The Plant Cell 7:869-885.

26. Naisbitt T, James EK and Sprent JI. 1992. The evolutionary significance of the legume genus Chamaecrista, as determined by nodule structure. New Phytologist 122: 487-492.

27. Oldroyd GE and Downie JA. 2004. Calcium, kinases and nodulation signaling in legumes. Nat Rev Mol Cell Biol. 5:566-576.

28. Oldroyd GE, Mitra RM, Wais RJ, and Long, SR 2001. Evidence for structurally specific negative feedback in the Nod factor signal transduction pathway. Plant J. 28:191–199.

29. Patil S, Takezawa D and Poovaiah BW. 1995. Chimeric plant calcium/calmodulindependent protein kinase gene with a neural visinin-like calcium-binding domain. Proc. Natl Acad. Sci. USA 92:4897–-490.

30. Perret X, Staehelin C and Broughton WJ. 2000. Molecular basis of symbiotic promiscuity. Microbiol. Mol. Biol. Rev 64:180-201.

31. Price NPJ, Relic B, Talmont F, Lewin A, Promé D, Pueppke SG, Maillet F, Promé JC and Broughton JC. 1992. Broad-host-range Rhizobium species strain NGR234 secretes a family of carbamoylated, and fucosylated, nodulation signals that are 0-acetylated or sulphated. Molecular Microbiology 6:3575-3584.

23

32. Relić B, Perret X, Estrada-García MT, Kopcinska J, Golinowski W, Krishnan HB, Pueppke SG and Broughton WJ. 1994. Nod factors of Rhizobium are a key to the legume door. Mol Microbiol. 13:171-178.

33. Sathyanarayanan PV, Cremo CR and Poovaiah BW. 2000. Plant chimeric Ca2+ /calmodulin-dependent protein kinase. Role of the neural visinin-like domain in regulating autophosphorylation and calmodulin affinity. J. Biol. Chem. 275:30417–-30422.

34. Smit P, Limpens E, Geurts R, Fedorova E, Dolgikh E, Gough C, Bisseling T. 2007. Medicago LYK3, an entry receptor in rhizobial nodulation factor signaling. Plant Physiology 145:183–191.

35. Smit P, Raedts J, Portyanko V, Debellé F, Gough C, Bisseling T and Geurts R. 2005. NSP1 of the GRAS protein family is essential for rhizobial Nod factor-induced transcription. Science 308:1789–1791.

36. Trinick MJ and Galbraith J. 1980. The Rhizobium requirements of the non-legume Parasponia in relationship to the cross-inoculation concept of legumes. New Phytologist 86:17-26.

37. Trinick MJ. 1979. Structure of nitrogen-fixing nodules formed by Rhizobium on roots of Paraponia andersonii Planch. Can J Microbiol 25: 565-578.

38. Trinick MJ. and Hadobas PA. 1988. Biology of the Parasponia-Bradyrhizobium symbiosis. Plant and Soil 110:177-185.

39. Tuskan GA et al. 2006. The genome of Black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313:1596-1604.

40. Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts, R and Leunissen JA. 2007. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Research, May7, Epub.

41. Untergasser A. “Cloning – Classic LR-Reaction II” Untergasser's Lab. Summer 2006. 10/2009.<http://www.untergasser.de/lab/protocols/lr_classic_gateway_reaction_ii_v1 _0.htm>.

42. Van Spronsen PC, Bakhuizen R, van Brussel AAN and Kljne JW. 1994. Cell wall degradation during infection thread formation by the root nodule bacterium Rhizobium leguminosarum is a two step process. Eur. J. Cell Biol. 64:88-94.

24

Appendix I - Preparation of Electro-competent Cells Materials needed: All materials were autoclaved at 120°C, 20min.

- 1 liter LB without NaCl (10g tryptone, 5g yeast extract)

- 1 liter MQ water

- 250ml glycerol 8.7% v/v

- 250ml cylinder, 4x1liter erlenmeyer flask, 6 centrifuge tubes, 5ml pipet tips, 1.5ml eppendorfs

Procedure: Day 1 Inoculate 10ml LB without NaCl with E.coli DH5α competent cells. Grow overnight at 37°C, 225rpm. Day 2 Keep the cells cold as much as possible and work sterile.

1. Inoculate 1 liter LB without NaCl with the 10ml overnight grown culture and incubate at 37°C, 225rpm until OD600 between 0.4-0.6 is obtained.

2. Keep all flasks on ice for 15min.

3. Pelllet the culture at 3500G for 20min at 4°C in the pre-cooled rotor JA14.

4. Discard supernatant as fast as possible; resuspend the pellet in 6x5 ml ice cold

water by pipetting. Supplement each tube with 50ml ice cold water.

5. Centriguge culture at 4000G for 20min at 4°C.

6. Discard supernatant; resuspend the pellet in 6x5ml ice cold water by pipetting. Pool 3 tubes into 1. Supplement each tube with 100ml ice cold water.

7. Centriguge at 4000G for 20min at 4°C.

8. Discard supernatant; resuspend the pellet in 2x5ml ice cold water by

pipetting. Supplement each tube with 100ml ice cold water.

9. Centriguge at 4000G for 20min at 4°C.

10. Repeat the former two steps 1 more time to wash the cells with water a total of 3 times.

25

11. Discard supernatant; resuspend the pellet in 2x5ml ice cold glycerol 8.7% glycerol. Supplement each tube with 100ml ice cold 8.7% glycerol.

12. Centriguge at 4000G for 20min at 4°C.

13. Discard supernatant; resuspend the 2 pellets in a total volume of 3 ml 8.7% glycerol.

The final volume of cell suspension is about 5-6ml.

14. Make 50µl aliquots in pre-cooled eppendorfs. Store the competent cells at -80°C.

Transformation of Electro-Competent Cells The electro-competent cells were completely thawed on ice. 1-2 µl of the ligation mixture was added to the cells and the solution was mixed gently by pipetting up and down. The cells were transferred into a pre-cooled electroporation cuvet; the suspension should cover the bottom of the cuvet. The voltage of electroporation was 2500 volts (12,5kV/cm), the pulse time should be >4.6 ms. 1ml LB was immediately added to the cuvet and the whole solution was transferred back to the eppendorf. The cells were incubated for 60min at 37 °C, 225rpm. 300 µl of the solution was plated out on LB plates containing ampicillin. The plates were incubated at 37 °C, overnight.

26

Appendix II - BAC DNA Isolation Buffers: ALSI (50mM glucose, 25mM TrisHCl pH8 and 10mM EDTA pH8), store at 4

oC.

ALSII (0.2M NaOH, 1% SDS), store at room temperature. ALSIII pH 4.8 (3M Sodium acetate, 11.5%w/v glacial acetic acid), make fresh. STE (NaCl 0.1M, TrisHCl 10mM, EDTA 1mM) store at 4

oC.

TE (TrisHCl 10mM, EDTA 1mM) store at rom temperature. Day 1 A single colony was used to inoculate 3ml LB liquid culture supplemented with 25µg/ml

chloramphenicol. The culture was grown at 37o for overnight in an orbital shaker. Day 2 50µl of starter culture was used to inoculate a 500ml erlenmeyer flask containing 100ml LB liquid culture supplemented with 25µg/ml chloramphenicol. The flask was grown overnight at 37

o.

Day 3

1. Centrifuge the culture in 50ml tube 4000rpm at room temperature for 10 minutes.

2. Suspend the pellet in 25ml cold STE.

3. Centrifuge the solution at 4000rpm for 10 minutes at room temperature.

4. Resuspend pellet in 4.5ml ALSI supplemented with 0.5ml lysozyme solution.

5. Incubate the solution on ice for 20 minutes.

6. Add 10ml ALSII, leave at room temperature for maxiumum 5 minutes.

7. Add 7.5ml of cold ALSIII, mix well.

8. Incubate on ice for minutes.

9. Centrifuge the solution at 4000rpm for 15 minutes at 4oC, slow breaking.

10. Filter the supernatant using miracloth and small funnels.

11. Add 0.6 volume propanol and mix well.

12. Precipitate the solution at least for 10 minutes at room temperature.

13. Centrifuge the mixture at 4000rpm, 20 minutes, 20

oC.

27

14. Wash the precipitate with 70% ethanol. 15. Dissolve in 0.4ml TE (pH 8.0) and transfer the solution to an eppendorf. Add 1µl

RNAse (10mg/ml) and incubate at 37oC for 30-60 minutes. Mix once in a while. 16. Add 1 volume of phenol/chloroform/isoamylalcohol 25:24:1. 17. Centrifuge for 5 minutes at 4000rpm at room temperature. 18. Transfer the aqueous phase to a new eppendorf and add 1 volume of

chloroform/isoamylalcohol 24:1. 19. Centrifuge the mixture 5 minutes at 4000rpm at room temperature and draw off

the supernatant. 20. Precipitate DNA with 0.1 volume of 3M Sodium acetate pH5.2 and 0.6 volume

isopropanol. 21. Wash the DNA pellet twice with 70% ethanol and dry it by leaving at room

temperature. 22. Dissolve the pellet in 100µl TE pH8 at 60oC by gently pipetting up and down with

a pipette with cut tip. Place at 4oC overnight to ensure complete dissolution of DNA.

23. Measure the DNA concentration by Nanodrop.

28

Appendix III - Conserved region of Cercis CCaMK gene SeqA Name Len(nt) SeqB Name Len(nt) Score ==========================================

1 CsCCaMK 466 2 LjCCaMK 1557 831 CsCCaMK 466 3 PtCCaMK 1566 79 1 CsCCaMK 466 4 MtDMI3 1569 812 LjCCaMK 1557 3 PtCCaMK 1566 772 LjCCaMK 1557 4 MtDMI3 1569 84 3 PtCCaMK 1566 4 MtDMI3 1569 74

========================================== Multiple alignment showing very high similarity between the first exons domain of CCaMKs in C.siliquastrum (CsCCaMK), L.japonicus (LjCCaMK), P.trichocarpa (PtCCaMK) and M. truncatula

29

Appendix IV - Screening Of Bac Library

Scanning of C.chinensis BAC filter showing positions of 7 BACs containing CCaMK

Scanning of P.andersonii BAC filter showing positions of 2 BACs containing CCaMK; 1 BAC containing NFP was also identified ( data used for another experiment).

30

Appendix V - Programs and Primers PCR using proof reading enzyme Primer concentration: 100µM. Make a primer mix with 20µl water, 10µl forward primer, 10µl reverse primer. Use 1µl of primer mix per PCR reaction. The DNA amount should be 1ng per PCR reaction. In 50µl reaction

5x Phusion HF Buffer 10µl

dNTPs (10mM) 1µl

Primer mix 1µl

DNA 1µl

Phusion polymerase 0.5µl

Water 36.5µl

Program

Temperature Time Cycles

98oC 30s

98oC 10s

60oC* 25s 30-40x

72oC 2m30s**

72oC 10m

18oC infinite

* The annealing temperature depends on the primers used.

** Use 30s for each 1kb of the expected PCR product

31

List of primers Name Sequence

Vn-CsDMI3-deg-F ACMAATGAGATWCTTGTRATGAGRMG

Vn-CsDMI3-deg-R CATTTGTTGTTTYTGGCGATT

VN_CsDMI3_F GAGGACTCAAATGGGGTTCA

VN_CsDMI3_R AGGAGCATCCTCCCTGCTAT

VN-PaDMI3 _F CACCGGTGATGAGGAAGATAGTGGAAA

VN_PaDMI3_pro_R1 ACGTGTGGAAGAGGACAGGTAT

VN_PaDMI3_pro_R2 CGGGGATAGGAGCAGTTTTAG

DNA Sequence

For screening of C.chinensis BAC library: Cercis CCaMK 639 bp

caaatgagatacttgtgatgaggaagatagtggaaaacgtttcaccccatccaaatgtgattgagctctatgatgtttatgaggactcaaa

tggggttcatcttgtgctggagctttgttcaggtggtgaactctttgatcggattgtggccataaaatggtataccgagggcggcgccgc

ggctgtggtgaggcagattgccgaaggattagaagctattcatagagctaatattgtccacagggacttgaagcctgagaactgcttatt

ccttgatagcagggaggatgctcctctcaagatcatggactttggtttgagttctgtggaagaatttactgaccctgttgttggtttgtttgga

tccattgattatgtttcaccagaagctctttctcaaggaaagataaccaccaagagtgacatgtggtctctgggagtcattctatatatcttg

ctctccgggtaacttgctactttaagttcttcaatttagtcattctatatatcaataggtttattgccttagacaatttctctctagtaatgaaattc

aatgatttccaggatttaacctcctatgttcttgtaggtatccacctttcattgctcagaataatcgccaaaaacggacaaat C. chinensis CCaMK sequence obtained by screening BAC library 1525 bp

atataaaagaagttatgaaagaaatagttatatattttttcttttatattgaaaacgttgaccatttgaaacatgtcatttgtattacgaattactta

ttaaaaacaataggcaacatggccatttatataatgagctgccggtgtatttaaaaaatgagacgatatttattgagaatcttacttttttaagt

tgggattttaaaaaactaaaaaaaattcgtgtatcaaacattaccttgatgcaattaaaaaaatctaaacttcaaatatagggaaaaaggaa

aaatacacaaaaatacatttgatatcaagcaccctaatttttataataaagatatgtgtcaagcgtgtagatcaactggtaagtagctattct

agcttaaccaagggtctcgggttcaagccattggaaatgcagctgcgtctgttgggagagctttactacctttgtggtcatttctagctcga

aaccgaattagtcgggagaagtttagacaccggtgggtaaccaaaaaaaaaagatgtgtcaatggactcataaaataatcattggtggt

aaattattttatacttgctagctattgatattatacactttgttttcatttttcactttctgttggtgaaaattaaagtcttatgctataaacaagcca

gtctttggcaaaaaagttttcttatttctttttggctaaatgatgaatatgtaaacttataatacaagggcagttgactctatctttgtccattcta

aaactgctcctatccccgatagtttattctcttgtacctatatgtatttcattcatattttatgccataaactaatgcagaaactcccagagggt

gatctcaattctcagccacttcaatccgcgtttgaatatctctcactcgtcatttaacatatacctgtcctcttccacacgtttcatttcatttctc

tagtcttcaagattccatttcaaaggctaagtcagcatgggacaggaaaccagaaggctctctgatgaatacgaagtctcagagatctta

ggaagaggaggattctcagttgtgagaaaaggaaccaaaaaatcaagcagtgaaaatactcaggttgctattaaaacactgagaagg

ataggtacctccactaatccttctggtcatggtggtaacaaattctctatttggagacaagtttccgtatcagatgctttactcgctaatgaga

ttctggttatgaggaagatagtggaaaacgtttcaccccatccaaatgtgattgagctctatgatgtttatgaggactcaaatggggttcat

cttgtgctggagctttgttcaggtggtgaactctttgatcggattgtggccataaaatggtataccgagggcggcgccgcggctgtggtg

aggcagattgcagaaggattagaagctattcatagagctaatattgtccacagggacttgaagcctgagaactgcttattccttgatagc

agggaggatgctcctctcaagatcatggactttgg 32