Everything you wanted to know about DNA but were afraid to ask.

DNA• A molecule that is present in all living

cells and contains the information that determines the traits that a living thing inherits and needs to survive.

DNA• Gives you your characterisitcs• Traits like eye color, height, & hair

texture.

+ DNA’s Two jobs

Instruction manual that builds and maintains cells Able to copy itself each time a cell divides

DNADOUBLE HELIX-Twisted ladder or spiral staircaseSides of ladder are made of molecules of sugar called deoxyribose alternating with molecules of phosphate

The rungs of the ladder are made of nitrogen bases:Adenine AThymine TGuanine GCytosine C

A little History

Rosalind Franklin• She made the first image of an actual DNA

molecule using x-ray diffraction• Through this breakthrough we learned that

DNA has a spiral shape

Watson & Crick• 1953’s they built the first model of

DNA• Won the Nobel Prize

Erwin Chargaff• 1950’s Chargaff found equal amounts

between certain base pairs• Adenine=Thymine• Cytosine=Guanine • Called Chargaff’s Rules

+ Making copies of DNA

This occurs in interphase Adenine always

pairs w/ Thymine

A~~~~~~~~ T Cytosine always

pairs w/ Guanine

C~~~~~~~~G

+ How copies are made

1. DNA unwinds and separates (like a zipper)

2. Bases on the open strand are used as a pattern for the new strand

3. Nitrogen bases that are floating in the nucleus pair up with the bases on each half of the unzipped DNA

4. Half of DNA is old & half is new

+ How DNA works About 2 meters of DNA in every cell of your body It is wound, coiled and bundled to fit inside every cell Order of the bases on one side is a CODE that carries

information Gene- is a piece of that code that gives the cell

information on the trait it controls

+ Reading the Code

ATTGGCCTTGATCCCCCATAGCGATGTGTACACTC The code is read like a book from one end to another They are split up by 3’s AGC is a code for a protein called “serine”

+ When things go wrong!

+ Mutations: the causes DNA damage from environmental agents such as

ultraviolet light (sunshine), nuclear radiation or certain chemicals

Mistakes that occur when a cell copies its DNA in preparation for cell division.

Changes in the number, type, or order of bases on DNA

Types of MutationsDeletion- When a base is left out

Insertion- When a base is added

Substitution - Occurs when the wrong base is used

+ What can happen?

Improved trait No change Harmful trait such as sickle cell disease

Clones • A new organism with an exact copy

of DNA from another organism • This is CopyCat: the first cat clone

Researchers in Texas have cloned a domestic cat, producing a two-month-old kitten called CopyCat.