Engineering Biomaterial-Associated Complement Activation to Improve Vaccine Efficacy

Engineering Biomaterial-Associated Complement Activation toImprove Vaccine EfficacyYuan Liu,†,‡,∥ Ying Yin,§,∥ Lianyan Wang,*,† Weifeng Zhang,†,‡ Xiaoming Chen,†,‡ Xiaoxiao Yang,†

Junjie Xu,*,§ and Guanghui Ma*,†

†National Key Laboratory of Biochemical Engineering, PLA Key Laboratory of Biopharmaceutical Production & FormulationEngineering, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100190, PR China‡University of Chinese Academy of Sciences, Beijing 100049, PR China§Laboratory of Vaccine and Antibody Engineering, Beijing Institute of Biotechnology, Beijing 100071, PR China

ABSTRACT: The complement system plays an important role ininnate and adaptive immunity, which suggests that complementactivation could be exploited as a potential strategy for vaccineadjuvants. Here we explored the potential of chitosan-basedmicroparticles (CS-NH2 MPs) as a vaccine adjuvant with an activesurface for complement activation due to the abundance of aminogroups. In vaccination studies, using recombinant anthrax protectiveantigen as a model antigen, compared with the control microparticles(amino-cross-linked MPs), we found that microparticles (MPs) withabundant amino groups significantly enhanced higher antigen-specificIgG titers in vivo and enhanced the production of IL-4 and IFN-γ with ex vivo restimulation. Furthermore, proliferative responsesof splenocytes to ex vivo antigen restimulation were enhanced following immunization with MPs with amino groups. Overall,these results indicated that CS-NH2 MPs with a high surface density of amino groups were favorable for complement activationand immune responses. Our data provide further design principles for studies on complement-activating MPs as a vaccineplatform.

■ INTRODUCTION

Vaccination is the most effective method to prevent infectiousdiseases. In view of safety issues, more defined vaccines basedon partially purified preparations from the organism orrecombinant subunit proteins have recently been developed.1

However, by themselves, these types of vaccines are often notsufficiently immunogenic due to the lack of an innate immunestimulus.2 Hence, adjuvants generally need to be added to thesetypes of vaccines to facilitate the immune response.3 Inexperimental vaccine formulations, most adjuvants, such asmonophosphoryl lipid A,4 the cytokine CD40 ligand,5 CpGODN,6 and interferon (IFN)-γ,7 are danger signals exertingtheir functions through the activation of Toll-like receptors(TLRs) and inflammatory cytokine receptors. Despite the factthat some promising results were achieved, many complexitiesof these adjuvants remain unclear, such as toxicity of CpGODN, high cost of cytokines, and so on. As an alternativeadjuvant strategy, Reddy et al. explored the possibility of usingthe complement cascade as a danger signal for innate immunity,designing nanoparticles with a surface chemistry thatspontaneously induces complement activation in situ.8

Biomaterials scientists have typically sought to avoid comple-ment activation to minimize effects such as implant rejectionand clearance of systemic drug-delivery vehicles.9−11 However,for vaccine, complement activation is encouraged and it couldgenerate a molecular adjuvant danger signal in situ.8

The complement system is a group of over 40 soluble andcell-surface proteins presented in animal body fluids and on cellsurfaces and serving as a first line of defense against pathogens.Initially, complement was thought to play a major role in innateimmunity, where a robust and rapid response is mountedagainst invading pathogens. However, recently, it is becomingincreasingly evident that complement also plays an importantrole in adaptive immunity involving T and B cells that help inelimination of pathogens, maintaining immunologic memory,and preventing pathogenic reinvasion.12,13

There are three complement activation pathways. Theclassical pathway is triggered primarily by immune complexes(containing antigen and IgG or IgM); the lectin pathway isinitiated by mannan-binding lectin/protein (MBL) andmannan-binding lectin-associated serine proteases (MASP andMASP2); and the alternative pathway is initiated spontaneouslybut is activated by contact with a variety of surfaces, such ascarbohydrate structures on microorganisms and other surfaces.Solid biomaterials (e.g., microparticles, implants, and nano-wires), depending on composition and other physicochemicalproperties, can activate complement via the alternativepathway.14

Received: June 26, 2013Revised: July 19, 2013Published: July 22, 2013

Article

pubs.acs.org/Biomac

© 2013 American Chemical Society 3321 dx.doi.org/10.1021/bm400930k | Biomacromolecules 2013, 14, 3321−3328

pubs.acs.org/Biomac

Incorporation of chemical groups influences complementactivation.15,16 Biomaterial surfaces with free amino groups aregenerally regarded as more dynamic at activating complementthan other surfaces because amino groups are essential for thecovalent binding of C3b.17 Considering the ability ofcomplement to promote antigen-specific immune responses,this study aimed to fabricate a novel kind of adjuvant withabundant amino groups to improve the vaccine efficacy.Chitosan, a cationic polysaccharide with abundant aminogroups, is obtained by the deacetylation of chitin, the majorcompound of exoskeletons in crustaceans. It has been used inmany research fields, including biomedical, agricultural, andenvironmental sciences, due to its biocompatible andbiodegradable nature.18−21 Moreover, microparticles (MPs)have a higher specific surface area, which can therefore provideincreased binding of surface amino groups to C3b. Because ofthese characteristics of chitosan and MPs, we fabricatedchitosan-based MPs (CS-NH2 MPs) with abundant aminogroups in this study to explore whether these MPs could offer apotential active surface for complement activation and furtherinduce adaptive immunity in vivo.

■ MATERIALS AND METHODSMaterials and Reagents. Chitosan was purchased from Yuhuan

Ocean Biochemical (Zhejiang, China); the degree of deacetylation was89%, and the viscosity-average molecular weight was 50 kDa.Hexaglycerin penta ester (PO-500) was supplied by SakamotoYakuhin Kogyo (Japan). Sodium alginate was purchased from AcrosOrganics (Fair Lawn, NJ). Shirasu porous glass (SPG) membraneswith 2.8 μm pore size were kindly provided by SPG Technology(Japan). Premix membrane emulsification equipment (FMEM-500M)was provided by the National Engineering Research Center forBiotechnology (Beijing). Recombinant anthrax protective antigen(rPA) (Mw 83 kDa) was kindly supplied by Beijing Institute ofBiotechnology (China). Human serum was obtained from WHSbio(China). Concanavalin A was purchased from Roche (Germany).Roswell Park Memorial Institute (RPMI) 1640 medium and fetalbovine serum (FBS) were purchased from Gibco (USA). All otherreagents were of analytical grade.Preparation and Characterization of MPs. Premix membrane

emulsification and layer-by-layer (LbL) technology were used toprepare CS-NH2 MPs, as previously described.22 In brief, a mixture ofliquid paraffin and petroleum ether 1:2 (v/v) containing 4 wt % PO-500 emulsifier was used as the oil phase. Alginate (1.0 wt %) wasdissolved in hot water and was used as the water phase. Coarseemulsions were first prepared by low-speed stator homogenization andthen poured into the premix reservoir. Subsequently, microdropletswere obtained by extruding the coarse emulsions through themembrane pores under high pressure. Then, a mini-emulsion ofCaCl2 prepared by dispersing CaCl2 solution (0.5 M) into the oilphase (the same recipe as that mentioned above) by ultrasonication(S450D, Branson Ultrasonics Corporation) was added to the sodiumalginate emulsion as the first step of solidification. The solidificationprocess was continued for 5 h under stirring at 300 rpm. The solidifiedalginate MPs were collected and washed. Then, the MPs weredispersed in 1.4 wt % chitosan acetic acid buffer solution. Afteradsorption of the first chitosan layer, the particles were centrifuged andwashed twice. In the next step, the MPs were incubated in 1.0 wt %alginate solution, followed by centrifugation and another washing step.This LbL procedure was repeated once more to deposit a total of twochitosan bilayers. Before characterization, the CS-NH2 MPs werelyophilized. Similarly, CS-CL MPs were also prepared by premixmembrane emulsification.23 Chitosan (0.5 wt %) dissolved in aceticacid buffer solution was used as the water phase, and glutaraldehyde-saturated toluene (GST) was used as the cross-linking agent. Aftermicrodroplets solidified into MPs, CS-CL MPs were collected andwashed. Prior to characterization, MPs were lyophilized.

The shape and surface features of microspheres were observed by aJEM-6700F scanning electron microscope (SEM; JEOL, Japan).Microspheres were suspended in distilled water, and the dispersionwas dropped on aluminum foil and dried at ambient atmosphere. Thesample was placed on a metal stub and coated with platinum undervacuum by an ion sputter (JFC-1600, JEOL).

The size distribution and zeta potential of MPs were measuredusing the ZetaPlus apparatus (Brookhaven Instruments) by dynamic(DLS) and electrophoretic (ELS) light scattering techniques. Thewavelength of the laser light was 670 nm. Size distributions weredetermined at 90° of the scattering angle of the laser beam and at 15°for zeta potential determination. The experiments were carried out at20 °C.

Endotoxin Levels. The endotoxin level in the final formulationwas determined by the LAL assay method with a commerciallyavailable endotoxin assay kit (Pyrosate 0.25 EU/mL) from Associatesof Cape Cod (Falmouth, MA) according to the manufacturer’sinstructions. All formulations were tested and used only when theendotoxin levels were <0.05 EU/mg MPs.

C3a Detection in Human Serum. A C3a sandwich enzyme-linked immunosorbent assay (ELISA) was performed to measurecomplement activation in human serum following incubation with CS-CL or CS-NH2 MPs. Human serum was incubated at 1:1 (50 μL totalvolume) with either PBS or MPs in Eppendorf tubes at 37 °C for 45min. Serum-MP samples were added to microtiter plates precoatedwith a monoclonal antibody specific to C3a. C3a was detected usingthe color change in biotinylated anti-C3a polyclonal antibodies andhorseradish peroxidase (HRP)-conjugated avidin upon the addition ofTMB substrate. Absorbance was measured at 450 nm with afluorescent microplate reader (TECAN Infinite M200). Backgroundvalues measured at 570 nm were subtracted from absorbancemeasurements to obtain final values.

Animals. Specific pathogen-free female BALB/c mice werepurchased from the Beijing Laboratory Animal Center and housedin a specific pathogen-free facility. Mice aged 6−8 weeks were used forimmunization and histochemical analysis. All animals were treatedaccording to the regulations of Chinese law and the local EthicalCommittee.

Quantitative Real-Time PCR. To analyze inflammatory cytokinegene expression following injection of MPs, we excised the injectionsite 3 h after injection with CS-NH2 MPs or CS-CL MPs. Total RNAwas extracted, reverse-transcribed, and amplified by real-time PCRusing a SYBR Green PCR kit (Bio-Rad, CA) on a CFX96 touch real-time PCR system (Bio-Rad). Threshold cycle (Ct) was used tocalculate the relative template quantity as the manufacturer’srecommendation using β-actin as an internal control. The basic geneexpression level was set at 1 when analyzing the data. The primers(Sangon Biotech, China) used were: forward, TTCAGGCAGGCA-GTATCA, and reverse, CCAGCAGGTTATCATCATCATC for IL-1β; forward, GTTGCCTTCTTGGGACTGATG, and reverse, ACT-CTTTTCTCATTTCCACGATTT for IL-6; forward, GCCTCT-TCTCATTCCTGCTTGT, and reverse, GGCCATTTGGGAACT-TCTCAT for TNFα; forward, TTAAAAACCTGGATCGGAACCAA,and reverse, GCATTAGCTTCAGATTTACGGGT for CCL2; andforward, GGCTGTATTCCCCTCCATCG, and reverse, CCAGTT-GGTAACAATGCCATGT for β-actin.

Histochemical Analysis. Mice were injected with 100 μL of CS-NH2 MPs or CS-CL MPs (5 mg/mL). After 1, 3, and 7 days, the micewere sacrificed, and the injection sites were isolated for histologicalanalyses. All tissue sections were subjected to H&E staining based onestablished protocols.

Immunization. Groups of six mice were immunized bysubcutaneous (s.c.) injection of 200 μL mixture of MPs (CS-NH2and CS-CL) and rPA (20 μg of rPA and 1 mg MPs/mouse/injection)in PBS, or a PBS plus rPA control. The preparations were injectedthree times at an interval of 2 weeks. Blood was collected by tailbleeding at days 14, 28, and 38 after the first immunization. Specificserum antibody titers were measured by ELISA. Thirty-eight days afterthe first immunization, mice were sacrificed, and their spleens werecollected.

Biomacromolecules Article

dx.doi.org/10.1021/bm400930k | Biomacromolecules 2013, 14, 3321−33283322

Determination of Antibody Titers. Direct ELISA was used fordetection of antibodies in the sera of immunized animals. ELISA plates(96-well) were coated with 200 ng/well of rPA in coating buffer (50mM Na2CO3−NaHCO3, pH 9.6) overnight at 4 °C. After washingthree times with PBS containing 0.05% (v/v) Tween 20, the plateswere blocked with 2% (w/v) bovine serum albumin (BSA) in PBS for1 h at 37 °C. Binding of the sera of immunized animals with the coatedantigen was monitored using two -fold dilutions, beginning with a 100-fold dilution. The plates were incubated at 37 °C for 1 h and washedsix times with PBS containing 0.05% Tween 20. Then, HRP-conjugated antimouse antibodies (Sigma) were added to each wellat a 1:2000 dilution, and plates were incubated at 37 °C for 40 min.The plates were washed six times and developed with TMB solution inthe dark for 5 min. The enzyme reaction was stopped by the additionof 2 M H2SO4, and the OD450 of the plates was read using a microplatereader (Bio-Rad).Evaluation of Cytokine Levels by ELISA. At 10 days after the

last immunization, spleens were isolated from mice, and splenocyteswere prepared by grinding between frosted slides. Erythrocytes werelysed by 0.9% ammonium chloride. Next, splenocytes were washedthree times with RPIM1640 supplemented with 10% FBS, and 2.5 ×106 cells were cultured with or without 10 μg rPA or 1 μg/mL ofconcanavalin A (ConA, positive control) in an incubator at 37 °C, 5%CO2, and 95% humidity. Supernatants were harvested at 48 and 72 hand stored at −80 °C until analysis. Levels of IL-4 and IFN-γ weredetermined using ELISA kits according to manufacturer’s protocols(eBioscience, San Diego, CA). Cytokine concentrations in thesupernatants were calculated using a five-parameter curve obtainedfrom the absorbance values of standards provided by the manufacturer.ELISPOT Assay. The frequency of IFN-γ and IL-4 secreting cells

was analyzed using commercial mouse IFN-γ and IL-4 ELISPOT kits(Mabtech, Sweden) following the manufacturer’s instructions. In brief,the cells (5 × 105 splenocytes per well) were added to precoated wellsin triplicate and were incubated for 48 h at 37 °C and 5% CO2 in thepresence of recombinant PA (10 μg/mL). ConA was used as a positivecontrol. After 48 h, the cells were discarded, and the plates werewashed with PBS. Membrane-bound IFN-γ or IL-4 was detected bythe addition of ALP-conjugated cytokine-specific antibodies anddevelopment with BCIP/NBT substrate solution. Spots were counted

using an automated ELISPOT reader (CTL, America). The mean spotnumber ± SD of triplicate wells for each stimulation antigen or controlwas calculated. The results were expressed as the number of antigen-specific spot-forming cells per 106 splenocytes.

Lymphocyte Proliferation Assay. Spleen cells (5 × 105 cells)from immunized mice were seeded in 96-well tissue culture plates (BDFalcon). Cells were incubated with purified rPA protein (10 μg/mL)and incubated at 37 °C with 5% CO2 for 72 h. Cells stimulated withConA (1 μg/mL) and medium alone served as positive and negativecontrols, respectively. Proliferation was assayed with CCK-8 vital stain(Dojindo Laboratories, Gaithersburg, MD). The proliferation index(PI) was calculated as the ratio of the average OD450 value of wellscontaining antigen-stimulated cells to the average OD value of wellscontaining only cells with medium.

Statistical Analysis. All statistical analyses were conducted usingGraphPad Prism5 software (San Diego, CA). Results have beenexpressed as mean ± SEM values. Differences between two meanswere tested using an unpaired, two-sided Student’s t test. Differencesbetween treatment groups were evaluated by one-way ANOVA withsignificance determined by Tukey-adjusted t tests.

■ RESULTS AND DISCUSSION

Characterization of MPs. First, we characterized CS-NH2MPs with abundant amino groups and fabricated CS-CL MPswith few amino groups as a control formulation. SEM analysisrevealed that these two types of MPs were spherical in shape, asshown in Figure 1. By measured the size distribution and zetapotential of MPs, we found that CS-NH2 MPs showed aparticle size of 1002.1 ± 16.9 μm and displayed anelectropositive surface charge with a zeta potential value of22.05 ± 2.46 mV, demonstrating the high surface density ofamino groups. For the cross-linked control formulation, the sizeof the CS-CL MPs was also ∼1.0 μm (1024.9 ± 68.5), and thesurface charge was found to be much less electropositive (1.59± 1.02 mV) than CS-NH2 MPs because most of the aminogroups were consumed by the cross-linking reaction withglutaraldehyde. These data showed that the main difference

Figure 1. (A) Surface chemical structure of two kinds of microparticles. CS-NH2 MPs with abundant free amino groups were fabricated by LBLtechnology (left). The amino groups of CS-CL MPs were cross-linked by glutaraldehyde (right). (B) SEM images of different microparticles: (right)CS-NH2 MPs and (left) CS-CL MPs.



between CS-NH2 MPs and CS-CL MPs was the surfacechemistry of amino groups, supporting the fact that these twotypes of MPs were suitable for evaluating the role of aminogroups on complement activation.CS-NH2 MP Surfaces Activate Complement. Amino

groups, representative nucleophilic groups, are considered to bepotent activators of the complement system via the alternativepathway.16 In the alternative pathway, C3 is activated byspontaneous proteolytic cleavage to form the C3a and C3bfragments. However, C3b has very short life, and unlessstabilized by the membrane or by molecules present on manypathogens, it is quickly inactivated. Certain bacteria or theirproducts, such as peptidoglycan and polysaccharides, canstabilize C3b. Biomaterial surfaces with free hydroxyl andamino groups are generally regarded as more dynamic thanother surfaces with respect to stabilization of C3b because thesefunctional groups are capable of inducing nucleophilic attackson the internal thioester bond in the α-chain of nascent C3b.Moreover, the free amino groups could form amide bonds withC3b, and C3 convertase could bond with Bb. Consistent withthis, low-molecular-weight amines have been shown to reactwith the thioester group of C3 and C3b.24 Reaction allowspowerful amplification reactions by the formation of C3b-generating enzymes, that is, C3 convertases that use plasma C3as a substrate. This positive feedback amplification loop

generates increasing amounts of surface-bound C3b in theclose vicinity of the initial enzyme.25 Because C3a release isindicative of the generation of C3b, we next exposed MPs tohuman serum and observed potent activation, as indicated byC3a release measured by ELISA. C3a release was significantlyenhanced upon exposure to CS-NH2 MPs (Figure 2A). CS-CLMPs also exerted a minimal effect on complement activation,demonstrating that although the surface amino groups werecritical for high levels of complement activation, they were notthe only feature of the MP surface involved in complementactivation.Activation of the complement cascade generates inflamma-

tory factors (C4a, C3a, and C5a), and these can trigger therelease of secondary mediators from a wide range of immunecells that subsequently initiate inflammation in individuals.26 Toconfirm the release of chemokines, we directly assessed theexpression of cytokines, including IL-1β, IL-6, CCL2, andTNFα, in the injection site 3 h after injection of PBS, CS-NH2MPs, or CS-CL MPs. As shown in Figure 2B, injection of CS-NH2 MPs induced much higher inflammatory cytokines whencompared with administration of CS-CL MPs. These resultsindicated that CS-NH2 MPs could increase the release ofsecondary mediators.Because C3a provokes acute inflammatory responses, which

are accompanied by a temporary increase in the number of

Figure 2. CS-NH2 MP surfaces activate complement. (A) MP-induced complement activation, as measured by the presence of C3a in human serumafter incubation with MPs. The results are normalized to the control for serum incubation with PBS. Values are means of three independentexperiments; error bars correspond to the standard error of mean (SEM). (B) In vivo analysis of the amounts of mRNA of inflammatory cytokinesmeasured by real-time RT-PCR, following injection of CS-NH2 MPs or CS-CL MPs. C. Histological changes in tissues surrounding thesubcutaneous injection site. Mice were injected with CS-NH2 MPs or CS-CL MPs. Hematoxylin- and eosin-stained sections obtained at 1, 3, and 7days after injection are shown.



neutrophils and stimulate greater attraction of antigen-presenting cells to the site, we next investigated pathologicalchanges in the subcutis. Tissues surrounding the subcutaneousinjection site of MPs were removed 1, 3, and 7 days afterinjection and stained with hematoxylin and eosin, and the tissuereaction was compared with samples from mice injected withPBS (Figure 2C). Histopathological analysis revealed thatsubcutaneous administration of CS-NH2 MPs or CS-CL MPsstimulated vigorous infiltration of leukocytes into subcutaneoustissues at 1 day after injection. After 3 days, the inflammatoryresponse to CS-CL MPs was minimal, while a severeinflammatory response to CS-NH2 MPs was maintained.These results suggested that animals receiving CS-NH2 MPsshowed more serious and prolonged inflammation at theinjection site than those injected with CS-CL MPs, consistentwith what was observed for C3a release. However, complementactivation is a double-edged sword that not only helps the hostto protect against invaders but also has the potential to inflictdamage to self-tissues. So we also observed the pathologicalchange 7 days after injection. As shown in Figure 2C, nosignificant cellular infiltrate and tissue destruction wereobserved in the CS-NH2 MP treatment group at 7 days afterinjection, indicating that CS-NH2 MPs were safe for use as avaccine-delivery platform for humans and animals.CS-NH2 MP-Enhanced Induction of PA-Specific Anti-

bodies in Mice after Immunization. The role of comple-ment in immunity can be considered to be two-fold: besidesproviding the first innate response to invading pathogens orforeign materials upon activation, the details of the ensuingcascade establish the immunological context directing gen-erated adaptive immune responses.27 Our data thus farindicated that CS-NH2 MPs with a high surface density ofamino groups could effectively induce complement systemactivation; however, whether this activation could furtherimprove the generation of adaptive immunity remained unclear.Therefore, we next evaluated the adjuvant activity of CS-NH2MPs in mice subcutaneously vaccinated with rPA with orwithout MPs. As expected, both groups of MP-treated miceexhibited strong anti-PA IgG responses following vaccination(Figure 3), while injection with rPA alone induced only a weakimmunogenic response. CS-NH2 MPs enhanced the produc-tion of PA-specific antibodies by 300% following primaryvaccination, 1000% following booster immunization (p < 0.01),and 300% following a third immunization (p < 0.05), ascompared with the responses to CS-CL MPs. Collectively,these data showed that CS-NH2 MPs with abundant amino

groups were more effective at enhancing the induction ofantigen-specific antibodies than CS-CL MPs with few aminogroups. During the past three decades, the complement systemhas been firmly identified as the “instructor” of the humoralimmune response.28 It serves as a natural adjuvant, lowers thethreshold for B-cell activation, facilitates the localization ofantigen to follicular dendritic cells (FDCs) in lymphoidfollicles, promotes the development of optimal B-cell memory,and maintains B-cell tolerance. Previous reports havedocumented the ability of complement to promote antigen-specific immune responses. For example, direct conjugation ofantigen to C3b and C3d increased antigen-specific humoralimmunity in vivo.29−31 Reddy et al. also reported that in situfunctionalization of nanoparticles with high ratios of C3b toiC3b enhanced C3-dependent antigen-specific antibody titersin vivo.32 Data from our studies also suggested that CS-NH2MPs with abundant amino groups, offering a potential activesurface for complement activation, could significantly enhanceantigen-specific antibody titers in vivo.

CS-NH2 MP-Enhanced Splenocyte Cytokine Produc-tion after Ex Vivo Restimulation. Another critical feature ofvaccines is the ability to induce cellular immunity. Todetermine whether T-helper cells were activated, splenocytesharvested at the end of each experiment were restimulated withrPA, and the supernatants were evaluated for the secretion ofcytokines, including IL-4 and IFN-γ. After stimulation with rPAfor 48 h, IL-4 levels produced by splenocytes harvested fromCS-NH2 MP-treated mice were significantly higher than thosefrom CS-CL MP-treated mice (Figure 4A; p < 0.01). Injectionof mice with the formulation containing CS-NH2 MPs alsoinduced higher secretion of IFN-γ (Figure 4B).After stimulation with rPA for 72 h, the secretion of IL-4 and

IFN-γ was further enhanced (Figure 4A,B). Moreover, both IL-4 and IFN-γ levels in splenocytes from CS-NH2 MP-treatedmice were obviously higher than those in splenocytes from CS-CL MP-treated mice (p < 0.01). Therefore, immunization withCS-NH2 MPs promoted IFN-γ and IL-4 production, resultingin enhanced antigen-specific T-cell immune responses.

CS-NH2 MP-Generated Efficient T-Cell Recall Re-sponses in Vitro. To assess the cellular immune responseelicited by these two types of MPs, we next determined thefrequencies of IL-4- and IFN-γ-producing cells at the single-celllevel by ELISPOT assay following stimulation of mouse spleenlymphocytes with rPA. Cells treated with CS-NH2 MPsgenerated ∼570 SFU/106 of IL-4 specific splenocytes, whichwas significantly higher than the group treated with CS-CLMPs (p < 0.01, Figure 5). Similarly, the number of IFN-γ-secreting cells generated in response to rPA in mice primedwith CS-NH2 MPs was higher than that in mice primed withCS-CL MPs (p < 0.05). These results were consistent withsplenocyte cytokine production, as measured by ELISA.

CS-NH2 MP-Enhanced Antigen-Specific T-Cell Prolif-eration in Vitro. Splenocyte proliferation in response to 72 hof in vitro stimulation with rPA was observed in splenocytesfrom mice that had been immunized with rPA-CS-NH2 MPs,rPA-CS-CL MPs, or rPA alone but not in splenocytes frommice given PBS only. As shown in Figure 6, splenocytes frommice treated with CS-NH2 MPs displayed the highest PI,followed by those from mice that received rPA-CS-CL MPs.These PI values were quite significantly higher than those ofsplenocytes from mice treated with rPA alone (p < 0.01 and p <0.001, respectively). Taken together, these data showed thatMPs with abundant amino groups were more effective at

Figure 3. CS-NH2 microparticle-enhanced antigen-specific antibodyproduction. PA-specific antibodies were measured by ELISA at 14 daysafter the primary immunization, 14 days after the boosterimmunization, and 10 days after the third immunization. Data areexpressed as the mean ± SEM (n = 6; *p < 0.05; **p < 0.01).



enhancing splenocyte proliferation than MPs with few aminogroups.Recently, complement has been shown to promote T-cell

immunity; however, the molecular mechanisms of this processand the interactions of complement with dendritic cells remainlargely unidentified. Current evidence suggests that T-cellactivation is induced through the presentation of antigen bymature antigen-presenting cells (APCs) in lymph nodes orsecondary lymphoid tissues. The nature of the antigen, theactivation state and phenotypical subtype of the APC, and the

microenvironment (i.e., cytokine and growth factor milieu)determine which effector functions the T cell will acquire (Th1,Th2, Th9, Th17, or a cytotoxic or regulatory phenotype) andwhether the activated T cells will then migrate to aninflammatory site.33 Emerging evidence indicates that comple-ment impacts T-cell immunity during the induction, effector,and contraction phases of an immune response.34 Important invitro findings support these conclusions. For example, APCsisolated from C5aR/C3aR−/− or C3−/− mouse strains produceless IL-12, express lower levels of CD80, and are weaker T cellstimulators than APCs from wild-type animals, while DAF−/−

dendritic cells and macrophages (in which restraint on localcomplement activation is diminished) produce more IL-12 andinduce stronger T-cell responses compared with wild-typeAPCs.35−37 Moreover, maturation of dendritic cells and furtherCD4- and CD8-T-cell responses upon antigen uptake do notoccur in C3-deficient mice.38 In our study, we found thattreatment with CS-NH2 MPs, which have abundant aminogroups, could significantly enhance Th1 and Th2 cytokineproduction with ex vivo restimulation and are more effective atenhancing splenocyte proliferation.

■ CONCLUSIONS

In this study, we explored the potential applications of CS-NH2MPs as a vaccine adjuvant that can offer a potential activesurface for complement activation due to the abundance ofamino groups on the surface of the material. Interestingly, wefound that CS-NH2 MPs with a high surface density of aminogroups were better able to induce complement systemactivation. In the context of vaccination, using rPA as amodel antigen, we found that MPs with abundant aminogroups significantly enhanced antigen-specific antibody titers invivo and cytokine production with ex vivo restimulation.Furthermore, proliferative responses of splenocytes to ex vivoantigen restimulation increased following immunization withMPs having abundant surface amino groups. Overall, theseresults indicated that CS-NH2 MPs with a high surface densityof amino groups contributed to complement activation andimmune responses. These results provide further designprinciples for studies of complement-activating MPs aspotential vaccine platforms.

■ AUTHOR INFORMATION

Corresponding Author*Tel/Fax: 8610-82544931; E-mail: [email protected] (L.Y.W.) Tel/Fax: 8610-63815273; E-mail: xujunjie@sina.

Figure 4. Cytokine production following 48 and 72 h of ex vivo culture. Ten days after the last immunization, splenocytes were cultured with rPA forstimulation of T cells. Production of IL-4 and IFN-γ in the supernatant was measured by ELISA (A,B). Data are expressed as the mean ± SEM (n =6; *p < 0.05).

Figure 5. Robust T-cell responses were generated upon restimulationwith rPA in vitro. Splenocytes from the immunized mice were isolated10 days after last immunization and were restimulated with rPA invitro for 48 h. The Figure shows the number of IL-4 and IFN-γsecreting cells as determined by ELISPOT assay. Data are expressed asthe mean ± SEM (n = 6; *p < 0.05).

Figure 6. Splenocytes isolated from rPA-CS-NH2 MP-vaccinated miceproliferated rapidly upon restimulation with rPA in vitro. Splenocytesfrom mice immunized with rPA-CS-NH2 MPs, rPA-CS-CL MPs, rPAalone, or PBS only were isolated 10 days after the last immunizationand were restimulated with rPA (10 μg/mL) in vitro for 72 h. Theproliferation index was calculated from the ratio of the average OD450value of wells containing antigen-stimulated cells to the average ODvalue of wells containing only cells with medium. Data are expressed asthe mean ± SEM (n = 6; *p < 0.05; **p < 0.01; ***p < 0.001).



mailto:[email protected]



com (J.J.X.). Tel/Fax: 8610-82627072; E-mail: [email protected] (G.H.M.).Author Contributions∥Yuan Liu and Ying Yin contributed equally to this work.NotesThe authors declare no competing financial interest.

■ ACKNOWLEDGMENTSThis work was financially supported by the 863 Program(Grant No. 2012AA02A406), Special Fund for AgroscientificResearch in the Public Interest (Grant No. 201303046), andthe Knowledge Innovation Program of the Chinese Academy ofSciences (Grant No. KSCX2-EW-R-19).

■ REFERENCES(1) Leleux, J.; Roy, K. Micro and Nanoparticle-Based DeliverySystems for Vaccine Immunotherapy: An Immunological andMaterials Perspective. Adv. Healthcare Mater. 2013, 2, 72−94.(2) Coffman, R. L.; Sher, A.; Seder, R. A. Vaccine Adjuvants: PuttingInnate Immunity to Work. Immunity 2010, 33, 492−503.(3) Singh, M.; O’Hagan, D. Advances in Vaccine Adjuvants. Nat.Biotechnol. 1999, 17, 1075−81.(4) Kazzaz, J.; Singh, M.; Ugozzoli, M.; Chesko, J.; Soenawan, E.;O’Hagan, D. T. Encapsulation of the Immune Potentiators MPL andRC529 in PLG Microparticles Enhances Their Potency. J. ControlledRelease 2006, 110, 566−573.(5) Auten, M. W.; Huang, W. T.; Dai, G. X.; Ramsay, A. J. CD40Ligand Enhances Immunogenicity of Vector-Based Vaccines inImmunocompetent and CD4+T Cell Deficient Individuals. Vaccine2012, 30, 2768−2777.(6) Klinman, D. M.; Klaschik, S.; Sato, T.; Tross, D. CpGOligonucleotides As Adjuvants for Vaccines Targeting InfectiousDiseases. Adv. Drug Delivery Rev. 2009, 61, 248−255.(7) Kumar, M.; Behera, A. K.; Hu, J. N.; Lockey, R. F.; Mohapatra, S.S. IFN-Gamma and IL-12 Plasmid DNAs As Vaccine Adjuvant in aMurine Model of Grass Allergy. J. Allergy Clin. Immunol. 2001, 108,402−408.(8) Reddy, S. T.; van der Vlies, A. J.; Simeoni, E.; Angeli, V.;Randolph, G. J.; O’Neill, C. P.; Lee, L. K.; Swartz, M. A.; Hubbell, J. A.Exploiting Lymphatic Transport and Complement Activation inNanoparticle Vaccines. Nat. Biotechnol. 2007, 25, 1159−1164.(9) Thasneem, Y. M.; Sajeesh, S.; Sharma, C. P. Effect of ThiolFunctionalization on the Hemo-Compatibility of PLGA Nanoparticles.J. Biomed. Mater. Res. A 2011, 99A, 607−617.(10) Mizrahy, S.; Raz, S. R.; Hasgaard, M.; Liu, H.; Soffer-Tsur, N.;Cohen, K.; Dvash, R.; Landsman-Milo, D.; Bremer, M. G. E. G.;Moghimi, S. M.; Peer, D. Hyaluronan-Coated Nanoparticles: TheInfluence of the Molecular Weight on CD44-Hyaluronan Interactionsand on the Immune Response. J. Controlled Release 2011, 156, 231−238.(11) Merkel, O. M.; Urbanics, R.; Bedocs, P.; Rozsnyay, Z.; Rosivall,L.; Toth, M.; Kissel, T.; Szebeni, J. In Vitro and in Vivo ComplementActivation and Related Anaphylactic Effects Associated withPolyethylenimine and Polyethylenimine-graft-Poly(Ethylene Glycol)Block Copolymers. Biomaterials 2011, 32, 4936−4942.(12) Heeger, P. S.; Kemper, C. Novel Roles of Complement in TEffector Cell Regulation. Immunobiology 2012, 217, 216−224.(13) Pekkarinen, P. T.; Vaali, K.; Junnikkala, S.; Rossi, L. H.;Tuovinen, H.; Meri, S.; Vaarala, O.; Arstila, T. P. A FunctionalComplement System Is Required for Normal T Helper CellDifferentiation. Immunobiology 2011, 216, 737−743.(14) Moghimi, S. M.; Andersen, A. J.; Ahmadvand, D.; Wibroe, P. P.;Andresen, T. L.; Hunter, A. C. Material Properties in ComplementActivation. Adv. Drug Delivery Rev. 2011, 63, 1000−1007.(15) Toda, M.; Kitazawa, T.; Hirata, I.; Hirano, Y.; Iwata, H.Complement Activation on Surfaces Carrying Amino Groups.Biomaterials 2008, 29, 407−417.

(16) Salvador-Morales, C.; Zhang, L. F.; Langer, R.; Farokhzad, O. C.Immunocompatibility Properties of Lipid-Polymer Hybrid Nano-particles with Heterogeneous Surface Functional Groups. Biomaterials2009, 30, 2231−2240.(17) Camacho, A. I.; Martins, R. D.; Tamayo, I.; de Souza, J.; Lasarte,J. J.; Mansilla, C.; Esparza, I.; Irache, J. M.; Gamazo, C. Poly(methylvinyl ether-co-maleic anhydride) Nanoparticles As Innate ImmuneSystem Activators. Vaccine 2011, 29, 7130−7135.(18) Mao, S. R.; Sun, W.; Kissel, T. Chitosan-Based Formulations forDelivery of DNA and siRNA. Adv. Drug Delivery Rev. 2010, 62, 12−27.(19) Senel, S.; McClure, S. J. Potential Applications of Chitosan inVeterinary Medicine. Adv. Drug Delivery Rev. 2004, 56, 1467−1480.(20) Garcia-Fuentes, M.; Alonso, M. J. Chitosan-Based DrugNanocarriers: Where Do We Stand? J. Controlled Release 2012, 161,496−504.(21) Croisier, F.; Jerome, C. Chitosan-Based Biomaterials for TissueEngineering. Eur. Polym. J. 2013, 49, 780−792.(22) Zhang, Y. L.; Wei, W.; Lv, P. P.; Wang, L. Y.; Ma, G. H.Preparation and Evaluation of Alginate-Chitosan Microspheres forOral Delivery of Insulin. Eur. J. Pharm. Biopharm. 2011, 77, 11−19.(23) Lv, P. P.; Wei, W.; Gong, F. L.; Zhang, Y. L.; Zhao, H. Y.; Lei, J.D.; Wang, L. Y.; Ma, G. H. Preparation of Uniformly Sized ChitosanNanospheres by a Premix Membrane Emulsification Technique. Ind.Eng. Chem. Res. 2009, 48, 8819−8828.(24) Gadjeva, M.; Dodds, A. W.; Taniguchi-Sidle, A.; Willis, A. C.;Isenman, D. E.; Law, S. K. A. The Covalent Binding Reaction ofComplement Component C3. J. Immunol. 1998, 161, 985−990.(25) Ekdahl, K. N.; Lambris, J. D.; Elwing, H.; Ricklin, D.; Nilsson, P.H.; Teramura, Y.; Nicholls, I. A.; Nilsson, B. Innate ImmunityActivation on Biomaterial Surfaces: A Mechanistic Model and CopingStrategies. Adv. Drug Delivery Rev. 2011, 63, 1042−1050.(26) Fischer, M.; Sperling, C.; Tengvall, P.; Werner, C. The Ability ofSurface Characteristics of Materials to Trigger Leukocyte TissueFactor Expression. Biomaterials 2010, 31, 2498−2507.(27) Sarma, J. V.; Ward, P. A. The Complement System. Cell TissueRes. 2011, 343, 227−235.(28) Carroll, M. C. Complement and Humoral Immunity. Vaccine2008, 26, I28−I33.(29) Villiers, M. B.; Villiers, C. L.; Laharie, A. M.; Marche, P. N.Amplification of the Antibody Response by C3b Complexed toAntigen through an Ester Link. J. Immunol. 1999, 162, 3647−3652.(30) Lyubchenko, T.; Dal Porto, J. M.; Holers, V. M.; Cambier, J. C.Cutting Edge: Complement (C3d)-Linked Antigens Break B cellAnergy. J. Immunol. 2007, 179, 2695−2699.(31) Kolla, R. V.; Chintalapati, S.; Sabet, M.; Santelli, E.; Liddington,R. C.; David, M.; Fierer, J.; Guiney, D.; Rickert, R. C. ComplementC3d Conjugation to Anthrax Protective Antigen Promotes a Rapid,Sustained, and Protective Antibody Response. PLoS One 2007, 2.(32) Thomas, S. N.; van der Vlies, A. J.; O’Neil, C. P.; Reddy, S. T.;Yu, S. S.; Giorgio, T. D.; Swartz, M. A.; Hubbell, J. A. EngineeringComplement Activation on Polypropylene Sulfide Vaccine Nano-particles. Biomaterials 2011, 32, 2194−2203.(33) Masopust, D.; Schenkel, J. M. The Integration of T CellMigration, Differentiation and Function. Nat. Rev. Immunol. 2013, 13,309−20.(34) Dunkelberger, J. R.; Song, W. C. Role and Mechanism of Actionof Complement in Regulating T cell Immunity. Mol Immunol. 2010,47, 2176−2186.(35) Heeger, P. S.; Lalli, P. N.; Lin, F.; Valujskikh, A.; Liu, J. B.;Muqim, N.; Xu, Y. Y.; Medof, M. E. Decay-Accelerating FactorModulates Induction of T Cell Immunity. J. Exp. Med. 2005, 201,1523−1530.(36) Liu, J. N.; Miwa, T.; Hilliard, B.; Chen, Y. H.; Lambris, J. D.;Wells, A. D.; Song, W. C. The Complement Inhibitory Protein DAF(CD55) Suppresses T Cell Immunity in Vivo. J. Exp. Med. 2005, 201,567−577.(37) Strainic, M. G.; Liu, J. B.; Huang, D. P.; An, F.; Lalli, P. N.;Muqim, N.; Shapiro, V. S.; Dubyak, G. R.; Heeger, P. S.; Medof, M. E.Locally Produced Complement Fragments C5a and C3a Provide Both






Costimulatory and Survival Signals to Naive CD4(+) T Cells.Immunity 2008, 28, 425−435.(38) Kemper, C.; Atkinson, J. P. T-Cell Regulation: WithComplements from Innate Immunity. Nat. Rev. Immunol. 2007, 7,9−18.



Documents

Engineering Biomaterial-Associated Complement Activation to Improve Vaccine Efficacy