Effects of Lipopolysaccharide Biosynthesis Mutations on K1Polysaccharide Association with the Escherichia coli Cell Surface

Natalia Jiménez,a Sofya N. Senchenkova,d Yuriy A. Knirel,d Giuseppina Pieretti,c Maria M. Corsaro,c Eleonora Aquilini,b Miguel Regué,b

Susana Merino,a and Juan M. Tomása

Departamento de Microbiología, Facultad de Biología, Universidad de Barcelona, Barcelona, Spaina; Departamento de Microbiología y Parasitología Sanitarias, Facultad deFarmacia, Universidad de Barcelona, Barcelona, Spainb; Dipartimento di Chimica Organica e Biochimica, Universita Federico II di Napoli, Complesso Universitario Monte S.Angelo, Napoli, Italyc; and N. D. Zelinsky Institute of Organic Chemistry, Russian Academy of Sciences, Moscow, Russiad

The presence of cell-bound K1 capsule and K1 polysaccharide in culture supernatants was determined in a series of in-frame nonpolar core biosynthetic mutants from Escherichia coli KT1094 (K1, R1 core lipopolysaccharide [LPS] type) forwhich the major core oligosaccharide structures were determined. Cell-bound K1 capsule was absent from mutants devoidof phosphoryl modifications on L-glycero-D-manno-heptose residues (HepI and HepII) of the inner-core LPS and reducedin mutants devoid of phosphoryl modification on HepII or devoid of HepIII. In contrast, in all of the mutants, K1 polysac-charide was found in culture supernatants. These results were confirmed by using a mutant with a deletion spanning fromthe hldD to waaQ genes of the waa gene cluster to which individual genes were reintroduced. A nuclear magnetic reso-nance (NMR) analysis of core LPS from HepIII-deficient mutants showed an alteration in the pattern of phosphoryl modi-fications. A cell extract containing both K1 capsule polysaccharide and LPS obtained from an O-antigen-deficient mutantcould be resolved into K1 polysaccharide and core LPS by column chromatography only when EDTA and deoxycholate(DOC) buffer were used. These results suggest that the K1 polysaccharide remains cell associated by ionically interactingwith the phosphate-negative charges of the core LPS.

Escherichia coli K1 is a facultative pathogen responsible forsevere extraintestinal diseases such as sepsis, meningitis,

cystitis, pyelonephritis, cellulitis, pneumonia, and postopera-tive infections. The production of a polysialic acid K1 capsule,a homopolymer of 5-acetamido-3,5-dideoxy-D-glycero-D-ga-lacto-non-2-ulosonic or N-acetylneuraminic acid (Neu5Ac)residues connected by �2– 8 linkage (24) with a phase-variableO-acetylation at position 7 or 9, is the common pathogenicfeature of these strains (29). The immunological tolerance ofthe K1 capsule by molecular mimicry to the host’s own polysi-alic antigen (oncofetal modification of the neural cell adhesionmolecule [NCAM]) impedes the development of effective vac-cines to prevent diseases caused by the K1 strain.

On the basis of capsule biosynthesis and assembly features,the E. coli capsules have been classified into four groups. TheK1 capsule is, together with the K5 capsule, the model systemfor group 2 E. coli capsules (36). As in other members of group2, the genes directing the biosynthesis of K1 capsule are orga-nized in three distinct functional regions: region 1, kpsFE-DUCS; region 2, neuDBACES, and region 3, kpsMT. Region 2genes appear to be K-serotype specific and are involved in K1biosynthesis while regions 1 and 3 appear to be involved in K1transport and are conserved among members of the E. coligroup 2.

Currently, it is thought that the first committed step in thebiosynthesis of the K1 polysaccharide (K1-PS) is catalyzed by theepimerase NeuC leading to the formation of N-acetylman-nosamine (ManNAc) from UDP-N-acetylglucosamine (UDP-GlcNAc), followed by the synthesis of CMP-N-acetylneuraminic(CMP-Neu5Ac) acid from ManNAc through the action ofNeu5Ac synthase NeuB and CMP-Neu5Ac synthetase NeuA. Theprocessive polysialyltransferase NeuS catalyzes the formation of ahomopolimer of Neu5Ac using CMP-Neu5Ac as a residue donor.

It is also hypothesized that the K1-PS is exported to the outermembrane through a transmembrane protein complex includingATP-binding cassette (ABC)-like transporter proteins KpsM andKpsT, polysaccharide copolymerase protein KpsE, and outermembrane polysaccharide export protein KpsD (reviewed in ref-erence 30). Finally, the group 2 E. coli capsule polysaccharide isthought to be attached at its reducing end to undecaprenyl phos-phate (27), a phospholipid, or to a residue of 3-deoxy-D-manno-oct-2-ulosonic acid (Kdo) located between the lipid and the re-ducing terminal Neu5Ac residue (7, 9), and the lipid domain hasbeen postulated to anchor these capsules to the outer membrane.Nevertheless, only a fraction (20 to 50%) of the isolated capsulepolysaccharides has the lipid substitution, opening the possibilitythat the nonlipidated fraction could be retained at the cell surfacevia ionic interactions (36).

In E. coli five different core lipopolysaccharide (LPS) structuresdiffering mainly in their outer-core structure have been recog-nized (K-12, R1, R2, R3, and R4) (14, 22). Studies based on reac-tions with specific core LPS polyclonal and monoclonal antibodies(4, 12) or on DNA amplification of core-specific diagnostic genes(3) revealed that the R1-type core LPS is the most frequent amongE. coli strains, accounting for about 68% of the studied strains (3).In addition, the R1 core type was found to be the most prevalentone in bacteremia (68%) (1) and septicemia (60%) (12) and toconstitute 100% of the strains of the group B2 of the E. coli refer-

Received 1 March 2012 Accepted 13 April 2012

Published ahead of print 20 April 2012

Address correspondence to Juan M. Tomás, jtomas @ub.edu.

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JB.00329-12

3356 jb.asm.org Journal of Bacteriology p. 3356–3367 July 2012 Volume 194 Number 13

on March 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

ence (ECOR) collection. The group B2 isolates contain knownvirulence genes for strains causing extraintestinal infections, likegenes involved in group 2 capsule biosynthesis.

In a previous work, we have shown that the Klebsiella pneu-moniae K2 capsule, which shares common features with group 1 E.coli capsules, establishes ionic interactions with core LPS negativecharges (10) provided by two galacturonic acid residues present inthe two known K. pneumoniae core LPS types (23, 33). Thus, wedecided to investigate if a similar interaction also occurs in the caseof E. coli K1 capsule. In this study, we used a K1-capsulated E. colistrain with core LPS type R1 to construct a series of nonpolar coremutants to analyze the effect of these mutations on K1 antigeninteraction or association to the cell surface.

MATERIALS AND METHODSBacterial strains, plasmids, and growth conditions. Bacterial strains(Table 1) were grown in Luria-Bertani (LB) broth and on LB agar at 37°C(19). LB medium was supplemented with ampicillin (100 �g ml�1),chloramphenicol (15 �g ml�1), and kanamycin (50 �g ml�1) whenneeded to maintain the different plasmids used (Table 1).

Mutant construction. E. coli KT1094, serotype K1 and with an R1-type core LPS, was used to mutate individual genes by creating in vitroin-frame deletions. Each mutated gene was transferred to the chromo-some by homologous recombination using the temperature-sensitive sui-cide plasmid pKO3 containing the counterselectable marker sacB (17).Mutations were made in the gene neuA involved in the K1 capsule poly-saccharide (CPS) and in eight core LPS biosynthetic genes, waaC, waaF,waaQ, waaP, waaY, waaG, waaO, and waaL. The plasmids containing theindividual engineered in-frame deletions derived from KT1094(pKO3�waaXKT1094, where X denotes the letter for each particular gene)were transformed into KT1094 by electroporation. Mutants were selectedbased on growth on LB agar with chloramphenicol at 42°C to select forplasmid integration and subsequent growth on LB agar containing 5%sucrose to identify second recombinants by loss of the chloramphenicolresistance marker of vector pKO3. The mutations were confirmed by se-quencing of the whole constructs in amplified PCR products. The �waaCmutant was constructed by asymmetric PCR amplifications using KT1094chromosomal DNA and primers waaC-R1-A (5=-CGCGGATCCTCGCTCTCATCA GAACGTC-3=), waaC-R1-B (5=-CCCATCCACTAAACTTAAACAGTGGAGAACATCGCCCATC-3=), waaC-R1-C (5=-TGTTTAAGTTTAGTGGATGGGCAGATGGTTTGTAGGGCTCC-3=) (overlappingregions are underlined), and waaC-R1-D (5=-CGCGGATCCCCGTCTGGCAATGTATGAA-3=). The primers include BamHI sites (indicated byboldface letters). DNA fragments of 606 (waaC-R1-A–waaC-R1-B) and607 (waaC-R1-C–waaC-R1-D) bp were obtained. DNA fragment waaC-R1-A–waaC-R1-B included nucleotide (nt) 4228414, inside waaF, to nt4228989, corresponding to the third base of codon 16 of waaC (nucleotidepositions are according to the genome of E. coli CFT073, GenBank acces-sion number AE014075.1). DNA fragment waaC-R1-C–waaC-R1-D in-cluded the last 33 codons of waaC, nt 4229821 to nt 4230398, inside waaL.DNA fragments waaC-R1-A–waaC-R1-B and waaC-R1-C–waaC-R1-Dwere annealed at their overlapping region (underlined in primers waaC-R1-B and waaC-R1-C) and amplified by PCR as a single fragment usingprimers waaC-R1-A and waaC-R1-D. The fusion product was purified,BamHI digested, ligated into BamHI-digested and phosphatase-treatedpKO3 vector, electroporated into E. coli KT1094, and plated on chloram-phenicol-LB agar at 30°C to obtain plasmid pKO3�waaCKT1094. Oligonu-cleotides waaC-R1-E and waaC-R1-F were used to amplify the mutatedregion by DNA amplification and nucleotide sequence determinationleading to amplicons of 2,493 and 1,562 bp for the wild-type and mutantstrains, respectively. Similarly, seven primers sets of four oligonucleotides(Table 2) were used to construct the seven additional pKO3�waaXKT1094

plasmids (Table 1). The same approach was used to generate an unencap-

sulated derivative of strain KT1094 by generation of an in-frame nonpolarmutation en the neuA gene (Table 1 and 2).

Plasmid constructions for mutant complementation studies. Forcomplementation studies of the nonpolar mutants, neuA and the R1 core typewaa genes were amplified from the strain KT1094 chromosomal DNA byusing primers waaC-R1-E and waaC-R1-F, which were also used for the test-ing of the correspondent mutants (Table 2). Amplified DNA fragments wereligated to pGEM-T Easy (Promega) and transformed into E. coli DH5�. Forcomplementation of the strain KT1094 �waa-Km(pGEMT-hldD) DNAfragments containing genes waaC and waaCF were amplified fromplasmid pWBS10 using oligonucleotides with engineered KpnI andXbaI restriction sites at its ends (Table 2) and ligated to KpnI-XbaI-digested pBAD33 (19) to obtain pBAD33-waaC and pBAD33-waaCF,respectively. DNA fragments containing genes waaQ, waaQG, andwaaQGP were amplified from strain KT1094 using oligonucleotideswith engineered XbaI and HindIII restriction sites at their ends (Table2). The amplified fragments were digested with XbaI and HindIII andligated to XbaI-HindIII-digested pBAD33-waCF to obtain plasmidspBAD33waaCFQ, pBAD33-waaCFQG, and pBAD33-waaCFQGP.These plasmid constructs were tested by nucleotide sequence determi-nation and then electroporated in the corresponding KT1094-derivedmutants for complementation assays.

Immunological methods. Whole cells, culture supernatants, cell sur-face extracts, or chromatographic fraction extracts were analyzed by en-zyme-linked immunosorbent assay (ELISA). ELISAs were performed bydispensing standardized suspensions of each cell or fraction in coatingbuffer (pH 9.6) into 96-well microtiter plates. The plates were left to standovernight at 4°C. The wells were blocked with 1% bovine serum albuminin phosphate-buffered saline for 2 h at 37°C. Anti-K1 polyclonal serum(1:500) was added and incubated for 2 h at 37°C. Detection was performedby using peroxidase-labeled sheep anti-rabbit immunoglobulin G (1:1,000) and 2,2=-azino-di-(3-ethylbenzthiazoline sulfonate) as the sub-strate.

Cell surface extraction and electrophoresis. E. coli cells grown in LBmedium at 37°C were dried and extracted. The phenol-water procedure(35) and the phenol-chloroform-light petroleum ether method (11) wereused for the extraction of O-PS-containing and -deficient LPS, respec-tively. For screening purposes, LPS was obtained after proteinase K diges-tion of whole cells (8). A cell extract fraction containing both LPS and CPSwas obtained using a modified phenol-water method, using phenol andwater (1:1) at 37°C. The resulting aqueous phase was dialyzed (molecular-weight cutoff, 3,500) for 4 days. The sample was ultracentrifuged at100,000 � g at 15°C for 17 h. Successively, the precipitate obtained afterultracentrifugation was dissolved and loaded on a Sephacryl S-200 col-umn, eluted with 50 mM NH4HCO3 first and then with a mixture of 0.2 MNaCl, 10 mM Tris, 0.25% DOC, and 10 mM EDTA. Extracts and fractionswere separated by SDS-PAGE or SDS-Tricine-PAGE using the method ofLaemmli and Favre (16) and visualized by silver and Alcian blue stainingas previously described (28, 15, 2).

Isolation of core LPS OS. The LPS was hydrolyzed in 1% acetic acid(100°C, 90 min), and the precipitate was removed by centrifugation (at2,500 � g for 1 h). The supernatant was evaporated to dryness, dissolvedin water, centrifuged (100,000 � g at 4°C for 4 h), and separated by gelpermeation chromatography on a column (2.5 by 70 cm) of SephadexG-50. The core oligosaccharides (OS) were then separated by high-per-formance anion-exchange chromatography (HPAEC) on a column (4 by250 mm; Dionex Corp.) of CarboPack PA100 which was eluted at 1 mlmin�1, using a linear gradient program of 15 to 40% 1 M sodium acetatein 0.1 M NaOH over 70 min, and isolated fractions were desalted by gelpermeation chromatography on a column (1 by 70 cm) of Sephadex G-10in 10 mM aqueous NH4HCO3.

Compositional analyses. Monosaccharides were analyzed as acety-lated methyl glycosides, which were obtained from the crude LPS (0.5mg). Methanolysis was performed in 1 M HCl/MeOH (0.5 ml; at 80°C for20 h), and the sample was extracted twice with hexane. The hexane layer

Interaction of E. coli LPS Core and K1 Polysaccharide

July 2012 Volume 194 Number 13 jb.asm.org 3357

on March 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

was analyzed by gas chromatography mass spectrometry (GC-MS) toidentify fatty acid methyl esters. The methanol layer was dried and acety-lated with Ac2O and pyridine (100°C, 30 min). The samples were analyzedon a Agilent Technologies gas chromatograph 6850A equipped with a5973N mass selective detector and a Zebron ZB-5 capillary column (Phe-nomenex; 30 m by 0.25-mm internal diameter, flow rate of 1 ml min�1,and He as the carrier gas). Acetylated methyl glycosides were analyzed

accordingly with the following temperature program: 150°C for 3 min,followed by 150°C to 240°C at 3°C min�1.

NMR spectroscopy. Samples were freeze-dried twice from a 99.9%D2O solution and dissolved in 99.95% D2O. Nuclear magnetic resonance(NMR) spectra were recorded on a Bruker Avance II 600-MHz spectro-meter (Germany) at 30°C. Internal sodium 3-trimethylsilylpropanoate-2,2,3,3-d4 (�H 0) was used as a reference for calibration. Two-dimensional

TABLE 1 Bacterial strains, plasmids, and bacteriophages used

Strain, plasmid, or phage Relevant characteristic(s) Reference or source

E. coli strainsW3310 Wild-type, core K-12JC7623 recB21 recC22 sbcB15 27KT1094 K1:O1:H7, LPS core type R1 J. Blancoa

KT1094 �neuA Nonpolar neuA mutant This studyKT1094 �waaC Nonpolar waaC mutant This studyKT1094 �waaF Nonpolar waaF mutant This studyKT1094 �waaQ Nonpolar waaQ mutant This studyKT1094 �waaP Nonpolar waaP mutant This studyKT1094 �waaY Nonpolar waaY mutant This studyKT1094 �waaG Nonpolar waaG mutant This studyKT1094 �waaO Nonpolar waaO mutant This studyKT1094 �waaL Nonpolar waaL mutant This studyKT1094 �waa-Km hldD-waaQ deletion mutant This study

PlasmidspKO3 Cmr sacB temperature-sensitive replication suicide vector 17pKO3�neuA pKO3 with engineered neuA deletion from strain KT1094 This studypKO3�waaC pKO3 with engineered waaC deletion from strain KT1094 This studypKO3�waaF pKO3 with engineered waaF deletion from strain KT1094 This studypKO3�waaQ pKO3 with engineered waaQ deletion from strain KT1094 This studypKO3�waaP pKO3 with engineered waaP deletion from strain KT1094 This studypKO3�waaY pKO3 with engineered waaY deletion from strain KT1094 This studypKO3�waaG pKO3 with engineered waaG deletion from strain KT1094 This studypKO3�waaO pKO3 with engineered waaO deletion from strain KT1094 This studypKO3�waaL pKO3 with engineered waaL deletion from strain KT1094 This studypWSB10 Contains the 5= end of yibB and the gmhD, waaF, waaC, and waaL genes 6pFFM991 pGEMT with a 1,554-bp insert from pWSB10 the 5= ends of yibD and gmhD genes This studypJSC2 Contains the 5= end of waaQ, the waaA and coaD genes, and the 3= end of fgp 5pWSKA Contains the 5= end of waaA and promoter region derived from pJSC2 This studypGA containing the 5= end of yibD and gmhD fused to the 5= end of waaA and the promoter region This studypGKMA pGA with a kanamycin resistance cassette from pUC4K between the gmhD gene and the 5=

waaA promoter regionThis study

pBAD33 Arabinose-inducible expression vector, Cmr 13pBAD33-waaC Arabinose-inducible waaC This studypBAD33-waaCF Arabinose-inducible waaCF This studypBAD33-waaCFQ Arabinose-inducible waaCFQ This studypBAD33-waaCFQG Arabinose-inducible waaCFQG This studypBAD33-waaCFQGP Arabinose-inducible waaCFQGP This studypGEMT PCR-generated DNA fragment cloning vector, Ampr PromegapGEMT-hldD pGEMT with hldD from strain KT1094 This studypGEMT-neuA pGEMT with neuA from strain KT1094 This studypGEMT-waaC pGEMT with waaC from strain KT1094 This studypGEMT-waaF pGEMT with waaF from strain KT1094 This studypGEMT-waaQ pGEMT with waaQ from strain KT1094 This studypGEMT-waaG pGEMT with waaG from strain KT1094 This studypGEMT-waaP pGEMT with waaP from strain KT1094 This studypGEMT-waaY pGEMT with waaY from strain KT1094 This studypGEMT-waaO pGEMT with waaO from strain KT1094 This study

PhagesP1clr100 Temperature sensitive, Cmr 25K1 K1-specific bacteriophage 20

a Laboratorio de Referencia de E. coli (Spain).

Jiménez et al.

3358 jb.asm.org Journal of Bacteriology

on March 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

TABLE 2 Oligonucleotides used for mutant construction and gene complementation

Construct and primername 5=–3= Sequence Product size(s) (bp [primer pair])

KT1094 �waaCwaaC-R1-A CGCGGATCCTCGCTCTCATCAGAACGTCwaaC-R1-B CCCATCCACTAAACTTAAACAGTGGAGAACATCGCCCATC 606 (A/B)waaC-R1-C TGTTTAAGTTTAGTGGATGGGCAGATGGTTTGTAGGGCTCCwaaC-R1-D CGCGGATCCCCGTCTGGCAATGTATGAA 607 (C/D)waaC-R1-E CTATATCGCGCTGGCCTATwaaC-R1-F TCGACCGTGTTGCATTATC 2,493 (wild type; E/F), 1,562 (mutant; E/F)

KT1094 �waaFwaaF-K12-A CGCGGATCCCGTTCCTGTACGCTTCTTCwaaF-K12-B CCCATCCACTAAACTTAAACATCATCATCATGTCGCCAACC 691 (A/B)waaF-K12-C TGTTTAAGTTTAGTGGATGGGATCGACATTACTCCCCAGCwaaF-K12-D CGCGGATCCAAATACGGCATATTCGCCAG 648 (C/D)waaF-K12-E AGCAACATCGTTAAAGCCCwaaF-K12-F TGATTCTTCCCATACCCACC 2,837 (wild type; E/F), 1,925 (mutant; E/F)

KT1094 �waaLwaaL-R1-A CGCGGATCCGGGTCTTTACTTTTCGATTTTTwaaL-R1-B CCCATCCACTAAACTTAAACAATCCCACAAAGACAAAGTCA 726 (A/B)waaL-R1-C TGTTTAAGTTTAGTGGATGGGACTGCTGTGTTTGTCACCATwaaL-R1-D CGCGGATCCAGTCTGGGCTATAGCAAACC 708 (C/D)waaL-R1-E GCGCTACAAGCAAAGAACTAwaaL-R1-F GCGCAAGGACAGTTTATATG 2,844 (wild type; E/F), 1,783 (mutant; E/F)

KT1094 �waaQwaaQ-R1-A2 CGCGGATCCAGGTAGAGAAGGGCGGTGTwaaQ-R1-B CCCATCCACTAAACTTAAACATTTTGCGTCAGGGTAATTT 588 (A/B)waaQ-R1-C TGTTTAAGTTTAGTGGATGGGCGTGACCGAAATGAGATGTwaaQ-R1-D2 CGCGGATCCACGGAAGATTTCACGGCTA 689 (C/D)waaQ-R1-E AACGTGCTGAACATCCTTCwaaQ-R1-F GGAACGATCGACACCTTTA 2,421 (wild type; E/F), 1,595 (mutant; E/F)

KT1094 �waaGwaaG-R1-A CGCGGATCCTCGTTGGTGAAGCAGACAACwaaG-R1-B CCCATCCACTAAACTTAAACAAACCCGAACATGATGACCTC 731 (A/B)waaG-R1-C TGTTTAAGTTTAGTGGATGGGCGCGACATTATGCTGATACAwaaG-R1-D CGCGGATCCCCGGTGCAGGTCAATTACT 675 (C/D)waaG-R1-E CGCTTATTAAATGCCCGTGTwaaG-R1-F CCCTTGTTCCTGCTTGAGAA 2,592 (wild type; E/F), 1,679 (mutant; E/F)

KT1094 �waaOwaaO-R1-A CGCGGATCCTCATTGCGGATGCCAGTATwaaO-R1-B CCCATCCACTAAACTTAAACAGCCATAAGCAACATGGAATG 753 (A/B)waaO-R1-C TGTTTAAGTTTAGTGGATGGGGCTCGTTATTGCGCTAAGCAwaaO-R1-D CGCGGATCCCCCTCGTAAAAGCGTGAGTAA 745waaO-R1-E GGACATCATAACGGGTGGTCwaaO-R1-F CGATATTCAACGCATCCTGA 2,524 (wild type; E/F), 1,729 (mutant; E/F)

KT1094 �waaYwaaY-R1-A CGCGGATCCACGCGACATACTTCAGGGTAwaaY-R1-B CCCATCCACTAAACTTAAACAAAATGAGAAGCCGCGATAGC 767 (A/B)waaY-R1-C TGTTTAAGTTTAGTGGATGGGCGTCACCTGGGTATTGCCAAwaaY-R1-D CGCGGATCCATCATTTTTCGCCCATGCTT 739waaY-R1-E GCTGGCGTTTCAATTTCTTCwaaY-R1-F TCTGGCAGGGATAATTCGTC 2,459 (wild type; E/F), 1,928 (mutant; E/F)

KT1094 �waaPwaaP-R1-A CGCGGATCCCAGCCAATAGCCGTGAAATCwaaP-R1-B CCCATCCACTAAACTTAAACAACGAAATACCTCACCCTGCA 702 (A/B)waaP-R1-C TGTTTAAGTTTAGTGGATGGGGCCACAAAAATCAGGGAAAGwaaP-R1-D CGCGGATCCAGCATCGCGTTCAGTAACAA 573

(Continued on following page)

Interaction of E. coli LPS Core and K1 Polysaccharide

July 2012 Volume 194 Number 13 jb.asm.org 3359

on March 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

(2D) NMR spectra were obtained using standard Bruker software, and theBruker TopSpin, version 2.1, program was used to acquire and process theNMR data.

Mass spectrometry. Electrospray ionization (ESI) mass spectra wererun in the negative ion mode using a micrOTOF II instrument (BrukerDaltonics). Mass spectra were acquired using standard experimental se-quences as provided by the manufacturer. Samples (�50 ng �g l�1) weredissolved in a 1:1 (vol/vol) water-acetonitrile mixture and sprayed at aflow rate of 3 �l min�1. Capillary entrance voltage was set to 4.5 kV, andexit voltage was set to �150 V; drying gas temperature was 180°C.

RESULTSEffect of R1 core LPS mutants in K1 capsule. In order to assess thepossible interaction between K1 capsule and LPS, we decided toconstruct a series of nonpolar in-frame mutants in the neuA gene,coding for a CMP-Neu5Ac synthetase involved in the biosynthesisof K1 CPS, and in several genes involved in core LPS biosynthesis.Since most of the K1-encapsulated strains contain an R1-type coreLPS, these mutants were constructed in E. coli KT1094 producing

K1 capsule and R1-type core LPS, as determined by DNA frag-ment amplification using R1 core-specific diagnostic oligonucle-otides (3). The E. coli KT1094 �neuA strain was devoid of K1 CPS,as evidenced by its resistance to K1-specific phage K1 and the lackof reactivity to an anti-K1 polyclonal antibody in ELISAs usingwhole cells. Analysis of LPS from E. coli KT1094 �neuA in SDS-Tricine-PAGE showed no differences in the mobility patterns be-tween the mutant and wild-type strains (Fig. 1A, lanes 1 and 2).

LPS samples obtained from strain KT1094-derived nonpolarin-frame waa mutants were analyzed by SDS-Tricine-PAGEwhich showed the expected mobility shift due to core LPS trunca-tions (Fig. 1). Among the studied mutants, only LPS from strainsKT1094 �waaQ and KT1094 �waaY (Fig. 1A, lanes 3 and 4) re-tained the ability to produce full O antigen, while only a faintamount of O antigen was apparent for KT1094 �waaP (Fig. 1A,lane 5).

To determine the effect of each core LPS mutation on K1 cap-sule, these mutants were assayed for sensitivity to phage K1 using

TABLE 2 (Continued)

Construct and primername 5=–3= Sequence Product size(s) (bp [primer pair])

waaP-R1-E CGGGCTGGACGTTTATTATGwaaP-R1-F GGAAACGACGGCTTTATCAG 2,300 (wild type; E/F), 1,655 (mutant; E/F)

KT1094 �neuA89neuA-A2 CGCGGATCCCCCCTTTTGACGAAGACTC89neuA-B CCCATCCACTAAACTTAAACAACTACGGGCTGGAATTATC 817 (A/B)89neuA-C TGTTTAAGTTTAGTGGATGGGGAAAACGAAATAGCGGAGAT89neuA-D2 CGCGGATCCCCAGTGTCAGCGTTACTGC 79989neuA-E GCTATTGCACCTAAGGCAG89neuA-F AGTTCCCAATTAGCCCACA 3,017 (wild type; E/F), 1,850 (mutant; E/F)

KT1094 �waa-Km1999-1 GAATTCTTTCCATTTATGCTG1999-2 TCGGTGATATCACCGTTGT 1,554RFAF TTTGCATCAGGATAATTCTGCRFAR ACCACGTTCAACCAGTGAA 1,511

pGEMT-hldDHldD1 GAAGGTTACAGTTATGATCATCGHldD2 GGAGCGTGCGATAGAGACTT 1,028

pBAD33-waaCC1 CGGGGTACCAGCGCGTACTGGAAGAACTCC2 CGCTCTAGATTAAATCATGGCAGCTTTTTCA 1,034

pBAD33-waaCFF1 CGGGGTACCTGAATCGTGACGCATAAGAGC2 CGCTCTAGATTAAATCATGGCAGCTTTTTCA 2,057

pBAD33-waaCFQQ1 CGCTCTAGAAGAGTTACTTGTGGATAAGCCATTTCQ2 CCCAAGCTTCGGCAACTGTCTGAGCAATA 1,150

pBAD33-waaCFQGQ1 CGCTCTAGAAGAGTTACTTGTGGATAAGCCATTTCG1 CCCAAGCTTCCTCACCCTGCAAGGTTTTA 2,264

pBAD33-waaCFQGPQ1 CGCTCTAGAAGAGTTACTTGTGGATAAGCCATTTCP1 CCCAAGCTTCGGAAATTACAACGATTTTCG 2,986

Jiménez et al.

3360 jb.asm.org Journal of Bacteriology

on March 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

as controls E. coli KT1094 (K1 capsule positive [K1�]) andKT1094 �neuA (K1 capsule negative [K1�]). The results obtained(Table 3) showed that no differences were detected between wild-type KT1094 and KT1094 �waaL (O antigen ligase mutant), indi-cating that the absence of O antigen did not affect the presence ofK1 capsule on the cell surface. The efficiency of plating (EOP) forphage K1 also remains unchanged in E. coli KT1094 �waaO[UDP-glucose:(glucosyl) LPS �1,3-glucosyltransferase mutant),suggesting that the presence of a core lacking four hexose (Hex)residues from the outer core [KdoHep(PPEtN)Hep(P)(Hep)Glc,where P is phosphate and PPEtN is pyrophosphorylethanol-amine] does not affect the expression and localization on the cellsurface of the K1 capsule. In contrast, inner-core LPS mutantsKT1094 �waaC (heptosyltransferase I mutant), KT1094 �waaF(heptosyltransferase II mutant), and KT1094 �waaP (unphos-phorylated L-glycero-D-manno-heptose I [HepI] mutant) becamecompletely resistant to phage K1 as well as outer-core mutantKT1094 �waaG [UDP-glucose:(heptosyl) LPS �1,3-glucosyl-transferase mutant] (Table 3). Inner-core mutants KT1094�waaY (unphosphorylated HepII mutant) and KT1094 �waaQ(heptosyltransferase III mutant) were still sensitive to phage K1but showed a clear reduction in EOP values compared to wild-type strain KT1094 levels (Table 3). To confirm the results ob-served for this series of core LPS mutants, another approach was

used to measure K1 capsule in these strains based on an ELISAwith anti-K1-specific polyclonal antibodies yielding results equiv-alent to those found using phage K1 (Table 3). Genetic comple-mentation of mutants showing increased resistance to phage K1restored wild-type levels of phage sensitivity and K1 capsule pro-ductions as determined by ELISA (data not shown). These resultssuggest that changes in the inner-core LPS structure could affectthe production and/or localization of the K1 capsule antigenon the cell surface. To differentiate between these two possibilities,the amount of the K1-PS was determined in the culture superna-tants of the mutant strains by ELISA (data not shown). The K1-PSwas found in the supernatant of all of the waa mutants, indicatingthat mutation in the inner-core LPS do not affect the productionof K1-PS. Furthermore, a 7-fold increase in K1-PS was found inthe culture supernatant of mutants KT1094 �waaF, KT1094�waaP, and KT1094 �waaG and a 2-fold increase in that of mu-tants KT1094 �waaQ and KT1094 �waaY compared to that ofKT1094 �waaL and KT1094 �waaO.

Core LPS structure of KT1094-derived mutants. In order toreveal a possible correlation between the core LPS structureand the expression of K1 capsule, we studied by ESI mass spec-trometry and/or NMR spectroscopy the chemical structure ofthe LPS for each of the core LPS nonpolar mutants constructedin this work; to facilitate this study nonpolar waaQ and waaY

FIG 1 Polyacrylamide gels showing the migration of LPS from E. coli KT1094 and derived nonpolar waa mutants. Shown are SDS-Tricine-PAGE analyses of LPSfrom E. coli mutants containing (A) and lacking (B) O antigen. (A) LPS samples from KT1094 (lane 1), KT1094 �neuA (lane 2), KT1094 �waaY (lane 3), KT1094�waaQ (lane 4), KT1094 �waaP (lane 5), and KT1094 �waaL (lane 6). (B) LPS samples from KT1094 (lane 1), KT1094 �waaL (lane 2), KT1094 �waaO (lane3), KT1094 �waaG (lane 4), KT1094 �waaF (lane 5), and KT1094 �waaC (lane 6).

TABLE 3 Determination of K1 capsule antigen in E. coli strain KT1094 and waa gene mutants

E. coli strain Core OS structure EOPa OD405b

KT1094 KdoHep(PPEtN)Hep(P)(Hep)GlcGlc(Glc)GalGal 1 1.8 0.15KT1094 �neuA KdoHep(PPEtN)Hep(P)(Hep)GlcGlc(Glc)GalGal 0.001 0.1KT1094 �waaL KdoHep(PPEtN)Hep(P)(Hep)GlcGlc(Glc)GalGal 1 1.7 0.12KT1094 �waaO KdoHep(PPEtN)Hep(P)(Hep)Glc 0.99 1.6 0.09KT1094 �waaG KdoHepHep 0.1 0.1KT1094 �waaQ KdoHep(PPEtN)Hep(P)GlcGlc(Glc)GalGal 0.50 0.4 0.03KT1094 �waaY KdoHep(PPEtN)Hep(Hep)GlcGlc(Glc)GalGal 0.25 0.3 0.03KT1094 �waaP KdoHepHepGlc 0.001 0.1KT1094 �waaF KdoHep 0.001 0.1KT1094 �waaC Kdo 0.001 0.1a K1 capsule was measured by determination of the multiplicity of infection (EOP) to K1 capsule-specific phage K1.b K1 antigen detection by ELISA with K1-specific polyclonal antibody. OD405, optical density at 405 nm.

Interaction of E. coli LPS Core and K1 Polysaccharide

July 2012 Volume 194 Number 13 jb.asm.org 3361

on March 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

mutants were constructed in KT1094 �waaL to obtain doublemutants KT1094 �waaL �waaQ and KT1094 �waaL �waaY.The core OS structure for mutants retaining the full sensitivityto phage K1 was, as expected, based on the known waa genefunctions. Two-dimensional NMR spectroscopic studies of theOS fraction from E. coli KT1094 �waaL confirmed the presenceof the full R1 core structure reported earlier (32). The massspectrum of the core OS from this strain (Fig. 2A) showed[M-H]� ion peaks at m/z 1,703.48, 1,783.45, 1,826.49, and1,906.46 corresponding to Hex5Hep3KdoP1, Hex5Hep3KdoP2,Hex5Hep3KdoPPEtN, and Hex5Hep3KdoP1PPEtN oligosac-charides, respectively. Each of these peaks was accompanied bya peak differing in 18 u for the corresponding compounds with

the Kdo residue in an anhydro form. These data are in agree-ment with the reported R1 core structure as well (Table 3). Asimilar analysis showed that the core OS structure from E. coliKT1094 �waaO corresponds to the whole inner core plus oneouter-core hexose residue (data not shown) (Table 3).

While KT1094 �waaL and KT1094 �waaO mutants showedphosphoryl modifications in their core LPSs, mutants that areresistant to phage K1 and thus devoid of K1 capsule showed nophosphorylation of the core. Data from E. coli KT1094 �waaC, E.coli KT1094 �waaF, E. coli KT1094 �waaP, and E. coli KT1094�waaG revealed major core OS structures of Kdo, HepKdo,HexHep2Kdo, and Hep2Kdo, respectively (data not shown) (Ta-ble 3).

FIG 2 ESI mass spectra of acid-released core LPS OS. Shown are spectra from E. coli KT1094 �waaL (A), E. coli KT1094 �waaL �waaY (B), and E. coli KT1094�waaL �waaQ (C) mutants. Shown are the regions of [M-H]� ion peaks.

Jiménez et al.

3362 jb.asm.org Journal of Bacteriology

on March 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

Mutants with a decreased amount of K1 capsule showed a reducedlevel of phosphorylation. The mass spectrum of the core OS fractionfrom E. coli KT1094�waaL�waaY (Fig. 2B) showed [M-H]� ion peaksfound in the OS fraction of E. coli KT1094 �waaL at m/z 1,685.47 and1,808.47 for Hex5Hep3KdoP1 and Hex5Hep3KdoPPEtN, with Kdoin an anhydro form, respectively, but was devoid of ion peaks forHex5Hep3KdoP2 andHex5Hep3KdoP1PPEtNoligosaccharides. Inaddi-tion, a [M-H]� ion peak at m/z 1,605.50 corresponding to a nonphos-phorylated Hex5Hep3Kdo oligosaccharide was found in the OS fractionfrom E. coli KT1094 �waaL �waaY while this peak was absent from themass spectrum of the E. coli KT1094 �waaL core OS.

The mass spectrum of the OS fraction from E. coli KT1094 �waaL�waaQ (Fig. 2C) showed [M-H]� ion peaks at m/z 1,413.44, 1,493.39,1,573.36, 1,616.39, and 1,696.36 for Hex5Hep2Kdo, Hex5Hep2KdoP1,Hex5Hep2KdoP2, Hex5Hep2KdoPPEtN, and Hex5Hep2KdoP1PPEtNoligosaccharides, respectively. Therefore, in agreement with a heptosyl-transferase III function for the WaaQ protein (38), the core OS from E.coliKT1094�waaL�waaQ lacksHepIII.Acloser inspectionofthismassspectrumtogetherwithNMRanalysisrevealedasignificantchangeintherelative abundance of phosphoryl modifications on HepI and HepIIcomparedtothoseofE.coliKT1094�waaL.Thedatapresented inTable4 show 8- and 14.5-fold reductions in the percentages of HepI(P)HepII(P) and HepI(PPEtN)HepII(P) species in E. coli KT1094 �waaL�waaQ compared with E. coli KT1094 �waaL. These distinctions couldbe responsible for the different behaviors of these two mutants in capsuleK1 detection by phage K1 sensitivity or ELISA.

Core LPS K1 interaction. A possible interpretation for theabove results could be the existence of a direct ionic interactionbetween the core LPS region and the K1 capsule antigen. In orderto study this possibility, the KT1094 �waaL mutant cells wereextracted by phenol-water at 37°C in order to reduce the extent ofdepolymerization of the capsular polysaccharide (CPS) (21).

The sample was analyzed by SDS-PAGE and stained with Al-cian blue as well as silver nitrate (data shown for silver nitrate),which revealed that both the LPS and the CPS were present. More-over, the GC-MS analysis of the acetylated methyl glycosidesshowed the presence of Gal, Glc, Hep, GlcN, and Kdo belonging tothe core LPS region, together with the neuraminic acid corre-sponding to K1 CPS.

A partial separation between LPS and CPS was achieved byultracentrifugation. Both the supernatant and the precipitate were

analyzed by SDS-PAGE and GC-MS sugar analysis, revealing thatonly CPS was present in the supernatant, while both LPS and CPSwere present in the precipitate. Repeating the process did not im-prove the separation.

The precipitate obtained after ultracentrifugation was split intwo aliquots, the first of which was loaded on a Sephacryl S-200column and eluted by 50 mM NH4HCO3. The chromatogramshowed the presence of two peaks (data not shown). SDS-PAGEanalysis revealed that both peaks contained LPS together withCPS. The presence of two peaks was probably due to the differentsizes of the LPS molecular aggregates. The second aliquot waschromatographed on the same column, this time eluting with abuffer of increased ionic strength (0.1 M NaCl and 10 mM Tris),which contained the metal ion chelator EDTA and the dissociatingdetergent DOC. In this case, the chromatogram showed the pres-ence of three peaks (Fig. 3A), named A, B, and C. These threepeaks were obtained only when EDTA was present in the elutingbuffer (Fig. 3B). The chemical composition of these three peaksdetermined by GC-MS of the acetylated methyl glycosides re-vealed the presence of LPS residues in peaks B and C and K1 CPSresidue in peaks A and B. Furthermore, ELISAs with anti-K1 poly-clonal antibody showed the presence of K1 antigen in peaks A(A660 of 1.8) and B (A660 of 0.5) but not in C (A660 of 0.1). Thematerial from these peaks was subjected to SDS-Tricine-PAGE

TABLE 4 Percentage of phosphorylated core OS variants from E. coliKT1094 �waaL and KT1094 �waaL �waaQ mutants

Strain and mass (Da)of core OS

Substituenton HepI

Substituenton HepII Content

% oftotala

E. coli KT1094 �waaL1,704 P 76 28.51,784 P P 103 38.61,827 PPEtN 26 9.71,907 PPEtN P 62 23.2

E. coli KT1094 �waaL�waaQ

1,512 P 83 67.51,592 P P 6 4.91,635 PPEtN 32 26.01,715 PPEtN P 2 1.6

a The percentage was calculated using the intensities of the [M-H]� ion peaks for thecomponents in the mass spectrum of the isolated core OS.

FIG 3 LPS and K1 CPS separation on a Sephacryl S-200 column. (A) Cellextract from E. coli KT1094 �waaL containing both LPS (O�) and K1 CPS wassubjected to Sephacryl S-200 chromatography using 0.2 M NaCl, 10 mM Tris,10 mM EDTA, and 0.25% DOC as eluant and with the same buffer but withoutEDTA (B). SDS-Tricine-PAGE (C) and SDS-PAGE (D) analysis of the ob-tained fractions. Shown are LPS preparations from E. coli KT1094 (C, lane 1)and E. coli KT1094 �waaL (C, lane 2) and samples from peaks A (C, lane 3; D,lane 1), B (C, lane 5; D, lane 2), and C (C, lane 4; D, lane 3). R.I., relativeintensity.

Interaction of E. coli LPS Core and K1 Polysaccharide

July 2012 Volume 194 Number 13 jb.asm.org 3363

on March 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

and SDS-PAGE analysis (Fig. 3C and D, respectively) and visual-ized by silver staining. The gel clearly showed that fraction A con-tained only high-molecular-mass bands (Fig. 3C, lane 3, and D,lane 1) corresponding to K1 CPS, according to its chemical com-position and reactivity with anti-K1 polyclonal antibody. FractionC contained an LPS banding material that did not react with an-ti-K1 antibody (Fig. 3C, lane 4, and D, lane 3). Fraction B con-tained LPS plus low-molecular-mass K1 CPS bands (Fig. 3C, lane5, and D, lane 2).

Reconstruction of core LPS. To further prove the above cor-relation, we used a complementary approach to individual genemutant construction. In this approach a mutant strain was con-structed (Fig. 4) with a deletion from codon 169 of the 3= end ofhldD (ADP-L-glycero-D-manno-heptose epimerase) to upstreamof waaQ gene. Thus, the DNA located between codon 169 of hldDand waaA (bifunctional Kdo transferase) was deleted and replacedby a kanamycin resistance cassette. To construct this mutant, plas-mid pWSB10 (6) (containing the 5= end of the gene yibB and thehldD, waaF, waaC, and waaL genes) and primers 1999-1 and1999-2 (engineered to include an EcoRV restriction site) (Table 2,underlined A in the sequence 1999-2) were used to amplify a1,554-bp DNA fragment containing the 5= ends of the yibD andhldD genes. Plasmid pFFM991 was obtained by ligation of theamplified fragment to pGEM-T. Plasmid pJSC2 (5) (containingthe 5= ends of the waaQ and the waaA and coaD genes and the 3=end of fpg) and primers RFAF and RFAR (Table 2) were used toamplify a 1,511-bp DNA fragment. This fragment was isolated anddigested with EcoRV and KpnI to obtain a 1,253-bp fragmentcontaining the promoter region and the 5= end of waaA and was

ligated to EcoRV-KpnI-digested pWSK29 (34) to obtain plasmidpWSKA. A 1,250-bp DNA fragment obtained by EcoRI-EcoRVdigestion of pFFM991 was ligated to EcoRI-EcoRV-digestedpWSKA to obtain plasmid pGA containing the 5= ends of yibD,hldD, and waaA as well as the waaA promoter. The kanamycinresistance gene from pUC4K was excised by HincII digestion andligated to EcoRV-digested pGA to obtain plasmid pGKMA (Fig.4). The engineered deletion was introduced into strain JC7623(37), because of its ability to recombine with linear incomingDNA fragments, by homologous recombination (18) by electro-poration of a 4,050-bp fragment obtained and purified fromEcoRI-KpnI-digested pGKMA. Once the mutant was constructedand checked by nucleotide sequence determination, the mutation(�waa Km) was transduced using the phage P1Cmts (25) to the E.coli strains W3310 and KT1094 containing K-12- and R1-typecore LPSs, respectively.

As expected, both mutant strains produced a core LPS contain-ing only lipid A and Kdo residues (data not shown), and strainKT1094 �waa-Km was resistant to K1-specific phage K1 and de-void of K1 capsule in ELISAs. On the other hand, colonies of thismutant grown on LB agar plates at 37°C showed a mucous phe-notype, suggesting that K1-PS was being produced but not re-tained at the cell surface. In agreement with this hypothesis, ma-terial reacting with anti-K1 polyclonal antibody was found inELISAs using KT1094 �waa-Km cells lysed with a French press,indicating that K1-PS was still synthesized in this mutant. Themutant KT1094 �waa-Km was transformed with plasmidpGEMT-hldD, and the transformant was used to reintroduce,step by step, the waa gene(s). Introduction of waaC (pBAD33-

FIG 4 Diagram of the construction of E. coli KT1094 �waa-Km. Shown are steps leading to the construction of plasmid pGKMA containing a deletion extendingfrom codon 169 of hldD to upstream of waaQ. Plasmid pGKMA was transformed into E. coli JC7623 to obtain by homologous recombination JC7623 �waa-Km.This mutation was transduced to E. coli KT1094 to obtain KT1094 �waa-Km. EI, EcoRI EI; EV, EcoRV; K, KpnI. EV*, EcoRV restriction site engineered onprimer 1999-2. Numbers 1, 2, 3, and 4 denote primers 1999-1, 1999-2, RFAF, and RFAR, respectively.

Jiménez et al.

3364 jb.asm.org Journal of Bacteriology

on March 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

waaC) into KT1094 �waa-Km(pGEMT-hldD) leads to a decreasein LPS mobility in SDS-Tricine-PAGE in agreement with the pres-ence of inner-core residue HepI (KdoHep) (Fig. 5, lane 4). Simi-larly, introduction of waaF and waaC (pBAD33-waaCF) producesa further reduction in LPS mobility in agreement with the pres-ence of inner-core HepI and HepII (Hep2Kdo) (Fig. 5, lane 5). Incontrast, introduction of the three heptosyltransferases encodedby the genes waaC, waaF, and waaQ (pBAD33-waaCFQ) leads tothe production of LPS with the same mobility as that of KT1094�waa-Km(pGEMT-hldD/pBAD33-waaCF) (Fig. 5, lane 6), indi-cating that the HepIII residue cannot be added to the core OS untilother main chain residues are transferred to the inner-core Hepdisaccharide. Introduction of waaCFQG (pBAD33-waaCFQG)(Fig. 5, lane 7) and waaCFQGP (pBAD33-waaCFQGP) (Fig. 5,lane 8) further reduces the mobility of the corresponding LPSsamples in SDS-Tricine-PAGE, in agreement with their core LPSstructures, HexHep2Kdo and HexHep2KdoP, respectively. Asshown in Table 5, core OS resulting from the introduction intoKT1094 �waa-Km(pGEMT-hldD) of pBAD33-waaC (KdoHep),pBAD33-waaCF (Hep2Kdo), pBAD33-waaCFQ (Hep2Kdo), andpBAD33-waaCFQG (HexHep2Kdo) did not become phage K1sensitive. Furthermore, all these constructs showed a mucous co-lonial phenotype in LB agar plates at 37°C. Only when the fivewaa genes waaC, waaF, waaQ, waaG, and waaP (pBAD33-waaCFQGP) were simultaneously introduced into the KT1094�waa-Km(pGEMT-hldD) strain, a reduction in the colonial mu-cous phenotype was found, and it was possible to detect K1 cap-sule with phage K1 and with polyclonal K1-specific antibody onwhole cells. These results establish a role for the phosphate substi-tution at the HepI residue of the inner-core LPS in the interactionbetween core LPS and the K1 CPS.

DISCUSSION

The analysis of the core OS structures of the individual waa genenonpolar mutants generated by an in-frame deletion method re-vealed that mutations affecting inner-core residues decrease theability to detect the K1 antigen. Furthermore, mutations preclud-ing the phosphorylation of both HepI and HepII, such as KT1094

with mutations �waaC, �waaF, �waaP, and �waaG, result in thelack of K1 antigen as determined by phage K1 EOP and ELISA. Inaddition, the core OS structures obtained from the KT1094�waaG mutant clearly indicate that phosphorylation of HepI andHepII residues depends on the transfer of the first Glc residue ofthe outer core, in agreement with previous results obtained withan E. coli waaG insertion mutant (39). The same conclusion can bedrawn from the analysis based on the step-by-step reintroductionof individual waa genes into a strain with a deletion spanning fromhldD to waaQ (KT1094 �waa-Km).

Among the different waa mutants leading to a decrease inK1 antigen, the ones with a longer core OS correspond toKT1094 �waaQ and KT1094 �waaY. The WaaY protein hasbeen proposed to be responsible for the transfer of phosphateto HepII (38), and accordingly the core LPS from KT1094�waaY is a full-length R1 core type but without phosphorylmodifications at the HepII residue (Fig. 2C), suggesting thatthis substitution is important for K1 CPS binding to the cellsurface. In the KT1094 �waaQ mutant, the core OS containsthe same residues as wild-type KT1094 or KT1094 �waaL withonly one Hep (HepIII) residue missing. Initially, it is not obvi-ous how the absence of HepIII could lead to a decrease in K1antigen, and only after a careful analysis of the phosphorylationpattern in this particular mutant can a hypothesis be made.Comparison of the degrees of phosphorylation of heptose res-idues in the core OS structures from KT1094 �waaL andKT1094 �waaQ (Table 4) revealed a strong reduction in thepercentage (from 38.6 to 4.9%) of OS being simultaneouslyphosphorylated at both HepI and HepII residues, similar towhat has been previously found with the waaQ insertion mu-tant (38). Another major difference between these OS was thedecrease from 23.2 to 1.6% in the OS fraction containingPPEtN and phosphate at HepI and HepII, respectively. Thus,the transfer of HepIII by WaaQ does not appear to be a prereq-uisite to phosphorylation of HepII by WaaY in contrast to whathas been found in a waaQ insertion mutant (38). But HepIIphosphorylation in the absence of HepIII proceeds inefficient-ly; i.e., transfer of HepIII creates a better substrate for WaaY.These changes in the phosphorylation pattern of the KT1094�waaQ strain would explain the reduction of cell-boundK1-PS in this mutant.

In addition, mutants KT1094 �waaY and KT1094 �waaQ, ashas been previously shown (38), did not appear to show pleiotro-pic effects since they showed essentially the wild-type sensibility tohydrophobic compounds, such as deoxycholate, SDS, and poly-

TABLE 5 Determination of K1 capsule antigen in E. coli mutant strainKT1094 �waa-Km(pGEMT-hldD) containing different waa genes

Added gene(s) EOPa OD405b

None 0.001 0.1waaC 0.001 0.1waaC, waaF 0.001 0.1waaC, waaF, waaQ 0.001 0.1waaC, waaF, waaQ, waaG 0.001 0.1waaC, waaF, waaQ, waaG, waaP 0.87 1.72 0.11a K1 capsule was measured by multiplicity of infection (EOP) to K1 capsule-specificphage K1.b K1 antigen detection by ELISA with K1-specific polyclonal antibody. OD405, opticaldensity at 405 nm.

FIG 5 Polyacrylamide gels showing the migration of LPS from E. coli KT109�waa-Km and reintroduced waa genes. Shown are SDS-Tricine-PAGE analy-ses of LPS from E. coli KT1094 �waaL (lane 1), KT1094 �waa-Km (lane 2),KT1094 �waa-Km(pGEMT-hldD) (lane 3), KT1094 �waa-Km(pGEMT-hldD/pBAD33-waaC) (lane 4), KT1094 �waa-Km(pGEMT-hldD/pBAD33-waaCF) (lane 5), KT1094 �waa-Km(pGEMT-hldD/pBAD33-waaCFQ) (lane6), KT1094 �waa-Km(pGEMT-hldD/pBAD33-waaCFQG) (lane 7), andKT1094 �waa-Km(pGEMT-hldD/pBAD33-waaCFQGP) (lane 8). The strainswith pBAD33 plasmid derivatives were grown under inducing conditions. LPSsamples were extracted and analyzed according to Darveau and Hancock (8).

Interaction of E. coli LPS Core and K1 Polysaccharide

July 2012 Volume 194 Number 13 jb.asm.org 3365

on March 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

myxin B, and outer membrane protein pattern in SDS-PAGE.These results suggest that there could be an ionic interaction be-tween the K1 capsule and negative charges contributed by phos-phate groups at HepI and HepII.

In agreement with this hypothesis, it was possible to recover bya modified water-phenol extraction method a cell surface fractioncontaining both K1-PS and LPS. This fraction could only be re-solved into individual high-molecular-mass K1-PS and LPSpeaks, as judged by SDS-PAGE, chemical composition analysis andELISA, and gel permeation chromatography using a high-ionic-strength eluting buffer containing EDTA and DOC. The requirementfor an ion chelator suggests that divalent cations bridge the negativecharges between phosphate core LPS and K1 residues.

A previous study has suggested that a waaR mutation pre-cluding the addition of a GlcIII residue in an E. coli K-12 strainavoids K5- and K1-PS binding to the cell surface (26). In con-trast, our results indicate that a waaO mutant precluding GlcIIincorporation to core LPS does not affect K1-PS binding to thecell surface. These two mutants were constructed using differ-ent approaches, and it should be noticed that waaR is just up-stream of waaY and that possible polar effects cannot be ruledout. Unfortunately in the previous work the actual core LPSstructure of the waaR mutant was not determined. Further-more, the E. coli waaR mutant used by Taylor et al. (26) wasconstructed in a K-12 strain, where the genes for K1 productionwere introduced by Hfr conjugation from a K1 strain (31), andnot in a natural K1-PS producer strain.

Thus, although it has been suggested that the K1 CPS and othergroup 2 E. coli capsules are anchored to the cell surface via a CPS lipiddomain (36), our results strongly suggest that a major fraction of theK1 CPS is retained on the cell surface via ionic interaction with thenegative phosphate charges of the core LPS. This fact is similar towhat has been described in K. pneumoniae, where core LPS galactu-ronic negative charges interact with K2 polysaccharide (10).

ACKNOWLEDGMENTS

This work was supported by Plan Nacional de I � D � i grant (Ministerio deEducación, Ciencia y Deporte and Ministerio de Sanidad, Spain) and fromGeneralitat de Catalunya (Centre de Referència en Biotecnologia). E.A. has apredoctoral fellowship from Ministerio de Educación, Ciencia y Deporte.

We also thank Maite Polo for her technical assistance. We thank A.S.Shashkov (Zelinsky Institute) for help with NMR spectroscopy, A.O. Chi-zhov (Zelinsky Institute) for measuring ESI mass spectra, and BrukerMoscow, Ltd., for providing access to a micrOTOF II instrument.

REFERENCES1. Aleksic S. 1995. WHO report on Shiga-like toxin producing Escherichia

coli (SLTEC), with emphasis on zoonotic aspects. World Health Organi-zation, Geneva, Switzerland.

2. Al-Hakim A, Linhardt RJ. 1990. Isolation and recovery of acidic oligo-saccharides from polyacrylamide gels by semi-dry electrotransfer. Electro-phoresis 11:23–28.

3. Amor K, et al. 2000. Distribution of core oligosaccharide types in lipo-polysaccharides from Escherichia coli. Infect. Immun. 68:1116 –1124.

4. Appelmelk BJ, et al. 1994. Frequencies of lipopolysaccharide core types inEscherichia coli strains from bacteraemic patients. Microbiology 140:1119 –1124.

5. Belunis CJ, Clementz T, Carty SM, Raetz CHR. 1995. Inhibition oflipopolysaccharide biosynthesis and cell growth following inactivation ofthe kdtA gene of Escherichia coli. J. Biol. Chem. 270:27646 –27652.

6. Brabetz W, Müller-Loennies S, Holst O, Brade H. 1997. Deletion of theheptosyltransferase genes rfaC and rfaF in Escherichia coli K-12 results inan Re-type lipopolysaccharide with a high degree of 2-aminoethanolphosphate substitution. Eur. J. Biochem. 247:716 –724.

7. Bronner D, et al. 1993. Expression of the capsular K5 polysaccharide ofEscherichia coli: biochemical and electron microscopic analyses of mutantswith defects in region 1 of the K5 gene cluster. J. Bacteriol. 175:5984 –5992.

8. Darveau RP, Hancock REW. 1983. Procedure for isolation of bacteriallipopolysaccharides from both smooth and rough Pseudomonas aerugi-nosa and Salmonella typhimurium strains. J. Bacteriol. 155:831– 838.

9. Finke A, Bronner D, Nicolaev AV, Jann B, Jann K. 1991. Biosynthesis ofthe Escherichia coli K5 polysaccharide, a representative of group II capsularpolysaccharides: polymerization in vitro and characterization of the prod-uct. J. Bacteriol. 173:4088 – 4094.

10. Fresno S, et al. 2006. The ionic interaction of Klebsiella pneumoniae K2capsule and core lipopolysaccharide. Microbiology 152:1807–1818.

11. Galanos C, Lüderitz O, Westphal O. 1969. A new method for the extrac-tion of R lipopolysaccharides. Eur. J. Biochem. 9:245–249.

12. Gibb AP, Barclay GR, Poxton IR, Di Padova F. 1992. Frequencies oflipopolysaccharide core types among clinical isolates of Escherichia colidefined with monoclonal antibodies. J. Infect. Dis. 166:1051–1057.

13. Guzman LM, Belin D, Carson MJ, Beckwith J. 1995. Tight regulation,modulation, and high-level expression by vectors containing the arabi-nose PBAD promoter. J. Bacteriol. 177:4121– 4130.

14. Heinrichs DE, Yethon JA, Whitfield C. 1998. Molecular basis for struc-tural diversity in the core regions of the lipopolysaccharides of Escherichiacoli and Salmonella enterica. Mol. Microbiol. 30:221–232.

15. Hitchcock PJ, Brown TM. 1983. Morphological heterogeneity amongSalmonella lipopolysaccharide chemotypes in silver-stained polyacryl-amide gels. J. Bacteriol. 154:269 –277.

16. Laemmli UK, Favre M. 1973. Maturation of the head of bacteriophageT4. I. DNA packaging events. J. Mol. Biol. 80:575–599.

17. Link AJ, Phillips D, Church GM. 1997. Methods for generating precisedeletions and insertions in the genome of wild-type Escherichia coli: applica-tion to open reading frame characterization. J. Bacteriol. 179:6228–6237.

18. Lloyd RG, Buckman C. 1985. Identification and genetic analysis of sbcCmutations in commonly used recBC sbcB strains of Escherichia coli K-12. J.Bacteriol. 164:836 – 844.

19. Miller JH. 1972. Experiments in molecular genetics. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

20. Ørskov F, Ørskov I. 1984. Serotyping of Escherichia coli. Methods Micro-biol. 14:43–112.

21. Pelkonen S, Häyrinen J, Finne J. 1988. Polyacrylamide gel electropho-resis of the capsular polysaccharides of Escherichia coli K1 and other bac-teria. J. Bacteriol. 170:2646 –2653.

22. Raetz CHR, Whitfield C. 2002. Lipopolysaccharide endotoxins. Annu.Rev. Biochem. 71:635–700.

23. Regué M, et al. 2005. A second outer-core region in Klebsiella pneumoniaelipopolysaccharide. J. Bacteriol. 187:4198 – 4206.

24. Silver RP, Vimr ER. 1990. Polysialic acid capsule of Escherichia coli K1. InIglewski BH, Clark VL (ed), Molecular basis of microbial pathogenesis.Academic Press, Inc. San Diego, CA.

25. Sternberg NL, Maurer R. 1991. Bacteriophage-mediated generalizedtransduction in Escherichia coli and Salmonella typhimurium. MethodsEnzymol. 204:18 – 43.

26. Taylor CM, Goldrick M, Lord L, Roberts IS. 2006. Mutations in thewaaR gene of Escherichia coli which disrupt lipopolysaccharide outer corebiosynthesis and affect cell surface retention of group 2 capsular polysac-charides. J. Bacteriol. 188:1165–1168.

27. Troy FA, Vijay IK, Tesche N. 1975. Role of undecaprenyl phosphate insynthesis of polymers containing sialic acid in Escherichia coli. J. Biol.Chem. 250:156 –163.

28. Tsai CM, Frasch CE. 1982. A sensitive silver stain for detecting lipopoly-saccharide in polyacrylamide gels. Anal. Biochem. 119:115–119.

29. Vimr ER, Steenbergen SM. 2006. Mobile contingency locus controllingEscherichia coli K1 polysialic acid capsule acetylation. Mol. Microbiol. 60:828 – 837.

30. Vimr ER, Steenbergen SM. 2009. Early molecular-recognition events inthe synthesis and export of group 2 capsular polysaccharides. Microbiol-ogy 155:9 –15.

31. Vimr ER, Troy FA. 1985. Regulation of sialic acid metabolism in Esche-richia coli: role of N-acylneuraminate pyruvate-lyase. J. Bacteriol. 164:854 – 860.

32. Vinogradov E, et al. 1999. The structures of the carbohydrate back-bones of the lipopolysaccharides from Escherichia coli rough mutantsF470 (R1 core type) and F576 (R2 core type). Eur. J. Biochem. 261:629 – 639.

Jiménez et al.

3366 jb.asm.org Journal of Bacteriology

on March 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

33. Vinogradov E, Perry MB. 2001. Structural analysis of the core region ofthe lipopolysaccharides from eight serotypes of Klebsiella pneumoniae.Carbohydr. Res. 335:291–296.

34. Wang RF, Kushner SR. 1991. Construction of versatile low-copy numbervectors for cloning, sequencing and gene expression in Escherichia coli.Gene 100:195–199.

35. Westphal O, Jann K. 1965. Bacterial lipopolysaccharide extraction withphenol-water and further application of the procedure. Methods Carbo-hydr. Chem. 5:83–91.

36. Whitfield C. 2006. Biosynthesis and assembly of capsular polysaccharidesin Escherichia coli. Annu. Rev. Biochem. 75:39 – 68.

37. Winans SC, Elledge SJ, Krueger JH, Walker GC. 1985. Site-directedinsertion and deletion mutagenesis with cloned fragments in Escherichiacoli. J. Bacteriol. 161:1219 –1221.

38. Yethon JA, Heinrichs DE, Monteiro MA, Perry MB, Whitfield C. 1998.Involvement of waaY, waaQ, and waaP in the modification of Escherichiacoli lipopolysaccharide and their role in the formation of a stable outermembrane. J. Biol. Chem. 273:26310 –26316.

39. Yethon JA, Vinogradov E, Perry MB, Whitfield C. 2000. Mutation of thelipopolysaccharide core glycosyltransferase encoded by waaG destabilizesthe outer membrane of Escherichia coli by interfering with core phosphor-ylation. J. Bacteriol. 182:5620 –5623.

Interaction of E. coli LPS Core and K1 Polysaccharide

July 2012 Volume 194 Number 13 jb.asm.org 3367

on March 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from