Early Low Fat Diet Enriched with Linolenic Acid Reduces Liver … · 2016. 3. 28. · EARLY LOW FAT DIET ENRICHED WITH LINOLENIC ACID REDUCES LIVER ENDOCANNABINOID TONE AND IMPROVES

EARLY LOW FAT DIET ENRICHED WITH LINOLENIC ACID REDUCES

LIVER ENDOCANNABINOID TONE AND IMPROVES LATE GLYCEMIC

CONTROL AFTER A HIGH FAT DIET CHALLENGE IN MICE

Laurent Demizieux, Fabiana Piscitelli#, Stephanie Troy-Fioramonti, Fabio Arturo Iannotti#,

Simona Borrino#, Joseph Gresti, Tania Muller, Jerome Bellenger†, Cristoforo Silvestri#,

Vincenzo Di Marzo# and Pascal Degrace

Running title : Early dietary n-3 fatty acids and endocannabinoid tone

Author’s affiliations :

Laurent Demizieux, Stephanie Troy-Fioramonti, Joseph Gresti, Tania Muller and Pascal

Degrace, Université de Bourgogne Franche-Comté, INSERM LNC UMR866, Team

Pathophysiology of Dyslipidemia, Faculty of Sciences Gabriel, 6 Bd Gabriel, F-21000 Dijon,

France

#Fabiana Piscitelli, Simona Borrino, Fabio Arturo Iannotti, Cristoforo Silvestri and Vincenzo

Di Marzo, Endocannabinoid Research Group, Institute of Biomolecular Chemistry, Consiglio

Nazionale delle Ricerche, Via Campi Flegrei 34, 80078 Pozzuoli, Naples, Italy

†Jerome Bellenger, Team Lipid transfer proteins and lipoprotein metabolism INSERM U866 -

Université de Bourgogne Franche-Comté, Faculty of Sciences Gabriel, 6 Bd Gabriel, 21000,

Dijon, France

Page 1 of 41 Diabetes

Diabetes Publish Ahead of Print, published online April 5, 2016

Correspondence to :

Pascal Degrace, Université de Bourgogne Franche-Comté, INSERM LNC UMR866, Team

Pathophysiology of Dyslipidemia, Faculty of Sciences Gabriel, 6 Bd Gabriel, F-21000 Dijon,

France

Phone : +33380393736 ; Fax : +33380396330 ; e-mail : [email protected]

Or

Vincenzo Di Marzo, Endocannabinoid Research Group, Institute of Biomolecular Chemistry,

Consiglio Nazionale delle Ricerche, Via Campi Flegrei 34, 80078 Pozzuoli, Naples, Italy.

Phone : +390818675093 (Office) ; Fax.: +39-081-8041770 ; e-mail : [email protected]

Word count : 5053 Number of tables : 2 Number of figures : 6

Page 2 of 41Diabetes

ABSTRACT

Evidence suggests that alterations of glucose and lipid homeostasis induced by obesity are

associated with elevation of endocannabinoid tone. The biosynthesis of the two main

endocannabinoids, N-arachidonoyl-ethanolamine (AEA) and 2-arachidonoyl-glycerol (2-AG),

which derive from arachidonic acid, is influenced by dietary fatty acids (FA).

We investigated whether exposure to n-3 FA at a young age may decrease tissue

endocannabinoid levels and prevent metabolic disorders induced by a later high-fat diet

(HFD) challenge. Three week-old mice received a 5% lipid diet containing either lard or lard

+ safflower oil or lard + linseed oil for 10 weeks. Then, mice were challenged with a 30%

lard diet for 10 additional weeks.

A low n-6/n-3 FA ratio in the early diet induces a marked decrease in liver endocannabinoid

levels. A similar reduction was observed in transgenic Fat-1 mice which exhibit high tissue

levels of n-3 FA compared to wild type mice. Hepatic expression of key enzymes involved in

carbohydrate and lipid metabolism was concomitantly changed. Interestingly, some gene

modifications persisted after HFD challenge and were associated with improved glycemic

control.

These findings indicate that early dietary interventions based on n-3 FA may represent an

alternative strategy to drugs to reduce endocannabinoid tone and improve metabolic

parameters in the metabolic syndrome.


INTRODUCTION

The endocannabinoid system (ECS) is known to play a crucial role in energy

homeostasis. Regulation by this system takes place at the central level by changing food

intake (1) and at the peripheral level by modification of energy metabolism (2). An overactive

ECS plays a crucial role in obesity by increasing food intake (3) and lipogenesis (4), by

down-regulating catabolic reactions (5; 6); and promoting fat accumulation and alteration of

glucose homeostasis. As a consequence, treating obesity by decreasing ECS activity has been

considered. A pharmacological approach was developed, leading to the commercialization of

an inverse agonist of the cannabinoid receptor type-1 (CB1R), Rimonabant. However, this

drug was withdrawn from the market due to its undesired central nervous system side effects

(7). Meanwhile, down-regulation of ECS tone in peripheral tissues involved in energy

homeostasis, either with non-brain penetrant CB1R blockers, or inhibitors of the biosynthesis

of endogenous CB1R agonists, is still considered as a potential approach to counter the

adverse events observed in obesity (8).

The ECS is defined as a set of endogenous ligands (endocannabinoids; EC),

synthesized and degraded by specific enzymes and receptors able to bind these molecules. It

includes two membrane receptors, CB1R and CB2R, and two main endogenous agonists, N-

arachidonoyl-ethanolamine (anandamide or AEA) and 2-arachidonoyl-glycerol (2-AG). AEA

is typically synthesized by the enzyme N-acylphosphatidylethanolamine phospholipase D

(NAPE-PLD), although alternative pathways exist, while 2-AG is formed by the action of

diacylglycerol lipase α or β upon diacylglycerols. After release, EC are subjected to rapid

breakdown by degrading enzymes such as fatty acid amide hydrolase (FAAH) for N-

acylethanolamines and monoacylglycerol lipase (MAGL) for 2-AG (9) (Figure 1A).


AEA and 2-AG are lipids and both ultimately derive from arachidonic acid (AA,

C20:4n-6) via AA-containing phospholipids. AA is endogenously biosynthesized from the

essential fatty acid (10) linoleic acid (LA, C18:2n-6). As a consequence, a dietary

supplementation in LA (11; 12) or AA itself (13) is able to elevate tissue contents of EC.

Conversely, diets enriched with n-3 polyunsaturated fatty acids (PUFA), such as

eicosapentaenoic acid (EPA; C20:5n-3) and docosahexaenoic acid (DHA, C22:6n-3), cause a

decrease in 2-AG and AEA levels because of the replacement of AA in phospholipids with

such FA (13; 14).

It is well known that dietary n-3 FA exert beneficial effects on obesity (15). For

instance, n-3 FA have the ability to reduce ectopic fat and inflammation in Zucker rats and to

reduce glucose intolerance generally associated with obesity (16). Thus, they were shown to

improve insulin sensitivity and gluconeogenesis in rodents (17,18). The existence of a direct

causal link between EC tone and the ability of n-3 FA to improve some of these features of

obesity has been recently evidenced (16), involving transcription factors such as CREBH (19)

and SREBP (20). This emphasizes the potential benefits of nutritional interventions in the

treatment of pathologies related to obesity, particularly using n-3 FA.

Accumulating evidence shows that dietary factors, including lipids, in developmental

periods such as fetal life, infancy, and early childhood, are associated with obesity risk later in

life (21). In line with this, it has been shown that early overnutrition leads to persistent

dysregulation in leptin and insulin sensitivity (22), along with enhanced inflammatory

response (23). In addition to excess calories, the FA composition of the perinatal diet is also

an important factor in the nutritional programming of the metabolic phenotype in adulthood.

Recent studies have shown that perinatal exposure to a rich n-6 FA diet is able to induce

obesity and to affect body fat mass across generations (24). On the other hand, the beneficial

role of dietary n-3 FA during early life has been emphasized since n-3 FA deficiency


increases adiposity in guinea pigs (25). This idea was reinforced by the study of Masseria et

al. showing that addition of α-linolenic acid (α-LNA, C18:3n-3) to a LA rich high-fat diet

(HFD) under isolipidic and isocaloric conditions, reduces the deleterious effect of n-6 FA

when given to mouse pups (26). The beneficial preventive effect of n-3 FA is not restricted to

HFD. Even in a normolipidic diet, they are able to limit HFD-induced insulin resistance and

hepatic steatosis, two main features of obesity (27). In keeping with this, improvement of

glucose and lipid homeostasis was also observed in transgenic Fat-1 mice, which can

synthesize n-3 FA from n-6 FA without the need for dietary supplementation (28).

In this study, we aimed to investigate the role of the FA composition of a normolipidic

diet (n-6 vs n-3 FA) in the early prevention of HFD-induced obesity and its relationship with

the EC tone. Our starting hypothesis was that a n-3 FA enriched diet given to weaning mice

can decrease ECS activity, which in turn prevents HFD-induced metabolic disorders. To

support our data, we also examined liver EC tone in Fat-1 mice presenting consistently high

levels of n-3 FA in their tissues.

RESEARCH DESIGN AND METHODS

Animals and diets

Official French regulations (n°87848) for the use and care of laboratory animals were

followed throughout the experimental period. The experimental protocol was approved by the

local ethic committee for animal experimentation (n°BX0622). Three week-old C57BL/6J

male mice were purchased from Charles River Laboratories (France). Mice surviving to the

stress of delivery were randomly separated in 3 series of 14-16 animals receiving different

low fat diets (LFD; 5% wt/wt total lipids) for 10 weeks as schematized in Figure 1B. Animals

were housed individually on a 12h/12h light/dark schedule at 22–23°C with ad libitum access


to water and food. Lipids in Lard series came exclusively from pork fat while lard was

partially substituted with safflower oil or linseed oil in SAF and LIN series respectively. The

FA composition of the custom diets manufactured by SSNIF (Soest, Germany) is presented in

Table 1. After 10 weeks, half of the population of each series was used for analyses and the

rest was challenged with a high fat diet (HFD; 30% wt/wt total lipids from lard) for an

additional period of 10 weeks. C57BL/6J transgenic fat-1 mice were generated and housed as

described previously (29).

Body and plasma parameters

Body composition (fat mass, lean mass, and total body water) was measured by EchoMRI

(Echo Medical Systems; Houston, TX). Plasma triglyceride (TG) and cholesterol (CS)

concentrations were determined using commercial kits (Dyasis, France). Adiponectin levels

were measured by enzyme-linked immunosorbent assay (ELISA) from Merck Millipore

(Darmstadt, Germany) while leptin and insulin plasma content was determined using a

luminex®-based Bio-Rad® Bio-Plex Pro™ mouse assay (Bio-Rad, Marnes-La-Coquette

France).

Glucose tolerance and insulin tolerance tests

For oral glucose tolerance test (OGTT) and insulin tolerance test (ITT), mice respectively

received an oral load (2g/kg) of a D-glucose solution (20% w/v) or an intraperitoneal injection

of insulin (0.5 UI/kg; Actrapid®, Novo Nordisk, France) after a 6-hour fasting. OGTT and

ITT were performed on the same mice within a 3-day interval. Glycemia was measured at 0,

15, 30, 45, 60, 90, and 120 minutes directly in blood sampled from the tail vein with a My

Life PuraTM glucose meter (Ypsomed, Paris, France). During OGTT, larger blood samples (25

µl) were collected from tail in tubes containing EDTA (Sarstedt, Nümbrecht, Germany) to


measure insulinemia at time 0, 15, 30 and 60 minutes after glucose load. Insulin levels were

determined using an Ultrasensitive mouse ELISA kit (Eurobio, Les Ulis, France).

Lipid and EC analyses

For determination of total FA composition in tissues and diets, lipids were extracted

according to Folch et al. (30). Concentrations were determined using C17:0 as internal

standard, after methylation according to the procedure of Christie (31) and separation by gas

chromatography (GC) as previously described (32). EC and congeners were purified from

lipid extracts and determined by isotope dilution liquid chromatography-atmospheric pressure

chemical ionization-mass spectrometry (LC-MS) using deuterated standards as described in

(33).

Western blots analysis

The isolation and quantification of total proteins from tissues was performed as previously

described (34). Briefly, from each animal previously anesthetized, the liver was isolated and

immediately frozen in liquid nitrogen. Each tissue was subsequently washed in cold PBS

(without Ca2+ and Mg2+, pH 7.4) and homogenized in a lysis solution containing: 150 mM

NaCl, 1 mM EDTA, 1% (v/v) TritonX-100, 2.5 mM sodium pyrophosphate, 1 mM β-

glycerophosphate, 1 mM Na3VO4, 20 mM Tris–HCl pH 8, 1% SDS, plus protease inhibitors)

at pH 7.4. Lysates were incubated 30 min at 4°C on a shaker and then centrifuged for 15 min

at 13,000 × g at 4◦C. Supernatants were transferred into clear tubes and quantified by DC

Protein Assay (Bio-Rad). Subsequently the samples (60–80 µg of total protein) were boiled

for 5 min in Laemmli SDS loading buffer and loaded on 8–10% SDS-polyacrylamide gel

electrophoresis and then transferred to a PVDF membrane. Filters were incubated overnight at

4◦C with the following antibodies: (a) mouse anti-FAAH clone 4H8 (dilution 1:1000; Sigma–


Aldrich); (b) rabbit anti-NAPE-PLD (dilution 1:2500; Abnova, Taiwan); (c) rabbit anti-

MAGL (dilution 1:200; Cayman Chemicals, Ann Arbor, MI, USA). The monoclonal anti-

tubulin clone B-5-1-2 (dilution 1:5000; Sigma–Aldrich) was used to check for equal protein

loading. Reactive bands were detected by chemiluminescence by the use of Clarity Western

ECL substrate (Bio-Rad). Images were analyzed on a Chemi-Doc station with Quantity-one

software (Bio-Rad).

Enzyme assays

FAAH and MAGL activity was measured as previously described (34). In particular, 2-AG

hydrolysis was measured by incubating the 10.000 x g liver cytosolic fraction (100

µg/sample) in Tris-HCl 50 mM, at pH 7.0 at 37 °C for 20 min, with synthetic 2-arachidonoyl-

[3H]-glycerol (40 Ci/mmol, ARC St. Louis, MO, USA) properly diluted with 2-AG (Cayman

Chemicals) to the final concentration of 10 µM. The amount of [3H]- glycerol produced was

measured by scintillation counting of the aqueous phase after extraction of the incubation

mixture with 2 volumes of CHCl3/CH3OH (1/1 ; v/v). AEA hydrolysis was measured by

incubating the 10,000 x g liver membrane fraction (70-100 µg/sample) in Tris-HCl l50 mM,

at pH 9-10 at 37°C for 30 min, with synthetic N-arachidonoyl-[14C]-ethanolamine (55

mCi/mmol, ARC St. Louis, MO, USA) properly diluted with AEA (Tocris Bioscience,

Avonmouth, Bristol, UK) to the final concentration of 2 µM. The amount of [14C]-

ethanolamine produced was measured by scintillation counting of the aqueous phase.

Activities were calculated in pmol of substrate hydrolyzed x min−1x mg protein−1.

RT-PCR

Total mRNAs from tissues were extracted with Tri-Reagent (Euromedex, Souffelweyersheim,

France) and 1 µg RNA was reverse-transcripted using the Iscript cDNA kit (Bio-Rad). Real-


time PCR was performed as described previously (6) using a StepOnePlus™ real-time PCR

system (Life Technologies, Saint-Aubin, France). Primer sequences used for amplification are

indicated in Supplementary Table 1. For each gene, a standard curve was established from

four cDNA dilutions (1/10 to 1/10000) and used to determine the relative gene expression

variation after normalization with the geometric mean of 3 housekeeping genes (TATA box

binding protein, L38 and 18S).

Statistical analysis

Results are expressed as means ± SEM. Data were analyzed statistically using 2-way

ANOVA followed by the Tukey post-hoc test, or using Student t-test. Differences were

considered significant at P<0.05.

RESULTS

Liver total FA composition

Lard used for the preparation of the LFD was partially replaced by safflower oil (SAF)

or linseed oil (LIN) to modify the proportions of LA and α-LNA while limiting background

variations. In this way, the final n-6/n-3 FA ratios in Lard, SAF and LIN diets were 22, 53 and

1 respectively (Table 1). The impact of 10 weeks feeding with the different LFD was

estimated through the analysis of total liver FA composition (Table 1). As expected, when

compared to Lard, SAF diet increased proportions of LA and AA in liver lipids at the expense

of C18:1n-9, while LIN induced an increase in DHA. This resulted in strong alterations of

tissue n-6/n-3 FA ratios. After challenging the animals with a 30% lard oil diet for 10 weeks,

the liver SAF and LIN FA profiles became very close to that of the Lard diet. Nevertheless,

the n-6/n-3 FA ratio in liver LIN remained slightly lower than Lard and SAF.


Tissue EC levels

Switching n-6/n-3 FA ratio from 53 to 1 in the diet (SAF vs LIN) affected both AEA

and 2-AG tissue levels in the liver (Figure 2). Comparing SAF vs Lard group aimed to reflect

the impact of a specific elevation of LA on tissue EC contents. Elevating dietary LA increased

only 2-AG in the liver. Likewise, the specific impact of the elevation of n-3 FA in the diet on

EC levels was estimated by comparing LIN to Lard group. In these conditions, AEA was

significantly lower in the liver of LIN mice compared with Lard while the same trend was

observed for 2-AG. In other tested tissues (supplemental figure 1), huge nutritional alteration

of n-6/n-3 FA ratio in the diet always significantly reduced AEA levels except for visceral

adipose tissue (VAT). 2-AG was concomitantly reduced in brain and muscle but not modified

in subcutaneous adipose tissue (SCAT) nor VAT.

Whatever the early diet administered, feeding the HFD raised liver AEA and 2-AG

levels (Figure 2). However, the increase was not significant for 2-AG in SAF series since

levels were already elevated at the end of the LFD. EC levels were also generally increased

after the HFD in brain, VAT and muscle. Otherwise, SCAT appeared to be differently

influenced by the HFD regardless of the early diet as suggested by the decrease in EC levels

(supplemental figure 1).

Transcriptomic and proteomic analysis of ECS (Figure 3A-C)

Data concerning FAAH and MAGL, which mainly hydrolyze AEA and 2-AG

respectively, indicated that the liver protein levels and activity of MAGL were more

influenced by the composition of the early diet than FAAH. In particular, both MAGL protein

levels and activity were reduced by SAF compared to other diets in accordance with higher

levels of 2-AG in this group. Protein levels of NAPE-PLD, which is involved in the formation


of AEA, were also reduced by SAF and LIN compared to Lard diet. Regarding CB1R, liver

mRNA levels were unchanged whatever the diet.

Challenging mice with 30% lard diet induced more pronounced alteration of liver

enzymes linked to ECS. Data related to FAAH indicated a strong downregulation while

NAPE-PLD was increased suggesting an inverse regulation of EC degradation and

biosynthetic pathways in favor of an elevation of AEA levels. HFD concomitantly induced

the mRNA expression of CB1R in the liver for all groups. Interestingly, the impact of the

HFD sometimes appeared to depend on the nutritional history. In particular, CB1R mRNA

expression was lower in the LIN compared to SAF group and FAAH protein levels were

higher in the LIN than in Lard group.

Body composition, plasma parameters and glycemic control

Body weight and fat pad relative mass measured at the end of the early LFD did not

differ among the three groups (Table 2). Nevertheless, LIN induced a significant decrease in

total fat mass as determined by echoMRI. The particular sensitivity of the liver to the different

early diets was indicated by the decrease in relative mass and lipid content induced by SAF

and LIN compared to Lard. Similarly, muscle lipids were also the highest for the Lard group

(data not shown). As expected, total body fat, fat pad weight and tissue lipids were increased

after the HFD challenge but no differences were observed between groups.

Early feeding with SAF and LIN experimental diets improved some important plasma

parameters related to glucose and lipid homeostasis in comparison with Lard (Table 2).

Notably, fasting triglyceridemia and cholesterolemia were reduced after SAF and LIN diets.

While these diets did not affect glycemia, insulin levels in these groups were higher than in

Lard suggesting a possible impairment of beta-cell function by early and prolonged exposure

to Lard diet. Interestingly, plasma adiponectin was significantly higher in LIN than in Lard


pointing out a putative impact of n-3 FA on adipose tissue metabolism. Data relative to

glycemic control (Figure 4A and B) showed that only the LIN diet exerted slight changes on

glucose clearance after oral glucose load or insulin administration.

As expected, HFD challenge induced marked variations in most of the metabolic

parameters measured (Table 2). Glycemia, cholesterolemia, insulinemia, adiponectin and

leptin increased in all groups. The slight hyperglycemia associated to the compensatory

hyperinsulinemia reflected the onset of an insulin resistant state whatever the early diet

consumed. However calculations derived from OGTT and insulin response (DI0-15/DG0-15 and

DI0 ) suggested an alteration in beta-cell function for mice fed with the Lard diet only (Table

2). Data also revealed that animals fed with the diet enriched in n-3 FA during 10 weeks

following weaning had higher plasma adiponectin levels and better glycemic control after

HFD challenge. Notably, OGTT, ITT and HOMA-IR were improved in the LIN group

compared to the others (Figure 4C and D and Table 2). In addition, t0-30min insulin production

in response to glucose load was also significantly higher in LIN than Lard (Figure 4E).

Expression of genes related to carbohydrate and lipid metabolism in the liver (Figure 5)

The fact that early feeding with LIN induced long-lasting positive effects on glycemic

control prompted us to study the impact of the different diets on the expression of genes

related to carbohydrate and lipid metabolism in the liver. Thus, early feeding with the LIN

diet significantly decreased mRNA levels of the key gluconeogenic enzymes genes PEPCK

and G6P as well as that of GK, FAS, SCD1 and the transcription factor CREBH compared

with the Lard group. Data also revealed that young mice fed with the diet containing

exclusively lard as lipid source showed the highest mRNA expression of FAT/CD36 and LPL

genes related to FA uptake. This observation also applied to TNFα mRNA levels suggesting


an elevated liver inflammatory status in Lard mice liver which was decreased by the SAF and

LIN diets.

Whatever the early diet, feeding mice with HFD induced changes in the expression of

genes responsive to insulin such as PEPCK and GK, which were respectively decreased and

increased. We further noticed that mice prefed with the LIN diet showed lower expression of

several genes after HFD challenge compared with other diets suggesting that addition of n-3

FA in the early diet may induce biological imprinting mechanisms controlling gene

expression. In this way, PEPCK, CREBH, LPL, and TNFα mRNA levels were lower in LIN

than SAF and Lard groups.

EC levels and gene expression in Fat-1 mice liver (Figure 6)

For further insight on the impact of n-3 FA tissue enrichment on ECS tone, we measured EC

content in the liver of Fat-1 mice. These transgenic animals are able to endogenously

synthesize n-3 FA from n-6 FA and consequently exhibit high levels of n-3 FA in their

tissues. Interestingly, EC levels were strongly reduced in Fat-1 mouse livers (Figure 6A). We

also found that the expression of FAAH, PEPCK, G6P and FAS gene was lower in Fat-1 than

in wild type mice (Figure 6B).

DISCUSSION

The objective of this study was twofold. First, we explored whether early exposure to

a diet enriched in n-3 or n-6 FA could concomitantly influence EC tone in several mouse

tissues and metabolic parameters with particular attention to the liver, considered the most

vulnerable organ following nutritional programming during perinatal period. Secondly, we

examined the long-term effects of these postnatal nutritional manipulations by examining


whether they were associated with alterations of metabolic parameters in response to a later

HFD challenge. Our data indicate in particular that exposure to an n-3 FA-enriched diet in the

early age induces a marked reduction in liver ECS activity associated with an alteration of key

enzymes involved in liver carbohydrate and lipid metabolism. In addition, we observed that

some of the liver gene expression modifications induced by n-3 FA feeding in the first weeks

of life persisted after HFD challenge and were associated with an improved glycemic control.

A recent series of studies carried out by Alvheim et al. highlighted the importance of

the dietary LA on EC tone (11; 12; 14). These works demonstrated that excessive LA

consumption elevates tissue EC levels and is associated with metabolic alterations. Here,

some important issues concerning the impact of dietary FA, and particularly n-3 FA, on ECS

activity were also emphasized. First, we observed that the substitution of 0.5% Lard for LIN

in the early diet was sufficient to decrease EC levels in brain, liver and muscle. Since EC

tissue levels were generally decreased when the diet was enriched in α-LNA regardless of

changes in LA levels, it might be suggested that EC synthesis is more influenced by n-3 than

n-6 dietary FA. The fact that increasing LA in the diet while α-LNA levels remained constant

did not induce marked variation in EC levels also supports this assumption. In line with this,

the decrease in liver AEA induced by chronic administration of LIN compared to Lard could

not be due to a net decrease in the supply of n-6 biosynthetic precursors of EC since LA levels

were in the same range in the two diets. Instead, competition between n-6 and n-3 FA for

elongation and desaturation steps may be crucial for EC synthesis in these conditions. We

also found here that early dietary n-3 FA reduces EC levels in the brain and the skeletal

muscle. Decreases in both AEA and 2-AG, with the former persisting after HFD challenge,

were observed in the LIN compared to SAF group. In the whole, these findings, in agreement

with previous data in adult mice (35) and rats (34) (36), confirm that early dietary

interventions based on n-3 FA, might constitute an alternative strategy to “global” CB1R


blockers to reduce ECS overactivity, and subsequently, various parameters of the metabolic

syndrome, while possibly limiting the consequences on brain function.

Animals from the Lard series were fed with a 5% lipid diet consisting mainly of long

chain saturated and monounsaturated FA initially prone to induce metabolic disorders related

to insulin resistance. So it was not surprising to observe that replacing part of the Lard with

SAF or LIN in the diet was able to limit the alterations of some metabolic parameters such as

triglyceridemia, cholesterolemia, and liver and muscle lipid content in agreement with

previous studies (37). The lower insulin levels observed in Lard compared to SAF and LIN

mice may also represent an impairment of beta-cell function induced by prolonged exposure

to saturated FA (38). However, a notable finding from this work is that only the diet enriched

with α-LNA induced specific changes in the liver expression of genes involved in

gluconeogenesis and de novo lipogenesis. Thus, LIN diet decreased PEPCK, G6P and GK

mRNA levels suggesting a slowing down of liver glucose production. Molecular data also

indicated that dietary n-3 FA reduce the liver expression of SCD1 and FAS suggesting a

decrease in FA de novo synthesis further illustrated by the lower liver lipid content observed

in this group. These findings concur with other studies showing an inhibitory effect of n-3 FA

on gluconeogenesis and de novo lipogenesis (39; 40) two key actors of insulin resistance

setup. Although the changes were not statistically significant, the LIN diet also tended to

improve glucose and insulin tolerance compared to the Lard diet suggesting that possibly

stronger positive effects of the diet might have occurred with a longer treatment.

Our findings are reminiscent of those observed in Fat-1 transgenic mice, which can

endogenously synthesize n-3 FA from n-6 FA and consequently show elevated levels of DHA

in the liver compared to wild type mice. They also appear to be protected from HFD-induced

glucose intolerance, dyslipidemia and liver steatosis (10; 41). A recent study indicated that

Fat-1 mice display reduced capacity for gluconeogenesis and lipid synthesis as suggested by


the low hepatic protein expression of PEPCK, G6P, ACC and FAS in the liver (28).

Interestingly, whilst confirming lower mRNA levels of these enzymes, we demonstrated that

AEA and 2-AG levels are also strongly reduced in the liver of Fat-1 mice.

The observation that tissue enrichment with n-3 FA (by dietary or transgenic

manipulation) induces a significant decrease in ECS tone in the liver and muscle supports the

possible existence of a direct causal link between the decrease in EC tone induced by LIN diet

and the improvement of metabolic parameters observed in our study. The role of the ECS in

regulating glucose homeostasis is well known (19; 42-44). In particular, studies using liver-

specific CB1R knockout mice demonstrated that hepatic CB1R activation is both necessary

and sufficient to account for diet-induced hepatic insulin resistance (42). In primary

hepatocytes, direct CB1R activation was found to induce glucose production by increasing

expression of CREBH and gluconeogenic genes (19). CREBH is a liver-specific transcription

factor recently described as a crucial actor in the regulation of hepatic glucose metabolism in

mammals. CREBH has been shown to be induced by fasting or insulin-resistant state in

rodents and to activate transcription of PEPCK or G6Pase gene. Consistent with this, we

observed that mice fed with the LIN diet show low levels of PEPCK, G6P and CREBH

associated with a reduced activity of the ECS in the liver. Therefore, it is conceivable that the

low gluconeogenic gene expression observed in the liver of these mice is mediated by reduced

CREBH expression observed in response to the decrease in EC tone induced by n-3 FA

exposure.

Liu et al. (45) have recently proposed a functional link between the ECS and de novo

lipogenesis pathways that could also apply to our findings. The authors identified hepatic

MUFA generated via SCD1 as endogenous inhibitors of FAAH in the liver and thereby

responsible for elevated hepatic levels of AEA. Here, addition of LIN in the diet increased n-3

FA of liver lipids without depressing n-6 FA but decreased the C18:1/C18:0 ratio, suggesting


that part of the effects might be due to desaturase activity modification. Thus, the low AEA

levels observed in the liver of LIN mice could result from downregulation of FAS and SCD1

gene expression and by a low liver monounsaturated FA production, which in turn would

increase the degradation of AEA by FAAH. The increase in ECS activity induced by HFD

challenge is also in agreement with the potential impact of monounsaturated FA on EC

biosynthesis. Thus, chronic administration of the lipogenic diet might have increased NAPE-

PLD, and decreased FAAH activity, thus leading to higher AEA levels.

Altogether, our results suggest that decreasing ECS activity by introducing n-3 FA in the

early diet induces liver gene expression changes that may contribute to carbohydrate and lipid

metabolism improvements. The reduction in fat mass expansion observed in LIN mice also

suggests a general amelioration of energy homeostasis.

It is widely accepted that the nutritional environment and weight gain in the first years

of life are associated with the risk of developing metabolic disorders. It has been shown that

during the postnatal period, a metabolic imprinting may occur and predispose to an early

onset and aggravation of metabolic disorders induced by exposure to HFD later in life (46). In

the current study, the impact of early diets on the susceptibility to develop metabolic disorders

induced by a subsequent HFD was tested challenging mice with a 30% lard-based diet for 10

weeks. Evidence has accumulated indicating a tonic overactivation of ECS following HFD-

induced obesity (14; 35; 47). Nevertheless, data from the literature also suggest that the effect

of HFD feeding on peripheral EC levels may depend on the FA composition of the diet (12;

14; 48). In the present study, we consistently observed that tissue EC contents were generally

higher after chronic administration of the HFD, whatever the early LFD. Liver transcriptomic

and proteomic analyses related to the ECS also supported a stimulatory effect of HFD on EC

tone as indicated by the marked increase in NAPE-PLD and CB1R expression along with the


concomitant decrease in FAAH expression and activity. However an important finding

concerns EC levels in the inguinal AT, which were lowered in all groups after HFD challenge

in agreement with previous works concerning the impact of HFD on adipose depots of both

rodents and humans (47; 49). Since leptin and insulin were strongly increased after HFD

challenge, it might be suggested that the decrease in SCAT EC levels is due to the action of

these hormones on EC production as previously shown (50; 51). This possibility implies that

our dietary conditions did not yet alter SCAT metabolism to such a degree that it became

resistant to hormonal control. The fact that adiponectin levels were increased by HFD

suggests that fat depots still had the capacity to expand by recruiting new adipocytes. Indeed,

adiponectin production is suppressed as adipocytes become hypertrophic and macrophages

infiltrate the tissue (52). So, it would be informative to determine whether ECS activity is still

decreased in other more severe models of obesity in which the SCAT shows excessive

hypertrophy and metabolic stress.

Feeding mice with 30% lard caused the typical metabolic disorders due to diet-induced

obesity independently on the postnatal nutritional history. However the metabolic

consequences were somehow limited likely due to the total lipid content and the duration of

the diet, which were not elevated. Thus, mice became fatter, showed liver triglyceride

accumulation, hyperinsulinemia, hyperleptinemia, slight hyperglycemia and

hypercholesterolemia. While the differences concerning liver EC tone and lipid composition

induced by the LIN early diet did not persist after HFD challenge, we interestingly observed a

better glucose tolerance in these animals compared with the Lard and SAF groups. Data

further suggest that the better glycemic control observed in mice fed with the early LIN diet

was not dependent on beta cell function but rather associated with an improvement of insulin

sensitivity. This may be closely related to the reduced expression of some key genes involved

in lipid and carbohydrate homeostasis in the liver of LIN fed mice. Although differences were


not always quite statistically significant for genes taken individually, the concomitant

decrease in CB1R, PEPCK, G6P, CREBH, FAS, SCD1, SREBP1c, FAT/CD36, LPL and

TNFα mRNA levels collectively suggests the existence of a metabolic imprinting set up by

the early n-3 FA exposure period.

In conclusion our results strongly support the possibility that early dietary n-3 FA

induce a decrease in liver EC tone giving rise to modifications persisting later in life and

promoting resistance towards metabolic complications induced by an obesogenic diet. These

findings support the emerging notion that dietary n-3 FA could be an alternative strategy to

drug use to reduce overactivity of peripheral ECS, and consequently improve or prevent

metabolic disorders related to obesity.

Acknowledgments. The authors thank Serge Monier (Plateforme de Cytométrie) from

INSERM LNC UMR866 for excellent technical assistance.

Funding. This work was supported by funds from the Regional Council of Burgundy and

Groupe Lipides et Nutrition (GLN).

Duality of Interest. No potential conflicts of interest relevant to this article were reported.

Author Contributions. L.D., V.D. and P.D. designed, analyzed the experiments and wrote

the manuscript. L.D., S.T.-F., J.G., T.M and P.D. performed experiments related to fatty acid

compositions, metabolic and molecular parameters. F.P., S.B., and C.S. determined tissue

endocannabinoid contents. F.A.I performed western blotting and enzyme activity

experiments. S.T.-F. reviewed the written draft of the manuscript. J.B. produced Fat-1 mouse

tissue samples. V.D. and P.D. are the guarantors of this work and, as such, had full access to


all the data in the study and take responsibility for the integrity of the data and the accuracy of

the data analysis.

REFERENCES

1. Di Marzo V, Goparaju SK, Wang L, Liu J, Batkai S, Jarai Z, Fezza F, Miura GI, Palmiter

RD, Sugiura T, Kunos G: Leptin-regulated endocannabinoids are involved in maintaining

food intake. Nature 2001;410:822-825

2. Quarta C, Mazza R, Obici S, Pasquali R, Pagotto U: Energy balance regulation by

endocannabinoids at central and peripheral levels. Trends Mol Med 2011;17:518-526

3. Williams CM, Kirkham TC: Anandamide induces overeating: mediation by central

cannabinoid (CB1) receptors. Psychopharmacology (Berl) 1999;143:315-317

4. Mallat A, Lotersztajn S: Endocannabinoids and their role in fatty liver disease. Dig Dis

2010;28:261-266

5. Jeong WI, Osei-Hyiaman D, Park O, Liu J, Batkai S, Mukhopadhyay P, Horiguchi N,

Harvey-White J, Marsicano G, Lutz B, Gao B, Kunos G: Paracrine activation of hepatic

CB1 receptors by stellate cell-derived endocannabinoids mediates alcoholic fatty liver.

Cell Metab 2008;7:227-235

6. Jourdan T, Demizieux L, Gresti J, Djaouti L, Gaba L, Verges B, Degrace P: Antagonism of

peripheral hepatic cannabinoid receptor-1 improves liver lipid metabolism in mice:

evidence from cultured explants. Hepatology 2012;55:790-799

7. Buggy Y, Cornelius V, Wilton L, Shakir SA: Risk of depressive episodes with rimonabant:

a before and after modified prescription event monitoring study conducted in England.

Drug Saf 2011;34:501-509

8. Di Marzo V, Despres JP: CB1 antagonists for obesity--what lessons have we learned from

rimonabant? Nat Rev Endocrinol 2009;5:633-638

9. Di Marzo V: Endocannabinoids: synthesis and degradation. Rev Physiol Biochem

Pharmacol 2008;160:1-24

10. Li J, Li FR, Wei D, Jia W, Kang JX, Stefanovic-Racic M, Dai Y, Zhao AZ: Endogenous

omega-3 polyunsaturated fatty acid production confers resistance to obesity,

dyslipidemia, and diabetes in mice. Mol Endocrinol 2014;28:1316-1328


11. Alvheim AR, Torstensen BE, Lin YH, Lillefosse HH, Lock EJ, Madsen L, Froyland L,

Hibbeln JR, Malde MK: Dietary linoleic acid elevates the endocannabinoids 2-AG and

anandamide and promotes weight gain in mice fed a low fat diet. Lipids 2014;49:59-69

12. Alvheim AR, Torstensen BE, Lin YH, Lillefosse HH, Lock EJ, Madsen L, Hibbeln JR,

Malde MK: Dietary linoleic acid elevates endogenous 2-arachidonoylglycerol and

anandamide in Atlantic salmon (Salmo salar L.) and mice, and induces weight gain and

inflammation in mice. Br J Nutr 2013;109:1508-1517

13. Berger A, Crozier G, Bisogno T, Cavaliere P, Innis S, Di Marzo V: Anandamide and diet:

inclusion of dietary arachidonate and docosahexaenoate leads to increased brain levels of

the corresponding N-acylethanolamines in piglets. Proc Natl Acad Sci U S A

2001;98:6402-6406

14. Alvheim AR, Malde MK, Osei-Hyiaman D, Lin YH, Pawlosky RJ, Madsen L, Kristiansen

K, Froyland L, Hibbeln JR: Dietary linoleic acid elevates endogenous 2-AG and

anandamide and induces obesity. Obesity (Silver Spring) 2012;20:1984-1994

15. Sato A, Kawano H, Notsu T, Ohta M, Nakakuki M, Mizuguchi K, Itoh M, Suganami T,

Ogawa Y: Antiobesity effect of eicosapentaenoic acid in high-fat/high-sucrose diet-

induced obesity: importance of hepatic lipogenesis. Diabetes 2010;59:2495-2504

16. Batetta B, Griinari M, Carta G, Murru E, Ligresti A, Cordeddu L, Giordano E, Sanna F,

Bisogno T, Uda S, Collu M, Bruheim I, Di Marzo V, Banni S: Endocannabinoids may

mediate the ability of (n-3) fatty acids to reduce ectopic fat and inflammatory mediators

in obese Zucker rats. J Nutr 2009;139:1495-1501

17. Kalupahana NS, Claycombe K, Newman SJ, Stewart T, Siriwardhana N, Matthan N,

Lichtenstein AH, Moustaid-Moussa N: Eicosapentaenoic acid prevents and reverses

insulin resistance in high-fat diet-induced obese mice via modulation of adipose tissue

inflammation. J Nutr 2010;140:1915-1922

18. Hein GJ, Chicco A, Lombardo YB: Fish oil normalizes plasma glucose levels and

improves liver carbohydrate metabolism in rats fed a sucrose-rich diet. Lipids

2012;47:141-150

19. Chanda D, Kim DK, Li T, Kim YH, Koo SH, Lee CH, Chiang JY, Choi HS: Cannabinoid

receptor type 1 (CB1R) signaling regulates hepatic gluconeogenesis via induction of

endoplasmic reticulum-bound transcription factor cAMP-responsive element-binding

protein H (CREBH) in primary hepatocytes. J Biol Chem 2011;286:27971-27979


20. Furuya DT, Poletto AC, Freitas HS, Machado UF: Inhibition of cannabinoid CB1 receptor

upregulates Slc2a4 expression via nuclear factor-kappaB and sterol regulatory element-

binding protein-1 in adipocytes. J Mol Endocrinol 2012;49:97-106

21. Zalewski BM, Patro B, Veldhorst M, Kouwenhoven S, Escobar PC, Lerma JC, Koletzko

B, Van Goudoever JB, Szajewska H: Nutrition of Infants and Young Children (1-3

Years) and its Effect on Later Health: A Systematic Review of Current

Recommendations (EarlyNutrition Project). Crit Rev Food Sci Nutr 2015:0

22. Glavas MM, Kirigiti MA, Xiao XQ, Enriori PJ, Fisher SK, Evans AE, Grayson BE,

Cowley MA, Smith MS, Grove KL: Early overnutrition results in early-onset arcuate

leptin resistance and increased sensitivity to high-fat diet. Endocrinology 2010;151:1598-

1610

23. Liu Z, Lim CY, Su MY, Soh SL, Shui G, Wenk MR, Grove KL, Radda GK, Han W, Xiao

X: Neonatal overnutrition in mice exacerbates high-fat diet-induced metabolic

perturbations. J Endocrinol 2013;219:131-143

24. Massiera F, Barbry P, Guesnet P, Joly A, Luquet S, Moreilhon-Brest C, Mohsen-Kanson

T, Amri EZ, Ailhaud G: A Western-like fat diet is sufficient to induce a gradual

enhancement in fat mass over generations. J Lipid Res 2010;51:2352-2361

25. Pouteau E, Aprikian O, Grenot C, Reynaud D, Pace-Asciak C, Cuilleron CY, Castaneda-

Gutierrez E, Moulin J, Pescia G, Beysen C, Turner S, Mace K: A low alpha-linolenic

intake during early life increases adiposity in the adult guinea pig. Nutr Metab (Lond)

2010;7:8

26. Massiera F, Saint-Marc P, Seydoux J, Murata T, Kobayashi T, Narumiya S, Guesnet P,

Amri EZ, Negrel R, Ailhaud G: Arachidonic acid and prostacyclin signaling promote

adipose tissue development: a human health concern? J Lipid Res 2003;44:271-279

27. Gonzalez-Periz A, Horrillo R, Ferre N, Gronert K, Dong B, Moran-Salvador E, Titos E,

Martinez-Clemente M, Lopez-Parra M, Arroyo V, Claria J: Obesity-induced insulin

resistance and hepatic steatosis are alleviated by omega-3 fatty acids: a role for resolvins

and protectins. FASEB J 2009;23:1946-1957

28. Romanatto T, Fiamoncini J, Wang B, Curi R, Kang JX: Elevated tissue omega-3 fatty acid

status prevents age-related glucose intolerance in fat-1 transgenic mice. Biochim Biophys

Acta 2014;1842:186-191

29. Bellenger J, Bellenger S, Bataille A, Massey KA, Nicolaou A, Rialland M, Tessier C,

Kang JX, Narce M: High pancreatic n-3 fatty acids prevent STZ-induced diabetes in fat-1

mice: inflammatory pathway inhibition. Diabetes 2011;60:1090-1099


30. Folch J, Lees M, Sloane Stanley GH: A simple method for the isolation and purification

of total lipides from animal tissues. J Biol Chem 1957;226:497-509

31. Christie WW: A simple procedure for rapid transmethylation of glycerolipids and

cholesteryl esters. J Lipid Res 1982;23:1072-1075

32. Niot I, Gresti J, Boichot J, Sempore G, Durand G, Bezard J, Clouet P: Effect of dietary n-

3 and n-6 polyunsaturated fatty acids on lipid-metabolizing enzymes in obese rat liver.

Lipids 1994;29:481-489

33. Bartelt A, Orlando P, Mele C, Ligresti A, Toedter K, Scheja L, Heeren J, Di Marzo V:

Altered endocannabinoid signalling after a high-fat diet in Apoe(-/-) mice: relevance to

adipose tissue inflammation, hepatic steatosis and insulin resistance. Diabetologia

2011;54:2900-2910

34. Iannotti FA, Piscitelli F, Martella A, Mazzarella E, Allara M, Palmieri V, Parrella C,

Capasso R, Di Marzo V: Analysis of the "endocannabinoidome" in peripheral tissues of

obese Zucker rats. Prostaglandins Leukot Essent Fatty Acids 2013;89:127-135

35. Matias I, Petrosino S, Racioppi A, Capasso R, Izzo AA, Di Marzo V: Dysregulation of

peripheral endocannabinoid levels in hyperglycemia and obesity: Effect of high fat diets.

Mol Cell Endocrinol 2008;286:S66-78

36. Di Marzo V, Griinari M, Carta G, Murru E, Ligresti A, Cordeddu L, Giordano E, Bisogno

T, Collu M, Batetta B, Uda S, Berge K, Banni S: Dietary krill oil increases

docosahexaenoic acid and reduces 2-arachidonoylglycerol but not N-acylethanolamine

levels in the brain of obese Zucker rats. Int Dairy J 2010;20:231-235

37. Sealls W, Gonzalez M, Brosnan MJ, Black PN, DiRusso CC: Dietary polyunsaturated

fatty acids (C18:2 omega6 and C18:3 omega3) do not suppress hepatic lipogenesis.

Biochim Biophys Acta 2008;1781:406-414

38. Elks ML: Chronic perifusion of rat islets with palmitate suppresses glucose-stimulated

insulin release. Endocrinology 1993;133:208-214

39. Delarue J, LeFoll C, Corporeau C, Lucas D: N-3 long chain polyunsaturated fatty acids: a

nutritional tool to prevent insulin resistance associated to type 2 diabetes and obesity?

Reprod Nutr Dev 2004;44:289-299

40. Rossi AS, Lombardo YB, Chicco AG: Lipogenic enzyme activities and glucose uptake in

fat tissue of dyslipemic, insulin-resistant rats: effects of fish oil. Nutrition 2010;26:209-

217

41. White PJ, Arita M, Taguchi R, Kang JX, Marette A: Transgenic restoration of long-chain

n-3 fatty acids in insulin target tissues improves resolution capacity and alleviates


obesity-linked inflammation and insulin resistance in high-fat-fed mice. Diabetes

2010;59:3066-3073

42. Liu J, Zhou L, Xiong K, Godlewski G, Mukhopadhyay B, Tam J, Yin S, Gao P, Shan X,

Pickel J, Bataller R, O'Hare J, Scherer T, Buettner C, Kunos G: Hepatic cannabinoid

receptor-1 mediates diet-induced insulin resistance via inhibition of insulin signaling and

clearance in mice. Gastroenterology 2012;142:1218-1228 e1211

43. Silvestri C, Di Marzo V: The endocannabinoid system in energy homeostasis and the

etiopathology of metabolic disorders. Cell Metab 2013;17:475-490

44. Troy-Fioramonti S, Demizieux L, Gresti J, Muller T, Verges B, Degrace P: Acute

activation of cannabinoid receptors by anandamide reduces gastrointestinal motility and

improves postprandial glycemia in mice. Diabetes 2015;64:808-818

45. Liu J, Cinar R, Xiong K, Godlewski G, Jourdan T, Lin Y, Ntambi JM, Kunos G:

Monounsaturated fatty acids generated via stearoyl CoA desaturase-1 are endogenous

inhibitors of fatty acid amide hydrolase. Proc Natl Acad Sci U S A 2013;110:18832-

18837

46. Sullivan EL, Grove KL: Metabolic imprinting in obesity. Forum Nutr 2010;63:186-194

47. Starowicz KM, Cristino L, Matias I, Capasso R, Racioppi A, Izzo AA, Di Marzo V:

Endocannabinoid dysregulation in the pancreas and adipose tissue of mice fed with a

high-fat diet. Obesity (Silver Spring) 2008;16:553-565

48. Piscitelli F, Carta G, Bisogno T, Murru E, Cordeddu L, Berge K, Tandy S, Cohn JS,

Griinari M, Banni S, Di Marzo V: Effect of dietary krill oil supplementation on the

endocannabinoidome of metabolically relevant tissues from high-fat-fed mice. Nutr

Metab (Lond) 2011;8:51

49. Annuzzi G, Piscitelli F, Di Marino L, Patti L, Giacco R, Costabile G, Bozzetto L, Riccardi

G, Verde R, Petrosino S, Rivellese AA, Di Marzo V: Differential alterations of the

concentrations of endocannabinoids and related lipids in the subcutaneous adipose tissue

of obese diabetic patients. Lipids Health Dis 2010;9:43

50. Matias I, Gonthier MP, Orlando P, Martiadis V, De Petrocellis L, Cervino C, Petrosino S,

Hoareau L, Festy F, Pasquali R, Roche R, Maj M, Pagotto U, Monteleone P, Di Marzo V:

Regulation, function, and dysregulation of endocannabinoids in models of adipose and

beta-pancreatic cells and in obesity and hyperglycemia. J Clin Endocrinol Metab

2006;91:3171-3180


51. D'Eon TM, Pierce KA, Roix JJ, Tyler A, Chen H, Teixeira SR: The role of adipocyte

insulin resistance in the pathogenesis of obesity-related elevations in endocannabinoids.

Diabetes 2008;57:1262-1268

52. Skurk T, Alberti-Huber C, Herder C, Hauner H: Relationship between adipocyte size and

adipokine expression and secretion. J Clin Endocrinol Metab 2007;92:1023-1033

FIGURE LEGEND

Figure 1. Schematic illustration of (A) the pathways for biosynthesis and degradation of

endocannabinoids and (B) the experimental study design.

AEA : N-arachidonoyl-ethanolamine ; 2-AG : 2-arachidonoyl-glycerol ; ECs :

Endocannabinoids ; FAAH : Fatty acid amide hydrolase ; MAGL : Monoacylglycerol lipase ;

NAPE-PLD : N-acylphosphatidylethanolamine phospholipase D.

Figure 2. Effect of early diets and later high-fat diet challenge on liver N-arachidonoyl-

ethanolamine (AEA) and 2-arachidonoyl-glycerol (2-AG) contents. Three-week old mice

were fed a 5% lipid diet containing either lard or lard + safflower oil (SAF) or lard + linseed

oil (LIN) for 10 weeks (early LF diet). Then mice were all challenged with a 30% lard diet for

10 additional weeks (HF diet challenge). Results are expressed as means ± SEM (n=4-6). Two

different superscript letters indicate significant statistical differences between groups after

early LF diet or after HF diet challenge at p<0.05. *Asterisks indicate significant statistical

differences between HF diet challenge vs corresponding early LF diet means (p<0.05).

Figure 3. Effect of early diets and later high-fat diet challenge on regulation of proteins

involved in liver endocannabinoid system activity. Three-week old mice were fed a 5% lipid

diet containing either lard or lard + safflower oil (SAF) or lard + linseed oil (LIN) for 10


weeks (early LF diet). Then mice were all challenged with a 30% lard diet for 10 additional

weeks (HF diet challenge). (A) Gene expression analysis of CB1R, NAPE-PLD (denoted as

NAPE) and FAAH. (B). Representative immunoblots of liver protein analysis of FAAH,

NAPE-PLD (denoted as NAPE) and MAGL with graphical densitometry quantification. (C)

FAAH and MAGL activity measured in 4 separated samples as described in Materials and

Methods. Results are expressed as means ± SEM (n=4-6). Two different superscript letters

indicate significant statistical differences between groups after early LF diet or after HF diet

challenge at p<0.05. *Asterisks indicate significant statistical differences between HF diet

challenge vs corresponding early LF diet means (p<0.05).

Figure 4. Effect of early diets and later high-fat diet challenge on glycemic control. Three-

week old mice were fed a 5% lipid diet containing either lard or lard + safflower oil (SAF) or

lard + linseed oil (LIN) for 10 weeks (early LF diet) and subject to (A) oral glucose tolerance

test (OGTT, 2 g/kg) and (B) insulin tolerance test (ITT, 0.5 UI/kg). Then mice were all

challenged with a 30% lard diet for 10 additional weeks (HF diet challenge) and subject to

(C) OGTT and (D) ITT. (E) Plasma insulin appearance after oral glucose load (2 g/kg) was

determined after HF diet challenge. Results are expressed as means ± SEM (n=7-9).

* p<0.05, LIN vs Lard and SAF.† p<0.05, LIN vs SAF. $ p<0.05, LIN vs Lard

Figure 5. Expression of genes related to carbohydrate and lipid metabolism in the liver.

Three-week old mice were fed a 5% lipid diet containing either lard or lard + safflower oil

(SAF) or lard + linseed oil (LIN) for 10 weeks (early LF diet). Then mice were all challenged

with a 30% lard diet for 10 additional weeks (HF diet challenge). Results are expressed as

means ± SEM (n=6-9). Two different superscript letters indicate significant statistical

differences between groups after early LF diet or after HF diet challenge at p<0.05. *Asterisks


indicate significant statistical differences between HF diet challenge vs corresponding early

LF diet means (p<0.05).

CREBH : Cyclic AMP-response element-binding protein H ; FAS : Fatty acid synthase ;

FAT/CD36 : Fatty acid translocase ; GK : Glucokinase ; G6P : Glucose-6-phosphatase ; LPL :

Lipoprotein lipase ; PEPCK : Phosphoenolpyruvate carboxykinase ; SCD1 : Stearoyl-CoA

desaturase 1; TNF-α : Tumor necrosis factor α.

Figure 6. N-arachidonoyl-ethanolamine (AEA) and 2-arachidonoyl-glycerol (2-AG) contents

and expression of genes related to the ECS and carbohydrate and lipid metabolism in the liver

of Fat-1 mice. (A) Liver AEA and 2-AG contents. (B) Gene expression analysis. Results are

expressed as means ± SEM (n=5). *Asterisks indicate significant statistical differences

between groups at p<0.05.

FAS : Fatty acid synthase ; GK : Glucokinase ; G6P : Glucose-6-phosphatase ; PEPCK :

Phosphoenolpyruvate carboxykinase.

Sup Figure 1. N-arachidonoyl-ethanolamine (AEA) and 2-arachidonoyl-glycerol (2-AG)

levels in (A) Brain, (B) muscle, (C) visceral adipose tissue (VAT) and (D) subcutaneous

adipose tissue (SCAT) (B). Three-week old mice were fed a 5% lipid diet containing either

lard or lard + safflower oil (SAF) or lard + linseed oil (LIN) for 10 weeks (early LF diet).

Then mice were all challenged with a 30% lard diet for 10 additional weeks (HF diet

challenge). Results are expressed as means ± SEM (n=3-6). Two different superscript letters






Table 1. Diet and liver total fatty acid composition

FA

Diet

Liver

after early LF diet

Liver

after HF diet challenge

(% total FA) Lard SAF LIN Lard SAF LIN Lard SAF LIN

C14 :0

2.1

1.2

1.7

- - - - - -

C16:0

27.7

17.6

24.0

24.40

± 0.56

22.49

± 0.24

25.36

± 0.22

25.19*

± 0.25

25.34*

± 0.36

26.23*

± 0.35

C16:1n-7

3.1

1.7

2.6

7.69a

± 1.14

4.00b

± 0.21

7.29a

± 0.28

4.38*

± 0.14

4.14

± 0.12

4.26*

± 0.16

C18:0

16.7

9.1

14.4

3.71a

± 0.19

7.97b

± 0.54

4.83a

± 0.17

3.91

± 0.44

3.82*

± 0.43

3.92*

± 0.43

C18:1n-9

40.5

28.1

37.4

44.47a

± 0.19

22.75b

± 0.81

35.63c

± 0.67

47.75*

± 1.63

46.49*

± 1.65

45.58*

± 1.73

C18:2n-6

8.6

40.9

10.0

5.11a

± 0.09

18.0b

± 0.51

7.34c

± 0.18

5.92*

± 0.33

6.33*

± 0.44

6.68

± 0.37

C18:3n-3

0.4

0.8

9.2

- - - - - -

C20:4n-6

- - - 5.49a

± 0.36

14.0b

± 0.80

3.94c

± 0.09

5.23*

± 0.82

5.09*

± 0.83

5.05*

± 0.79

C22:6n-3

- - - 1.14a

± 0.17

2.34b

± 0.09

7.25c

± 0.13

0.27a*

± 0.22

1.37b*

± 0.22

1.99b*

± 0.40

n-6/n-3

22.3 52.7 1.1 8.72a

± 0.10

13.46b

± 0.73

1.03c

± 0.02

8.73a

± 0.63

9.34a*

± 0.59

6.36b*

± 0.50

Liver fatty acids (FA) are expressed as means ± SEM (n=7-9). Two different superscript letters indicate significant statistical differences between groups after early LF diet or after HF diet challenge at p<0.05. Values are not indicated when fatty acid content did not reach 1g/100g in at least one series. *Asterisks indicate significant statistical differences between HF diet challenge vs corresponding early LF diet means (p<0.05).


Table 2. Body composition and plasma parameters.

After early LF diet After HF diet challenge

Lard SAF LIN Lard SAF LIN n=7 n=7 n=7 n=7 n=9 n=7

Body weight (g)

22.7

± 0.74

22.8

± 0.47

23.5

± 0.74

35.4*

± 1.60

36.3*

± 2.13

36.4*

± 1.63

Liver

(% of bw)

4.43a

± 0.07

3.61b

± 0.10

3.61b

± 0.07

4.00

± 0.19

4.17

± 0.25

3.78

± 0.22

pVAT

(% of bw)

2.19

± 0.17

2.23

± 0.08

2.34

± 0.17

6.19

± 0.34

5.91

± 0.42

6.33

± 0.29

iSCAT

(% of bw)

1.33a

± 0.07

1.02b

± 0.04

1.16c

± 0.06

2.74

± 0.28

2.84

± 0.31

2.82

± 0.18

Fat mass

(% of bw)

13.9 a

± 0.46

14.8 a

± 0.95

12.9 b

± 0.27

33.3*

± 1.73

33.4*

± 2.43

34.3*

± 1.88

Triglycerides

(mg/ml)

0.43a

± 0.04

0.27b

± 0.03

0.29b

± 0.04

0.27*

± 0.02

0.32

± 0.03

0.28

± 0.02

Cholesterol

(mg/ml)

1.30a

± 0.06

1.17b

± 0.09

1.07b

± 0.12

1.68*

± 0.12

1.71*

± 0.12

1.69*

± 0.05

Adiponectin

(µg/ml)

15.5a

± 2.17

20.9b

± 3.07

22.3b

± 2.59

28.66a*

± 1.69

31.75ab*

± 1.61

35.54b*

± 2.16

Leptin

(pg/ml)

40.1

± 26.6

16.1

± 10.5

21.0

± 10.1

526.4*

± 129.1

890.5*

± 156.1

622.6*

± 141.3

Insulin

(pg/ml)

25.4a

± 15.4

108.3b

± 36.0

131.5b

± 62.7

715.5*

± 168.3

837.0*

± 151.5

755.9*

± 119.2

Glucose

(g/l)

1.76

± 0.06

1.70

± 0.02

1.63

± 0.10

2.07*

± 0.14

2.09*

± 0.11

1.97*

± 0.08

HOMA-IR - - - 20.0ab

± 2.63

22.7a

± 3.40

15.4bc

± 1.98

DI0-15/DG0-15 - - - -176a

±220

2344b

±646

1993b

±504


DI0 - - - -0.002a

±0.005

0.056b

±0.014

0.060b

±0.013

All parameters except glucose levels were measured from blood and tissue samples collected the day of sacrifice on overnight-fasted animals. Glucose levels and calculations were determined from blood samples collected during OGTT experiments initiated with 6h-fasting animals. HOMA-IR = fasting glucose (mmol/l)*fasting insulin(µUI/l)/22.5. DI0-15/DG0-15 : insulin production to glucose load (µUI/mmol). DI0 : Oral disposition index (mmol-1) = (DI0-15/DG0-15)*1/fasting insulin Results are expressed as means ± SEM (n=7-9). Two different superscript letters indicate significant statistical differences between groups after early LF diet or after HF diet challenge at p<0.05. *Asterisks indicate significant statistical differences between HF diet challenge vs corresponding early LF diet means (p<0.05).


Figure 1

382x551mm (300 x 300 DPI)


Figure 2

382x551mm (300 x 300 DPI)


Figure 3

382x551mm (300 x 300 DPI)


Figure 4

382x551mm (300 x 300 DPI)


Figure 5

382x551mm (300 x 300 DPI)


Figure 6

382x551mm (300 x 300 DPI)


Supplementary table 1. Primers for real-time PCR

Gene 5'-sense primer-3'

5'-antisense primer-3'

CB1R ccgcaaagatagtcccaatg aaccccacccagtttgaac

CREBH gcacctgcatagcggtccttctg gggatgcagcgtggttgtgga

FAAH ggaccttgctcccctttct cctgctgggctgtcacata

FAS ggctgcagtgaatgaatttg ttcgtacctccttggcaaac

FAT/CD36 aattagtagaaccgggccac ccaactcccaggtacaatca

GK actttccaggccacaaaca tcccagaactgtaagccactc

G6P tggcctggcttattgtacct gtgctaagaggaagacccga

LPL ctaaggacccctgaagacaca tctcatacattcccgttaccgt

NAPE-PLD ctcgatatctgcgtggaaca ctgaattctggcgctttctc

PEPCK cagccagtgccccattatt ccaccaaagatgataccctca

SCD1 ccggagaccccttagatcga tagcctgtaaaagatttctgcaaacc

TNF-a cggggtgatcggtccccaaag tggtttgctacgacgtgggct

18S gtgtggggagtgaatggtg gcgagacagtcaaaccacg

L38 catgcctcggaaaattgag tcttgacagacttggcatcct

TPB acggcacaggacttactcca gctgtctttgttgctcttccaa

Primer pairs were designed using Primers! software or NCBI/ Primer-BLAST and

were synthesized by MWG-Biotech AG (Ebersberg, Germany). CB1R : Cannabinoid

receptor 1 ; CREBH : Cyclic AMP-response element-binding protein H ; FAAH :

Fatty acid amide hydrolase ; FAS : Fatty acid synthase ; FAT/CD36 : Fatty acid

translocase ; GK : Glucokinase ; G6P : Glucose-6-phosphatase ; LPL : Lipoprotein

lipase ; NAPE-PLD : N-acyl phosphatidylethanolamine phospholipase D; PEPCK :

Phosphoenolpyruvate carboxykinase ; SCD1 : Stearoyl-CoA desaturase 1; TNF-α :

Tumor necrosis factor α ; 18S : 18S ribosomal RNA ; L38 : L38 Ribosomal protein;

TPB : TATA box binding protein.


264x382mm (72 x 72 DPI)


Sup Figure 1. N-arachidonoyl-ethanolamine (AEA) and 2-arachidonoyl-glycerol (2-AG)

levels in (A) Brain, (B) muscle, (C) visceral adipose tissue (VAT) and (D) subcutaneous

adipose tissue (SCAT) (B). Three-week old mice were fed a 5% lipid diet containing either

lard or lard + safflower oil (SAF) or lard + linseed oil (LIN) for 10 weeks (early LF diet).

Then mice were all challenged with a 30% lard diet for 10 additional weeks (HF diet

challenge). Results are expressed as means ± SEM (n=3-6). Two different superscript letters





Documents

Early Low Fat Diet Enriched with Linolenic Acid Reduces Liver … · 2016. 3. 28. · EARLY LOW FAT DIET ENRICHED WITH LINOLENIC ACID REDUCES LIVER ENDOCANNABINOID TONE AND IMPROVES