Chemosphere 93 (2013) 1029–1034

Contents lists available at SciVerse ScienceDirect

Chemosphere

journal homepage: www.elsevier .com/locate /chemosphere

Early life permethrin treatment leads to long-term cardiotoxicity

0045-6535/$ - see front matter � 2013 Elsevier Ltd. All rights reserved.http://dx.doi.org/10.1016/j.chemosphere.2013.05.073

⇑ Corresponding author. Address: School of Pharmacy, Via Gentile III da Varano,UNICAM, 62032 Camerino, MC, Italy. Tel.: +39 0737 403208; fax: +39 0737 403290.

E-mail address: rosita.gabbianelli@unicam.it (R. Gabbianelli).

M.S. Dhivya Vadhana a, S. Siva Arumugam b, Manuel Carloni c, Cinzia Nasuti c, Rosita Gabbianelli c,⇑a School of Advanced Studies, University of Camerino, Via Lili, 62032 Camerino, MC, Italyb School of Environmental and Natural Sciences, University of Camerino, Via Gentile III da Varano, 62032 Camerino, MC, Italyc School of Pharmacy, University of Camerino, Via Gentile III da Varano, 62032 Camerino, MC, Italy

h i g h l i g h t s

� Early life pesticide exposure has long-term consequences on heart.� A significant decrease in heart surface area was observed in treated rats.� Calcium and Nrf2 gene expression levels were increased in old age.

a r t i c l e i n f o

Article history:Received 20 December 2012Received in revised form 23 May 2013Accepted 25 May 2013Available online 24 June 2013

Keywords:Early-lifePermethrinCardiac hypotrophyOld ageNrf2Calcium

a b s t r a c t

Environmental, nutritional or hormonal influences in early life may have long-term effects changinghomeostatic processes and physiological parameters in adulthood. NF-kB and Nrf2, two of the main tran-scription factors regulating genes involved in pro-inflammatory and antioxidant responses respectively,can be modified by various stimuli. NF-kB controls immediate early genes and is required for cardiomy-ocyte hypertrophic growth, while Nrf2 protects the heart from oxidative stress-induced cardiovascularcomplications.

The aim of this study was to investigate the impact of early life permethrin treatment (1/50 of LD50,from 6th to 21st day of life) on the development of cardiotoxicity in 500-day-old rats. Nrf2 and NF-kBgene expression, calcium level and heart surface area were chosen as biomarkers of toxicity.

Six candidate reference genes were first examined and GAPDH resulted the most stable one for RT-qPCR. The comparative expression analysis of the target genes showed 1.62-fold increase in Nrf2 mRNAlevel, while the NF-kB mRNA in treated rats was not significantly changed compared to control ones. Asignificant decrease in heart surface area was observed in treated rats (296.59 ± 8.09, mm2) with respectto the control group (320.86 ± 4.93, mm2). Finally, the intracellular calcium influx in heart of early lifetreated rats increased 4.33-fold compared to the control one.

In conclusion, early life pesticide exposure to low doses of permethrin insecticide, has long-term con-sequences leading to cardiac hypotrophy, increased calcium and Nrf2 gene expression levels in old age.

� 2013 Elsevier Ltd. All rights reserved.

1. Introduction

There is increasing evidence that the cardiovascular system issusceptible to external influences throughout gestation and afterbirth. Fetal, early childhood and adolescent environmental expo-sures can impair cardiovascular health and function. In addition,biological and lifestyle factors can strongly affect cardiovascularhealth, sometimes by interacting with the effects of environmentalexposures (Mone et al., 2004). Cardiomyocytes are highly differen-tiated cells that rarely replicate after birth; thus, any agent thatharms them during the fetal period can cause lasting damage(Mone et al., 2004). Epidemiological studies have shown a strong

correlation between stressful events (nutritional, hormonal orenvironmental) in early life and development of adult diseasessuch as obesity, diabetes and cardiovascular failure (Trevenzoliet al., 2007). Environmental, nutritional or hormonal influencesin early life (during gestation and lactation) may change somephysiological parameters in adulthood; this phenomenon is knownas programming (Barker, 1995; Waterland and Garza, 1999).Several animal models of programming have been studied to ex-plain how imprinting factors in early life may modulate physiolog-ical parameters and metabolism in a later permanent manner(Vickers et al., 2005; Zambrano et al., 2006). There are multiplereasons for the delayed appreciation of cardiovascular toxicity asa significant outcome of environmental pollutants (Bhatnagar,2004).

Permethrin, a synthetic pyrethroid with a broad-spectruminsecticidal activity, is used for outdoor/indoor pest control and

1030 M.S. Dhivya Vadhana et al. / Chemosphere 93 (2013) 1029–1034

as anti-wood worm agent (Bradberry et al., 2005). Permethrin ischaracterized by pronounced lipophilicity, which makes it able toeasily cross membranes leading to human contamination, as dem-onstrated by the presence of permethrin metabolites in urine(Bradberry et al., 2005). In medicine, it has been shown to be effec-tive and safe for treatment of body lice, head lice and scabies andchildren come in contact with this pesticide also following theseuses (Taplin and Meinking, 1990).

A study by Blaylock et al. (1995) using oral exposure to per-methrin in a mouse model, demonstrated immunotoxicity of per-methrin in the form of inhibited T lymphocyte cytotoxic activity.Several reports from our laboratory show that chronic permethrintreatment brings to striatum oxidative stress and neurobehavioraldisorders (Nasuti et al., 2007; Falcioni et al., 2010), immune systemimpartment (Gabbianelli et al., 2004, 2009; Vadhana et al., 2011;Fedeli et al., 2012) as well as heart cell damage (Vadhana et al.,2010). Moreover, previous findings demonstrate that early life per-methrin treatment in rats induces biochemical changes correlatedto heart disease and neurodegeneration in adulthood (Vadhanaet al., 2011; Carloni et al., 2012).

Since environment-gene interactions can cause changes ingenes involved in the redox system, here we analyzed the impactof early life permethrin exposure on gene expression profiles ofthe two main genes, Nrf2 and NF-kB, involved in the anti-inflammatory and pro-inflammatory responses. Nuclear factorE2-related factor 2 (Nrf2) is a transcription factor, ubiquitously ex-pressed in the cardiovascular system, that controls the expressionof a battery of antioxidant genes and other cytoprotective phase IIdetoxifying enzymes (Li et al., 2009a,b). In addition to the wealth ofevidence showing Nrf2 to be a major regulator of cellular defensesagainst various pathological stresses in diverse organs, such as lungand kidney, it has been demonstrated that Nrf2 plays a critical rolethrough the co-ordination of a group of its downstream antioxi-dant genes to suppress myocardial oxidative stress (Li et al.,2009a,b). Meanwhile, the transcription factor NF-kB regulates awide variety of biological effects in diverse cell types and organs,particularly stress, immune and adaptive responses. In the heart,NF-kB has been found to be required for development of late pre-conditioning against myocardial infarction (Jones et al., 2005). NF-jB is important in regulating cellular responses because it belongsto the category of ‘‘rapid-acting’’ primary transcription factor thatallows it to be a first responder to harmful cellular stimuli likereactive oxygen species (Chandel et al., 2000).

A better understanding of the heart transcriptional profiling fol-lowing early life permethrin exposure, could be used to monitorthe impact of pesticide exposure on the development of diseasesassociated with heart damage in adult age. For this reason, thepresent study aims at analyzing the expression of Nrf2 and NF-kB target genes in the heart tissue of 500-day-old rats treated withpermethrin during early life (1/50 LD50, from 6th to 21st day oflife). Rats were sacrificed when they were 500-days-old becausethis age corresponds to 50-year-old humans (Andreollo et al.,2012) which represents the beginning of old age. Moreover, in or-der to evaluate permethrin cardiotoxicity, functional markers suchas heart surface area and intracellular calcium level weremeasured.

2. Materials and methods

2.1. Materials

All reagents were of pure and analytical grade and were ob-tained from Sigma Chemical Co. (USA). Technical grade (75:25,trans:cis; 94% purity) 3-phenoxybenzyl-(1R,S)-cis,trans-3-(2,2-dichlorovinyl)-2,2-dimethylcyclopropanecarboxyl-ate, (Permeth-

rin) was generously donated by Dr. A. Stefanini of ACTIVA, Milan,Italy.

2.2. Animals

Male and female Wistar rats from Charles River (Calco, LC,Italy), weighing 250–270 g and about 90 d old were used. The ani-mals were housed in plastic (Makrolon) cages (five rats/cage) in atemperature controlled room (21 ± 5 �C) and maintained on a lab-oratory diet with water ad libitum. The light/dark cycle was from 7p.m. to 7 a.m. Animal use in this study complied with the Directive2010/63/EU of the European Parliament and of the Council of 22September 2010 on the protection of animals used for scientificpurposes. Rat pups born in our laboratory from primiparous damswere used in the study. The parturition day was set as Post NatalDay 0 (PND0). On PND1, all litters were examined externally forthe presence of gross abnormalities, sexed, weighed and the femalepups were discarded. Two male pups were assigned to each damuntil weaning (PND21). No cross-fostering was employed. At 2 dof age, litters were randomly assigned to two experimental groups(n = 6 rats for each).

2.3. Treatment

Permerthin was dissolved in corn oil and administered orally byan intragastric tube (4 mL kg�1) at a dose of 1/50 of LD50 corre-sponding to 34.05 mg kg�1 (Cantalamessa, 1993). The dosage waschosen based on the ‘‘no observed adverse effect level’’ (NOAEL)for permethrin of 25 mg kg�1. The compounds were administeredonce a day in the morning from PND6 to PND21. Control rats weretreated with vehicle (corn oil 4 mL kg�1) on a similar schedule. Thevolume of the compound administered was adjusted daily basedon body weight measured during the dosing period. On PND21,the offspring were weaned and the littermates were housed to-gether. At old age (PND 500), six rats from each group (Permethrintreated and control groups) were sacrificed by exposure to CO2,and their hearts were collected and pooled for analysis. For theexperiments, the groups of animals were formed by drawing ani-mals from different litters, so that no group contained siblings.All data were analyzed considering the litter as the smallest unit.

2.4. Total RNA isolation and quality assessment

Total RNA was isolated from a pool of tissue samples from con-trol and treated rats using Trizol reagent (Gibco BRL), following themanufacturer’s instructions, and resuspended in diethylpyrocar-bonate (DEPC) treated water. RNA concentration was then quanti-fied using the NanoDrop� ND-1000 UV–VIS spectrophotometer(Thermo Scientific Inc., USA). RNA quality was also assessed byrunning samples on a 1.7% agarose gel and staining with ethidiumbromide to reveal two sharp bands in every sample.

2.5. cDNA synthesis and PCR amplification

Total RNA (2 lg) was reverse transcribed into single strandcDNAs using Maxima First Strand cDNA Synthesis Kit for RT-qPCR(Fermentas, Thermo Fisher Scientific Inc., USA) following the man-ufacturer’s instructions. Serial dilutions of the cDNA in water wereprepared (10�1–10�4) and were used to amplify 6 control genesused for normalization and 2 test genes (Table 1). The primers usedfor amplification (Table 1) were designed using the Primer De-signer program, v3.0 (Scientific and Educational Software). ThePCR was performed using Phire Hot Start II DNA Polymerase (Finn-zymes Oy, Finland) in a total volume of 20 ll containing 100 ng ofcDNA, 0.5 lM of sense and antisense gene-specific primers and200 lM of dNTP Mix (Fermentas, Thermo Fisher Scientific Inc.,

Table 1List of Primer used for the RT-qPCR study.

Gene 50-Primer (F) 30-Primer (R) Amplicon size

Rattus beta-Ac TAAAGACCTCTATGCCAACACAGTGC AGAGTACTTGCGCTCAGGAGGAG 145Rattus Cop9 TGGAGGTGGATGCAGCAGTC CCCGATCAGAGCCCCAAT 161Rattus Hmbs TCAGCTGGCTCGCATACAGACC CAGGGCGTTTTCTAGCTCCTTGGT 172Rattus Ppib TCATCGTGGGCTCCGTTG AGCCAAATCCTTTCTCTCCTGTAGC 214Rattus Rpl10a GCAAGTTTCTGGAGACGGTGG CCAGGACGCACACGGAGA 141Rattus Gapdh CGCCTGGAGAAACCTGCC GTAGGCCATGAGGTCCACCAC 212Rattus Nrf2 CAGCACATCCAGACAGACACCA CGTATTAAGACACTGTAACTCGGGAATGG 333Rattus Nfkb CAAGATCAATGGCTACACGGGA CGGACCGCATTCAAGTCATAGTC 291

M.S. Dhivya Vadhana et al. / Chemosphere 93 (2013) 1029–1034 1031

USA). The cycles performed for amplification consisted of an initialstep of 30 s at 98 �C followed by 35 cycles of 5 s at 98 �C, 5 s at63 �C, 15 s at 72 �C and the final step was at 72 �C for 1 min. PCRproducts were separated on a 1.7% agarose gel in 1x TAE buffer(40 mM Tris–acetate and 1 mM EDTA) containing 0.5 lg mL�1 ethi-dium bromide. GeneRuler 100 bp DNA Ladder (Fermentas, ThermoFisher Scientific Inc., USA) was used to size DNA fragments. Gelimages were captured using the KODAK Image Station 2000rSystems.

2.6. Real-time quantitative PCR

For precise, quantitative analysis of mRNA, each sample was runin triplicate using the 96-well thermal system of the MX3000Pquantitative PCR instrument (Stratagene). For each reaction,25 ng of template cDNA, 0.25 lM sense and antisense primers,10 ll of iQ SYBR Green Super Mix (BIORAD) and water were addedto make a final volume of 20 ll. Thermal cycling was carried out asfollows: initial denaturation at 95 �C for 3 min; and 40 cycles at95 �C for 30 s, 63 �C for 30 s and 72 �C for 1 min. The programwas terminated by a final extension at 95 �C for 1 min, 60 �C for30 s and 95 �C for 30 s. Threshold cycles (Ct values) were deter-mined. Each PCR was run in triplicate and the mean value was usedto calculate the mRNA abundance according to the 2�DDCt method(Carloni et al., 2012).

2.7. Data acquisition

To consider the quality and quantity of mRNA, normalizationwas performed on the expression levels of six housekeeping genes.To determine the stability among the six housekeeping genes used,analysis was performed using the GeNorm 3.3 visual basic applica-tion for Microsoft Excel validated previously (Vandesompele et al.,2002). Upon validation of the best housekeeping gene, relativeQuantitation (RQ) using Comparative Ct method was used to deter-mine the change in expression of the target(test) genes Nrf2 andNF-kB. For each sample, mean Ct both for the gene of interestand for the validated best housekeeping gene were determinedto calculate DCt,sample (Ct, target gene � Ct, housekeeping gene).The expression level was reported to a calibrator consisting ofcDNA from control rats. Subsequently, DDCt (DCt,sam-ple � DCt,calibrator) was determined, and the relative expressionlevels were calculated from 2�DDCt. RNA expression levels are thusindicated as arbitrary units (means SE).

2.8. Calcium levels

The isolation of single cells from the heart tissue for measuringthe calcium flux was performed by Race’s method with minormodifications (Kao, 2009). The heart tissue was rapidly excisedand dropped into a beaker of cold Krebs–Henseleit bicarbonatebuffer for 5–10 min following the perfusion of heart tissue withcalcium free Krebs–Henseleit bicarbonate buffer for 5–10 min.

Throughout the experiment the buffers were gassed with oxygensupply. The tissue was then incubated with the enzyme solutioncontaining 65.25 U mL�1 of collagenase and 2.1 U mL�1 of proteaseat 37 �C under gentile agitation. The dispersed cells were harvestedafter every 5 min of incubation by decantation. Fresh enzyme solu-tion was then added to continue cell isolation. After 30 min, thesolution was transferred to a 15-mL tube and centrifuged at239 g, 4 �C, 5 min to collect the cells. The pellet was washed twicein cold Krebs–Henseleit buffer to remove the enzymes completelyand finally resuspended in Phosphate Buffer Saline (PBS). Measure-ment of calcium influx on fresh heart cells obtained from controland treated rats was assessed using Calcium Green-1 AM (Invitro-gen, USA) as fluorescent indicator as previously described (Sileiet al., 2000) with minor modifications. Cells were maintained un-der oxygen flux throughout the experiment. Briefly, calciumGreen-1 AM was reconstituted in high-quality anhydrous Dimethylsulfoxide (DMSO). Calcium level was measured in a reaction mix-ture containing 5 lM Calcium Green-1 AM, and 3 � 106 heart cellsobtained from control and treated rats individually. The fluores-cence was monitored using a Hitachi 4500 spectrofluorometer,emission wavelength, 531 nm, excitation wavelength, 506 nm,excitation slit 5, emission slit 5. Measurements were recorded from0 to 10 s. A standard curve was done using CaCl2 in PBS at differentconcentrations in the presence of Calcium Green-1 AM (5 lM finalconcentration) to report the results as mM Ca2+/106 cells.

2.9. Heart surface area

After sacrifice, the heart of each rat was immediately photo-graphed by digital photocamera (Olympus SP-560UZ) with sizemarker (8 � 8 mm) used for the scale. The digital images weretransferred to Image J program and measured for surface area(mm2). Three measurements were taken from each image andthe mean values for control and treated group were calculated.

2.10. Statistical analysis

Statistical analysis was carried out using a one-way analysis ofvariance followed by post hoc Newman–Keuls test (Statsoft Statis-tica Software, 9.0). Data were expressed as mean values ± SEM. A Pvalue 6 0.05 was considered statistically significant.

3. Results

3.1. GeNorm analysis

Gene expression variation was calculated for all six candidatereference genes based on Ct-values. The variation in expressionof the reference genes revealed the ranking of the six candidate ref-erence genes in whole heart, according to their average expressionstability (M value) shown in Fig. 1. From the most stable (lowest M-value) to the least stable (highest M value): GAPDH < COP 9 < RPL10A < PPI < HMB < ACTB, all six genes reach high expression

0,5

0,6

0,7

0,8

0,9

1

ACTB HMB PPI RPL 10A COP 9 GAPDH

Least stable genes Most stable genes

Ave

rage

exp

ress

ion

stab

ility

M

Fig. 1. Average expression stability values (M) of the six reference genes. M isrepresented from the least stable (left) to the most stable (right), as analyzed by thegeNorm programme.

0

5

10

15

20

25

30

35

GAPDH RPL 10A PPI ACTB COP9 HMB

Reference genes

Ct

- va

lue

1:1 dil1:10 dil1:100 dil

Fig. 2. Expression levels of housekeeping genes: Stock plots showing the expressionlevels of the different reference genes in heart samples (n = 6) at different dilutionsof cDNA. Values are given as cycle threshold numbers (Ct values).

A

0

0,5

1

1,5

2

Control Treated

Rel

ativ

e qu

anti

fica

tion

(R

Q) *

B

0

0,5

1

1,5

2

TreatedControlR

elat

ive

quan

tifi

cati

on (

RQ

)

Fig. 3. Nrf2 (A) and NF-kB (B) gene expression measured using real-time qPCR incontrol and treated rats. All expression values were normalized to the value ofGAPDH used as an internal control gene. *P 6 0.05 versus control. All data presentedas mean ± SE.

0

1

2

3

4

5

6

7

8

TreatedControl

Ca2+

mM

/1x1

06 c

ells

*

1032 M.S. Dhivya Vadhana et al. / Chemosphere 93 (2013) 1029–1034

stability with low M-values. Therefore, GAPDH was the most stablereference gene with the least M value and was hence selected forthe comparative expression analysis of the target genes. The sec-ond and third best reference genes were COP 9 and RPL 10A witha 0.07 difference in M value. In addition, Fig. 2 shows the rangeand distribution of the Ct values with different dilutions in heartvarying among the different reference primers selected for thestudy.

Fig. 4. Intracellular calcium flux in rat heart cells using the Fluorescent CalciumGreen-1 indicator. Cells were excited at 506 nm, and emission fluorescence wascollected at 531 nm from 0 s to 10 s. A standard curve was done using CaCl2 in PBSat different concentrations in the presence of Calcium Green-1 AM (5 lM finalconcentration) to report the results as mM Ca2+/106 cells. Data represent themeans ± SE. *P 6 0.001, versus control at the respective time of treatment.

3.2. Gene expression

In this study, we examined the mRNA expression of Nrf2 andNF-kB transcription factors in hearts from 500-day-old rats, treatedwith permethrin during early life. qRT-PCR analysis revealed thatmRNA levels change for both Nrf2 and NF-kB due to permethrinearly life treatment. The outcomes showed a significant differencefor Nrf2 expression (1.62-fold increase) in the treated group withrespect to the control one (Fig. 3A), while no significant differencewas observed for NF-kB (Fig. 3B).

3.3. Calcium levels

The level of calcium in the cytosol is determinant for the con-tractile state of cardiac muscle and a transient increase of cytosoliccalcium is produced during each action. Fig. 4 shows the Ca2+ influxlevel on fresh heart cells obtained from control and treated ratsmaintained under constant oxygen flux. A significant increase(F1,6 = 182592; P < 0.0001) in calcium influx into the cells was ob-served in heart of treated rats (7.013 ± 0.024, mM Ca2+/106 cells)with respect to the control ones (1.619 ± 0.005, mM Ca2+/106 cells).

Moreover, the same outcome in control and treated groups wasmaintained until 90 min (data not shown).

3.4. Heart surface area

Fig. 5 shows the heart surface area measured on fresh heart ob-tained from control and treated rats after sacrifice. A significant de-crease (F1,23 = 6,81; P < 0,05) in heart surface area was observed intreated rats (296.59 ± 8.09, mm2) with respect to the control group(320.86 ± 4.93, mm2).

4. Discussion

Validation of more tissue-specific reference genes is a funda-mental first-step in RT-qPCR analysis, because normalization based

Fig. 5. Myocardial surface area of heart measured by digital photocamera (OlympusSP-560UZ) at postmortem from control and treated groups. Morphometric data arepresented as means ± SE. *P 6 0.001, versus control.

M.S. Dhivya Vadhana et al. / Chemosphere 93 (2013) 1029–1034 1033

only on a single reference gene can lead to erroneous results (Tri-carico et al., 2002; Akilesh et al., 2003; Brunner et al., 2004; De Koket al., 2005; Schmittgen and Zakrajsek, 2000). Statistical algorithmssuch as geNorm (Vandesompele et al., 2002) have been developedto assess the appropriateness of reference genes. GeNorm, a VisualBasic Application for Microsoft Excel, determines the expressionstability of candidate reference genes by assigning to each gene agene-stability measure M. The gene with the highest M-value (i.e.least stable) gets eliminated until the two most stable expressedgenes remain.

In our study, we evaluated the expression levels for six genes inorder to select potential reference genes for normalization ofmRNA expression data on rat heart tissue. Variability of Ct valueswas first examined through graphical visualizations (Fig. 2). Weidentified GAPDH, COP 9 and RPL 10A to be the most stable ex-pressed genes respectively, recommended for use as referencegenes for RT-qPCR analyses in heart tissue.

This study shows for the first time, that Nrf2 gene expressionin heart cells is overexpressed in 500 day-old-rats treated in earlylife with permethrin. Nf-E2 related factor-2 (Nrf2) is a basic leu-cine zipper transcription factor that binds and activates the anti-oxidant response element (ARE) in the promoters of manyantioxidant and detoxification genes (Purdom-Dickinson et al.,2007). Nrf2 has been shown to be a key regulator in reducing oxi-dative stress and inflammatory damage in SAH-induced cerebralvasospasm (Wang et al., 2010). In addition, a cardioprotective ef-fect against pathological cardiac remodeling in murine hearts, fol-lowing the increase in Nrf2 transcriptional activity induced byAmerican ginseng, has been reported (Li et al., 2010). In the pres-ent work, it could be hypothesized that the increased transcrip-tion level of Nrf2 gene could be a response related to oxidativestress in heart developed after early life exposure to permethrin.This hypothesis can be supported by precedent findings wherean increase in glutathione peroxidase activity was found in heartcells of another cohort of rats under the same treatment (Vadhanaet al., 2011). Growing evidences suggest that a rapid onset ofselective protein translation serves as an important mechanismfor cells to deal with stress (Sheikh and Fornace, 1999; Holcikand Sonenberg, 2005). Our data are in agreement with the reportsof Kopf et al., where 1.5-fold Nrf2 upregulation was found in miceleft ventricle after treatment with TCDD, an environmental toxi-cant able to induce oxidative stress (Kopf et al., 2008), and withdata of Zhu et al., that support the role of Nrf2 in cardiac fibro-blasts in the regulation of antioxidant and phase II enzymes(Zhu et al., 2005).

NF-kB, a pleiotropic transcription factor has been implicated inthe signal transduction pathways underlying various cardiac path-ophysiologic states, including ischemic preconditioning, conges-tive heart failure, unstable angina pectoris, atherogenesis, andapoptosis (Ritchie, 1998; Wong et al., 1998; Xuan et al., 1999). De-spite the fact that treated rats showed many marks of oxidativedamage in heart (i.e. DNA damage, protein and lipid oxidation,reduction of GSH, etc.) and in plasma (i.e. increased pro-inflamma-tory cytokines, high cholesterol and low albumin levels) when theywere 300-days old (Vadhana et al., 2011), in the present study, at500-days old, no significant NF-kB gene expression variation be-tween control and treated rat heart cells were observed. The con-trasting results can be explained, firstly, taking into account thatpermethrin treatment was done during the early stages of life,while the gene expression studies were assessed in 500-day-oldrats, therefore the stress response/changes elicited by permethrin(Vadhana et al., 2011; Carloni et al., 2012) could have been neutral-ized by the antioxidant defense mechanism, mediated by Nrf2activation.

Secondly, Ca2+ plays a key role in the maintenance of myocar-dial contractility, so its level represents a useful marker to testheart functionality. Models of heart failure have been correlatedwith mechanical dysfunction due to changes in the calcium regula-tion observed in isolated myocytes (Eberhard and Erne, 1991). Cal-cium green-1 is one of the most suitable Ca2+ indicators formeasurement of intracellular calcium levels. This probe, becauseof its high affinity, can be used to measure resting and stimulated[Ca2+] accurately, allowing a rapid and easy evaluation of varia-tions of intracellular calcium ([Ca2+]i) in cell suspensions (Eberhardand Erne, 1991; Silei et al., 2000). Our results showed an increasedcalcium influx level in hearts collected from permethrin treatedrats compared to control ones. To explain the increased calcium in-flux observed in heart cells of treated rats, two hypotheses may beformulated. The first is supported by electrophysiology studies inheart demonstrating that pyrethroids bind to the cardiac Na+ chan-nel isoform prolonging the net Na+ inward current that in turn,leads to increased Ca2+ influx via the Na+–Ca2+ exchanger mecha-nism (Spencer et al., 2001; De la Cerda et al., 2002). Hence, per-methrin treatment, through epigenetic mechanisms, couldpermanently alter Na+ channel functionality leading to increasednet Na+ influx that leads to increased Ca2+ influx via the Na+–Ca2+

exchanger even when pesticide exposure has ended, although wedo not verify this hypothesis yet. The second hypothesis takes intoaccount that the same treated rats showed lower noradrenalineand adrenaline levels versus the control ones (Fedeli et al., 2013).Maybe, the increased calcium influx is implicated as a compensa-tory mechanism in response to depressed sympathetic tone andhence reduced heart contractility (Fedeli et al., 2013). This explana-tion is in agreement with a previous study on b-adrenergic-KOmice demonstrating that compensatory mechanisms may beactivated to maintain cardiac function even in the absence ofadrenergic tone (Lee et al., 2010).

It has been shown that [Ca2+]i elevation may mediate differentheart failure phenotypes, thus the area surface of the entire heartwas measured in order to determine if permethrin treatment couldinduce gross myocardial phenotype changes. A decreased surfacearea was observed in the heart of treated rats compared with con-trols. Also, we observed that the ventricle wall of treated animalswere less elastic which could probably be due to the pericardiumbreakage made to draw blood from the animal under anesthesiabefore the sacrifice. Hence, our findings showing cardiac hypotro-phy in treated rats point to an involvement of reduced sympathetictone on the modeling of myocardial physiology following pyre-throid treatment.

In conclusion, early life pesticide exposure to low doses of per-methrin insecticide has long-term consequences leading to cardiac

1034 M.S. Dhivya Vadhana et al. / Chemosphere 93 (2013) 1029–1034

hypotrophy, and increased calcium and Nrf2 gene expression lev-els in old age. The over expression of Nrf2 and the increased cal-cium level in heart could occur through epigenetic mechanismsthat maintain the memory of pesticide contact even when expo-sure has ended and they may contribute to the formation of theadult phenotype. To establish this point, epigenetic studies toestablish the mechanisms related with long lasting effects of earlylife treatment will be the object of future investigations. Moreover,additional studies aimed to identify the type of cardiomyopathy in-volved will be performed on our rats.

Acknowledgement

This paper was supported by MIUR, National Grant No.2008ZW3FJ3 to R.G.

References

Akilesh, S., Shaffer, D.J., Roopenian, D., 2003. Customized molecular phenotyping byquantitative gene expression and pattern recognition analysis. Genome Res. 13,1719–1727.

Andreollo, N.A., Santos, E.F., Araújo, M.R., Lopes, L.R., 2012. Rat’s age versus human’sage: what is the relationship? Arq. Bras. Cir. Dig. 25, 49–51.

Barker, D.J., 1995. The fetal and infant origins of disease. Eur. J. Clin. Invest. 25, 457–463.

Bhatnagar, A., 2004. Cardiovascular pathophysiology of environmental pollutants.A.J.P – Heart 286, H479–H485.

Blaylock, B.L., Abdel-Nasser, M., McCarty, S.M., Knesel, J.A., Tolson, K.M., Ferguson,P.W., et al., 1995. Suppression of cellular immune responses in BALB/c micefollowing oral exposure to permethrin. Bull. Environ. Contam. Toxicol. 54, 768–774.

Bradberry, S.M., Cage, S.A., Proudfoot, A.T., Vale, A., 2005. Poisoning due topyrethroids. Toxicol. Rev. 24, 93–106.

Brunner, A.M., Yakovlev, I.A., Strauss, S.H., 2004. Validating internal controls forquantitative plant gene expression studies. BMC Plant Biol. 4, 14–21.

Cantalamessa, F., 1993. Acute toxicity of two pyrethroids, permethrin andcypermethrin in neonatal and adult rats. Arch. Toxicol. 67, 510–513.

Carloni, M., Nasuti, C., Fedeli, D., Montani, M., Amici, A., Vadhana, M.S., Gabbianelli,R., 2012. The impact of early life permethrin exposure on development ofneurodegeneration in adulthood. Exp. Gerontol. 47, 60–66.

Chandel, N.S., Trzyna, W.C., McClintock, D.S., Schumacker, P.T., 2000. Role ofoxidants in NF-kappa B activation and TNF-alpha gene transcription induced byhypoxia and endotoxin. J. Immunol. 165, 1013–1021.

De Kok, J.B., Roelofs, R.W., Giesendorf, B.A., Pennings, J.L., Waas, E.T., Feuth, T., et al.,2005. Normalization of gene expression measurements in tumor tissues:comparison of 13 endogenous control genes. Lab. Invest. 85, 154–159.

De la Cerda, E., Navarro-Polanco, R.A., Sánchez-Chapula, J.A., 2002. Modulation ofcardiac action potential and underlying ionic currents by the pyrethroidinsecticide deltamethrin. Arch. Med. Res. 33, 448–454.

Eberhard, M., Erne, P., 1991. Calcium binding to fluorescent indicators: calciumgreen, calcium orange and calcium crimson. Biochem. Biophys. Res. Commun.180, 209–215.

Falcioni, M.L., Nasuti, C., Bergamini, C., Fato, R., Lenaz, G., Gabbianelli, R., 2010. Theprimary role of glutathione against nuclear DNA damage of striatum induced bypermethrin in rats. Neuroscience 168, 2–10.

Fedeli, D., Montani, M., Carloni, M., Nasuti, C., Amici, A., Gabbianelli, R., 2012.Leukocyte Nurr1 as peripheral biomarker of early life environmental exposureto permethrin insecticide. Biomarkers 17, 604–609.

Fedeli, D., Carloni, M., Nasuti, C., Gambini, A., Scocco, V., Gabbianelli, R. 2013. Earlylife permethrin pesticide exposure affects plasma and urines metabolites in 500days old rats Pestic. Biochem. Physiol. http://dx.doi.org/10.1016/j.pestbp.2013.05.010

Gabbianelli, R., Nasuti, C., Falcioni, G., Cantalamessa, F., 2004. Lymphocyte DNAdamage in rats exposed to pyrethroids: effect of supplementation withVitamins E and C. Toxicology 203, 17–26.

Gabbianelli, R., Falcioni, M.L., Nasuti, C., Cantalamessa, F., Imada, I., Inoue, M., 2009.Effect of permethrin insecticide on rat polymorphonuclear neutrophils. Chem.Biol. Interact. 182, 245–252.

Holcik, M., Sonenberg, N., 2005. Translational control in stress and apoptosis. Nat.Rev. Mol. Cell. Biol. 6, 318–327.

Jones, W.K., Brown, M., Wilhide, M., He, S., Ren, X., 2005. NF-kappaB incardiovascular disease: diverse and specific effects of a ‘‘general’’transcription factor? Cardiovasc. Toxicol. 5, 183–202.

Kao, R.L., 2009. In: James M. Downey (Ed.), Isolation of Ventricular Myocytes fromAdult Rat. ISHR Handbook of Experimental Laboratary procedures, University ofSouth Alabama MSB, Room 3074 USA.

Kopf, P.G., Huwe, J.K., Walker, K.M., 2008. Hypertension, cardiac hypertrophy, andimpaired vascular relaxation induced by 2,3,7,8-tetrachlorodibenzo-p-dioxinare associated with increased superoxide. Cardiovasc. Toxicol. 8, 181–193.

Lee, S., Grafweg, S., Schneider, T., Jimenez, M., Giacobino, J.P., Ghanem, A., Tiemann,K., Bloch, W., Müller-Ehmsen, J., Schwinger, R.H.G., Brixius, K., 2010. Total b-adrenoceptor deficiency results in cardiac hypotrophy and negative inotropy.Physiol. Res. 59, 679–689.

Li, J., Ichikawa, T., Janicki, J.S., Cui, T., 2009a. Targeting the Nrf2 pathway againstcardiovascular disease. Expert Opin. Ther. Targets 13, 785–794.

Li, J., Ichikawa, T., Villacorta, L., Janicki, J.S., Brower, G.L., Yamamoto, M., 2009b. Nrf2protects against maladaptive cardiac responses to hemodynamic stress.Arterioscler. Thromb. Vasc. Biol. 29, 1843–1850.

Li, J., Ichikawa, T., Jin, Y., Hofseth, L.J., Nagarkatti, P., Nagarkatti, M., Windust, A., Cui,T., 2010. An essential role of Nrf2 in American ginseng-mediated anti-oxidativeactions in cardiomyocytes. J. Ethnopharmacol. 130, 222–230.

Mone, S.M., Gillman, M.W., Miller, T.L., Herman, E.H., Lipshultz, S.E., 2004. Effects ofenvironmental exposures on the cardiovascular system: prenatal periodthrough adolescence. Pediatrics 113, 1058–1069.

Nasuti, C., Gabbianelli, R., Falcioni, M.L., Di Stefano, A., Sozio, P., Cantalamessa, F.,2007. Dopaminergic system modulation, behavioural changes, and oxidativestress after neonatal administration of pyrethroids. Toxicology 229, 194–205.

Purdom-Dickinson, S.E., Sheveleva, E.V., Sun, H., Chen, Q.M., 2007. Translationalcontrol of Nrf2 protein in activation of antioxidant response by oxidants. Mol.Pharmacol. 72, 1074–1081.

Ritchie, M.E., 1998. Nuclear factor-kappaB is selectively and markedly activated inhumans with unstable angina pectoris. Circulation 98, 1707–1713.

Schmittgen, T.D., Zakrajsek, B.A., 2000. Effect of experimental treatment onhousekeeping gene expression: validation by real-time, quantitative RT-PCR. J.Biochem. Biophys. Methods 46, 69–81.

Sheikh, M.S., Fornace, A.J., 1999. Regulation of translation initiation following stress.Oncogene 18, 6121–6128.

Silei, V., Fabrizi, C., Venturini, G., Tagliavini, F., Salmona, M., Bugiani, O., Lauro, G.M.,2000. Measurement of intracellular calcium levels by the fluorescent Ca2+

indicator calcium-green. Brain Res. Protoc. 5, 132–134.Spencer, C.I., Yuill, K.H., Borg, J.J., Hancox, J.C., Kozlowski, R.Z., 2001. Actions of

pyrethroid insecticides on sodium currents, action potentials, and contractilerhythm in isolated mammalian ventricular myocytes and perfused hearts. J.Pharmacol. Exp. Ther. 298, 1067–1082.

Taplin, D., Meinking, T.L., 1990. Pyrethrins and pyrethroids in dermatology. Arch.Dermatol. 126, 213–221.

Trevenzoli, I.H., Valle, M.M.R., Machado, F.B., Garcia, R.M.G., Passos, M.C.F., Lisboa,P.C., Moura, E.G., 2007. Neonatal hyperleptinaemia programmes adrenalmedullary function in adult rats: effects on cardiovascular parameters. J.Physiol. 580, 629–637.

Tricarico, C., Pinzani, P., Bianchi, S., Paglierani, M., Distante, V., Pazzagli, M., et al.,2002. Quantitative real-time reverse transcription polymerase chain reaction:normalization to rRNA or single housekeeping genes is inappropriate for humantissue biopsies. Anal. Biochem. 309, 293–300.

Vadhana, M.S.D., Nasuti, C., Gabbianelli, R., 2010. Purine bases oxidation and repairfollowing permethrin insecticide treatment in rat heart cells. Cardiovasc.Toxicol. 10, 199–207.

Vadhana, M.S.D., Carloni, M., Nasuti, C., Fedeli, D., Gabbianelli, R., 2011. Early lifepermethrin insecticide treatment leads to heart damage in adult rats. Exp.Gerontol. 46, 731–738.

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Roy, N.V., De Paepe, A.,Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCRdata by geometric averaging of multiple internal control genes. Genome Biol. 3,90–99 (research0034.1–research0034.11).

Vickers, M.H., Gluckman, P.D., Coveny, A.H., Hofman, P.L., Cutfield, W.S., Gertler, A.,et al., 2005. Neonatal leptin treatment reverses developmental programming.Endocrinology 146, 4211–4216.

Wang, Z., Chen, G., Zhu, W.W., Zhou, D., 2010. Activation of nuclear factor-erythroid2-related factor 2 (Nrf2) in the basilar artery after subarachnoid hemorrhage inrats. Ann. Clin. Lab. Sci. 40, 233–239.

Waterland, R.A., Garza, C., 1999. Potential mechanisms of metabolic imprinting thatlead to chronic disease. Am. J. Clin. Nutr. 69, 179–197.

Wong, S.C., Fukuchi, M., Melnyk, P., Rodger, I., Giaid, A., 1998. Induction ofcyclooxygenase-2 and activation of nuclear factor-kappaB in myocardium ofpatients with congestive heart failure. Circulation 98, 100–103.

Xuan, Y.T., Tang, X.L., Banerjee, S., Takano, H., Li, R.C., Han, H., et al., 1999. Nuclearfactor kappaB plays an essential role in the late phase of ischemicpreconditioning in conscious rabbits. Circ. Res. 84, 1095–1109.

Zambrano, E., Bautista, C.J., Deas, M., Martinez-Samayoa, P.M., Gonzalez-Zamorano,M., Ledesma, H., et al., 2006. A low maternal protein diet during pregnancy andlactation has sex- and window of exposure-specific effects on offspring growthand food intake, glucose metabolism and serum leptin in the rat. J. Physiol. 571,221–230.

Zhu, H., Itoh, K., Yamamoto, M., Zweier, J.L., Li, Y., 2005. Role of Nrf2 signaling inregulation of antioxidants and phase 2 enzymes in cardiac fibroblasts:protection against reactive oxygen and nitrogen species-induced cell injury.FEBS Lett. 579, 3029–3036.