Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
3223RESEARCH ARTICLE
INTRODUCTIONRecent studies have linked together the action of several tumor
suppressors into a Fat-Hippo-Warts signaling network (reviewed by
Reddy and Irvine, 2008). These genes play a crucial role in growth
control from Drosophila to mammals, as exemplified by the ever-
increasing number of cancers that have been associated with
mutations in pathway genes (Steinhardt et al., 2008; Zeng and Hong,
2008). Fat-Warts signaling regulates growth through a
transcriptional co-activator protein, called Yorkie (Yki) in
Drosophila and YAP in vertebrates (Dong et al., 2007; Huang et al.,
2005). In addition, Fat influences a distinct planar cell polarity (PCP)
pathway (reviewed by Reddy and Irvine, 2008; Strutt, 2008). Planar
cell polarity is the polarization of cells within the plane of a tissue,
and can include both polarized structures, like hairs and bristles, and
polarized behaviors, such as cell division and cell intercalation
(Strutt, 2008).
Fat is a large member of the cadherin family, and acts as a
transmembrane receptor (reviewed by Reddy and Irvine, 2008). Fat
influences the subcellular localization of both the unconventional
myosin Dachs and the FERM-domain protein Expanded, and
through these proteins ultimately regulates the kinase Warts (Bennett
and Harvey, 2006; Cho et al., 2006; Feng and Irvine, 2007; Mao et
al., 2006; Silva et al., 2006; Tyler and Baker, 2007; Willecke et al.,
2006). Warts then inhibits Yki by phosphorylating it:
phosphorylated Yki is retained in the cytoplasm, but
unphosphorylated Yki enters the nucleus to promote the
transcription of target genes (Dong et al., 2007; Oh and Irvine, 2008;
Zhao et al., 2007). The Fat PCP pathway is less well characterized,
but it is partially dependent upon Dachs (Mao et al., 2006), and also
involves Atrophin (Grunge), a transcriptional co-repressor that can
bind to the Fat cytoplasmic domain (Fanto et al., 2003).
The only Fat ligand identified is Dachsous (Ds), which like Fat
is a large, atypical cadherin (Clark et al., 1995), and which
influences the phosphorylation of Fat by Discs overgrown (Feng
and Irvine, 2009; Sopko et al., 2009). ds mutants have phenotypes
similar to, but weaker than, those of fat mutants, raising the
possibility that there might be other ligands, or other means of
regulating Fat. The Golgi kinase Four-jointed (Fj) also regulates
Fat signaling, but presumably acts by modulating Fat-Ds
interactions (Ishikawa et al., 2008; Reddy and Irvine, 2008).
Intriguingly, the two known Fat pathway regulators (ds and fj) are
expressed in gradients in developing tissues (Clark et al., 1995;
Villano and Katz, 1995). The vectors (directions) of these
gradients parallel vectors of PCP, and experimental manipulations
of ds and fj indicate that, at least in some tissues, their graded
expression can direct PCP (Adler et al., 1998; Casal et al., 2002;
Simon, 2004; Strutt and Strutt, 2002; Yang et al., 2002; Zeidler et
al., 1999). The graded expression of ds and fj also influences the
transcriptional branch of the pathway and wing growth, but in this
case it is the slope rather than the vector of their gradients that
appears to be instructive (Cho et al., 2006; Cho and Irvine, 2004;
Reddy and Irvine, 2008; Rogulja et al., 2008; Willecke et al.,
2008).
Although thus far most components of Fat signaling have been
identified through genetic studies in Drosophila, protein interaction
screens are an alternative approach with which to identify
components of signaling pathways. A genome-wide yeast two-
hybrid screen identified the product of the CG13139 gene as both a
candidate Fat-interacting protein and a candidate Ds-interacting
protein (Giot et al., 2003). This gene, which we have named lowfat(lft), encodes a small protein of unknown structure and biochemical
function. It shares sequence similarity with two vertebrate genes,
Limb expression 1 (Lix1) and Lix1-like (Lix1l; Fig. 1A). Lix1 was
first identified in chickens through a differential screen for genes
expressed during early limb development (Swindell et al., 2001).
Subsequent analysis in mice revealed that Lix1 is actually expressed
more broadly (Moeller et al., 2002). Lix1l has been defined only by
its sequence similarity to Lix1. The biological functions of these
genes have not been described, although genetic mapping of a feline
spinal muscular atrophy identified LIX1 as a candidate gene (Fyfe et
al., 2006).
Drosophila lowfat, a novel modulator of Fat signalingYaopan Mao*, Binnaz Kucuk* and Kenneth D. Irvine†
The Fat-Hippo-Warts signaling network regulates both transcription and planar cell polarity. Despite its crucial importance to thenormal control of growth and planar polarity, we have only a limited understanding of the mechanisms that regulate Fat. Wereport here the identification of a conserved cytoplasmic protein, Lowfat (Lft), as a modulator of Fat signaling. Drosophila Lft, andits human homologs LIX1 and LIX1-like, bind to the cytoplasmic domains of the Fat ligand Dachsous, the receptor protein Fat, andits human homolog FAT4. Lft protein can localize to the sub-apical membrane in disc cells, and this membrane localization isinfluenced by Fat and Dachsous. Lft expression is normally upregulated along the dorsoventral boundary of the developing wing,and is responsible for elevated levels of Fat protein there. Levels of Fat and Dachsous protein are reduced in lft mutant cells, andcan be increased by overexpression of Lft. lft mutant animals exhibit a wing phenotype similar to that of animals with weak allelesof fat, and lft interacts genetically with both fat and dachsous. These studies identify Lft as a novel component of the Fat signalingpathway, and the Lft-mediated elevation of Fat levels as a mechanism for modulating Fat signaling.
KEY WORDS: Drosophila, Fat, Hippo, Lix1, PCP, Signaling
Development 136, 3223-3233 (2009) doi:10.1242/dev.036152
Howard Hughes Medical Institute, Waksman Institute and Department of MolecularBiology and Biochemistry, Rutgers The State University of New Jersey, Piscataway,NJ 08854, USA.
*These authors contributed equally to this work†Author for correspondence ([email protected])
Accepted 22 July 2009 DEVELO
PMENT
3224
While a basic outline of Fat signaling has emerged, many steps
remain poorly understood. Here, we show that lft is a modulator of
Fat signaling, and identify a cellular requirement for Lft in
establishing normal levels of both Fat and Ds. Our observations
identify transcriptional regulation of lft as a potential mechanism for
modulating Fat signaling through its post-translational regulation of
Fat and Ds protein levels. We also establish human LIX1L as a
functional homolog of Lft, and LIX1 and LIX1L as Fat-interacting
proteins, thus identifying a likely cellular function of vertebrate Lix1genes as modulators of Fat signaling. This linkage raises the
possibility that other Fat pathway components could be candidate
susceptibility loci for spinal muscular atrophy.
MATERIALS AND METHODSDrosophila stocks and crossesUnless otherwise noted, crosses were conducted at 25°C. Gal4 lines
employed included ptc-Gal4, en-Gal4, act-Gal4[3rd chromosome] and tub-Gal4[LL7]. ds and fat mutant stocks employed have been described
previously (Cho et al., 2006; Cho and Irvine, 2004).
A null mutation in lft was created using ends-out homologous
recombination-mediated gene targeting (Gong and Golic, 2003). The
targeting vector included a 5000-bp left arm and a 3680-bp right arm,
amplified by PCR from wild-type (Oregon-R) genomic DNA and cloned
into pW25 (Gong and Golic, 2003). The left arm 3� end is 40-bp upstream
of the lft start codon, and the right arm 5� end is 16-bp upstream the lft stop
codon. Third chromosome transgenic lines, W25-TG2 and W25-TG4, were
crossed to hs-Flp; hs-I-SceI/TM3, and heat shocked at 38°C for one hour
three days after egg laying. Progeny with mosaic eyes were crossed to hs-Flp-70 lines, and their progeny with non-mosaic eyes were balanced over
CyO. Southern blotting and PCR were performed to confirm correct
targeting. The targeted line lftTG2 was used for all experiments.
Primers for creating the targeting construct were as follows:
Left arm, CG13139-960 5�-GGTCCATTGCGGCCGCGCTGCC -
TGCGAGCTACGGTGCTCAAAA-3� and CG13139-5964 5�-GACG -
GTACCGGTTTCGGGTTTCGTTTTCAGCACAAA-3�;Right arm, CG13139-7013 5�-TGAGGCGCGCCCGGCTA CCAT -
TGATGATTA-3� CG13139-10775 5�-CCGGACCGGGTGG AAGAAT-3�.TILLING was performed by the Seattle TILLING Project
(http://tilling.fhcrc.org). The screened region covered 1464 bp, including
part of the promoter region and the first 214 codons. The primers sequences
were 5�-TGGTCCGTTCTCCTGGATAAAATAAAAGTG-3� (left primer)
and 5�-ATTATCGTGCTCCCTGGCAATCCAAT-3� (right primer).
For the creation of conventional mutant clones, lftTG2 FRT40A, dsUAO71
FRT40A/CyO Kr-Gal4 UAS GFP, fatG-rv FRT40A/CyO GFP, fatG-rv lftTG2
FRT40A/CyO GFP or dsUA071 lftTG2 FRT40A/CyO GFP were crossed to y whs-FLP[122]; Ubi-GFP FRT40A/CyO.
For the creation of MARCM clones, lftTG2 FRT40A; UAS-d:V5[9F], fat8FRT40A; UAS-lft:FLAG[6] or dsUAO71 FRT40A; UAS-lft:FLAG[6] were
crossed to y w hs-FLP tub-Gal4 UAS-GFP/FM7; tub-Gal80 FRT40A/CyO.
For the examination of wing disc growth, en-Gal4 UAS-GFP/CyO; UAS-dcr2/TM6B flies were crossed to RNAi ds (vdrc36219), RNAi lft and RNAids (vdrc36219); RNAi lft /TM6B flies, and cultured at 28.5°C.
Two methods were used to establish transgenic lines expressing FLAG-
tagged lft. For P-mediated transformation, pUAST-Flag:lft was created, and
insertions were isolated on the second (UAS-FLAG:lft[H]) and third
(UAS-FLAG:lft[G]/TM6B, UAS-FLAG:lft[F]/TM6B and UAS-FLAG:lft[6]/TM6B) chromosomes. In order to compare the activities of lftversus its mammalian homologs, we used phiC31-mediated site-specific
integration to insert transgenes into the attP site at 68A (Groth et al., 2004).
Plasmids pUASTattB-3xFlagCG13139, pUASTattB-3xFlagLIX1 and
pUASTattB-LIX1L were used to create the transgenic fly lines
UAS-FLAG:lft[attP68A], UAS-FLAG:LIX1[attP68A], and UAS-FLAG:LIX1L[attP68A], respectively.
To investigate the consequences of reducing lft on fat mRNA expression,
en-Gal4, UAS-GFP/CyO; dcr2/TM6B flies were crossed to UAS-RNAi lft(NIG13139R-1), and, as a control, to UAS-RNAi fat (vdrc 9396), and
cultured at 28.5°C. To investigate regulation of lft mRNA, en-Gal4, UAS-
GFP/CyO; dcr2/TM6B flies were crossed to UAS-RNAi fat, UAS-RNAiwarts (vdrc 9928), UAS-RNAi Notch (NIG 3936R-3) or w– controls and
cultured at 28.5°C. Regulation by Notch was also confirmed by crossing
UAS-ECN:FLAG (dominant negative Notch) to ptc-Gal4. Knockdown of
Wg signaling was lethal, so regulation by Wg signaling was investigated by
crossing UAS-sgg to ptc-Gal4 UAS-GFP;UAS-Gal80ts/TM6B. Flies were
kept at 18°C, and then shifted to 29°C for 48 hours to allow expression of
Sgg (GSK3β) before dissecting.
For rescue experiments, lftTG2 FRT40A; tub-Gal4/TM6B was crossed to
lftTG2 FRT40A; UAS-FLAG:lft[F]/TM6B, lftTG2 FRT40A; UAS-FLAG:lft[attP68A], lftTG2 FRT40A; UAS-FLAG:LIX1[attP68A] or lftTG2
FRT40A;UAS-FLAG:LIX1L[attP68A].
To examine the influence of ft or ds mutant clones on FLAG:Lft
localization, hs-Flp, arm-lacZ/CyO; act-Gal4/TM6B was crossed to ft8
FRT40A/CyO; UAS-FLAG:lft[G]/TM6B or dsUA071 FRT40A /CyO; UAS-FLAG:lft[G]/TM6B.
Histology and imagingDiscs were fixed and stained as described previously (Cho and Irvine, 2004),
using mouse anti-Wg [1:800, 4D4, Developmental Studies Hybridoma Bank
(DSHB)], rat anti-Fat (1:400) (Feng and Irvine, 2009), rat anti-Ds (1:200,
M. Simon, Stanford University, Stanford, USA), mouse anti-V5 (1:400,
Invitrogen), mouse anti-Flag (1:600, Sigma), mouse anti-Diap1 (1:500, gift
of B. Hay, Cal Tech, Pasadena, USA), rat anti-Elav (1:20, 7E8A10, DSHB),
mouse anti-Pros (1:50, MR1A, DSHB), goat anti-β-gal (1:1000, Biogenesis)
and rat anti-E-Cad (1:40, DSHB). Fluorescent stains were captured on a
Leica TCS-SP5 confocal laser scanning microscope. For horizontal sections,
maximum projection using Leica software was employed to allow
visualization of staining in different focal planes.
In situ hybridization was carried out as described previously (Rauskolb
and Irvine, 1999). For lft, an antisense RNA probe derived from the full-
length coding region of lft was used, and discs from lftTG2 were used as a
negative control. For fat, an antisense RNA probe derived from cDNA
encoding the intracellular domain of Fat was used, and a sense probe was
used as a negative control.
Photoshop and Image J were used for measurements of wing areas and
distances. Prism (Graphpad) was used for statistical analyses.
Co-immunoprecipitation and western blottingCo-immunoprecipitation experiments were performed as described
previously (Cho et al., 2006), using cell lysates prepared in
radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl pH 7.5,
150 mM NaCl, 1 mM EDTA, 1% NP40, 0.1% SDS, 0.5% Na deoxycholate).
Cell debris was precipitated by centrifugation with a table-top centrifuge at
15,700 g for 15 minutes. The supernatant was mixed with anti-FLAG M2
beads (Sigma); after overnight incubation, beads were washed seven times
with RIPA buffer and then boiled in SDS-PAGE loading buffer.
Wing imaginal discs for the western blotting experiment were collected
from wild-type (w–), lftTG2, and the progeny of act-Gal4/TM6B crossed to
UAS-FLAG:lft[F], UAS-FLAG:lft[6]. Flies were allowed to lay for 5-6
hours, and wing discs were collected 96 hours later. Wing discs were
dissected in ice-cold HyQ CCM3 serum-free medium (Hyclone, catalog
number SH30065.01), and approximately 30 discs were pelleted at 1500 gfor 4 minutes and then flash frozen in dry ice/ethanol and stored at –80°C.
For chemiluminescence western blotting, we used mouse anti-V5-HRP
(1:6000, Invitrogen), mouse anti-FLAG M2-HRP (1:100,000, Sigma),
mouse anti-α-Tubulin (1:4000, Sigma) and rat anti-Fat (1:4000). For
quantitative western blotting, immunofluorescent secondary antibodies were
used [anti-mouse IgG IRDye700 (LiCor) and anti-rat IgG IRDye800
(Rockwell)], and gels were captured on a Li-Cor Odyssey infrared imaging
system and analyzed using Li-Cor software.
Plasmid constructspUAST-Fat-TM-ICD:V5 was constructed from pUAST-fat-STI-4 (Feng and
Irvine, 2009) by digesting with KpnI and XbaI to remove an existing triple
epitope tag, and then ligating with oligonucleotides (5�-CGGTAAG -
CCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGG -
TCATCATCACCATCACCATTGAGTTTAAGAATTCT-3� and 5�-CTA -
RESEARCH ARTICLE Development 136 (19)
DEVELO
PMENT
GAGAATTCTTAAACTCAATGGTGATGGTGATGATGACCG GTACG -
CGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACC G -
GTAC-3�) to insert V5 and His tags.
pUAST-Ds-TM-ICD:V5 was constructed by PCR amplifying the Ds
transmembrane and intracellular domains from genomic DNA (using the
forward primer 5�-GCCTTTCCGCGAAGAAGAGCCG GTGGTTC -
GTCAAGTGGTTCCATT-3� and the reverse primer 5�-GCAG GTA C -
CCATCCGTGTCCCCACATTTCCCCTCTGACTT-3�). The PCR product
was digested with SapI and KpnI, and ligated into SapI/KpnI cut pUAST-
fatSTI-4, to create a fusion gene utilizing the Fat signal peptide but the Ds
transmembrane and cytoplasmic domains. The C-terminal tags were then
exchanged as described above for Fat-TM-ICD-V5.
pUAST-TM-EGFP:V5 was constructed by PCR amplifying EGFP from
pmaxEGFP (Amaxa) using the forward primer 5�-GCACCGCGG -
AACTAGTGCCACCATGCCCGCCATGAA-3� (adding a SacII site) and
the reverse primer 5�-GCAGGTAC CTCGAG CTCGAGATCTGGCGAA-
3� (adding a KpnI site), and digesting the PCR product with SacII/KpnI. This
fragment was then cloned into SacII/KpnI cut pUAST-Ft-TM-ICD, which
leaves the transmembrane domain and five amino acids of the predicted Fat
cytoplasmic domain. The C-terminal tags were then exchanged as described
above.
pUAST- FAT4-TM-ICD:V5 was constructed from pUAST-FAT4-TM-
ICD:FLAG (Y. Feng) using a PCR product (forward primer, 5�-CTGAAGCCTCGAAGGTACCACGGTCGCAGGGCC-3�; reverse
primer, 5�-GGGGTACCTCAACCGGTACGCGTAGAATCGAG ACCG -
AGGAGAGGGTTAGGGATAGGCTTACCCACATACTGTTCTGCT-3�)to exchange the existing FLAG tag for a V5 tag.
pUAST-Fat-TM-ICD-�C:V5 was constructed by PCR amplifying the
portion of the fat intracellular domain to be retained (using the forward
primer, GGGAATTCGTTAACAGATCTGCG GCCGCATGGAG AGG -
CTA and the reverse primer, TCTAGATTATCAACCGGT ACGC -
GTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCCT -
CGAATCCATCGTA), digesting with EcoRI and XbaI, and then using this
fragment to replace the corresponding region of Fat-TM-ICD:V5. The
resulting construct lacks the C-terminal 99 codons of Fat.
pUAST-TM-EGFP+Ft-C:V5 was constructed by PCR amplifying the C-
terminal 99 codons from pUAST- Fat-TM-ICD:V5 (using the forward
primer, GGGGTACCCTGGCCGCCGCCTCATCATTTCGCGGAT and
the reverse primer, GGGGTACCTCCCACGTACTCCTCTGGAGCC).
This PCR product was then digested with KpnI, and ligated into KpnI cut
pUAST-EGFP:V5.
lft constructs were generated from a full-length cDNA, amplified by
RT-PCR from wild-type (Oregon-R) larvae using a one-step RT-PCR kit
(Qiagen) (using CG13139-UPinfrm, 5�-GTACCCGGGGA TGGTC TAT -
CCCGAAGAACCTTTT-3� and CG13139-lower, 5�-CCGGC TGCA -
GTT AATCATCAATGGTAGCCGAGTTAA-3�). This PCR product,
together with a triple FLAG epitope tag at the 5� end, was cloned into
pUAST and pUASTattB using XhoI and XbaI sites. The constructed
plasmids were named pUAST-FlagCG13139 and pUASTattB-
3xFlagCG13139, respectively. Human cDNAs of LIX1 and LIX1-likewere obtained from the ATCC and cloned by PCR (using the primers
hlix1up, 5�-GACGGTACCAGGCCTATGGACAGAACCTTGGAATC -
TCT-3� and hlix1lw, 5�-GACGCTAGCGGGCTTGGCCTTGCTAGT -
GATA-3� for human LIX1; and hlix1Lup, 5�-GACGGTACCA GGCCT -
ATGG AGA CTATGCGAGCGCA-3� and hlix1Llw, 5�-GACGCTAGC -
GGGTGGATG CCTAGCAGTTGGAA-3� for human LIX1-like) into
pUAST-FlagCG13139 using KpnI and NheI/XbaI sites, replacing the lftinsertion. The constructed plasmids were named pUASTattB-lix1 and
pUASTattB-lix1-like. All plasmid constructs were verified by DNA
sequencing.
RESULTSLowfat binds to the intracellular domains of Fatand DachsousTo evaluate whether the reported interaction between Lft and Fat and
Ds (Giot et al., 2003) could be reproduced in Drosophila cells,
epitope-tagged Lowfat protein (FLAG:Lft) was expressed in
cultured S2 cells together with tagged fragments of Fat or Ds. As Lft
was predicted to encode a cytoplasmic protein, we focused on
examining interactions between Lft and polypeptides including the
intracellular and transmembrane domains of Fat and Ds (Fat-TM-
ICD:V5 and Ds-TM-ICD:V5, Fig. 1B), but excluding their
extracellular domains. Immunoprecipitation of Lft:FLAG
specifically and reproducibly co-precipitated Fat-TM-ICD:V5 or
Ds-TM-ICD:V5, but not a control protein (TM-EGFP:V5; Fig. 1D).
Thus Lft can bind to both Fat and Ds in Drosophila cells.
Pair-wise BLASTP analysis of the Fat and Ds cytoplasmic
domains identified a small region of similarity between them (Fig.
1C) (Clark et al., 1995). Deletion of the C-terminal 99 amino acids
of Fat (Fat-TM-ICD-�C:V5), which includes this region,
substantially reduced Fat-Lft binding (Fig. 1D), implying that this
region contributes to their physical association. However, as binding
was not completely eliminated, the interaction between Lft and Fat
apparently also involves additional regions of the cytoplasmic
domain. Nonetheless, the Fat C-terminal region makes a crucial
contribution to the association with Lft, as its addition onto GFP
(TM-EGFP+Ft-C:V5) conferred to this protein a modest but
reproducible ability to bind Lft (Fig. 1D). Thus, Lft is a Fat- and Ds-
binding protein, and this binding is mediated in part through the C
terminus of Fat, which exhibits some sequence similarity to a region
of Ds.
lft is required for normal wing developmentTo investigate biological requirements for lft, we first reduced lftexpression by RNAi, using a UAS-hairpin transgene (UAS-RNAilft; NIG-13139R-1). Ubiquitous expression of this lft RNAi
transgene under act-Gal4 control resulted in flies with slightly
shorter wings (Fig. 2C), but no evident phenotypes in other
organs. The reduced length of the wing was most obvious in the
middle, where the distance between the anterior and the posterior
cross-veins was decreased (Fig. 2C,J). Reduction in the distance
between cross-veins is a diagnostic Fat pathway phenotype, as it
has been observed in viable alleles of all of the genes identified to
date as functioning specifically within the Fat branch of the Fat-
Hippo-Warts pathways [i.e. fat, ds, fj, approximated (app) and
dachs] (Mao et al., 2006; Matakatsu and Blair, 2008; Villano and
Katz, 1995; Waddington, 1940). The observation of this
phenotype with lft RNAi thus suggests that it is a component of
the Fat pathway.
RNAi often only partially reduces gene function, hence we sought
to isolate mutations in lft. Two strategies were used, both of which
were successful. In one approach, we used homologous
recombination-mediated gene targeting (Gong and Golic, 2003) to
create a lft allele in which the entire coding region was deleted (Fig.
2A). This deletion allele of lft (lftTG2) is homozygous viable and
fertile, and the only obvious phenotype was a reduced wing length
and a shorter cross-vein distance (Fig. 2D,J). Measurements
revealed an average wing area that was 82% of that in wild-type
wings, and an average cross-vein distance that was 59% of that in
wild-type wings (Fig. 2J, data not shown). This wing phenotype was
stronger than the lft RNAi phenotype, and similar to that observed
in null alleles of fj or app, or in hypomorphic alleles of fat or dachs.
The reduced size of the wing implies that the regulation of wing
growth by Fat signaling could be affected, which would suggest that
there is an influence on Fat-Warts signaling. At the same time, the
shape of the wing was also affected, as the length was affected more
than the width, especially in the middle of the wing. Wing shape can
be influenced by the Fat PCP pathway (Baena-Lopez et al., 2005).
The orientation of wing hairs, however, which also reflects PCP, was
3225RESEARCH ARTICLEModulation of Fat signaling by lowfat
DEVELO
PMENT
3226
not significantly affected in lft mutants (Fig. 3D). We also examined
lft mutant clones for effects on PCP, or the transcription of
downstream targets of Fat-Warts signaling, including Diap1,
Wingless and Expanded, but no significant effects were observed
(see Fig. S1 in the supplementary material; data not shown).
Sequence analysis implied that there are no other lft-like genes in
Drosophila. These observations suggest that lft could contribute to
normal Fat signaling during wing development, but that the
requirement for lft is relatively mild.
In parallel to the creation of a deletion allele of lft, we
employed the Seattle TILLING Project (http://tilling.fhcrc.org/)
to identify point mutations in lft. TILLING screens for nucleotide
changes in mutagenized chromosomes regardless of phenotypic
effect (Till et al., 2003). Seven mis-sense mutations in the lftcoding region were identified by TILLING of a 1464-bp region,
corresponding to the first 214 codons of lft. Two of these resulted
in obvious wing phenotypes as transheterozygotes with lftTG2
(Fig. 2E,J). Measurements of the distance between cross-veins
identified lft3709 as similar to lftTG2, whereas lft3762 exhibited a
slightly milder reduction in cross-vein length. Another allele,
lft0451, exhibited an even weaker phenotype (Fig. 2J). All of these
alleles change amino acids that are conserved among Lft and its
human homologs LIX1 and LIX1L (Fig. 1A). The other four mis-
sense mutations did not exhibit significant wing phenotypes. Lft
and its vertebrate homologs are highly conserved, but structurally
novel, and their biochemical function is unknown. The
RESEARCH ARTICLE Development 136 (19)
Fig. 1. Lft, LIX1, and LIX1L bind Fat, Ds and FAT4. (A)Amino acid alignment of Drosophila Lft, and human LIX1L and LIX1. Amino acids identicalamong all three proteins are in red, amino acids identical between two proteins are in blue. Amino acids above, in italics, identify mutations in lftTILLING alleles, which were named according to the mutagenized Zuker collection second chromosome from which they were isolated: lft2101 G16E,lft4168 L45M, lft3762 G72R, lft4907 F75S, lft1925 S90N, lft3709 S99F, lft0451 G140E. Mutations with lft phenotypes are in purple. (B) Schematic of DrosophilaFat, and the portions of Fat retained in Fat-TM-ICD:V5 and Fat-TM-ICD-�C:V5. Thin rectangle denotes a transmembrane domain. (C)Amino acidsequence alignment of the portion of Fat that exhibits similarity to Ds (Clark et al., 1995); the C-terminal half of this region is also conserved in FAT4.Identical amino acids are in red, similar amino acids are in blue. (D)Western blots depicting the results of co-immunoprecipitation experiments. Uppertwo panels (input) show blots on lysates of S2 cells transfected to express the indicated V5-tagged Fat, Ds or EGFP (control) proteins, and FLAG-taggedLft, LIX1 or LIX1L proteins; bottom panel (co-IP) shows blots (anti-V5) on material precipitated by anti-FLAG beads.
DEVELO
PMENT
characterization of these TILLING alleles identified amino acids
that are or are not required for normal Lft function independently
of their evolutionary conservation.
Lft is broadly expressed in imaginal tissuesVertebrate Lix1 was first identified and named as a gene expressed
in developing limbs (Swindell et al., 2001), but subsequent studies
have revealed that it is also expressed elsewhere (Fyfe et al., 2006;
Moeller et al., 2002). Expression of Drosophila lft was examined by
in situ hybridization to mRNA. lft was broadly expressed in
developing imaginal discs, including wing, leg and eye, and was also
expressed within the neuroepithelia of the optic lobes of the brain
(Fig. 4, data not shown). These are all places where fat and ds are
expressed. Comparison with control imaginal discs from lftTG2
mutants indicated that although lft is expressed throughout the wing
and eye disc, the levels of expression vary. In the eye imaginal disc,
lft expression is highest along the morphogenetic furrow (Fig. 4C),
and, in the wing imaginal disc, lft expression is highest near the
dorsoventral (DV) compartment boundary (Fig. 4A). The DV
compartment boundary is a site of Notch activation and a source of
Wg expression, and the upregulation of lft expression in the wing
was eliminated by the downregulation of Notch or Wg signaling (see
Fig. S2 in the supplementary material). By contrast, lft is not subject
to feedback regulation by Fat signaling, as its expression was not
affected by the downregulation of fat or warts (Fig. S2 in the
supplementary material).
Lft increases Fat and Ds protein levelsFat is expressed broadly throughout imaginal discs, but its
expression is not uniform. Consistent with earlier reports (Strutt and
Strutt, 2002; Yang et al., 2002), we observed, using a Fat-specific
sera (Feng and Irvine, 2009), that in the wing imaginal disc Fat
protein staining is elevated in the region fated to give rise to the wing
blade (the wing pouch), especially near the DV boundary, and that
in the eye disc Fat staining is strongest near the morphogenetic
furrow (Fig. 5A,C). Although fat mRNA distribution is also not
uniform at late third instar (see Fig. S3 in the supplementary
material) (Garoia et al., 2000), it does not match the strong increase
in protein levels along the DV boundary or morphogenetic furrow
in comparison to other regions of these discs, suggesting that Fat
levels are regulated post-transcriptionally. The correlation between
regions of imaginal discs in which lft expression is elevated and
regions in which Fat protein staining is elevated raised the possibility
that Lft might influence Fat protein levels or localization.
Indeed, Fat protein staining was clearly reduced in wing and eye
imaginal discs from lft mutants (Fig. 5B,D), especially in regions
where peak levels of Fat staining are observed in wild type. To
provide a direct comparison between Fat levels in wild-type versus
lft mutant cells, Fat staining was examined in discs with lft mutant
clones. In eye discs, and in the wing pouch region of the wing disc,
lft mutant clones were associated with a strong decrease in Fat levels
(Fig. 5E,H). In the region of the disc fated to give rise to the wing
hinge, lft mutant clones had little effect on Fat levels (Fig. 5G),
although this apparently reflects Lft perdurance, as Fat levels could
be affected by lft RNAi in the hinge (see Fig. S3 in the
supplementary material), and also appeared to be reduced in the
hinge within lft mutants (Fig. 5B). Thus, Lft increases Fat levels, and
its effects are most obvious in regions where the highest levels of Fat
and lft are normally observed.
To investigate whether Fat protein staining could also be
influenced by increased Lft, a FLAG epitope-tagged UAS-lfttransgene was created. Expression of UAS-lft under tub-Gal4 control
rescued the wing phenotype of lftTG2 mutants, confirming that
FLAG:Lft provides Lft function (Fig. 2G,J). Expression of UAS-lftunder ptc-Gal4 control elevated Fat protein staining, especially in
the hinge and notal regions of the wing disc, where endogenous
levels of lft are relatively low (Fig. 6A,B). To confirm that the visible
changes in Fat staining associated with mutation or overexpression
of Lft are reflective of differences in Fat protein levels, Fat was
examined by quantitative western blotting of lysates from wing
3227RESEARCH ARTICLEModulation of Fat signaling by lowfat
Fig. 2. lft mutations. (A) Map of the lft transcription unit. Upper line:thick bars indicate exons, thin bars indicate introns, gray indicates ORFand black indicates untranslated regions. Lower line depicts DNApresent and deleted (dashed) in the lftTG2 mutation. (B-I) Adult malewings from the indicated genotypes, arrows point to the cross-veins.Extra vein material was sometimes observed in tub-Gal4 flies, andhence could not be specifically ascribed to the expression of Lft or itshuman homologs. (J) Histogram of the relative distance between cross-veins (normalized to the average distance in wild-type controls) fromthe indicated genotypes. Error bars indicate s.d., between nine and 25wings were measured for each genotype. Statistical analysis (unpairedt-test) confirmed that the reduction in cross-vein length was significantfor each of the mutants; rescue of lftTG2 by lft, LIX1 and LIX1L was alsosignificant (P<0.0001).
DEVELO
PMENT
3228
discs. A 2.2-fold decrease in Fat levels was detected in lft mutant
discs when compared with wild-type discs (Fig. 6J), which, because
this is an average over the entire disc, underestimates the decrease
in peak regions. A 3.0-fold increase in Fat protein levels occurred in
discs overexpressing Lft under act-Gal4 control (Fig. 6J).
To confirm that these effects of lft on Fat protein levels are post-
transcriptional, fat mRNA levels were examined by in situ
hybridization in discs in which lft levels were reduced by RNAi, or
increased by overexpression. Expression of the lft RNAi construct
under en-Gal4 control reduced Fat protein levels, but did not
significantly reduce fat mRNA levels (see Fig. S3E,H in the
supplementary material). Moreover, expression of lft under ptc-Gal4control did not increase fat mRNA levels (see Fig. S3B,C in the
supplementary material). Thus, the influence of Lft on Fat is post-
transcriptional.
The observation that Lft binds to Ds as well as to Fat raised the
possibility that Lft might also influence Ds levels. Indeed, although
endogenous levels of Ds are quite low in the wing pouch, a reduction
in Ds protein staining at the membrane could be observed within lftmutant wing clones (Fig. 5F), and also in eye disc clones (not
shown). When Lft was overexpressed, Ds protein staining was
increased in both the hinge and the pouch (Fig. 6I). The influence of
Lft on Fat and Ds is specific, because mutation or overexpression of
Lft did not detectably influence levels of E-cadherin or Notch (not
shown). To confirm that Lft could independently influence both Fat
and Ds, clones of cells overexpressing Lft but mutant for fat or dswere stained for expression of Ds or Fat, respectively. Strong
upregulation of Fat, and weak upregulation of Ds, was observed in
such clones within both the wing pouch and the wing hinge (see Fig.
S4 in the supplementary material).
Fat and Ds influence Lft membrane localizationTo gain further insight into the mechanism by which Lft
influences Fat, we employed antibodies against the FLAG epitope
tag to localize Lft expressed in imaginal discs from UAS-lfttransgenes. Endogenous Fat and Ds proteins are preferentially
localized to the sub-apical membrane, just apical to the adherens
junctions. FLAG:Lft was detected at the sub-apical membrane,
overlapping Fat and Ds staining, but was also distributed broadly
throughout the cytoplasm (Fig. 6A,H). The profile of FLAG:Lft
staining detected varied depending upon the expression level and
the region of the disc. When expressed in the wing imaginal disc
under ptc-Gal4 control, strong cytoplasmic staining of FLAG:Lft
was detected in the wing pouch, but in parts of the wing hinge
FLAG:Lft was preferentially detected at the sub-apical membrane
(Fig. 6A,B,E). Because Ds is expressed at high levels in the wing
hinge and low levels in the wing pouch, these differences suggest
that the localization of FLAG:Lft to the sub-apical membrane
RESEARCH ARTICLE Development 136 (19)
Fig. 3. Genetic interaction between lft and fat1. (A,B) Adult malewings from fat1 and fat1 lftTG2. L2 identifies the second longtidudinalvein, which is often affected in these double mutants. (C-F) Close upsof the wing, just proximal to the anterior cross-vein. Hair polarity isconsistently disturbed in this region in fat1 lftTG2 double mutants (bluearrow in F), subtle effects were occasionally observed in fat1 (E), and noeffect was observed in lftTG2 (D). (G-J) Close ups of the distal coxa. Hairpolarity is consistently disturbed in this region in fat1 lftTG2 doublemutants (blue arrows in J), subtle effects were occasionally observed infat1 (I), and no effect was observed in lftTG2 (H). (K-N) Adult maleprothoracic legs, with leg segments identified (co, coxa; tr, trochanter;fe, femur; ti, tibia; ta, tarsus). The femur, tibia and tarsal segments areobviously shorter and wider in fat1 lftTG2 double mutants, and there areonly four tarsal segments (N); fat1 and lftTG2 single mutants have veryweak effects (L,M).
DEVELO
PMENT
could depend upon the availability of its binding partners. Indeed,
localization of FLAG:Lft to the sub-apical membrane was
reduced in fat or ds mutant clones (see Fig. S5 in the
supplementary material). Conversely, when fat or ds were
overexpressed under ptc-Gal4 control, FLAG:Lft levels were
substantially increased (Fig. S5 in the supplementary material).
Thus, Lft and its binding partners, Fat and Ds, have reciprocal
effects on the levels and localization to the sub-apical membrane
of one another.
lft and ds have additive effects on FatAlthough the lft mutant phenotype is relatively mild, the Fat ligand
ds also has a mutant phenotype that appears weaker than that of fatmutants. Intriguingly, lft and ds are expressed in partially
complementary domains in wing discs, as ds is expressed at highest
levels in proximal cells, whereas lft expression is highest in distal
cells. Thus, we explored the consequences of loss of both lft and ds.
ds mutant animals [dsUA071/Df(2L)ED94] can survive to adulthood,
but ds lft double mutant flies [dsUA071 lftTG2/Df(2L)ED94 lftTG2] did
not survive. To determine whether an additive phenotype of lft and
ds could also be detected for wing growth, we examined imaginal
discs in which their levels were reduced by RNAi. By expressing
UAS-RNAi transgenes specifically in the posterior (P) half of the
disc under en-Gal4 control and comparing the relative sizes of the
anterior (A) and P compartments, we could control for variations in
developmental stage that might otherwise confound precise
measurements of disc growth. In wild type, the P compartment of
the wing disc was 80% of the size of the A compartment. Expression
of lft RNAi under en-Gal4 control resulted in a modest, but
statistically significant, increase in the relative size of the P
compartment, to 87% of A compartment size (Fig. 7B,E).
Expression of ds RNAi alone resulted in a large increase in P
compartment size, to 140% of A compartment size (Fig. 7C,E). Co-
expression of lft and ds RNAi lines enhanced the overgrowth of the
P compartment to 178% of A compartment size (Fig. 7D,E). Thus,
lft and ds have additive effects on wing disc growth.
We also examined lft and ds mutant clones for their effects on Fat
protein staining. Mutation of ds had distinct effects on Fat in
different regions of the disc. In the wing pouch, Fat staining
appeared modestly elevated and slightly more diffuse within dsmutant clones (Fig. 5L). Nonetheless, preferential localization to the
sub-apical membrane, which visibly outlines cells, remained. By
contrast, in the wing hinge, Fat staining remained strong within dsmutant clones, but appeared diffusely distributed on the apical
surface (Fig. 5K). This diffuse staining was surrounded by a one-
cell-wide halo depleted of Fat staining, which presumably reflects a
re-localization of Fat to the membrane at the outer edge of the clone,
where it could be bound by Ds in neighboring wild-type cells (Cho
and Irvine, 2004; Ma et al., 2003; Strutt and Strutt, 2002). lft mutant
clones resulted in a strong reduction in Fat staining in the wing
pouch, but the Fat protein that remained appeared to localize
normally (Fig. 5H). lft mutant clones had no obvious effect on Fat
staining in the hinge (Fig. 5G). In both the wing hinge and the wing
pouch, ds lft double mutant clones exhibited additive effects on Fat
staining. Fat was diffusely localized in the wing hinge and levels
were reduced (Fig. 5I); Fat levels were also greatly reduced in the
wing pouch (Fig. 5J). Similarly, fat and lft had additive effects on Ds
localization in the wing pouch, as lft mutant clones reduced Ds levels
in the wing pouch, fat mutant clones resulted in diffuse apical
localization, and fat lft double mutant clones exhibited Ds staining
that was both reduced and diffuse (see Fig. S6 in the supplementary
material).
lft interacts genetically with fatThe mild phenotype of lft mutants, despite the substantial reduction
in Fat protein levels, suggests that Fat protein is normally present in
excess. However, we reasoned that if further reductions in Fat
activity could be achieved, such that its levels were closer to the
minimal thresholds needed for normal development, then lft mutants
should exhibit stronger phenotypes. This was explored by
investigating the phenotypes of animals doubly mutant for lftTG2 and
a weak allele of fat, fat1. The distance between cross-veins was
greatly reduced in fat1 lftTG2 double mutants (Fig. 3B). In addition
the posterior cross-vein was incomplete, and the L2 longitudinal
vein was often both incomplete and associated with ectopic vein
material, phenotypes that are not observed in either single mutant.
Leg growth is only very subtly affected in either lftTG2 or fat1 single
mutants, but fat1 lftTG2 double mutants had shorter legs, and
individual leg segments, including the femur and tibia were both
shorter and broader (Fig. 3K-N). In addition, fat1 lftTG2 double
mutants had only four tarsal segments instead of the usual five (Fig.
3N), a phenotype that is characteristic of mutations in fat pathway
genes. Finally, we did not observe PCP phenotypes in lft mutants,
and fat1 mutants had only very subtle PCP phenotypes (Fig. 3)
(Fanto et al., 2003), but obvious PCP phenotypes were observed in
fat1 lftTG2 double mutants in both wings and legs (Fig. 3F,J). Thus,
under sensitized conditions, an influence of lft mutations on Fat
signaling can be detected in multiple organs, and for both growth
and PCP phenotypes.
3229RESEARCH ARTICLEModulation of Fat signaling by lowfat
Fig. 4. lft expression. In situ hybridization to Drosophila tissues.(A,B) Wing discs; arrow points to DV boundary. (C,D) Eye discs; arrowpoints to morphogenetic furrow. (E) Larval brain and CNS. A, C and Eare wild-type tissues; B and D are lftTG2 mutant tissues, which serve asnegative controls.
DEVELO
PMENT
3230
Human LIX1L is a functional homolog ofDrosophila LftLft protein appears to be highly conserved with two human
homologs, LIX1 and LIX1L. Although LIX1L differs from Lft and
LIX1 in that it has a longer, unconserved, N-terminal region, within
the central conserved region (amino acids 24-257 of Lft), Lft is more
similar to LIX1L (75% amino acid identity) than it is to LIX1 (57%
identity), or even than LIX1 is to LIX1L (61% identity; see Fig. 1A).
The functional significance of these sequence similarities was
examined both in vitro and in vivo.
In co-immunoprecipitation experiments, human LIX1 and
LIX1L expressed in Drosophila S2 cells bound to the cytoplasmic
domains of Fat and Ds (Fig. 1D). LIX1 and LIX1L binding
appeared similar to Lft binding, and involved the same C-terminal
region of Fat. LIX1, but not Lft or LIX1L, also appeared to be
unstable when expressed without a binding partner in S2 cells, as
it was barely detectable when co-expressed with GFP, but was
readily detected when co-expressed with Fat or Ds (Fig. 1D). We
also examined the ability of these proteins to bind to the
cytoplasmic domain of human FAT4, which within its
cytoplasmic domain is the closest of the four human FAT proteins
to Drosophila Fat. LIX1, LIX1L and Lft could all co-precipitate
FAT4 (Fig. 1D).
The interaction between LIX1 and LIX1L and Drosophila Fat
was also investigated by comparing their influence on Fat protein
levels to that of Lft. Transgenes expressing FLAG-tagged lft, LIX1and LIX1L under UAS control were inserted into the same
chromosomal location using phiC31-mediated integration (Groth et
al., 2004), such that their expression levels would be similar.
Expression of LIX1L under ptc-Gal4 control resulted in an
RESEARCH ARTICLE Development 136 (19)
Fig. 5. Influence of lftmutation on Fat and Ds.Imaginal discs stained for Fat(red) or Ds (magenta); mutantclones are marked by absenceof GFP (green). Panels markedprime show single channel ofthe image to the left.(A) Wild-type wing disc; Fatstaining is elevated along theDV boundary (arrow).(B) lftTG2 mutant wing disc;Fat staining is reducedcompared with that in wildtype. (C) Wild-type eye disc;Fat staining is elevated alongthe morphogenetic furrow(arrow). (D) lftTG2 mutant eyedisc; Fat staining is reducedcompared with that in wildtype. (E,E�) Eye disc with lftTG2
mutant clone. (F,F�) Wing discwith lftTG2 mutant clones.(G-H�) Wing discs with lftTG2
mutant clones, focused onhinge (G,G�) or pouch (H,H�).(I-J�) Wing discs with dsUA071
lftTG2 double mutant clones,focused on hinge (I,I�) orpouch (J,J�). (K-L�) Wing discswith dsUA071 mutant clones,focused on hinge (K,K�) orpouch (L,L�).
DEVELO
PMENT
upregulation of Fat protein staining, both in the wing hinge and in
the wing pouch, similar to the effects of Lft (Fig. 6C,F). Expression
of LIX1 also resulted in an upregulation of Fat protein staining in
the hinge, but actually decreased Fat protein staining in the wing
pouch (Fig. 6D,G). This apparently complex effect could be
interpreted as indicating that LIX1 has weak Lft-like activity. Hence,
we suggest that in the hinge, where Lft levels are lower, LIX1
elevates Fat levels by providing partial Lft activity, but in the pouch,
where Lft levels are higher, it decreases Fat levels by competing with
Lft. Like Drosophila FLAG:Lft, FLAG:LIX1 and FLAG:LIX1L
could be detected at the sub-apical membrane, overlapping Fat and
Ds staining (Fig. 6C-G). However, in the case of LIX1L, but not
LIX1, we also detected strong cytoplasmic staining. Indeed, under
identical expression and staining conditions, LIX1 protein was
barely detectable in the wing pouch (Fig. 6G), suggesting that, as in
S2 cells, it is unstable when not associated with a binding partner.
Finally, we examined the ability of human LIX1 and LIX1L to
rescue the lft mutant phenotype. Expression of LIX1 under tub-Gal4control exhibited only a partial rescue of lft (Fig. 2I,J). However,
LIX1L rescued the wing phenotype of lft mutants as well as did lftitself (Fig. 2H,J). Thus, human LIX1L is a functional homolog of
Drosophila Lft. The difference in the extent of rescuing activity for
LIX1 versus LIX1L correlates with their sequence similarity to Lft,
and with their distinct effects on Fat protein staining.
DISCUSSIONElucidation of the Fat signaling pathway requires the identification
and characterization of pathway components. Here, we have identified
Lft as a novel, highly conserved modulator of Fat signaling. lft mutants
display decreased levels of both Fat and Ds protein staining, and
presumably as a consequence exhibit a characteristic Fat pathway
phenotype in the wing. In addition, lft can genetically interact with
both fat and ds to cause more severe phenotypes. The lft mutant
phenotype resembles weak mutant alleles of fat or ds, and lft mutants
do not exhibit any additional phenotypes that could not be accounted
for by effects on Fat signaling. The expression of lft itself is modulated
by other signaling pathways, and differences in lft expression levels
correlate with differences in Fat and Ds protein levels both in wild-
3231RESEARCH ARTICLEModulation of Fat signaling by lowfat
Fig. 6. Influence of lft overexpression on Fatand Ds. (A-I�) Portions of wing imaginal discsexpressing lft or its human homologs, asindicated, under ptc-Gal4 control, and stained forLft, LIX1 or LIX1L (FLAG epitope tag, green), andFat (red) or Ds (magenta). Panels marked primeshow separate channels of the same disc.(A,I) Lower power views. Boxes in A indicate theapproximate locations of the close-up imagesdepicted in B-G; arrow in I highlightsupregulation of Ds in cells overexpressing Lft.(B-D) Close-ups of the hinge region of the wingdisc. (E-G) Close-ups of the pouch region of thewing disc. (H) Vertical section through the wingpouch, apical is at top. (J) Western blot of wingdiscs from the indicated genotypes; Tub (Tubulin)is a loading control.
DEVELO
PMENT
3232
type animals, and when lft levels are experimentally increased or
decreased. Thus, transcriptional regulation of lft defines a mechanism
for modulating Fat signaling.
Lft influences levels of both Fat and Ds. Because Fat and Ds in
turn can influence levels of Lft, and because Fat and Ds also
influence the localization of one another to the membrane, we
infer that for any one of these three proteins, the influence that it
has on the other two includes both direct effects, and indirect
effects mediated through the third protein. In addition, the net
effect observed for any one protein presumably also reflects the
consequences of feedback regulation of its own levels via the
other two proteins.
Given the substantial decrease in Fat staining in lft mutants, the
phenotype appears surprisingly mild. This observation suggests that
Fat is normally present in excess; for example, it could be that only
a fraction of Fat is normally active, and that levels of Fat are not
normally limiting for pathway activation. This hypothesis was
supported by the observation of enhanced Fat pathway phenotypes
in combination with fat1, and would be consistent with the
conclusion that Fat acts as a ligand-activated receptor, with only a
fraction of Fat normally being present in the active form (Feng and
Irvine, 2009; Sopko et al., 2009). Complicating this simple
explanation is the observation that the levels of the Fat ligand Ds
are also reduced in lft mutants. However, because Fat signaling is
influenced not only by the amount of Ds, but also by the pattern of
Ds (i.e. is Ds expression graded, and how steeply), Ds can have
positive or negative effects on Fat activity (Reddy and Irvine, 2008;
Rogulja et al., 2008; Willecke et al., 2008). Thus, we suggest that
the lft mutant phenotype might be relatively weak because
decreased Fat and Ds levels, which would be expected to decrease
Fat signaling, are partially offset by a flattening of the Fat and Ds
expression gradients, which would be expected to increase Fat-
Warts signaling (Reddy and Irvine, 2008; Rogulja et al., 2008;
Willecke et al., 2008).
The observation that ds lft double mutants have more severe
phenotypes than do ds or lft single mutants indicates that ds and lftcan each independently influence Fat. lft and ds both influence Fat
levels and localization, but even in the absence of these two genes,
there was a visible difference in Fat protein staining between the
wing pouch and the wing hinge. This implies that there are
additional Fat regulators, and that the expression of these additional
Fat regulators is differentially distributed between the wing pouch
and the wing hinge. One additional Fat regulator that is differentially
expressed between the pouch and the hinge is Fj (Villano and Katz,
1995), although as Fj is thought to act by influencing Fat-Ds
interactions, it is not clear whether it could explain the differential
Fat staining observed.
It appears that Lft is a major contributor to the normal levels of
Fat. As Lft binds to the Fat cytoplasmic domain, it presumably
influences Fat protein levels through this direct binding. Different
molecular mechanisms for how Lft might influence Fat (and Ds)
levels can be envisioned. One attractive possibility, given that
Fat and Ds are transmembrane proteins, and that Lft could co-
localize with them at the sub-apical membrane, is an effect on
endocytosis, but it is also possible that Lft affects them in some
other way.
Because Lft is closely related to LIX1 and LIX1L, and indeed
LIX1L is functionally homologous to Lft, our studies of Lft identify
regulation of mammalian Fat and Ds homologs as the likely cellular
functions of LIX1 and LIX1L. Consistent with this inference, these
proteins could bind to the cytoplasmic domain of human FAT4, and
a BLASTP search with a short sequence motif of Fat common to Ds
and FAT4 (WEYLLNWGPSYENLMGVFKDIAELPD, Fig. 1C)
identifies these three proteins plus the mammalian Ds homologs
DCHS1 and DCHS2 as the five closest matches in protein databases.
This sequence motif also exhibits weak similarity to a region of E-
cadherin that has been identified as contributing to binding to β-
catenin (Clark et al., 1995; Huber and Weis, 2001), but there is no
obvious primary sequence similarity between Lft and β-catenin, and
Lft did not detectably affect E-cadherin staining.
Functional studies of LIX1 and LIX1L in vertebrates have not
yet been reported. However, feline LIX1 has been genetically
linked to feline spinal muscular atrophy (Fyfe et al., 2006). Direct
examination of human LIX1 in spinal muscular atrophy patients
did not reveal any mutations (Fyfe et al., 2006; Parkinson et al.,
2008). Nonetheless, the linkage of LIX1 and LIX1L to Fat
signaling suggests that other members of the Fat signaling
pathway should also be examined as potential candidate
susceptibility loci for this debilitating disease. Murine Fat4 has
been shown to be required for normal PCP in the ear and kidney
(Saburi et al., 2008); however, it is also highly expressed in the
nervous system, as are murine Lix1 and Dchs genes (Moeller et
al., 2002; Rock et al., 2005), consistent with the expectation that
these genes will interact in mammals, and might influence
nervous system development.
AcknowledgementsWe thank Adnan Riaz for assistance in characterizing TILLING alleles; QumiaoXu for assistance in characterizing the lft RNAi phenotype; the DevelopmentalStudies Hybridoma Bank, the Bloomington Stock Center, the Seattle TILLINGProject, M. Simon, C. Zuker, and the National Institute of Genetics (Japan) forantibodies and Drosophila stocks; and P. Francis-West for comments on themanuscript. This research was supported by the HHMI and by NIH grantGM078620. Deposited in PMC for release after 6 months.
Supplementary materialSupplementary material for this article is available athttp://dev.biologists.org/cgi/content/full/136/19/3223/DC1
RESEARCH ARTICLE Development 136 (19)
Fig. 7. Influence of lft and ds on disc growth. (A-D) Representativewing imaginal discs from experiments in which UAS-RNAi transgeneswere expressed under en-Gal4 control, in the presence of UAS-dcr2 (toenhance RNAi) and UAS-GFP (to mark the en-Gal4-expressing, P cells).(A) Control disc expressing only UAS-dcr2 and UAS-GFP. (B-D) Discsexpressing the indicated transgenes. (E) Quantitation of relative sizes(P/A size ratio); error bars indicate s.d. The number of discs measuredwas nine (control), eight (lft), 40 (ds) and 36 (ds lft). The differencebetween wild type (+) and lft was significant (Student’s t-test, P<0.05),and the difference between ds and ds lft was highly significant(P<10–10).
DEVELO
PMENT
ReferencesAdler, P. N., Charlton, J. and Liu, J. (1998). Mutations in the cadherin
superfamily member gene dachsous cause a tissue polarity phenotype byaltering frizzled signaling. Development 125, 959-968.
Baena-Lopez, L. A., Baonza, A. and Garcia-Bellido, A. (2005). The orientationof cell divisions determines the shape of Drosophila organs. Curr. Biol. 15, 1640-1644.
Bennett, F. C. and Harvey, K. F. (2006). Fat Cadherin modulates organ size inDrosophila via the Salvador/Warts/Hippo signaling pathway. Curr. Biol. 16, 2101-2110.
Casal, J., Struhl, G. and Lawrence, P. (2002). Developmental compartments andplanar polarity in Drosophila. Curr. Biol. 12, 1189-1198.
Cho, E. and Irvine, K. D. (2004). Action of fat, four-jointed, dachsous and dachsin distal-to-proximal wing signaling. Development 131, 4489-4500.
Cho, E., Feng, Y., Rauskolb, C., Maitra, S., Fehon, R. and Irvine, K. D.(2006). Delineation of a Fat tumor suppressor pathway. Nat. Genet. 38, 1142-1150.
Clark, H. F., Brentrup, D., Schneitz, K., Bieber, A., Goodman, C. and Noll, M.(1995). Dachsous encodes a member of the cadherin superfamily that controlsimaginal disc morphogenesis in Drosophila. Genes Dev 9, 1530-1542.
Dong, J., Feldmann, G., Huang, J., Wu, S., Zhang, N., Comerford, S. A.,Gayyed, M. F., Anders, R. A., Maitra, A. and Pan, D. (2007). Elucidation of auniversal size-control mechanism in Drosophila and mammals. Cell 130, 1120-1133.
Fanto, M., Clayton, L., Meredith, J., Hardiman, K., Charroux, B., Kerridge, S.and McNeill, H. (2003). The tumor-suppressor and cell adhesion molecule Fatcontrols planar polarity via physical interactions with Atrophin, a transcriptionalco-repressor. Development 130, 763-774.
Feng, Y. and Irvine, K. D. (2007). Fat and expanded act in parallel to regulategrowth through warts. Proc. Natl. Acad. Sci. USA 104, 20362-20367.
Feng, Y. and Irvine, K. D. (2009). Processing and phosphorylation of the Fatreceptor. Proc. Natl. Acad. Sci. USA 106, 11989-11994.
Fyfe, J. C., Menotti-Raymond, M., David, V. A., Brichta, L., Schaffer, A. A.,Agarwala, R., Murphy, W. J., Wedemeyer, W. J., Gregory, B. L., Buzzell, B.G. et al. (2006). An approximately 140-kb deletion associated with feline spinalmuscular atrophy implies an essential LIX1 function for motor neuron survival.Genome Res. 16, 1084-1090.
Garoia, F., Guerra, D., Pezzoli, M. C., Lopez-Varea, A., Cavicchi, S. andGarcia-Bellido, A. (2000). Cell behaviour of Drosophila fat cadherin mutationsin wing development. Mech. Dev. 94, 95-109.
Giot, L., Bader, J. S., Brouwer, C., Chaudhuri, A., Kuang, B., Li, Y., Hao, Y. L.,Ooi, C. E., Godwin, B., Vitols, E. et al. (2003). A protein interaction map ofDrosophila melanogaster. Science 302, 1727-1736.
Gong, W. J. and Golic, K. G. (2003). Ends-out, or replacement, gene targeting inDrosophila. Proc. Natl. Acad. Sci. USA 100, 2556-2561.
Groth, A. C., Fish, M., Nusse, R. and Calos, M. P. (2004). Construction oftransgenic Drosophila by using the site-specific integrase from phage phiC31.Genetics 166, 1775-1782.
Huang, J., Wu, S., Barrera, J., Matthews, K. and Pan, D. (2005). The Hipposignaling pathway coordinately regulates cell proliferation and apoptosis byinactivating Yorkie, the Drosophila Homolog of YAP. Cell 122, 421-434.
Huber, A. H. and Weis, W. I. (2001). The structure of the beta-catenin/E-cadherincomplex and the molecular basis of diverse ligand recognition by beta-catenin.Cell 105, 391-402.
Ishikawa, H. O., Takeuchi, H., Haltiwanger, R. S. and Irvine, K. D. (2008).Four-jointed is a Golgi kinase that phosphorylates a subset of cadherin domains.Science 321, 401-404.
Ma, D., Yang, C. H., McNeill, H., Simon, M. A. and Axelrod, J. D. (2003).Fidelity in planar cell polarity signalling. Nature 421, 543-547.
Mao, Y., Rauskolb, C., Cho, E., Hu, W. L., Hayter, H., Minihan, G., Katz, F. N.and Irvine, K. D. (2006). Dachs: an unconventional myosin that functionsdownstream of Fat to regulate growth, affinity and gene expression inDrosophila. Development 133, 2539-2551.
Matakatsu, H. and Blair, S. S. (2008). The DHHC palmitoyltransferaseapproximated regulates Fat signaling and Dachs localization and activity. Curr.Biol. 18, 1390-1395.
Moeller, C., Yaylaoglu, M. B., Alvarez-Bolado, G., Thaller, C. and Eichele, G.(2002). Murine Lix1, a novel marker for substantia nigra, cortical layer 5, andhindbrain structures. Brain Res. Gene Expr. Patterns 1, 199-203.
Oh, H. and Irvine, K. D. (2008). In vivo regulation of Yorkie phosphorylation andlocalization. Development 135, 1081-1088.
Parkinson, N. J., Baumer, D., Rose-Morris, A. and Talbot, K. (2008). Candidatescreening of the bovine and feline spinal muscular atrophy genes reveals noevidence for involvement in human motor neuron disorders. Neuromuscul.Disord. 18, 394-397.
Rauskolb, C. and Irvine, K. D. (1999). Notch-mediated segmentation and growthcontrol of the Drosophila leg. Dev. Biol. 210, 339-350.
Reddy, B. V. and Irvine, K. D. (2008). The Fat and Warts signaling pathways: newinsights into their regulation, mechanism and conservation. Development 135,2827-2838.
Rock, R., Schrauth, S. and Gessler, M. (2005). Expression of mouse dchs1, fjx1,and fat-j suggests conservation of the planar cell polarity pathway identified inDrosophila. Dev. Dyn. 234, 747-755.
Rogulja, D., Rauskolb, C. and Irvine, K. D. (2008). Morphogen control of winggrowth through the Fat signaling pathway. Dev. Cell 15, 309-321.
Saburi, S., Hester, I., Fischer, E., Pontoglio, M., Eremina, V., Gessler, M.,Quaggin, S. E., Harrison, R., Mount, R. and McNeill, H. (2008). Loss of Fat4disrupts PCP signaling and oriented cell division and leads to cystic kidneydisease. Nat. Genet. 40, 1010-1015.
Silva, E., Tsatskis, Y., Gardano, L., Tapon, N. and McNeill, H. (2006). Thetumor-suppressor gene fat controls tissue growth upstream of expanded in theHippo signaling pathway. Curr. Biol. 16, 2081-2089.
Simon, M. A. (2004). Planar cell polarity in the Drosophila eye is directed bygraded Four-jointed and Dachsous expression. Development 131, 6175-6184.
Sopko, R., Silva, E., Clayton, L., Gardano, L., Barrios-Rodiles, M., Wrana, J.,Varelas, X., Arbouzova, N. I., Shaw, S., Saburi, S. et al. (2009).Phosphorylation of the tumor suppressor fat is regulated by its ligand Dachsousand the kinase discs overgrown. Curr. Biol. 19, 1112-1117.
Steinhardt, A. A., Gayyed, M. F., Klein, A. P., Dong, J., Maitra, A., Pan, D.,Montgomery, E. A. and Anders, R. A. (2008). Expression of Yes-associatedprotein in common solid tumors. Hum. Pathol. 39, 1582-1589.
Strutt, D. (2008). The planar polarity pathway. Curr. Biol. 18, R898-R902.Strutt, H. and Strutt, D. (2002). Nonautonomous planar polarity patterning in
Drosophila: dishevelled-independent functions of frizzled. Dev. Cell 3, 851-863.Swindell, E. C., Moeller, C., Thaller, C. and Eichele, G. (2001). Cloning and
expression analysis of chicken Lix1, a founding member of a novel gene family.Mech. Dev. 109, 405-408.
Till, B. J., Reynolds, S. H., Greene, E. A., Codomo, C. A., Enns, L. C., Johnson,J. E., Burtner, C., Odden, A. R., Young, K., Taylor, N. E. et al. (2003). Large-scale discovery of induced point mutations with high-throughput TILLING.Genome Res. 13, 524-530.
Tyler, D. M. and Baker, N. E. (2007). Expanded and fat regulate growth anddifferentiation in the Drosophila eye through multiple signaling pathways. Dev.Biol. 305, 187-201.
Villano, J. L. and Katz, F. N. (1995). four-jointed is required for intermediategrowth in the proximal-distal axis in Drosophila. Development 121, 2767-2777.
Waddington, C. H. (1940). The genetic control of wing development inDrosophila. J. Genet. 41, 75-139.
Willecke, M., Hamaratoglu, F., Kango-Singh, M., Udan, R., Chen, C. L., Tao,C., Zhang, X. and Halder, G. (2006). The Fat Cadherin acts through the Hippotumor-suppressor pathway to regulate tissue size. Curr. Biol. 16, 2090-2100.
Willecke, M., Hamaratoglu, F., Sansores-Garcia, L., Tao, C. and Halder, G.(2008). Boundaries of Dachsous Cadherin activity modulate the Hippo signalingpathway to induce cell proliferation. Proc. Natl. Acad. Sci. USA 105, 14897-14902.
Yang, C., Axelrod, J. D. and Simon, M. A. (2002). Regulation of Frizzled by Fat-like Cadherins during planar polarity signaling in the Drosophila compound eye.Cell 108, 675-688.
Zeidler, M. P., Perrimon, N. and Strutt, D. I. (1999). The four-jointed gene isrequired in the Drosophila eye for ommatidial polarity specification. Curr. Biol. 9,1363-1372.
Zeng, Q. and Hong, W. (2008). The emerging role of the hippo pathway in cellcontact inhibition, organ size control, and cancer development in mammals.Cancer Cell 13, 188-192.
Zhao, B., Wei, X., Li, W., Udan, R. S., Yang, Q., Kim, J., Xie, J., Ikenoue, T., Yu,J., Li, L. et al. (2007). Inactivation of YAP oncoprotein by the Hippo pathway isinvolved in cell contact inhibition and tissue growth control. Genes Dev. 21,2747-2761.
3233RESEARCH ARTICLEModulation of Fat signaling by lowfat
DEVELO
PMENT