[CANCER RESEARCH57, 714-719, February 15, 1997J

ABSTRACT

As a specific competitive inhibitor of 5a-reductase, an intracellularenzyme that converts testosterone to dihydrotestosterone, finasteride isbeing extensively used for the treatment of benign prostatic hyperplasiaand in experimental settings for prostate cancer. In this study, we showedthat finasteride markedly inhibited prostate-specific antigen (PSA) secretion and expression.

The promoter of the PSA gene contains several well-known cis-regulatory elements. Among them, steroid receptor-binding consensus (SRBC)has been identified as a functional androgen-responsive element. Ourprevious study showed that PSA was not only present in conditionedmedium of the PSA-positive LNCaP cells but was also detectable in smallamounts in PSA-negative cell lines, PC-3 and DU-145 (L. G. Wang et ci,OncoL Rep., 3: 911—917,1996). A strong correlation between binding ofnuclear factors to SRBC and the level of PSA present in the conditionedmedium and cell extracts was found in these three cell lines, whereas nosuch correlation with binding was obtained using Spi oligonucleotide as aprobe. Binding of LNCaP cell nuclear proteins to SRBC was diminishedwhen the cells were exposed to 25 @tMfinasteride, at which concentration50% of both PSA mRNA and protein were inhibited. As a major component of DNA-protein complexes, the level of androgen receptor was dramatically decreased in the cells treated with finasteride.

Our data indicate that inhibition of complex formation between SRBCand nuclear proteins due to the remarkable decrease in the bevel ofandrogen receptor plays a key role in the down-regulation of PSA geneexpression by finasteride in LNCaP cells.

INTRODUCTION

As a specific competitive inhibitor of 5a-reductase, an intracellularenzyme that converts testosterone to dihydrotestosterone, finasterideis being extensively used for the treatment of BPH3 and in experimental settings for prostate cancer (1). Finasteride has no bindingaffinity for androgen receptor sites and possessesno androgenic,antiandrogenic, or other steroid hormone-related properties (1). However, we and others have shown that finasteride exhibits growthinhibitory effects on androgen-sensitive, PSA-positive LNCaP cellsand, to a much lesser degree, on the androgen-independent and thePSA-negative cell lines: PC-3 and DU-145 in vitro (2, 3). To explorethe possible mechanism by which finasteride inhibits prostate cancercell growth, the effect of this agent on PSA expression was studied.

PSA is a glycoproteinwith chymotrypsin-,trypsin-, and esterase

Received 9/24/96; accepted 12/20/96.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18U.S.C.Section1734solely to indicatethis fact.

I This study was supported by the Don Monti Memorial Research Foundation.

2 To whom requests for reprints should be addressed, at Don Monti Division of

Hematology and Oncology, Department of Medicine, New York University School ofMedicine, North Shore University Hospital, Manhasset, NY 11030. Phone: (516) 562-8906; Fax: (516) 562-8950.

3 The abbreviations used are: BPH, benign prostatic hyperplasia; AR, androgen recep

tor; FBS, fetal bovine serum;MGSA, mobility gel shift assay;PSA, prostate-specificantigen; SRBC, steroid receptor-binding consensus; IGFBP-2, insulin-like growth factorbinding protein; PC, prostate cancer.

like activities (4, 5). Since it is produced almost exclusively by theepithelial cells of the prostate, PSA has been used extensively as aserum marker for diagnosis and prognosis of prostate cancer and asanimmunohistochemical marker for the identification of prostatic tissuesand cells in pathological specimens(6). Our previous study has shownthat PSA is involved in the growth stimulation of the androgenresponsive LNCaP cells (7). The regulation of PSA gene expressionby growth factors and hormones has been extensively studied (8—10).The promoter region of the PSA gene contains several well-knowncis-regulatory elements, including a variant TATA box, a transcription factor Spi-binding site, a SRBC, and a CACCC motif (11, 12).Among them, SRBC has been implicated as a functional androgenresponsive element (13). In this study, we showed that in LNCaP cellsfinasteride significantly inhibits PSA expression and that this downregulation of PSA expression by finasteride correlates with the inhibition of complex formation between androgen receptors and SRBC.This decrease in complex formation can be accounted for by adose-related decreaseof the AR level in LNCaP cells after treatmentwith finasteride.

MATERIALS AND METHODS

Reagents. Finasteride was a gift from the Merck Research Laboratorythrough the courtesy of Dr. G. J. Gormley. PSA antibody was purchased fromtheDAKO Corporation(Carpinteria,CA). Antibody againstAR, corresponding to aminoacids900—919mappingat the carboxybterminusof the AR ofhuman origin, anti-rabbit IgO-horseradish peroxidase, and protein agarose Aplus 0 were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).Tandem-E PSA, an immunoenzymetric kit for the quantitative measurement ofPSA levels, was obtained from Hybritech, Inc. (San Diego, CA). A Westernblotting detectionkit and [7-32P]ATPwerepurchasedfrom Amersham(Arlington Heights, IL). Reagents for SDS-PAGE and protein determination wereobtained from Bio-Rad (Richmond, CA). RPM! 1640 and FBS were obtainedfrom Life Technologies, Inc. (Gaithersburg, MD). Other chemicals for thisstudy were purchased from Sigma Chemical Company (St. Louis, MO).Oliogonucleotidescontainingthe Spl site CAGGCICA0000CGGAGTCCT(12) and SRBC OCAGAACAGCAAGTGCTAGC in the promoter of the PSA

gene(12, 14)weresynthesizedby Dr. R. Pergolizziin theBiopolymerFacilityof our hospital.

Cell Culture. The prostaticcarcinomacell lines LNCaP,PC-3, and DU145 were purchased from the American Type Culture Collection (Rockville,MD). Cells were cultured under conditions as described previously (7).

Determinationof PSA Secretion. The levelof the PSAsecretedinto themedium was determined using a Tandem-E PSA immunoenzymetric kit according to the instructions provided by the manufacturer and by Westernblotting asdescribedbelow.

Western Blotting of Cellular Proteins and Medium. LNCaP cells at65—75%confluence in RPMI 1640 containing 10% FBS were harvested andwashed with cold PBS once. Total cellular proteins were extracted as describedpreviously (15). One hundred p@gof cellular extracts or 50 @.dof culturemediumfrom LNCaPcells,treatedwith variousconcentrationsof finasteride,wereseparatedby 4%/l0% stackSDS-PAGE,electrotransferredto nitrocellulose filters, and immunoblotted with antibodies against PSA and/or AR,respectively. Quantitation by densitometry of the X-ray films was done using

714

Down-Regulation of Prostate-specific Antigen Expression by Finasteride throughInhibition of Complex Formation between Androgen Receptor and SteroidReceptor-binding Consensus in the Promoter of the PSA Gene inLNCaP Cells1

Long Gui Wang, Xiao Mei Liu, Will Kreis,2 and Daniel R. Budman

Department of Medicine, New York University, North Shore University Hospital, Manhasset. New York 11030

on May 8, 2018. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

UntreatedIIITreatedwithFinasteside25pM100pM1.0

.a ,al,@,@,@ll,@@wso e-@c-i w Nw c-imc-i Nw

m c-ic-i@ N

ci)

a)

0

I 140.-@ 120E

0

0U

DOWN-REGULATION OF PSA EXPRESSION BY FINASTERIDE

an Imaging DensitometerModel 05-700 (Bio-Rad Laboratories,Hercules,CA).

Northern Blotting Assay. LNCaPcells grown to 65—75%confluence inR.PMI 1640 containing 10% FBS were treated with varying concentrations offinasteridefor 72 h. Thecellswereharvestedandwashedwith cold PBS,andtotal RNA wasextractedusingthe guanidinium/phenolmethodasdescribedpreviously (15, 16). RNA was quantitated spectrophotometrically, and 20 @galiquotswerefractionatedon 1.2%agarose-formaldehydegelsandtransferredto Zeta-ProbeBlotting Membrane(Bio-Rad).The double-strandedPSA-specific oligonucleotidepmbe (5'-AGCCFAGAGAAGGCTGTGAGCCAAGGAGGGAGGGTCTFCC1TFGGCATGGGATGGGGATGAAGTAAGGAGAGGGACT-3') describedby Young et aL (8), 5' end labeled,was usedforhybridization as described previously (15). Radioautographs were analyzedusing an Imaging Densitometer Model GS-700 (Bio-Rad) and normalized to285 RNA.

MGSA. MGSA was performedas describedpreviously(15). Briefly, LNCaPcells grown to 65—75%confluencein RPMI 1640containing10%FBSwere harvestedand washedoncewith cold PBS,and nuclearproteinswereextractedin thepresenceofproteaseinhibitors,including1 @g/mlleupeptin,1i.ag/mipepstain,and2 @.tg/mlaprotimn.Theproteinsweredividedinto aliquotsand stored at —20°Cuntil use.

Five @gofnuclearproteinwerereactedfor 30miii atroomtemperaturewiththe 32P-labebedSpl or SRBCprobein binding buffer composedof 10 mt@iTris-HC1(pH7.5), 50 mMNaC1,1mistDTT, 1mMEDTA,0.5%(v/v) glycerol,and 2.0 i@gol' poly(dI)/(dC) in a final volume of 20 s.d.For identification ofspecific proteins involved in the formation of DNA-protein complexes, theproteins were immunoprecipitated with the antibody at 4°Covernight prior tothebindingassay.Controlswereperformedunderthesameconditionswithoutany antibody or with histone Hi antibody. The reaction mixtures were thensubjected to 8% low ionic strength PAGE [6.7 mr@iTris-HC1 (pH 7.5), 3.3 mtvisodiumacetate,and 1.0mr@iEDTA). Thebinding complexeswerevisualizedby exposing the dried gel to X-ray film at —70°Covernight.

Statistics. All data of PSA secretion determined using the Tandem-E PSAimmunoenzymetric kit were expressed as the mean ±SD. Significant differencesamong the meanswere determinedusing Fisher's exact test, andP < 0.05 was used to identify significance.

RESULTS

Inhibition of PSA Secretion and Expression. Incubation of LNCaP cells with various concentrations of fmasteride for 48 h caused amarked decreaseof PSA level in the medium as determined immu

Fig. 1.Dose-(A) andtime- (B) dependentinhibitionofPSA secretionby finasteridein LNCaPcells.LNCaPcells grown exponentially in RPM! 1640 containing10%FBS wereexposedto the indicatedconcentrationsoffinasteride,andthemediumwasharvestedat48h (A)or at indicated time points (B). The PSA level in themedia was determined using a Tandem-E PSA immunoenzymetrickit accordingto the proceduresprovidedby the manufacturerand nonnalizedby cell numbers.Datarepresentmeansfromthreeseparateexperiments.Bars, SD.

Untreated Treated with Finasteiide

I 25@iM

.a .@ .a ,g@@w so e@ w so c-ic-i@ N c-i w

l0O@tM

l.a .a .a1w so c-ic-i w N

A

45kDa —

PSA [ e@ — , — —@ —3lkDa —

C

24 48 72

@1

0

.@

Time (h)

Fig. 2. Specificinhibitionof PSA secretionby finastendein LNCaP cells.LNCaP cellsgrownexponentiallyin RPM! 1640containing10%FBSweretreatedwith the indicatedconcentrations of finastende, and the medium was harvested at 48 h. Fifty @.&bof themedium from each treatment were subjected to 10% SDS-PAGE, and the proteins wereelectrotransferredto nitroceblulosemembranesand immunoblottedwith PSA (A) orIGFBP-2 (B) antibodies.Levels of PSA in A were determinedfrom X-ray film by anImagingDensitometerModelGS-700(C).

BA‘@‘300-a)C.)

0@z:250 -

I@200-

.,@

E 150 -

a)

.@

Cl °@

—0-— Control

—0— 25j.tM—o—-5Øj@4—@-100pM....O-.. 200@.tM

200

180

160

100

80

60

40

20

0

..‘:@ 0

I I I

0 24 48 72Concentration of finasteride

Time (h)

715

45kDa

IGFBP-2@@@@@@@@@ B

31 kDa

on May 8, 2018. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

DOWN-REGULATIONOF PSA EXPRESSION BY FINASTERIDE

Correlation of PSA Secretion/Expression with the Binding ofNuclear Extracts to the SRBC in the PSA Promoter. As observedearlier, PSA protein was found not only in the medium conditionedby an androgen-responsive prostate cancer cell line LNCaP butalso, to a much lesser extent, in the medium conditioned by theandrogen-independent cell lines, PC-3 and DU-145 (7). Previousevidence demonstrated that the transcription regulation of the PSA

A gene by androgens took place via the SRBC present in the promoter region of the PSA gene (17). In view of this observation, we

examined whether a correlation existed between the binding of

nuclear proteins to SRBC or the Spi that are present in the

promoter region of the PSA gene and the PSA gene expression. As_________________________________ shown in Fig. 5, left panel, the difference in the level of PSA

present in the conditioned media was found to correlate with thedifference in the level of the binding of nuclear proteins to theSRBC. No such binding complex formation was observed when theSpi oligonucleotide was reacted in an identical manner (Fig. 5,right panel). The specificity of the complex formed between SRBC

noenzymetrically. As shown in Fig. 1, this inhibition of the PSAsecretion by finasteride was found to be dose (Fig. 1A) and time (Fig.1B) dependent. At lower concentrations of the drug (25 ,LM), theamount of PSA in the medium was decreasedby approximately 56%without significant decrease of the cell viability. This result wasconsistent with the result obtained with Western blotting shown inFig. 2A. However, no such decrease of the secretion of the IGFBP-2was observed (Fig. 2B). The decreaseof the PSA secretion into themedium after treatment of LNCaP cells with finasteride paralleled theprotein level present in the total cellular extracts as measured byWestern blotting (Fig. 3A). Again, no such decreasewas found whenthe IGFBP-2 antibody was used in the assay (Fig. 3B). These resultsindicate that the decreasedPSA protein secretion may result from theinhibition by finasteride of the protein expression in the cells, and thatthis inhibition was a specific event.

To understand whether the decrease of PSA protein is due to thechanges of rates of the transcription or the translation of the protein,the mRNA of PSA was determined in LNCaP cells after treatmentwith finasteride. As shown in Fig. 4, the very pronounced decreaseinthe level of PSA mRNA was observed in a dose-dependent mannerafter exposure of LNCaP cells to finasteride for 72 h that accuratelyparalleled the decrease in the amount of PSA protein. This resultsuggests that the regulation of PSA gene expression by finasteridewas, at least in part, in the transcriptional level.

716

B

45 kDa

PSA [

31 kDa

45 kDa —

IGFBP-2--@

31 kDa

PSA mRNA

Total RNA

Fig. 3. Levels of PSA and IGFBP-2 in total cell extracts.LNCaP cells grownexponentially were exposed to 25 or 100 @Mfinasteride in regular RPMI 1640 containing10%FBS for 24, 48, or 72 h, andthe cells wereharvested,washedoncewith ice-coldPBS, and the total cell proteins were extracted with PBSTDS containing I mzaDTF, 1 msiphenylmethylsulfonylfluoride, and 1 @gleupeptin.One hundred @gof proteinsweresubjected to 10% SDS-PAGE and the proteins in the gel were electrotransferred tonitrocellubosemembranesandimmunoblottedwith PSA(A) andIGFBP-2(B) antibody,respectively.

00

30

,@‘ 25

@20

0@, 15

.@ 10

@ 5

0

@ 0@ 0c-@l v@ e— —

ConcentrationsofFinasteride(jiM)

Fig. 4. Extent of PSA gene expression in LNCaP cells as a function of dosage offinasteride.LNCaPcells grown at 65%—75%confluencein RPMI 1640containing10%FBS were exposed to indicated concentrations of finasteride for 72 h, and the cells wereharvested, washed once with ice-cold PBS, and total RNA was extracted. The PSA mRNAwas then detected with Northern blotting using 5' end-labeled PSA-specific oligonucleotideas theprobe.Toppanel,PSAmRNAmeasuredby Northernblotting;middlepanel,total RNA; andbottompanel,densityof theplotsof PSAmRNA determinedfrom X-rayfilm by an Imaging Densitometer Model 05-700. Data are the means of two separateexperimentsscoredby the densitometerandnormalizedto 285 RNA.

.@ @.4,

I0@ 0 88

U c-Si “@@

T: @am@I@ @L

0@0@

@,28 S

1:18S

on May 8, 2018. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

DOWN-REGULATIONOF PSA EXPRESSION BY FINASTERIDE

Complex

Complex —@a@

Free probe—@@

Fig. 5. Binding of nuclear proteins extracts from theandrogen-sensitivecell line LNCaPandandrogen-independent cell lines PC-3 and DU-l45 to SRBC. Five @gof nuclear cell extracts were reactedwith 32Pendlabeled SRBC oligonucleotide: 5'-GCAGAACAGCAAGTGCTAOC-3' (left panel) or Spl oligonucleotide 5'-CAGGGCA000-GCGGAGTCCT-3' (rightpanel) in binding buffer containing 2 jag/mI poly(dC)/(dl) for 30 miii.The reactionmixtureswerethensubjected to an 8% natural polyacrylamide gel, and thebindingcomplexesweredetectedby exposingthedriedgel to X-ray film at —70'Covemight.

and nuclear factors obtained from LNCaP cells was further estab- of unlabeled homologous SRBC decreased the level of complexeslished by competition analysis using a homologous unlabeledSRBC oligonucleotide (Fig. 6, left panel) or the nonhomologousunlabeled Spl oligonucleotide (Fig. 6, right panel). The presence

Fig. 6. Detennination of the specificity of the binding complexesformedbetweenSRBCand nuclearproteins.Five @gofnuclearproteinsextractedfromnormalculturedLNCaPcellsreacted with 32Pend-labeled SRBC oligonucleotide in the presence of cold homologous (SRBC, leftpanel) or nonhomologousoligonucleotide(Spi, right panel) for 30 mm at 37CC.The reactionmixturesweresubjectedto an 8%naturalpobyacrylamidegel.The binding complexes were detected by exposing the dried gel toX-ray film at —70Covernight.

in a concentration-dependent manner. In contrast, the extent ofcomplexes formed was not altered in the presence of high concentrations of Spl oligonucleotide.

32F P]-SRBC++++32 IP1-SRBC+++++Proteins-++++Proteins++++Cold

SRBC(fold)52550Cold Spi (fold)100250500

Freeprobe

717

SRBCProbeI Nuclear extracts from

,@ :@i

,@Qel@

@Zo@

Spi Probe1 I I

Nuclear extracts from

.cz: Free probe

Bindingcomplexes

Fme@probe

Bindingcomplexes

on May 8, 2018. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

++

DOWN-REGULATIONOF PSA EXPRESSION BY FINASTERIDE

were made from LNCaP cells treated with various concentrations offinasteride for 72 h. As shown in Fig. 7, the levels of bindingcomplexes were markedly decreased when the nuclear proteins prepared from LNCaP cells were treated with 25 pM or higher concentrations of finasteride. The absenceof a dose-responseeffect regarding the binding complexes may be due to the fact that the inhibitionof finasteride at 25 @.aMon the PSA expression has almost reached thepeak level. This result parallels the PSA level presentin the cellstreated with the same concentrations of the drug.

Fig. 8 shows the effect of androgen antibody on the formation of thebinding complexes and the effect of finasteride on the level of AR inthe cells. Complexes were significanfly diminished when the nuclearextracts were preprecipitated with AR antibody, whereas no changeswere observed when the histone Hi antibody proteins were used (Fig.8A). This finding provides additional evidence that the AR plays a keyrole in the formation of the binding complexes and confirms theprevious mechanism as outlined by Luke and Coffey (17). Aftertreatment with various concentrations of finasteride, the AR levels inthe cell extracts of LNCaP cells were remarkably decreased in adose-dependent manner (Fig. 8B). As documented in the Fig. 8C,following the treatment of LNCaP cells with 25 @uvtfinasteride, ARlevels in cellular extracts were decreased to approximately 50% ofbaseline without significant cytotoxicity.

DISCUSSION

Finasteride, an effective 5a-reductase inhibitor, has been introduced to clinicians for treatment of BPH and for trials for the treatment of PC (18, 19). The effects of the drug on serum PSA in menwith stage D PC have been described earlier (20).

Previous observation showed that besides the importance of thePSA as a serum marker for both BPH and PC, PSA itself plays a rolein the growth stimulation of the androgen-responsive prostate cancercell line, LNCaP cells (7). In this study, we provide evidence thatfinasteride markedly inhibits both PSA secretion and expression inLNCaP cells. Thus, the down-regulation of finasteride on PSA andpossibly other AR target gene expressions may imply an additionalmechanism by which this drug decreases prostate volume.

Effects of steroids on target cells are mediated by their respectivereceptors. A number of reports have shown that antagonists of steroid

Free probe -@

SRBC probe +Nuclearproteins -

ARantibody -Histone HI antibody -

97 kDa

66 kDa

@AR

B

C

Fig. 8. Participationof AR in the formationofcomplexesbetweennuclearproteinsand SRBC(A) and the effect of finasteride on the level of ARin LNCaPcells evaluated(B and C). A, 5 @agofnuclear proteins from normal cultured LNCaPcells pre-precipitated with AR (A, Lane 3) orhistoneHl (A, Lane4) antibodyovernightat4'C,followed by reactionwith 32Pend-labeledSRBCprobe. The MGSA was then performed as described in “Materialsand Methods.―B, 100 @gofproteins extracted from LNCaP cells treated withdifferent concentrations of finasteride for 72 hwere subjected to an 8% SDS-polyacrylamide gelfollowed by immunoblotting with AR antibody,andthelevelof AR in theextractswasquantitatedwith a densitometer from X-ray film images (C).

.@‘0

.@

A0 25 50 100 200

Concentrationoffinasteride (uM)

718

0 N@

Fig. 7. Effect of fmasteride on the formation of binding of nuclear proteins to SRBC.LNCaP cells grown exponentially in RPMI 1640 containing 10% FBS were treated withdifferent concentrationsof finasteride for 48 h. The cells were harvested,washedonce withcold PBS, and nuclear proteins extracted. Five g@gof nuclear proteins were reacted with 32Pend-labeled SRBC oligonucleotide in the presenceof 2 @tgof poly(dC)/(dI) for 30 missat37°C.Thereactionmixturesweresubjectedto 8%naturalpolyaciylamidegeLThebindingcomplexesweredetectedby exposingthedriedgel to X-ray film at -70°Covernight

Inhibition of Complex Formation between ARs and SRBC inthe Promoter of the PSA Gene by Finasteride. To explore whethera decrease of the PSA secretion and expression by finasteride isrelated to the binding of nuclear proteins to SRBC, nuclear extracts

Bindingcomplexes

Bindingcomplexe

Freeprobe

on May 8, 2018. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

DOWN-REGULATIONOF PSA EXPRESSION BY FINASTERIDE

receptors inhibit binding of receptors to target DNA (21, 22). Thepromoter of the PSA gene contains several well-known cis-regulatoryelements. Among them, SRBC has been implicated as a functionalandrogen-responsive element (13). A core sequencefor the androgenresponse element has been found to be GGA!FACAnnn-TGTFCT(23).PSAwasnotonlypresentin conditionedmediumfromthePSA-positive cell line LNCaP cells, but was also detectable in smallamounts in the PSA-negative cell lines PC-3 and DU-145 (7). Astrong correlation between binding of nuclear factors to SRBC and thelevel of PSA present in the cell extracts was found in those cell lines,whereas no such correlation with binding was obtained using Sploligonucleotide as a probe. Binding of LNCaP cell nuclear proteins toSRBC was diminished when the cells were exposed to 25 p.M finasteride, at which concentration over 50% of the PSA expression wasinhibited. These results imply that the down-regulation of PSA cx

pression by finastende is through the inhibition of complex formationof nuclear proteins with SRBC in the promoter region of the PSA genein these cells.

The AR is a member of a steroid superfamily of ligand-inducibleintracellular regulators that activate or repress transcription of targetgenes (24, 25). Several genes have been demonstrated to be regulatedby androgen in LNCaP cells primarily at the level of transcriptioninitiation presumably via AR, including the human kallikrein-relatedPSA and hGK-1 genes (17, 26). ARs are structurally and functionallyorganized into domains that mediate hormone binding, nuclear translocation, dimerization, DNA binding, and transcriptional activation(27—30).Inthepresentstudy,usingARantibodytoremoveARfromnuclear extracts followed by MGSA, the binding of nuclear proteinsto SRBC decreased to undetectable levels. Our result provides additional evidence that AR is a major component of SRBC-proteincomplexes. This finding paralleled the observed decrease of the ARlevel in the cells treated with finasteride. Thus, lack of formation ofSRBC-protein complexes due to the decrease in the level of AR mayplay a key role in the down-regulation of PSA gene expression byfinasteride.

REFERENCES

1. Sudduth,S. L., and Koronkowski,M. J. Finasteride:the first 5a-reductaseinhibitor.Pharmacotherapy, 13: 309—329,1993.

2. Bologna, M., Muzi, P., Biordi, L., Festuccia, C., and Vicentini, C. Finasteridedose-depexlently reduces the proliferation rate ofthe LNCaP human prostatic cancercell line in vitro. Urology. 45: 282—290,1995.

3. Kreis, W., Budman, 0. R., Calabro, A., Wang, L G, and Liu, X. M. Combinedeffectsof estramustine(EM) and other estramustinephOsphateS(EMP) with otherantitumoragents in 3 establishedcell lines derivedfrom prostatecancer (PC).Proceed@ ofthe 9th NatiOnal Cancer Institute-European Organization for Researchand Treatmentof CancerSymposiumon New Dnsgsin CancerTherapy,p. 46.Amsterdam (4755): Kluher Academic Publishers, Dordrecht, 1996.

4. Papsidero, L D., Wang. M. C., Kuriyama, M., Horoszewicz, J. S., Leong, S. S.,Croghan, 6. A., Valenzuela, L A., Murphy, G. P., and Chu, T. M. Human prostateepithelial cell-specific antigen. Proc. Clin. Biol. Res., 75A: 435—443,1981.

5. Watt, K. W., Lee, P. J., M'Timkulu, 1., Chan, W. P., and Loor, R. Human prostates@fic antigen: strucwral and functional similarity with serine proteases. Proc. Nail.Acad. Sci. USA, 83: 3166—3170, 1986.

6. Stamey,1. A., Ekman,P. E., Blankenstein,M. A., Cooper,E. H., Kontturi,M., Lilja,

H., Oesterling, J. E., Stenman, U. H., and Turkes, A. Tumor makers. ConsensusConferenceon DiagnosisandPrognosticParametersin LocalizedProstateCancer.Stockholm,Sweden,May 12—13,1993.

7. Wang, L. G., Liu, X. M., Kreis, W., and Budman, D. R. Involvement of prostatespecificantigenin thestimulationof LNCaPcell growth.Oncol.Rep.,3: 911—917.1996.

8. Young, C. Y-F., Montgomery, B. T., Andrews, P. E., Qui S. D., Bilhartz, D. L., andTindall, D. J. Hormonalregulationof prostate-specificantigenmessengerRNA inhuman prostatic adenocarcinoma cell line LNCaP. Cancer Res.. 51: 3748—3752,1991.

9. Henttu, P., Liao, S., andVihko, P. Androgenup-regulatethe humanprostate-specificantigenmessengerribonucleicacid (mRNA),but down-regulatethe prostaticacidphosphatasemRNA in the LNCaPcell line. Endocrinology,130: 766—772,1992.

10. Henifu, P., and Vihko, P. Growth factor regulationof geneexpressionin the humanprostatic carcinoma cell line LNCaP. Cancer Res., 53: 1051—1058,1993.

11. Lundwall, A. Characterization of the gene for prostate-specific antigen, a humanglandular kallikrein. Biochem. Biophys. Res. Commun., 161: 1151—1159, 1989.

12. Riegman, P. H., Vlietstra, R. J., van der Korput, J. A., Romijn, J. C., and Trapman,

J. Characterizationof the prostate-specificantigengene:a novelhumankallikreinlike gene.Biochem.Biophys.Res.Commun..159:95—102,1989.

13. Riegman, P. H., Vlietstra, R. J., van der Korput, J. A., Brinkmann, A. 0., andTrapman, J. The promoter of the prostate-specific antigen gene contains a functionalandrogen responsive element. Mol. Endocrinol., 5: 1921—1930,1991.

14. Klobeck, H. 0., Combriato, G., Schulz, P., Arbusow, V., and Fittler, F. Genomicsequence of human prostate specific antigen (PSA). Nucleic Acids Res., 17: 3981,1989.

15. Wang, L. G., Liu, X. M., Li, Z. R., Denstman, S., and Bloch, A. Differential bindingof nuclearc-ets-l proteinto an intron I fragmentof thec-mybgenein growth versusdifferentiation.Cell Growth & Differ., 5: 1243—1251,1994.

16. Chomczynski,P., and Sacchi,N. Single-stepmethodof RNA isolatedby acidguanidinium thiocyanate-phenol-chioroform extraction. Anal. Biochem., 162: 156-159, 1987.

17. Luke, M. C., and Coffey, D. S. Human androgen receptor binding to the androgenresponseelementof prostatespecificantigen.J. Androl.. 15: 41—51,1994.

18. Gormley, 0. J., Stoner, E., Bniskewitz, R. C., lmperato-McGinley, .1.,Walsh, P. C.,McConnell,J. D., Andriole, 0. L, Bracken,B. R., Tenover,J. S., Vaughan,E. D.,Taylor, A., Binkowitz, B., andNg, J. The effect of fmasteridein menwith benignprostatic hyperplasia. The Finasteride Group. N. Engi. J. Med., 327: 1185-1191,1992.

19. Guess,H. A., Gonnley,0. J.,Stoner,E.,andOesterling,J.E.Theeffectof finasterideon theprostatespecificantigen:reviewof availabledata.J. Urol., 155: 3—9,1996.

20. Presti,J. C., Jr., Fair, W. R., Andriole,0., Sogani,P. C., Seidmon,E. J., Ferguson,D., Ng, J., and Gormley, 0. J. Multicenter,randomized,double-blind, placebocontrolledstudyto investigatetheeffectof finasteride(MK-906) on stageD prostatecancer. J. Urol., 148: 1201—1204,1992.

21. Fawell, S. E., White, R., Hoare, S., Sydenham, M., Page M., and Parker, M. 0.Inhibition of estrogenreceptor-DNAbindingby the“pure―antiestrogenIC! 164,384appears to be mediated by impaired receptor dimerization. Proc. Nail. Acad. Sci.USA, 87: 6883—6887,1990.

22. Fawell, S. E., Lees, J. A., White, R., and Parker, M. 0. Characterization andcolocalizationof steroidbinding and dimerizationactivities in the mouseestrogenreceptor.Cell, 60: 953—962,1990.

23. Roche,P.J., Hoare,S. A., andParker,M. G. A consensusDNA-bindingsite for theandrogen receptor. Mol. Endocrinol., 6: 2229—2235, 1992.

24. Lubahn, D. B., Joseph, D. R., Sullivan, P. M., Willard, H. F., French, F. S., andWilson, E. M. Cloning of human androgenreceptorcomplementaryDNA andlocalizationto theX chromosome.Science(WashingtonDC), 240: 327—330,1988.

25. Chang,C., and Kokontis,J. Identificationof a new memberof the steroidreceptorsuper-family by cloning and sequence analysis. Biochem. Biophys. Res. Commun.,155:971—977,1988.

26. Wolf, D. A., Schulz, P., and Fittler, F. Transcriptional regulation of prostate kallikrein-like genesby androgen.Mol. Endocrinol.,6: 753—762,1992.

27. Beato, M. Gene regulation by steroid hormones. Cell, 56: 335—344,1989.28. Carson-Jurica,M. A., Schrader,W. T., andO'Malley, B. W. Steroidreceptorfamily:

structure and functions. Endocr. Rev., 11: 201—220,1990.29. Evans,R.M.Thesteroidandthyroidhormonereceptorsuperfamily.Science(Wash

ington DC), 240: 889—895,1988.30. Ham, J., and Parker,M. 0. Regulationof geneexpressionby nuclearhormone

receptors. Curr. Opin. Cell Biol., 1: 503—511,1989.

719

on May 8, 2018. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

1997;57:714-719. Cancer Res   Long Gui Wang, Xiao Mei Liu, Willi Kreis, et al.  

Gene in LNCaP CellsPSAthe Promoter of the Androgen Receptor and Steroid Receptor-binding Consensus inFinasteride through Inhibition of Complex Formation between Down-Regulation of Prostate-specific Antigen Expression by

  Updated version

  http://cancerres.aacrjournals.org/content/57/4/714

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/57/4/714To request permission to re-use all or part of this article, use this link

on May 8, 2018. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from