Figure 4

Recommended thermal cycling conditions used for PCR.

*Calculated annealing temperature for LTP 5 primers

determined by {Ta=81.5+0.41(%GC)-(675/primer length)=67}

Gradient PCR of annealing temperatures ranged from 62-72°C.

**Extension time is 1 min./ kb of PCR product.

ACCTTCTACTTTCATGCATTTGCACTCATAAGCTCTCTCTATATAAACCCAACCTTCATTACCATTCTTCATTA

TCCAATCCAATCCATTACTTACTAAGTAAAAAGAGAAAAAAAAAAAATTAAGATATGGAGGGACTCTTGAA

GTTGTCAACTTTGGTGATTGTGTGCATGTTAGTGACCGCTCCAATGGCGTCCGAGGCAGCAATCTCGTGC

GGCGCAGTCACCGGCAGCTTAGGTCAATGCTATAACTACTTGACCCGAGGCGGTTTCATTCCTAGAGGGT

GTTGCTCTGGCGTTCAGAGGCTCAACAGCTTGGCTCGTACCACCCGTGACCGCCAACAAGCTTGTCGTT

GTATCCAGGGAGCAGCGAGAGCCTTGGGTTCTCGACTTAACGCTGGTCGTGCTGCTCGTCTCCCTGGTG

CTTGCCGTGTTAGGATCTCTTACCCCATCAGTGCCAGAACCAACTGTAACACGTACGTTATCTTCTATCTCA

CTCTATATTTATTACATTTTTACTTGAGGTCCTAATATTTAATGGAGTGGTAGTAACCATATGATTGATGTATTT

GGTTGGTTGCAGCGTCAGGTGATCAAAAGAAGATAGACGTTGAAGGGTTTTCATATAATCGATGAGAGAG

TATTAAAAATAATTAAGATGTCACACTATATACACACTAGTGTATCCTTTTACTGTTATTATTGTTGTGTTTCTA

GATTTTGTGTTTTCATGTCTTTCTTTGTATATGACGGTCCATTTAATTGGTCGTCTGTGTTATGTACTCCTCTA

ATGATATATTGAATTTACGATTATGTATTATCTTCAAACTCTTGCCATTAACTTTGGTCACGTTCTGCTT

`

The goal of this project was to successfully isolate

and amplify specific lipid transfer protein gene

regions (LTP 5 and LTP 12) from Arabidopsis thaliana.

DNA was extracted from a wild type and primers were

designed in order to amplify the LTP sequence of

interest. Studies undergoing plant senescence have

shown that suppressed LTP3 and LTP4 genes have a

role in regulating plant senescence and regenerate

plant growth after apparent death. These LTP genes

were chosen in order to determine the roles other

members of the LTP family might have in plant

development. (Supported by NIH grant 5 R25 GM

49001-10)

ABSTRACT

BACKGROUND

• Polymerase chain reaction (PCR) is a biochemical

technique used to amplify a specific fragment of

DNA many thousands of fold. The technique uses a

thermal cycler that undergoes a programmed cycle

of heating and cooling in order to establish

conditions for denaturation, annealing, and

extension by enzymatic activity.

• PCR requires primers that are short complimentary

sequences of nucleotides that are designed to attach

to a target sequence, which begins DNA

amplification by DNA polymerase.

• Lipid transfer proteins (LTPs) are small proteins (9

kDa) found in the epidermal tissues of plants. In-vitro studies suggest that non-specific lipid transfer

proteins are responsible for the transfer of

phospholipids, glycolipids, fatty acids and steroids

between membranes [5]. LTPs may play a role in the

development of plant organs but their relationship to

mechanisms underpinning plant physiology are still

unknown.

• Research shows that LTPs function as signal

carriers, in plant antimicrobial defense, and

correlate with cell death in other plants. In the model

plant Arabidopsis thaliana, LTPs were found to be

part of a multigene family encompassing over 15

identified genes [1].

• As an annual plant, Arabidopsis thaliana undergoes

senescence soon after seeding. The accumulation of

oxidative radicals such as hydrogen peroxide begins

to degrade what remains of its tissues.

• Research suggests that the suppression of LTP 3 and

LTP 4 genes allow the plant to regenerate from the

remaining meristem, essentially converting the

annuals into hybrid-perennials. Figure 3 shows a

comparison of a wild type and a mutant LTP3

Arabidopsis thaliana during rosette growth (R.

Vellanoweth).

MATERIALS AND METHODS

RESULTS

• LTP5 was successfully amplified. Optimal annealing

temperature was 62.1°C. Gel electrophoresis

showed positive bands at the expected product size

of 753 bp.

• LTP12 gradient PCR was not successful; no bands

were noticeable at the LTP12 expected product size

of 682 bp.

References

[1] Arondel, Vincent, Chantal Vergnolle, Catherine Cantrel, and Jean-Claude Kader.

"Lipid Transfer Proteins Are Encoded by a Small Multigene Family in Arabidopsis

Thaliana." Plant Science 157 (2000): 1-12. Print.

[2] Banuelos, G., R. Argumedo, K. Patel, V. Ng, F. Zhou, and R. Vellanoweth. "The

Developmental Transition to Flowering in Arabidopsis Is Associated with an

Increase in Leaf Chloroplastic Lipoxygenase Activity." Plant Science 174.3 (2008):

366-73. Print.

[3] Cheng, Chao-Sheng, Yaw-Jen Liu, and Ping-Chiang Lyu. "Result Filters." National Center for Biotechnology Information. U.S. National Library of Medicine, 2 June

2004. Web. 14 Aug. 2012. <http://www.ncbi.nlm.nih.gov/pubmed/15504025>.

[4] Eklund, D. M. "Localization of Nonspecific Lipid Transfer Proteins Correlate with

Programmed Cell Death Responses during Endosperm Degradation in Euphorbia

Lagascae Seedlings." Plant Physiology 132.3 (2003): 1249-259. Print.

[5] Marion, Didier. "Structure, Biological and Technological Functions of Lipid Transfer

Proteins." INRA Angers-Nantes. N.p., 22 Feb. 2006. Web. 12 Aug. 2012.

<http://www.angers-

nantes.inra.fr/angers_nantes_eng/unites_de_recherche_unites_experimentales/bio

polymeres_interactions_assemblages_bia/edifices_lipoproteiques_et_proteo_polys

accharidiques/proteines_de_transfert_de_lipides>.

[6] "National Center for Biotechnology Information." National Center for Biotechnology Information. U.S. National Library of Medicine, n.d. Web. 14 Aug. 2012.

<http://www.ncbi.nlm.nih.gov/>.

[7] "Primer3 Input (version 0.4.0)." Primer3 Input (version 0.4.0). N.p., n.d. Web. 14

Aug. 2012. <http://frodo.wi.mit.edu/>.

[8] Saiki, R., D. Gelfand, S. Stoffel, S. Scharf, R. Higuchi, G. Horn, K. Mullis, and H.

Erlich. "Primer-directed Enzymatic Amplification of DNA with a Thermos table DNA

Polymerase." Science 239.4839 (1988): 487-91. Print

[9] "TAIR - Home Page." TAIR - Home Page. N.p., n.d. Web. 14 Aug. 2012.

<http://www.arabidopsis.org/>.

[10] Thomas, S., Y. Kaneko, and C. Somerville. "A Non-specific Lipid Transfer Protein

from Arabidopsis Is a Cell Wall Protein." The Plant Journal 3.3 (1993): 427-36. Print.

Acknowledgments

This project was possible through the support of Dr.

Robert L. Vellanoweth, Jessica Ortiz, and all of Dr.

Vellanoweth’s biochemistry lab. Special thanks to the

California State University Los Angeles M.O.R.E.

programs and the (NIH) National Institute of Health.

Future work

• In order to amplify LTP12 we must expand our

temperature gradient to find the optimal annealing

conditions for our primer. In addition concentrations

of PCR master mix (MgCl2, Go taq enzyme , DNA

template) must be reassessed.

• Additional care must also be taken to extract pure DNA

samples due to contamination which could inhibit

PCR.

Figure 2

DNA sequence for LTP 5 gene includes primers (green), intron

(underlined), and protein-coding sequence (yellow). Primers

where chosen to be 15-30 nucleotides long with 40-60% GC

content.

Figure: 1

The plants were transferred into a growing chamber

which maintained a 16hr photoperiod in 23ºC. Twice a

week plants were fed a nutrient solution containing

0.0005 M KNO3, 0.0025M KH2PO4, 0.004 M MgSO4_7

H2O, and 0.002 M Ca(NO3)2_4H2O.

Figure: 3

LTP 3,4 mutant (top) and Wild type

Arabidopsis thaliana (bottom).

Picture taking at 8-10 growth period.

Department of Chemistry and Biochemistry

California State University, Los Angeles

Israel Santana, Michelle Reid, Jessica Ortiz, and Robert L Vellanoweth

DNA AMPLIFICATION OF SPECIFIC LIPID TRANSFER

PROTEINS (LTPs) FROM ARABIDOPSIS THALIANA

PLANT GROWTH

The soil used was composed of a 4:3:2 potting soil: vermiculite:

perlite mixture which was autoclaved and treated with

0.05% fungicide and 0.4% larvacide. The pots were filled ¾

full; 1-4 seeds were placed in each pot only slightly below the surface. The seeds were placed in an incubating room in 4ºC for

two days to stimulate and synchronize germination.

DNA Extraction

A CTAB: mercapto ethanol: chloroform protocol was used

to extract DNA from plant tissue. A small amount (0.25g) of leaf

tissue was frozen in liquid nitrogen and ground into a fine

powder using a mortar and pestle.

PCR

OPTIMIZATION

A specific PCR protocol was

designed for GoTaq Flexi DNA

polymerase. A temperature gradient (+-5˚C) PCR was used to determine optimal

amplification conditions(Figure 4).

ELECTROPHORESIS

A 1.0% agarose gel containing 0.5g of agarose, 50mL of 1x TAE buffer and 0.5uL of ethidium bromide

was used to verify amplification of gene

regions. Expected product size of LTP 5 gene region is

753 bp and 682 bp for LTP12 (Figure 5).

Initial

denaturation

95°C 2 min.

Denaturation 95°C 30 sec.

Annealing 67°C* 30 sec. 30X

Extension 72°C** 45 sec.

Final extension 72°C 5 min.

Soak 4°C Indefinite

Lane

1 2 3 4 5 6 7 8 9 10

Figure 5

PCR run (with temperature gradient ) showed positive results at 750bp (left). Lane 1 shows the optimal

amplification settings with annealing temperature at 62.1°C. Lanes 2-5 show a decline in amplification

(right) shows the LTP12 PCR reaction with an unsuccessful amplification

Gel Electrophoresis

LTP5 LTP12

Lane

1 2 3 4 5 6 7 8 9 10

ANNEALING TEMPS. °C 62.1 62.5 63.2 64.2 65.5 66.8 68.2 69.5 70.7

Lane

1 2 3 4 5 6 7 8 9 10

CONCLUSION

The functions of the various LTPs can be investigated

through generating transgenic or mutant plants that

express antisense RNA. But before any of that is

possible, the isolation and amplification of specific LTP

regions must be performed. Our data shows that LTP 5

was successfully amplified but LTP 12 was not. There are

many possible contributing factors (i.e. wrong primers,

inhibitors in reaction, too much dNTPs etc.) in the

methods that may have affected the amplification of

LTP12 (Figure 5).

250 bp----

500----

750----

1,000----

10,000----

3,000----

250 bp----

500---- 750----

1,000----

10,000----

3,000----