Digestion of DNA with Restriction - RSI · In principle, 1 U restriction endonuclease completely digests 1 •g of purified DNA in 60 min using the recommended assay conditions. However,

SECTION IRESTRICTION ENDONUCLEASES

UNIT 3.1Digestion of DNA with RestrictionEndonucleases

Restriction endonucleases recognize short DNA sequences and cleave double-strandedDNA at specific sites within or adjacent to the recognition sequences. Restrictionendonuclease cleavage of DNA into discrete fragments is one of the most basic proceduresin molecular biology. The first method presented in this unit is the cleavage of a singleDNA sample with a single restriction endonuclease (see Basic Protocol). A number ofcommon applications of this technique are also described. These include digesting a givenDNA sample with more than one endonuclease (see Alternate Protocol 1), digestingmultiple DNA samples with the same endonuclease (see Alternate Protocol 2), andpartially digesting DNA such that cleavage only occurs at a subset of the restriction sites(see Alternate Protocol 3). A protocol for methylating specific DNA sequences andprotecting them from restriction endonuclease cleavage is also presented (see SupportProtocol). A collection of tables describing restriction endonucleases and their properties(including information about recognition sequences, types of termini produced, bufferconditions, and conditions for thermal inactivation) is given at the end of this unit (seeTable 3.1.1, Table 3.1.2, Table 3.1.3, and Table 3.1.4).

BASIC

PROTOCOL

DIGESTING A SINGLE DNA SAMPLE WITH A SINGLE RESTRICTIONENDONUCLEASE

Restriction endonuclease cleavage is accomplished simply by incubating the enzyme(s)with the DNA in appropriate reaction conditions. The amounts of enzyme and DNA, thebuffer and ionic concentrations, and the temperature and duration of the reaction will varydepending upon the specific application.

Materials

DNA sample in H2O or TE buffer (APPENDIX 2)10× restriction endonuclease buffers (see recipe)Restriction endonucleases (Table 3.1.1 and Table 3.1.3)10× loading buffer (UNIT 2.5)0.5 M EDTA, pH 8.0 (optional; APPENDIX 2)

Additional reagents and equipment for agarose or polyacrylamide gelelectrophoresis (UNIT 2.5 or UNIT 2.7), DNA extraction (optional; UNIT 2.1), andethanol precipitation (optional; UNIT 2.1)

1. Pipet the following into a clean microcentrifuge tube:

x µl DNA (0.1 to 4 µg DNA in H2O or TE buffer)2 µl 10× restriction buffer (Table 3.1.1)18 − x µl H2O.

A 20-�l reaction is convenient for analysis by electrophoresis in polyacrylamide or agarose

gels. The amount of DNA to be cleaved and/or the reaction volume can be increased or

decreased provided the proportions of the components remain constant.

2. Add restriction endonuclease (1 to 5 U/µg DNA) and incubate the reaction mixture1 hr at the recommended temperature (in general, 37°C).

Supplement 31

Contributed by Kenneth D. Bloch and Barbara GrossmannCurrent Protocols in Molecular Biology (1995) 3.1.1-31.21Copyright © 2000 by John Wiley & Sons, Inc.

3.1.1

EnzymaticManipulation ofDNA and RNA

In principle, 1 U restriction endonuclease completely digests 1 �g of purified DNA in 60

min using the recommended assay conditions. However, crude DNA preparations, such as

those made by rapid procedures (UNIT 1.6), often require more enzyme and/or more time for

complete digestion (see Critical Parameters). The volume of restriction endonuclease

added should be less than 1⁄10 the volume of the final reaction mixture, because glycerol in

the enzyme storage buffer may interfere with the reaction.

3. Stop the reaction and prepare it for agarose or acrylamide gel electrophoresis (UNIT

2.5 or UNIT 2.7) by adding 5 µl (20% of reaction vol) 10× loading buffer.

The reaction can also be stopped by chelating Mg2+ with 0.5 �l of 0.5 M EDTA (12.5 mM

final concentration). If the digested DNA is to be used in subsequent enzymatic reactions

(e.g., ligation or “filling-in” reactions), addition of EDTA should be avoided. Alternatively,

many enzymes can be irreversibly inactivated by incubating 10 min at 65°C (see Table

3.1.1). Some enzymes that are partially or completely resistant to heat inactivation at 65°Cmay be inactivated by incubating 15 min at 75°C. When the enzyme(s) is completely

resistant to heat inactivation, DNA may be purified from the reaction mixture by extraction

with phenol and precipitation in ethanol (UNIT 2.1).

Alternatively, DNA may be purified conveniently using a silica matrix suspension as

described in UNIT 2.1 (also commercially available as Geneclean from Bio101.)

ALTERNATE

PROTOCOL 1

DIGESTING DNA WITH MULTIPLE RESTRICTIONENDONUCLEASES

It is often desirable to cleave a given DNA sample with more than one endonuclease. Twoor more enzymes may be added to the same reaction mixture if all are relatively active inthe same buffer and at the same temperature. Many enzymes are active in a wide varietyof buffer solutions. It is frequently possible to choose a standard buffer solution in whichtwo or more enzymes will retain activity (see Commentary and Table 3.1.2). Alternatively,most restriction endonucleases and some DNA-modifying enzymes are active to someextent in potassium glutamate– and potassium acetate–based buffers (see recipe for 10×restriction endonuclease buffers). Hence, these buffers may be useful for digesting DNAwith multiple enzymes. However, if the reaction conditions needed are too dissimilar,follow the procedure below.

1. Digest the DNA with the enzyme(s) that is active at the lower NaCl concentration(see Basic Protocol, steps 1 and 2).

If optimal digestion conditions differ only in incubation temperature, cleave the DNA with

one enzyme, then shift the temperature and add the second enzyme (the order of cleavage

does not matter; Table 3.1.1). However, many enzymes with optimal activity at high

temperatures are also active at 37°C. In these cases, the enzymes can be added simultane-

ously and the reaction mixture incubated at 37°C (it may be necessary to add more of the

“high-temperature” enzyme than usual).

2. For enzymes active at higher salt concentrations, add 1 M NaCl (1 to 3 µl for a 20-µlreaction) so that the final concentration is suitable for digestion by the next enzyme(s).Add enzyme(s) for the second reaction and incubate appropriately.

Purification of the DNA fragments between digestions is the most reliable method to ensure

complete, multiple digestions. However, it is much more laborious and is rarely necessary.

3. Stop the reaction for electrophoretic analysis or further enzymatic treatment (seeBasic Protocol, step 3).

Supplement 31 Current Protocols in Molecular Biology

3.1.2

Digestion of DNAwith Restriction

Endonucleases

ALTERNATE

PROTOCOL 2

DIGESTING MULTIPLE SAMPLES OF DNA

This procedure minimizes the number of pipetting steps when multiple samples are to bedigested with the same enzyme(s) and, hence, saves time. More importantly, by minimiz-ing the number of transfers from the tube containing the restriction enzyme, the potentialfor contamination of the enzyme is reduced.

1. For each sample to be tested, add a constant volume of DNA to a separate microcen-trifuge tube.

It is critical to use a different pipet tip for each DNA sample in order to prevent

cross-contamination.

2. Prepare a “premix solution” containing sufficient 10× restriction endonuclease bufferand water for digesting all the samples. Place solution on ice.

For example, if ten 3-�l samples of DNA are each to be digested in a 20-�l reaction mixture,

the premix will contain 20 �l of 10× restriction buffer and 150 �l water. It is prudent to

make up enough solution for at least one more sample than is to be tested.

3. Add sufficient restriction endonuclease(s) for digesting all the samples. Mix quicklyby flicking the tube and replace on ice.

The solution to which the enzyme is added should not be more concentrated than 3× buffer.

4. Add the appropriate amount of solution containing the restriction endonuclease (17µl for above example) to each tube of DNA and incubate the reactions 1 hr at theappropriate temperature.

For most analytical purposes, the same pipet tip can be used to dispense the restriction

endonuclease solution provided that care is taken to avoid direct contact with the DNA at

the bottom of the tubes. For preparative purposes, it is advisable to use a different pipet tip

for each sample.

5. Stop the reactions for electrophoretic analysis or further enzyme digestion (see BasicProtocol, step 3).

ALTERNATE

PROTOCOL 3

PARTIAL DIGESTION OF DNA WITH RESTRICTIONENDONUCLEASES

For some purposes, it is useful to produce DNA that has been cleaved at only a subset ofthe restriction sites. This is particularly important for cloning segments of DNA in whichthe site(s) used for cloning is also present internally within the segment, and is also usefulfor restriction mapping (UNIT 3.3). Partial cleavage is accomplished using reduced (andtherefore limiting) concentrations of restriction enzyme. Here a set of serial dilutions ofenzyme is set up so that one or more of the conditions used is likely to produce theappropriate partial digestion product. If necessary, the procedure can be used for analyticalpurposes, and the reaction can be repeated and/or scaled up using digestion conditionsthat have been empirically determined. Partial cleavage can also be achieved by varyingthe time of digestion, but this is more tedious and less reliable.

1. Make up a 100-µl reaction mixture containing DNA in 1× restriction enzyme buffer.

2. Divide up reaction mixture such that tube 1 contains 30 µl, tubes 2 to 4 contain 20µl, and tube 5 contains 10 µl. Place tubes on ice.

3. Add the selected restriction endonuclease (3 to 10 U/µg DNA) to tube 1, mix quicklyby flicking the tube, and place the tube back on ice.

Current Protocols in Molecular Biology Supplement 31

3.1.3


4. Using a different pipet tip, add 10 µl from tube 1 into tube 2, mix quickly, and placeback on ice. Continue the serial dilution process by successively pipetting 10 µl fromtube 2 to 3, 3 to 4, and 4 to 5. When finished, all five tubes should contain 20 µl andbe on ice.

Figure 3.1.1 illustrates the serial dilution process.

It is critical to use a new pipet tip for each dilution step.

5. Incubate all five tubes for 15 min at the appropriate temperature for the restrictionendonuclease and stop the reactions for electrophoretic analysis or further enzymatictreatment (see Basic Protocol, step 3).

By virtue of the serial dilution process, the amount of enzyme per microgram of DNA has

been varied over a 54-fold range. The extent of digestion is determined by gel electropho-

resis of the samples. For most purposes, the desired partial digestion products can be

obtained directly.

1

2

3

4

mix DNA and

1x buffer;

keep on ice100 µl

divide samples on ice

vol: 30 µl 20 µl

perform serial

dilution;

keep on ice

add enzyme;

keep on ice

vol: 20 µl 20 µl

N/3

20 µl

N/9

20 µl

N/27

20 µl

N/54

stop reaction and analyze products

by gel electrophoresis

incubate 15 min at 37°C

amount of enzyme: N

20 µl 20 µl 10 µl

10 µl 10 µl 10 µl 10 µl

Figure 3.1.1 Partial digestion by serial dilution.


3.1.4


Endonucleases

SUPPORT

PROTOCOL

METHYLATION OF DNA

A number of commercially available methylases covalently join methyl groups to adenineor cytosine residues within specific target sequences (i.e., the EcoRI methylase methylatesan A residue within the EcoRI recognition sequence). Methylation of these sites rendersthem resistant to cleavage by the corresponding restriction endonuclease.

Additional Materials (also see Basic Protocol)

10× methylase buffer (see recipe)S-adenosylmethionine (SAM)

1. Set up a reaction (typically 20 µl) containing DNA (at a final concentration of ∼20to 200 µg/ml) in 1× methylase buffer (Table 3.1.3).

2. Add SAM to achieve a final concentration of 80 µM.

SAM is the methyl group donor.

3. Add a sufficient amount of methylase to completely protect the DNA from cleavageby the corresponding restriction endonuclease.

A unit of methylase protects 1 �g bacteriophage λ DNA under the recommended conditions

from cleavage by the corresponding restriction endonuclease.

4. Incubate the reaction mixture 1 hr at the appropriate temperature (usually 37°C).

Methylase reactions frequently contain EDTA, which may inhibit subsequent endonuclease

reactions. Methylated DNA may be purified from the reaction mixture by extraction with

phenol/chloroform and precipitation in ethanol (UNIT 2.1).

REAGENTS AND SOLUTIONS

Use deionized, distilled water in all recipes and protocol steps. For common stock solutions, seeAPPENDIX 2; for suppliers, see APPENDIX 4.

Methylase buffer, 10×NaClTris⋅Cl, pH 7.5 (APPENDIX 2)EDTA2-mercaptoethanol (2-ME) or dithiothreitol (DTT)S-adenosylmethionine (SAM)

The concentrations of buffer components depend upon the methylase (Table 3.1.3)

Restriction endonuclease buffers

10× sodium chloride–based buffers

100 mM Tris⋅Cl, pH 7.5 (APPENDIX 2)100 mM MgCl2

10 mM dithiothreitol (DTT)1 mg/ml bovine serum albumin (BSA)0, 0.5, 1.0, or 1.5 M NaCl

The concentration of NaCl depends upon the restriction endonuclease (Table 3.1.1). The

four different NaCl concentrations listed above are sufficient to cover the range for essen-

tially all commercially available enzymes except, those requiring a buffer containing KCl

instead of NaCl (see recipe below). Autoclaved gelatin (at 1 mg/ml) can be used instead of

BSA. See Critical Parameters.

continued


3.1.5


Note that most restriction enzymes are provided by the suppliers with the appropriate buffers.

10× potassium acetate–based buffer

660 mM potassium acetate330 mM Tris⋅acetate, pH 7.9100 mM magnesium acetate5 mM DTT1 mg/ml BSA (optional)10× potassium chloride–based buffer

60 mM Tris⋅Cl, pH 8.0 (APPENDIX 2)60 mM MgCl2

200 mM KCl60 mM 2-mercaptoethanol (2-ME)1 mg/ml BSA2× potassium glutamate–based buffer

200 mM potassium glutamate50 mM Tris⋅acetate, pH 7.5100 µg/ml BSA1 mM 2-ME

COMMENTARY

Background InformationRestriction endonucleases are enzymes that

cleave DNA in a sequence-dependent manner.Such cleavage is used for a wide number ofapplications in molecular biology, including (a)establishment of an endonuclease map of aplasmid or bacteriophage clone; (b) fragmen-tation of genomic DNA prior to electrophoreticseparation and Southern blotting; (c) genera-tion of fragments that can be subcloned inappropriate vectors; and (d) generation of frag-ments to be used as labeled probes in bothSouthern (UNIT 2.9) and northern (UNIT 4.9) blot-ting, as well as in nuclease protection analysis(UNIT 4.7).

Members of a large subgroup of these en-zymes (type II restriction endonucleases) rec-ognize short nucleotide sequences and cleavedouble-stranded DNA at specific sites withinor adjacent to the sequences. The recognitionsequences are generally, but not always, 4 to 6nucleotides in length and are usually charac-terized by dyad symmetry (the 5′ to 3′ nucleo-tide sequence of one DNA strand is identical tothat of the complementary strand). Two en-zymes, NotI and SfiI, recognize an 8-bp se-quence found infrequently in genomic DNAand hence are extremely useful for cleavingDNA into large fragments. More than 600 typeII restriction endonucleases have been isolated.

Some type II restriction endonucleasescleave at the axis of symmetry, yielding “flush”or “blunt” ends. Others make staggered cleav-ages, yielding overhanging single-stranded 3′

or 5′ ends known as cohesive termini or “stickyends.”

BamHI cleavage generates cohesive 5′ over-hanging ends:

5′ G↓G-A-T-C-C 3′3′ C-C-T-A-G↑G 5′

KpnI cleavage generates cohesive 3′ over-hanging ends:

5′ G-G-T-A-C↓C 3′3′ C↑C-A-T-G-G 5′

DraI cleavage generates blunt ends:

5′ T-T-T↓A-A-A 3′3′ A-A-A↑T-T-T 5′

Endonucleases with the same recognitionsequences are called isoschizomers. Isoschizo-mers may or may not cleave DNA identicallyto produce the same ends. Conversely, two ormore restriction endonucleases recognizingidentical or different sequences may generateidentical DNA fragment termini (Table 3.1.4).These endonucleases are said to produce com-patible ends. DNA fragments with compatibletermini may be ligated with DNA ligases toproduce hybrid DNA molecules (UNIT 3.16).

For example, BglII recognizes a differentsix-nucleotide sequence from BamHI, but gen-erates cohesive termini compatible with thoseof BamHI. BglII cleaves:

5′ A↓G-A-T-C-T 3′3′ T-C-T-A-G↑A 5′


3.1.6


Endonucleases

The hybrid sites generated by joining BamHIand BglII cohesive ends cannot be cleaved byeither enzyme.

Restriction endonucleases, generally foundin prokaryotic organisms, are probably impor-tant for degrading foreign DNA (particularlybacteriophage DNA). Organisms that producerestriction endonucleases protect their owngenomes by methylating nucleotides within theendonuclease recognition sequences. A spe-cific methylase covalently links methyl groupsto adenine or cytosine nucleotides within targetsequences, thus rendering them resistant tocleavage by the restriction enzyme.

Several sources provide comprehensive andup-to-date listings of restriction endonucleases,including their restriction sites, isoschizomers,and reaction conditions. One source is the cata-logs of commercial suppliers of enzymes. TheBiotech Buyers’ Guide (ACS, 1995) providesfree of charge an annually updated list of re-striction enzymes and their suppliers. Anothercomprehensive source listing all known restric-tion endonucleases is a special annual supple-ment to Nucleic Acids Research (e.g., Roberts,1994). This provides an additional listing of allcommercial suppliers of each enzyme. Themost complete and up-to-date version ofRoberts’ information is maintained as a text filedatabase called REBASE, available online from avariety of electronic mail and network servers(see UNIT 19.1 for a complete listing of sources).

Critical Parameters

Purity of DNA

The efficiency of the restriction endonu-clease reaction is very dependent upon the pu-rity of the DNA. Contaminants found in someDNA preparations (e.g., protein, phenol, chlo-roform, ethanol, EDTA, SDS, high salt concen-tration) may inhibit restriction endonucleaseactivity. Such impurities are often present inDNA samples prepared by miniprep proce-dures (UNIT 1.6). The decreased reaction effi-ciency associated with impure DNA prepara-tions may be overcome by increasing the num-ber of enzyme units added to the reactionmixture (up to 10 to 20 U per microgram DNA),increasing the reaction volume to dilute poten-tial inhibitors, or increasing the duration ofincubation. Some preparations of DNA (par-ticularly minipreps) are contaminated byDNases. Because DNases require Mg2+ forenzyme activity, DNA in such preparations isstable in its storage buffer (which containsEDTA), but is rapidly degraded upon addition

of restriction endonuclease buffer. This prob-lem can be overcome only by repurifying theDNA.

Digestion of genomic DNA (prepared as inUNITS 2.2-2.4) can be facilitated by the addition ofthe polycation spermidine (final concentration1 to 2.5 mM), which acts by binding negativelycharged contaminants. However, as spermidinewill precipitate DNA at 4°C, it should be addedafter the other components of the reaction mix-ture have been incubated at the appropriatetemperature for a few minutes. Finally, somepreparations of DNA require repurification(phenol and chloroform extractions and ethanolprecipitation) prior to digestion with restrictionenzymes.

Degree of methylation

Some restriction endonucleases are inhib-ited by methylation of nucleotides within theirrecognition sequences (Table 3.1.1). In general,Escherichia coli host strains from which plas-mids are harvested contain two nucleotide-se-quence-specific methylases: dam, whichmethylates adenine in the sequence GATC, anddcm, which methylates the internal cytosineresidue in the sequences CC(A/T)GG (Table3.1.3). Thus, plasmid DNA from normal strainsmay be cleaved partially or not at all by restric-tion endonucleases that are sensitive to methy-lation. This can be avoided by preparing plas-mid DNA from strains that lack these methy-lases (UNIT 1.4).

Mammalian DNA contains occasional 5-methylcytosine residues, usually at the 5′ sideof guanosine residues. The degree of methyla-tion varies from site to site, and is stronglyinfluenced by the cell type from which the DNAis isolated. Methylation patterns in eukaryoticgenomic DNA can be investigated by using thedifferent methylation sensitivities of isoschi-zomers. For example, MspI cleaves CCGGeven when the internal cytosine is methylated,whereas HpaII, which also cleaves CCGG, isvery sensitive to such methylation.

In some situations, it is useful to take advan-tage of a restriction enzyme’s inability to cleavemethylated nucleotide sequences. Methylasesrecognizing sequences close to a restrictionenzyme’s recognition sequences can inhibitcleavage at those sites, thereby altering theenzyme’s apparent sequence specificity. Alter-natively, when using synthetic linkers to mod-ify the termini of a DNA fragment (UNIT 3.16), itmay be important to protect internal restrictionenzyme sites by methylation prior to enzymecleavage of linkers.


3.1.7


Other factors influencing DNA cleavage

Larger amounts (up to 20-fold more) ofsome enzymes are necessary to cleave super-coiled plasmid or viral DNA as compared to theamount needed to cleave linear DNA (Fuchsand Blakesley, 1983). In addition, some en-zymes cleave their defined sites with differentefficiency, presumably due to differences inflanking nucleotides. In general, cleavage ratesfor different sites recognized by a given enzymediffer by less than a factor of 10. Although suchvariability is usually irrelevant, it can be sig-nificant in experiments involving partial diges-tion. It may be difficult to cleave DNA at aparticular site without extensive cleavage atother sites. A few restriction endonucleasessuch as NarI, NaeI, SacII, and XmaIII showextreme variability such that some sites are verydifficult to cleave.

Buffer conditions

The typical restriction endonuclease buffercontains magnesium chloride, sodium or potas-sium chloride, Tris⋅Cl, 2-mercaptoethanol (2-ME) or dithiothreitol (DTT), and bovine serumalbumin (BSA). A divalent cation, usuallyMg++, is an absolute requirement for enzymeactivity. Buffer, typically Tris⋅Cl, is necessaryto maintain the optimal pH for enzyme func-tion. Sulfhydryl reagents may be useful forstabilization of some restriction enzymes, butmay also stabilize potential contaminants.Some restriction endonucleases are very sensi-tive to the concentration of sodium or potas-sium ion, while others are active over a widerange of ionic strengths.

For each restriction endonuclease, optimalreaction conditions are recommended by themanufacturer. However, strict adherence tothese recommendations would require the in-vestigator to stock a large number of buffers.Because many enzymes retain most of theiractivity over a wide range of reaction condi-tions (Table 3.1.2), most manufacturers havebegun to recommend a panel of four buffers foruse with their restriction endonucleases. Thesebuffers may be provided with the purchase ofenzymes or may be purchased separately, orthey may be prepared in the laboratory andstored at −20°C, as 10× concentrates, for morethan a year. The buffer systems typically in-clude a core buffer with varying NaCl concen-trations, pH, and specific ion requirements.Manufacturers’ catalogs include descriptionsof these buffers and indicate enzyme activitiesin each buffer. Unfortunately, these buffers

have not been standardized among the variouscompanies; different manufacturers may rec-ommend different buffers for the same endonu-clease. In general, we recommend purchasingrestriction endonucleases from a single com-pany based upon price and using the buffersthat are provided with the enzymes.

As an alternative to the four-buffer systemdescribed above, many laboratories use potas-sium glutamate–based (McClelland et al.,1988) and potassium acetate–based (O’Farrellet al., 1980) buffers (known as “universal”buffers) for digestion of DNA with restrictionendonucleases. The key features of these buff-ers is that they include potassium glutamate orpotassium acetate instead of sodium chlorideand Tris⋅acetate instead of Tris⋅Cl. Most restric-tion endonucleases are active in these buffers,although some enzymes are less active (some-times only 20%) than under optimal conditionsspecified by the manufacturer. Several DNA-modifying enzymes are also active in thesebuffers, including T4 DNA polymerase and T4DNA ligase. “Universal” buffers are useful fordigestion of DNA with multiple restriction en-donucleases, particularly when the endonu-cleases are incompatible in any one of thestandard buffers.

Some restriction endonucleases “relax”their recognition sequence specificity in“nonoptimal” reaction conditions (includinghigh endonuclease concentrations, high gly-cerol concentrations, low ionic strength, Mn2+

instead of Mg2+, and high pH). This “star”activity cleaves DNA at other sites besidesthose containing the “correct” sequence. Forexample, EcoRI star activity cleaves some butnot all sequences of the form AATT (usuallysites with a 5 out of 6 match to GAATTC arecleaved better than sites with a 4 out of 6 match).The cleavage products all contain cohesiveends identical to those generated by the trueEcoRI activity.

Additional comments

Enzymes should be stored at −20°C. Whilein use, enzymes should be carefully maintainedon ice.

Be extremely careful to avoid contaminatingenzyme solutions, particularly with plasmidDNA, other restriction endonucleases, orDNase I.

Some restriction enzymes are expensive,others relatively inexpensive. Their use is dic-tated in part by their cost. Ironically, expensiveenzymes are often of lower quality.


3.1.8


Endonucleases

Anticipated ResultsComplete cleavage of the DNA by a restric-

tion endonuclease should generate a set of dis-crete DNA fragments that are bounded by therestriction sites. Upon analysis by gel electro-phoresis (UNITS 2.5 & 2.7), the cleavage productsshould be visualized as sharp bands.

Time ConsiderationsIn principle, if 1 U of restriction endonu-

clease digests 1 µg of DNA in 1 hr, then incu-bations for longer durations might be expectedto permit conservation of expensive enzymes.In practice, however, some restriction endonu-cleases have only limited stability in the reac-tion mixture. Thus, enzyme reactions are usu-ally carried out for 30 min to 2 hr unless verylarge amounts of DNA or expensive enzymesare involved. In addition, be aware that ex-tended incubations often reveal low levels ofcontaminating nuclease activities, which mayconfound experimental results.

Literature CitedACS (American Chemical Society). 1995. Biotech

Buyers’ Guide 1995. ACS, Washington, D.C.

Fuchs, R. and Blakesley, R. 1983. Guide to the useof type II restriction endonucleases. Methods

Enzymol. 100:3-38.

McClelland, M., Hanish, J., Nelson, M., and Patel,Y. 1988. KGB: A single buffer for all restrictionendonucleases. Nucl. Acids Res. 16:364.

O’Farrell, P.H., Kutter, E., and Nakanishe, M. 1980.Mol. Gen. Genet. 179:411-435.

Roberts, R.J. 1994. Restriction enzymes and theirisoschizomers. Nucl. Acids Res. 20(Supp.#1):2167-2180.

Contributed by Kenneth D. BlochMassachusetts General HospitalBoston, Massachusetts

Barbara Grossmann (Table 3.1.1)Amersham Life Science, Inc.Cleveland, OH

Tables appear on following pages.


3.1.9


Table 3.1.1 Recognition Sequences and Reaction Conditions of Commercially Available RestrictionEndonucleasesa

Name Siteb Saltc Rxn.temp.d

Inact.temp.d Isoschizomers Commentse

Restriction endonucleases

AatI AGG↓CCT M 37 75 Eco147I, StuI dcm

AatII GACGT↓C M(K) 37 60AccI GT↓(A/C)(G/T)AC —f 37 90 ↑ activity at 55°CAccII CG↓CG L 37 Bsh1236I, BstUI, MvnI, ThaIAccIII T↓CCGGA H 60 BseAI, BsiMI, BspEI, Kpn2I,

MroIAcc65I G↓GTACC H(K) 37 65 Asp718I, KpnIAccB7I CCAN4↓NTGG M 37 PflMI, Van91IAciI C↓CGC

GGC↑GH 37 65

AcsI Pu↓AATTPy —f 50 ApoIAcyI GPu↓CGPyC H 50 65 BbiII, BsaHI, Hin1I, Hsp92IAfaI GT↓AC M 37 70 Csp6I, RsaIAflII C↓TTAAG M 37 65 BfrI, Bst98IAflIII A↓CPuPyGT H 37 100AgeI A↓CCGGT L 25 PinAIAhdI GACN3↓N2GTC —f 37 65 AspEI, Eam1105I, EclHKIAluI AG↓CT M 37 70AlwI GGATCN4↓

CCTAGN5↑—f 37 65 dam

Alw21I G(A/T)GC(A/T)↓C L 37 65 AspHI, BsiHKAI, HgiAIAlw26I GTCTCN↓

CAGAGN5↑L 37 65 BsmAI

Alw44I G↓TGCAC M 37 65 ApaLIAlwNI CAGN3↓CTG —f 37 65AocI CC↓TNAGG L 37 Bsu36I, CvnI, Eco81I, MstII,

SauIAor51HI AGC↓GCT M 37 Eco47IIIApaI GGGCC↓C L 37 65 Bsp120I dcm

ApaLI G↓TGCAC L 37 Alw44IApoI Pu↓AATTPy H 50 AcsIAscI GG↓CGCGCC —f 37 65AseI AT↓TAAT H(K) 37 65 AsnI, VspI Star activityAsnI AT↓TAAT H 37 AseI, VspIAspI GACN↓N2GTC H 37 Tth111IAsp700I GAAN2↓N2TTC H 37 XmnIAsp718I G↓GTACC H 37 Acc65I, KpnIAspEI GACN3↓N2GTC L 37 65 AhdI, Eam1105I, EclHKIAspHI G(A/T)GC(A/T)↓C H 37 Alw21I, BsiHKAI, HgiAIAsuI G↓GNCC M 37 BsiZI, Bsu54I, Cfr13I, Sau96IAvaI C↓PyCGPuG M 37 100 BcoI, NspIII ↑ activity at 45°CAvaII G↓G(A/T)CC M 37 65 Eco47I, SinI dcm

AviII TGC↓GCA H 37 FdiII, FspI, MstIAvrII C↓CTAGG M 37 BlnIBalI TGG↓CCA L 25 65 MluNI, MscI dcm; active >18 hrBamHI G↓GATCC H 37 60 BstI Star activityBanI G↓GPyPuCC L 50 70

continued


3.1.10

BanII GPuGCPy↓C M 37 60BanIII AT↓CGAT M 37 70 BsiXI, Bsp106I, BspDI, ClaIBbeI GGCGC↓C L 37 65 EheI, KasI, NarIBbiII GPu↓CGPyC L 37 AcyI, BsaHI, Hin1I, Hsp92IBbrPI CAC↓GTG H 37 Eco72I, PmaCI, PmlIBbsI GAAGACN2↓

CTTCTGN6↑L 37 65 BpuAI, Bsc91I

BbuI GCATG↓C L 37 65 SphIBbvI GCAGCN8↓

CGTCGN12↑L 37 65 Bst71I

Bca77I (A/T)↓CCGG(A/T) —f —gBsaWI

BcgI ↓N10GCAN6TCGN12↓↑N12CGTN6AGCN10↑

H 37 65 Requires SAM

BclI T↓GATCA H(K) 50 100 BsiQI dam

BcnI CC↓(G/C)GG H 37 NciIBcoI C↓PyCGPuG H 65 AvaI, NspIIIBfaI C↓TAG —f 37 MaeIBfrI C↓TTAAG M 37 AflII, Bst98IBglI GCCN4↓NGGC H 37 65BglII A↓GATCT H 37 100BlnI C↓CTAGG H 37 AvrIIBlpI GC↓TNAGC —f 37 Bpu1102I, CelII, EspIBmyI G(A/G/T)GC(A/C/T)↓C —f 37 Bsp1286IBpmI CTGGAGN16↓

GACCTCN14↑H 37 65 GsuI

Bpu1102I GC↓TNAGC —f 37 BlpI, CelII, EspIBpuAI GAAGACN2↓

CTTCTGN6↑H 37 BbsI, Bsc91I

BsaI GGTCTCN↓CCAGAGN5↑

—f 60 65 10% activity at 37°C

BsaAI PyAC↓GTPu H 37BsaBI GATN2↓N2ATC M 60 BsiBI, BsrBrI, MamI dam; 20% activity at

37°CBsaHI GPu↓CGPyC —f 37 65 AcyI, BbiII, Hin1I, Hsp92I ↑ activity at 37°CBsaJI C↓CN2GG M 60 20% activity at 37°CBsaMI GAATGCN↓

CTTAC↑GNH 65 BsmI

BsaOI CGPuPy↓CG M 50 BsiEI, McrIBsaWI (A/T)↓CCGG(A/T) M 60 Bca77IBsc91I GAAGACN2↓

CTTCTGN6↑H 37 BbsI, BpuAI

BscBI GGN↓NCC —f 55 NlaIVBseAI T↓CCGGA —f 55 AccIII, BsiMI, BspEI, Kpn2I,

MroIBseRI GAGGAGN10↓

CTCCTCN8↑L 37 65

BsgI GTGCAGN16↓CACGTCN14↑

—f 37 65

BshI GG↓CC 37 BspKI, HaeIII, PalIBsh1236I CG↓CG H 37 65 AccII, BstUI, MvnI, ThaI

Table 3.1.1 Recognition Sequences and Reaction Conditions of Commercially Available RestrictionEndonucleasesa continued



continued


3.1.11

BsiBI GATN2↓N2ATC 55 BsaBI, BsrBrI, MamIBsiCI TT↓CGAA L 65 BstBI, Csp45I, NspV,

Nsp7524V, SfuIBsiEI CGPuPy↓CG M 60 BsaOI, McrIBsiHKAI G(A/T)GC(A/T)↓C H 60 Alw21I, AspHI, HgiAIBsiLI CC↓(A/T)GG —f 60 BstGI, BstNI, BstOI, EcoRII,

MvaIBsiMI T↓CCGGA —f 60 AccIII, BseAI, BspEI, Kpn2I,

MroIBsiQI T↓GATCA —f 55 BclIBsiWI C↓GTACG H 60 SplI, SunI 50% activity at 37°CBsiXI AT↓CGAT —f 65 BanIII, Bsp106I, BspDI, ClaIBsiYI CCN5↓N2GG M 55 BslIBsiZI G↓GNCC —f 65 AsuI, Bsu54I, Cfr13I, Sau96IBslI CCN5↓N2GG H 55 BsiYI 30% activity at 37°CBsmI GAATGCN↓

CTTAC↑GNM 65 90 BsaMI 20% activity at 37°C

BsmAI GTCTCN↓CAGAGN5↑

H 55 Alw26I 10% activity at 37°C;30% activity at 65°C

BsmBI CGTCTCN↓GCAGAGN5↑

H 55

BsmFI GGGACN10↓CCCTGN14↑

L 37

BsoFI GC↓NGC L 55 65 Fnu4HIBsp106I AT↓CGAT —f 37 BanIII, BsiXI, BspDI, ClaIBsp120I G↓GGCCC L 37 ApaIBsp1286I G(A/G/T)GC(A/C/T)↓C L 30 BmyI dam

Bsp1407I T↓GTACA —f 50 70 SspBIBsp90I GTA↓TAC —f 45 Bst1107IBspCI CGAT↓CG —f 37 PvuI, XorIIBspDI AT↓CGAT —f 37 65 BanIII, BsiXI, Bsp106I, ClaI dam

BspEI T↓CCGGA H 37 AccIII, BseAI, BsiMI, Kpn2I,MroI

BspHI T↓CATGA H(K) 37 65 RcaI dam

BspKI GG↓CC —f 40 BshI, HaeIII, PalIBspMI ACCTGCN4↓

TGGACGN8↑M 37

BspWI GCN5↓N2GC —f 42 MwoIBsrI ACTGGN↓

TGAC↑CNH(K) 65

BsrBI GAG↓CGGCTC↑GCC

M 37 BstD102 I

BsrBrI GATN2↓N2ATC L 65 BsaBI, BsiBI, MamIBsrDI GCAATGN2↓

CGTTAC↑N2

M 60

BsrFI Pu↓CCGGPy M 37 Cfr10IBsrGI T↓GTACA M 37 SspBIBssHII G↓CGCGC Lf 50 90

continued





3.1.12

BssSI C↓TCGTG H 37BstI G↓GATCC H(K) 55 85 BamHI Star activity; 10%

activity at 37°CBst1107I GTA↓TAC H(K) 37 Bsp90IBst71I GCAGCN8↓

CGTCGN12↑H 50 BbvI

Bst98I C↓TTAAG M 37 AflII, BfrIBstBI TT↓CGAA M 65 BsiCI, Csp45I, Nsp7524V,

NspV, SfuI10% activity at 37°C

BstD102I GAG↓CGG M 37 BsrBIBstEII G↓GTNACC H 60 85 EcoO651 Star activity; 10%

activity at 37°CBstGII CC↓(A/T)GG —f —g

BsiLI, BstNI, BstOI, EcoRII,MvaI

BstNI CC↓(A/T)GG H 60 BsiLI, BstGII, BstOI, EcoRII,MvaI

Difficult ligation; 30%activity at 37°C

BstOI CC↓(A/T)GG M 60 BsiLI, BstGII, BstNI, EcoRII,MvaI

BstUI CG↓CG H 60 AccII, Bsh236I, MvnI, ThaI 20% activity at 37°CBstXI CCAN5↓NTGG H 50 65BstYI Pu↓GATCPy L 60 MflI, XhoII 30% activity at 37°CBstZI C↓GGCCG H 50 EagI, EclXI, Eco52I, XmaIIIBsu23I T↓CCGGA —f 37 65 AccIII, BseAI, BsiMI, BspEI,

Kpn2I, MroIBsu36I CC↓TNAGG H 37 AocI, CvnI, Eco81I, MstII, SauIBsu54I G↓GNCC —f —g

AsuI, BsiZI, Cfr13I, Sau96ICac8I GCN↓NGC H 37 65CcrI C↓TCGAG H 37 PaeR7I, XhoICelII GC↓TNAGC H 37 BlpI, Bpu1102I, EspICfoI GCG↓C L 37 HhaI, HinP1ICfr9I C↓CCGGG —f 37 PspAI, SmaI, XmaICfr10I Pu↓CCGGPy Lf 37 100 BsrFICfr13I G↓GNCC M 37 100 AsuI, BsiZ I, Bsu54 I, Sau96 IClaI AT↓CGAT M 37 65 BanIII, BsiXI, Bsp106I, BspDI dam

CpoI CG↓G(A/T)CCG H 30 60 CspI, RsrIICsp6I G↓TAC L 37 AfaI, RsaICspI CG↓G(A/T)CCG H(K) 30 CpoI, RsrIICsp45I TT↓CGAA M 37 65 BsiCI, BstBI, NspV, Nsp7524V,

SfuICviJI PuG↓CPy —f —g

CvnI CC↓TNAGG M 37 65 AocI, Bsu36I, Eco81I, MstII,SauI

DdeI C↓TNAG H 37 70DpnI GA↓TC H 37 65 Both strands

methylated Am

DpnII ↓GATC H 37 65 MboI, NdeII, Sau3A I dam

DraI TTT↓AAA M 37 65DraII PuG↓GNCCPy H 37 EcoO109IDraIII CACN3↓GTG H 37 65 Star activityDrdI GACN4↓N2GTC M(K) 37

continued





3.1.13

DsaI C↓CPuPyGG H 55DsaV ↓CCNGG H 60 ScrFIEaeI Py↓GGCCPu M(K) 37 65 dcm

EagI C↓GGCCG H 37 65 BstZI, EclXI, Eco52I, XmaIIIEam1104I CTCTTCN↓

GAGAAGN4↑H(K) 37 65 EarI, Ksp632I

Eam1105I GACN3↓N2GTC —f 37 65 AhdI, AspEI, EclHKIEarI CTCTTCN↓

GAGAAGN4↑L 37 65 Eam1104I, Ksp632I

EclHKI GACN3↓N2GTC M 37 65 AhdI, AspEI, Eam1105IEclXI C↓GGCCG H 37 BstZI, EagI, Eco52I, XmaIIIEcl136II GAG↓CTC —f 37 65 EcoICRI, SacI, SstIEco105I TAC↓GTA L 37 SnaBIEco130I C↓C(A/T)(A/T)GG H 37 EcoT14I, StyIEco47I G↓G(A/T)CC H 37 100 AvaII, SinIEco47III AGC↓GCT H 37 100 Aor51HIEco52I C↓GGCCG H 37 80 BstZI, EagI, EclXI, XmaIIIEco57I CTGAAGN16↓

GACTTCN14↑L 37 65

EcoO65I G↓GTNACC H 37 70 BstEIIEco72I CAC↓GTG —f 37 65 BbrPI, PmaCI, PmlIEco81I CC↓TNAGG L 37 90 AocI, Bsu36I, CvnI, MstII, SauIEcoICRI GAG↓CTC M 37 65 Ecl136II, SacI, SstIEcoNI CCTN2↓N3AGG —f 37EcoO109I (A/G)G↓GNCC(C/T) L 37 65 DraII dcm

EcoRI G↓AATTC H 37 65 Star activityEcoRII ↓CC(A/T)GG M 37 60 BstGII, BsiLI, BstNI, BstOI,

MvaIdcm

EcoRV GAT↓ATC H 37 65 Star activityEcoT14I C↓C(A/T)(A/T)GG H 37 Eco130I, StyIEcoT22I ATGCA↓T H 37 100 NsiI, Ppu10IEheI GGC↓GCC L 37 70 BbeI, KasI, NarIEspI GC↓TNAGC H 37 100 BlpI, Bpu1102I, CelIIEsp3I CGTCTCN↓

GCAGAGN5↑—f 37 65

FdiII TGC↓GCA L 50 100 AviII, FspI, MstIFnu4HI GC↓NGC L 37 65 BsoFI, ItaI Difficult ligationFokI GGATGN9↓

CCTACN13↑L 37 65

FseI GGCCGG↓CC M 30FspI TGC↓GCA M 37 65 AviII, FdiII, MstIGsuI CTGGAGN16↓

GACCTCN14↑—f 37 65 BpmI

HaeII PuGCGC↓Py M 37 65HaeIII GG↓CC M 37 90 BshI, BspKI, PalI Very stable; active at

70°CHapII C↓CGG —f 37 HpaII, MspIHgaI GACGCN5↓

CTGCGN10↑M 37 65

continued





3.1.14

HgiAI G(A/T)GC(A/T)↓C H 37 65 Alw21I, AspHI, BsiHKAIHgiDI GPu↓CGPyC AcyI, BbiII, BsaHI, Hin1IHhaI GCG↓C M 37 90 CfoI, HinP1IHin1I GPu↓CGPyC L 37 80 AcyI, BbiII, BsaHI, Hsp92IHincII GTPy↓PuAC H 37 70 HindIIHindII GTPy↓PuAC M 37 65 HincIIHindIII A↓AGCTT M 37 90 Star activityHinfI G↓ANTC H 37 80 Star activityHinP1I G↓CGC L 37 CfoI, HhaIHpaI GTT↓AAC M(K) 37 90HpaII C↓CGG L(K) 37 90 HapII, MspI No cleavage when

internal C ismethylated

HphI GGTGAN8↓CCACTN7↑

L(K)f 37 65 dam

Hsp92I GPu↓CGPyC L 37 AcyI, BbiII, BsaHI, Hin1I Hsp92II CATG↓ H 37 NlaIIIItaI GC↓NGC H 37 65 BsoFI, Fnu4HIKasI G↓GCGCC M 37 65 BbeI, EheI, NarI Site-dependent activityKpnI GGTAC↓C L 37 60 Acc65I, Asp718I Star activityKpn2I T↓CCGGA —f 55 AccIII, BseAI, BsiMI, BspEI,

MroIKspI CCGC↓GG H 37 SacII, SstIIKsp6321 CTCTTCN↓

GAGAAGN4↑H(K) 37 Eam1104I, EarI

MaeI C↓TAG H 45 BfaIMaeII A↓CGT H 50MaeIII ↓GTNAC H 45MamI GATN2↓N2ATC H 37 BsaBI, BsiBI, BsrBrIMboI ↓GATC H 37 65 DpnII, NdeII, Sau3AI dam

MboII GAAGAN8↓CTTCTN7↑

L(K) 37 65 dam

McrI CGPuPy↓CG H 37 BsaOI, BsiEIMfeI C↓AATTG —f 37 65 MunIMflI Pu↓GATCPy L 37 BstYI, XhoIIMluI A↓CGCGT H 37 100MluNI TGG↓CCA —f 37 65 BalI, MscIMnlI CCTCN7

GGAGN6

M 37 65

MroI T↓CCGGA L 37 100 AccIII, BseAI, BsiMI, BspEI,Kpn2I

MscI TGG↓CCA M 37 BalI, MluNI Star activityMseI T↓TAA M 37 65 Tru9IMslI CAPyN2↓N2PuTG M 37 65MspI C↓CGG M 37 90 HapII, HpaII No cleavage when 5′

C is methylatedMspA1I C(A/C)G↓C(G/T)G H 37 65 NspBII

continued





3.1.15

MstI TGC↓GCA H 37 AviII, FdiII, FspIMstII CC↓TNAGG H 37 65 AocI, Bsu36I, CvnI, Eco81I, SauIMunI C↓AATTG M 37 65 MfeIMvaI CC↓(A/T)GG H 37 100 BsiLI, BstGII, BstNI, BstOI,

EcoRIIMvnI CG↓CG M 37 AccII, Bsh1236I, BstUI, ThaIMwoI GCN5↓N2GC —f 60 BspWINaeI GCC↓GGC L 37 100 NgoAIV, NgoMI Site-dependent activityNarI GG↓CGCC L 37 65 EheI, KasI Stable at 37°C for 24

hr; site-dependentactivity

NciI CC↓(G/C)GG L 37 80 BcnI Difficult ligationNcoI C↓CATGG H 37 80NdeI CA↓TATG —f 37 65 t1⁄2 ∼15 min at 37°CNdeII ↓GATC H 37 65 DpnII, MboI, Sau3AINgoAIV G↓CCGGC —f 37 NaeI, NgoMINgoMI G↓CCGGC —f 37 NaeI, NgoAIVNheI G↓CTAGC M 37 65NlaIII CATG↓ Lf 37 65 Hsp92IINlaIV GGN↓NCC Lf 37 65 BscBINotI GC↓GGCCGC H 37 100NruI TCG↓CGA H 37 80 SpoI dam

NsiI ATGCA↓T H 37 EcoT22I, Ppu10INspI PuCATG↓Py L 37 65 Nsp7524INspIII C↓PyCGPuG —f 37 85 AvaI, BcoINspV TT↓CGAA L 50 BsiCI, BstBI, Csp45I,

Nsp7524V, SfuINsp7524I PuCATG↓Py —f 37 NspINsp7524V TT↓CGAA L 37 70 BsiCI, BstBI, Csp45I, NspV, SfuINspBII C(A/C)G↓C(G/T)G L 37 MspA1IPacI TTAAT↓TAA L 37PaeR7I C↓TCGAG —f 37 CcrI, XhoI Site-dependent activityPalI GG↓CC M 37 65 BshI, BspKI, HaeIIIPflMI CCAN4↓NTGG H 37 65 AccB7I, Van91IPinAI A↓CCGGT M 37 65 AgeIPleI GAGTCN4↓

CTCAGN5↑—f 37 65

PmaCI CAC↓GTG L 37 60 BbrPI, Eco72I, PmlIPmeI GTTT↓AAAC —f 37 65PmlI CAC↓GTG L 37 BbrPI, Eco72I, PmaCIPpu10I A↓TGCAT —f 37 65 EcoT22I, NsiIPpuMI PuG↓G(A/T)CCPy —f 37 Psp5II dcm

PshAI GACN2↓N2GTC K 37Psp1406I AA↓CGTT —f 37 65Psp5II PuG↓G(A/T)CCPu H 37 PpuMI

continued





3.1.16

PspAI C↓CCGGG —f 37 65 Cfr9I, SmaI, XmaIPstI CTGCA↓G H 37 70 Star activityPvuI CGAT↓CG H 37 100 BspCI, XorIIPvuII CAG↓CTG M 37 95 Star activityRcaI T↓CATGA M 37 65 BspHIRsaI GT↓AC M 37 65 AfaI, Csp6IRsrII CG↓G(A/T)CCG L 37 65 CpoI, CspISacI GAGCT↓C L 37 60 Ecl136II, EcoICRI, SstISacII CCGC↓GG L 37 80 KspI, SstII Site-dependent activitySalI G↓TCGAC H 37 80 Star activitySapI GCTCTTCN↓

CGAGAAGN4↑—f 37 65

SauI CC↓TNAGG H 37 AocI, Bsu36I, CvnI, Eco81I,MstII

Sau3AI ↓GATC H 37 70 DpnII, MboI, NdeIISau96I G↓GNCC L 37 AsuI, BsiZI, Bsu54I, Cfr13I dcm

ScaI AGT↓ACT H 37 100 Star activityScrFI CC↓NGG H 37 65 DsaVSdyI GGNCC —f —g

AsuI, BsiZI, Bsu54I, Cfr13I,Sau96I

SexAI A↓CC(A/T)GGT M 37SfaNI GCATCN5↓

CGTAGN9↑H 37 65

SfcI C↓TPuPyAG —f 37 65SfiI GGCCN4↓NGGCC M 50SfuI TT↓CGAA H 37 BsiCI, BstBI, Csp45I,

Nsp7524V, NspVSgfI GCGAT↓CGC L 37SgrAI CPu↓CCGGPyG —f 37SinI G↓G(A/T)CC L 37 65 AvaII, Eco47ISmaI CCC↓GGG L(K)f 30 65 Cfr9I, PspAI, XmaISnaBI TAC↓GTA M 37 Eco105ISpeI A↓CTAGT M 37 65SphI GCATG↓C H 37 100 BbuISplI C↓GTACG H 55 BsiWI, SunISpoI TCG↓CGA M(K) 37 65 NruISrfI GCCC↓GGGC M 37 65Sse8387I CCTGCA↓GG —f 37 60SspI AAT↓ATT —f 37 65SspBI T↓GTACA —f 50 70 BsrGISstI GAGCT↓C M 37 65 Ecl136II, EcoICRI, SacISstII CCGC↓GG M 37 KspI, SacIIStuI AGG↓CCT M 37 65 AatI dcm

StyI C↓C(A/T)(A/T)GG H 37 65 EcoO130I, EcoT14ISunI C↓GTACG M 55 BsiWI, SplISwaI ATTT↓AAAT H 25

continued





3.1.17

TaqI T↓CGA H 65 90 TthHB8I dam

TfiI G↓A(A/T)TC L 65 Star activity; 10%activity at 37°C

ThaI CG↓CG L 60 AccII, Bsh1236I, BstUI, MvnITru9I T↓TAA M 65 MseITsp45I ↓GT(G/C)AC L 65Tsp509I ↓AATT —f 65TspRI N2CAGTGN2↓ —f 65Tth111I GACN↓N2GTC —f 65 AspI Difficult ligation; 10%

activity at 37°CTthHB8I T↓CGA H 65 TaqIVan91I CCAN4↓NTGG H(K) 37 65 AccB7I, PflMIVspI AT↓TAAT H 37 AseI, AsnIXbaI T↓CTAGA M 37 70 dam

XcmI CCAN5↓N4TGG M(K) 37 65XhoI C↓TCGAG H 37 80 CcrI, PaeR7IXhoII Pu↓GATCPy L 37 65 BstYI, MflIXmaI C↓CCGGG L 37 65 Cfr9I, PspAI, SmaIXmaIII C↓GGCCG L 25 BstZI, EagI, EclXI, Eco52IXmnI GAAN2↓N2TTC L 37 65 Asp700I Star activityXorII CGAT↓CG L 37 BspCI, PvuI

Intron-encoded endonucleases

I-CeuI TAACTATAACGGTCCTAA↓GGTAGCGAf

ATTGATATTGCCAG↑GATTCCATCGCTRxn. temp. 37°Cf

I-PpoI ATGACTCTCTTAA↓GGTAGCCAAAf

TACTGAGAG↑AATTCCATCGGTTTRxn. temp. 37°Cf

I-SceI TAGGGATAA↓CAGGGTAATfATCCC↑TATTGTCCCATTA Rxn. temp. 37°Cf

PI-PspI TGGCAAACAGCTATTAT↓GGGTATTATGGGTf

ACCGTTTGTCGAT↑AATACCCATAATACCCARxn. temp. 65°Cf

PI-SceI ATCTATGTCGGGTGC↓GGAGAAAGAGGTAATGAAATGGCAf

TAGATACAGCC↑CACGCCTCTTTCTCCATTACTTTACCGTRxn. temp. 37°Cf

PI-TliI GGTTCTTTATGCGGACAC↓TGACGGCTTTATGf

CCAAGAAATACGCC↑TGTGACTGCCGAAATACRxn. temp. 50°Cf

aCompiled from Amersham (1994-95), Boehringer Mannheim (1994), GIBCO/BRL (1994), New England Biolabs (1995), Pharmacia Biotech(1994), Promega (1994), Stratagene (1995). See APPENDIX 4 for addresses and phone numbers of suppliers.bAbbreviations: N, any nucleotide (G, A, T, C); Pu, either purine (G or A); Py, either pyrimidine (C or T).cRecommended concentrations of NaCl (or KCl, indicated by parenthetical K) where L is <50 mM, M is 50-100 mM, and H is >100 mM (see recipefor restriction endonuclease buffers).dReaction temperature is the temperature (°C) at which the reaction should be performed; inactivation temperature indicates the temperature (°C)at which the enzyme is inactivated after 15 min of incubation.eAbbreviations and other terminology: dam, activity blocked by dam or overlapping dam methylation; dcm, activity blocked by dcm or overlappingdcm methylation; difficult ligation, the enzyme has single-bp 5′ overhanging ends that are difficult to ligate with T4 DNA ligase; SAM,S-adenosylmethionine; site-dependent activity refers to marked differences in rates of cleavage at various sites by a particular enzyme (probablydetermined by the surrounding sequence); star activity refers to altered specificity of a restriction enzyme that causes it to cleave sequences that aresimilar but not identical to its defined recognition sequence—conditions that may provoke this altered specificity include elevated pH, high glycerolconcentration, low ionic strength, and high enzyme to DNA ratio; t1⁄2, half-life.fRefer to manufacturer’s recommendations and Table 3.1.2 for information on salt requirements.gRefer to manufacturer’s recommendations for reaction temperature.





3.1.18

Table 3.1.2 Effect of NaCl Concentration on Restriction Endonuclease Activitya

Enzyme0 mMNaCl

50 mMNaCl

100 mMNaCl

150 mMNaCl Enzyme

0 mMNaCl

50 mMNaCl

100 mMNaCl

150 mMNaCl

AatII + ++ ++ + EcoRI b +++ +++ +++AccI +++ +++ + + EcoRV + + + +++AciI + +++ +++ +++ Fnu4HI +++ +++ ++ +AflII + +++ ++ ++ FokI +++ +++ +++ +++AhaII + ++ +++ +++ FspI + +++ ++ ++AluI + +++ +++ ++ HaeII +++ +++ +++ ++AlwI +++ +++ ++ + HaeIII +++ +++ +++ +++AlwNI ++ +++ +++ + HgaI +++ +++ + +ApaI +++ +++ ++ + HgiAI + + ++ +++ApaLI +++ +++ ++ + HhaI + + + ++AscI + ++ ++ + HincII ++ +++ +++ +++AseI + +++ +++ +++ HindIII ++ +++ +++ ++AvaI +++ +++ +++ +++ HinfI ++ +++ +++ +++AvaII +++ +++ ++ + HinPI +++ +++ +++ +++AvrII +++ +++ +++ ++ HpaI + +++ +++ +BalI +++ ++ ++ + HpaII +++ +++ ++ +BamHI + ++ +++ +++ HphI +++ +++ +++ +BanI +++ +++ ++ ++ KasI + +++ + +BanII +++ +++ +++ +++ KpnI +++ + + +BbvI +++ +++ +++ +++ MboI ++ +++ +++ +++BcgI +++ +++ +++ +++ MboII +++ +++ +++ +++BclI + +++ +++ + MluI ++ +++ +++ ++BglI + +++ +++ +++ MnlI +++ +++ +++ ++BglII ++ +++ +++ +++ MseI +++ +++ ++ +BsaHI ++ +++ +++ + MspI +++ +++ +++ +++BsmI +++ +++ +++ +++ NaeI +++ +++ +++ +Bsp1286 +++ +++ ++ + NarI +++ +++ + +BspHI ++ +++ +++ +++ NciI +++ +++ ++ +BspMI ++ ++ +++ +++ NcoI + ++ +++ +++BspMII ++ ++ +++ +++ NdeI + + ++ +++BssHII +++ +++ +++ +++ NheI +++ +++ +++ ++BstBI +++ +++ ++ + NlaIII + + + +BstEII + ++ +++ +++ NlaIV + + + +BstNI ++ ++ +++ +++ NotI + +++ +++ +++BstUI +++ +++ ++ + NruI + +++ +++ +++BstXI ++ +++ +++ +++ NsiI ++ ++ ++ ++BstYI +++ +++ ++ ++ PaeR7I +++ +++ +++ +Bsu36I + ++ +++ ++ PflMI ++ +++ +++ ++ClaI +++ +++ +++ ++ PleI +++ + + +DdeI ++ +++ +++ +++ PpuMI +++ +++ ++ +DpnI + ++ +++ +++ PstI +++ +++ +++ +++DraI ++ +++ + + PvuI + ++ +++ +++DraIII ++ +++ +++ ++ PvuII +++ +++ +++ +++EaeI ++ +++ ++ + RsaI +++ +++ +++ +++EagI ++ +++ +++ +++ RsrII +++ ++ + +

continued


3.1.19

Eam1105I + ++ + + SacI +++ ++ ++ +EcoNI +++ +++ +++ +++ SacII +++ + + +EcoO109 +++ +++ +++ +++ SalI + + ++ +++Eco57I +++ +++ +++ ++ Sau3AI +++ +++ +++ +++Sau96I +++ +++ +++ +++ StuI +++ +++ +++ +++ScaI + +++ +++ ++ StyI + ++ +++ +++ScrFI ++ +++ +++ +++ TaqI +++ +++ +++ ++SfaNI + + +++ +++ Tth111I +++ +++ +++ +SmaI + + + + XbaI + +++ +++ +++SnaBI +++ +++ ++ + XcaI +++ + + +SpeI ++ +++ +++ ++ XhoI ++ +++ +++ +++SphI + + +++ +++ XmaI +++ +++ ++ +SspI ++ +++ +++ ++ XmnI +++ +++ + +aReprinted by permission of New England Biolabs. The activity of each enzyme listed is compared at specified NaClconcentrations to its activity in recommended assay bufffer. Recommended assay buffers in some cases differ widely in termsof pH and specific ion requirements. The conditions here varied only the NaCl concentration. All buffers contained 10 mMTris⋅Cl (pH 7.5) and 100 µg/ml bovine serum albumin. All incubations were done for 60 min at the optimum temperature foreach enzyme. Scoring is as follows:

+ <10% of the activity can be obtained using these conditions compared to the recommended conditions.

++ between 100% and 20% of the activity can be obtained using these conditions compared to the recommendedconditions.

+++ between 30% and 100% of the activity can be obtained using these conditions compared to the recommendedconditions.

bNot recommended because of star activity, which refers to cleavage at sites other than the usual recognition sequence. Staractivity occurs under nonoptimal reaction conditions, such as low ionic strength, high endonuclease concentrations, highglycerol concentrations, high pH, and when Mn2+ is used in place of Mg2+.

Table 3.1.3 Recognition Sequences and Reaction Conditions ofCommercially Available Methylasesa

MethylaseRecognitionsequenceb

NaCl Tris⋅Clc EDTA MEd

(mM)AluI AGCmT0 50 10 5 —BamHI GGATCmC 50 10 10 5 ClaI ATCGAmT 0 50 10 5 CpG CmG 50 10 0.1 1e dam GAmTC 0 50 10 5 EcoRI GAAmTTC 100 100 1 0 FnuDII CmGCG 0 50 10 5 HaeIII GGCmC 50 50 10 1D HhaI GCmGC 0 50 10 5 HpaII CCmGG 0 50 10 5 MspI CmCGG 100 50 10 5 PstI CTGCAmG 0 50 10 5 TaqI TCGAm 100 10 0 6f aAll reaction mixtures contain 80 µM S-adenosylmethionine and are incubated at 37°C.bSuperscript m signifies methylated nucleotide.cpH 7.5.d2-mercaptoethanol or dithiothreitol (D).eReaction buffer includes 160 µM S-adenosylmethionine.fReaction buffer includes 6 mM MgCl2.

Table 3.1.2 Effect of NaCl Concentration on Restriction Endonuclease Activitya, continued

Enzyme0 mMNaCl

50 mMNaCl

100 mMNaCl

150 mMNaCl Enzyme

0 mMNaCl

50 mMNaCl

100 mMNaCl

150 mMNaCl


3.1.20


Endonucleases

AATT ACGT AGCT ATAT CATG CCGG CGCG CTAG GATC GCGC GGCC GTAC TATA TCGA TGCA TTAA

↓∗∗∗∗ Tsp 509I Dpn II

Mbo Ic

Sau3 AI

∗↓∗∗∗ Mae II Msp I

Hpa IIc

Bfa I Hin PI Csp 61 Taq I Mse I

∗∗↓∗∗ Alu I Bst UI Dpn I Hae III Rsa I

∗∗∗↓∗ Hha I

∗∗∗∗↓ Nla III

A↓∗∗∗∗T Apo I HindIII Afl III Age I

Bsr FIBsa WI

Mlu I

Afl IIISpe I Bgl II

Bst YIPpu 10I

A∗↓∗∗∗TPsp1406I Cla I

Bsp DIAse I

A∗∗↓∗∗T Ssp I Eco 47III Stu I Sca I

A∗∗∗↓∗T

A∗∗∗∗↓TNspHI Hae II Nsi I

C↓∗∗∗∗GMun I Nco I

Sty I

Dsa I

Xma I

Ava IDsa I Avr II

Sty IEag I

Eae IBsi WI Sfc I Xho I

Ava ISfc I Afl II

C∗↓∗∗∗G Nde I

C∗∗↓∗∗GPml I

Bsa AIPvu II

Msp A1ISma I Msp A1I

C∗∗∗↓∗G Sac II Pvu I

Bsi EIBsi EI

C∗∗∗∗↓GPst I

G↓∗∗∗∗CEco RI

Apo INgo MI

Bsr FlBss HII Nhe I BamHI

Bst YIKas I

Ban IBsp120I Acc 65I

Ban ISal I Apa LI

G∗↓∗∗∗C Bsa HI Nar I

Bsa HIAcc I Acc I

G∗∗↓∗∗C Ecl 136II Eco RV Nae I Ehe I Bst1107I Hin cII Hpa I

Hin cII

G∗∗∗↓∗C

G∗∗∗∗↓CAat II

Sac I

Ban IIBsi HKAIBsp1286I

Sph I

NspH1Bbe I

Hae II

Apa I

Ban IIBsp1286I

Kpn I Bsp1286IBsiHKAI

T↓∗∗∗∗A Bsp HI Bsp EI

Bsa WIXba I Bcl I Eae I Bsr GI

T∗↓∗∗∗A Bst BI

T∗∗↓∗∗ASna BI

Bsa AINru I Fsp I Msc I Dra I

T∗∗∗↓∗A

T∗∗∗∗↓A



3.1.21

Table 3.1.4 Cross Index of Recognition Sequences and Restriction Endonucleasesa,b

aReprinted by permission of New England Biolabs.bSequences at the top of each column are written 5′ to 3′. Asterisks at the left of each row are place holders for nucleotides within a recognition sequence, andarrows indicate the point of cleavage. Sequences of complementary strands and their cleavage sites are implied. Enzymes written in bold type recognize onlyone sequence, while those in light type have multiple recognition sequences.cSequence cleaved identically by two or more enzymes that are affected differently by DNA modification at that site (see Table 3.1.1).

reaction (PCR) provides additional versatility for constructing recombinant DNA mole-cules. UNIT 3.17 gives a general approach and discusses particular scenarios for incorporat-ing specific sequences onto the ends of DNA fragments, for creating in-frame fusionproteins, and for creating deletions and insertions using inverse PCR.

A final section on specialized applications describes the labeling and various means ofdetecting nonisotopically labeled probes. Biotinylated and digoxygenin-labeled probesare becoming more widely used in place of their radioactive counterparts for the hybridi-zation applications described in UNITS 2.9, 4.9 & 14.3. Aside from eliminating the concerns ofworking with hazardous materials, the use of these probes offers increased stability andreasonable sensitivity to colorimetric (UNIT 3.18) or chemiluminescent (UNIT 3.19) detectiontechniques.

Kevin Struhl


3.0.2

Introduction

SECTION IIRESTRICTION MAPPING

Construction of an accurate map of the sites where restriction endonucleases cleaveDNA—restriction mapping—is critical for almost all subsequent manipulations of ge-netic material. Restriction mapping is based upon the cleavage of DNA at or near specificnucleotide sequences with restriction endonucleases and the determination of the sizesof the resulting DNA fragments by gel electrophoresis (see UNITS 2.5 and 2.7).

Restriction maps are often determined by digesting recombinant DNA molecules in whichthe DNA of interest is cloned into plasmid or phage vectors. The most common approachis to deduce the map after digesting the DNA of interest with a variety of restrictionenzymes, either individually or in combination. This method requires the fewest experi-mental manipulations, and it is easy to use for cloned DNA segments up to 20 kb in length.Restriction mapping of larger unknown regions gets progressively more difficult. Thismethod is best used for generating an initial restriction map with enzymes that cleave theDNA relatively infrequently.

In an alternative method, DNA fragments are end labeled (UNITS 3.5 and 3.10), purified byelectrophoresis (UNITS 2.6 and 2.7), and subjected to partial endonucleolytic cleavage. Thismethod defines the position of restriction sites with respect to a single defined position,the site of labeling. It is valuable in situations where a restriction endonuclease cleavesthe DNA in many positions, or in mapping very large DNA molecules.

It is important to note that careful restriction mapping is critical for subcloning (UNIT 3.16) and isuseful for nucleotide sequence analysis (UNIT 7.4). Conversely, nucleotide sequence data canpredict restriction endonuclease cleavage sites and thereby generate a complete restriction map.

UNIT 3.2Mapping by Multiple Endonuclease Digestions

BASIC

PROTOCOLThe DNA of interest is cleaved with a variety of restriction endonucleases, eitherindividually or in combination, and the resulting products are separated by agarose oracrylamide gel electrophoresis. By determining the sizes of DNA fragments produced byendonuclease cleavage, the restriction map is deduced progressively from simple situ-ations where enzymes cleave the DNA once or twice to more complex situations wherecleavage occurs more frequently.

Materials

Restriction endonucleases (Table 3.1.1)10× restriction endonuclease buffers (UNIT 3.1)

Additional reagents and equipment for agarose or polyacrylamide gelelectrophoresis (UNITS 2.5 or 2.7) and DNA molecular weight markers (UNITS 2.5A)

1. In each of several separate tubes, cleave the DNA of interest (up to 20 kb in length)with a restriction endonuclease that can be expected to cleave infrequently.

In general, inexpensive restriction endonucleases with six base-pair recognition sequences

are used first (e.g., EcoRI, HindIII, BamHI, PstI, KpnI, XbaI, SalI, and XhoI). DNA

fragments produced by cleavage with these enzymes are also easily subcloned into standard

plasmid or phage vectors.

2. After cleavage, remove a small portion of each reaction mixture and separate theproducts by agarose or polyacrylamide gel electrophoresis. Store the remainders ofthe reaction mixtures on ice.

It is essential that the DNA is completely cleaved by the restriction endonuclease. See

critical parameters.

Supplement 13

Contributed by Kenneth D. BlochCurrent Protocols in Molecular Biology (1995) 3.2.1-3.2.5Copyright © 2000 by John Wiley & Sons, Inc.

3.2.1

EnzymaticManipulationof DNA and RNA

3. Using DNA fragments of known lengths for comparison (see UNIT 2.5 for the prepa-ration of size standards), calculate the lengths of all the fragments. Determine thenumber of cleavage sites for each restriction endonuclease.

A restriction endonuclease cleaving a DNA molecule N times will generate N restriction

fragments if the molecule is circular and N + 1 fragments if the molecule is linear.

4. For each sample from step 1, transfer an aliquot into separate tubes and add a differentrestriction endonuclease to each tube. In this way, the DNA in each tube will bedigested by two enzymes. One aliquot from each sample should not be cleaved witha second enzyme.

Obviously, it is wasteful and unnecessary to perform secondary digestions with enzymes

that do not cleave the DNA (as determined from step 3).

5. Using agarose gel electrophoresis, compare DNA fragments resulting from digestionwith the two restriction enzymes with the fragments resulting from digestion withthe first enzyme alone and with the second enzyme alone. Calculate the lengths ofall the restriction fragments.

6. As more restriction enzymes are used to digest the DNA and the resulting restrictionfragments are analyzed, an unambiguous, internally consistent map of restrictionendonuclease cleavage sites can be determined. See commentary and examples.

COMMENTARY

Critical Parameters

Completeness of digestion

When digestion is complete, the cleavageproducts should be present in equimolar quan-tities. If DNA is visualized by staining withethidium bromide (UNIT 2.5), band intensity isproportional to fragment length. For example,an 8-kb fragment stains twice as intensely as a4-kb fragment. Bands that appear fainter thanexpected for their molecular weight are prob-ably the result of incomplete cleavage. Bandsthat appear more intense than expected areprobably due to the presence of two (or more)DNA fragments of similar length. If DNA isend labeled at the 5′ (UNIT 3.10) or 3′ (UNIT 3.5)termini and visualized by autoradiography, allradiolabeled restriction fragments should pro-duce bands of equal intensity. If DNA is uni-formly labeled (such as by nick translation asdescribed in UNIT 3.5), band intensities are pro-portional to fragment length.

Internal consistency of the results

Sum of fragment lengths. It is obvious thatthe sum of the lengths of the restriction frag-ments should equal the total length of the DNAmolecule. In other words, for each enzyme thatis tested, the sum of all the fragments should beequal.

If, for a given digestion, the sum is lowerthan expected, check carefully for fragments ofsimilar length. Such “comigrating” fragmentscan be identified by their increased band inten-sity (two comigrating fragments should pro-duce a band that is twice as intense as expectedfrom the molecular weight) or by band “broad-ening” or “fuzziness” (due to similar but dis-tinct electrophoretic mobilities of two frag-ments). Alternatively, a low sum of fragmentlengths could be due to the existence of severalsmall fragments, which may be difficult tovisualize in the agarose gel or which may have“run off” the bottom of the gel.

If the sum is larger than expected, the mostlikely explanation is that some of the bandsarise from incomplete digestion. Another pos-sibility, less likely in general, is that the DNAbeing tested is actually a mixture of DNAs.Finally, some DNA fragments have anomalouselectrophoretic mobilities (especially in acry-lamide gels), usually because of unusual bend-ing properties dictated by specific DNA se-quences.

Number of bands. As mentioned, the num-ber of DNA fragments produced in a givenreaction is directly related to the number oftimes that the restriction enzyme cleaves the DNA.Thus, it follows that when DNA is cleaved


3.2.2

Mapping byMultiple

EndonucleaseDigestions

by two (or more) enzymes, the number of frag-ments should be the sum of the fragmentsgenerated by the individual enzymes. For ex-ample, if cleavage of a circular molecule byenzyme A generates three fragments (indicativeof three sites) and cleavage by enzyme B gen-erates five fragments (indicative of five sites),cleavage by enzymes A + B should generateeight fragments. If fewer fragments are seen, itmeans either that some fragments are comigrat-ing or that very small DNA fragments havebeen generated due to the proximity of A andB sites.

Additional comments

If the DNA to be studied is subcloned intoa plasmid or phage vector for which the restric-tion map is known, restriction mapping of theDNA insert is facilitated by digestion with aseries of restriction endonucleases that cleavethe vector at least once. In this way, restrictionsites in the DNA are mapped with respect toknown sites in the vector (see Example 3.2.2).

Utilization of nucleic acid hybridizationprobes (UNIT 3.5) and of the Southern transfertechnique (UNIT 2.9) permits restriction mappingof a small segment of DNA within a largerfragment or even within total cellular DNA.

Anticipated ResultsWhen sufficient enzyme digestions are per-

formed, it should be possible to obtain an un-ambiguous and internally consistent map.

Time ConsiderationsDepending on the resolution that is desired,

it will take 1 to 10 days to generate a restrictionmap. Additional mapping can be done at anytime.

EXAMPLES

Example 3.2.1: Restriction Mapping aPlasmid of Unknown Structure

Consider a 9-kb circular plasmid DNA,pPROTO, with an unknown restriction map.Cleavage with restriction endonuclease A orwith enzyme B generates a 9-kb linear DNAmolecule, thus indicating that each enzymerecognizes a single site in pPROTO. To deter-mine the location of enzyme A’s cleavage sitewith respect to enzyme B’s cleavage site,pPROTO is digested with both enzymes. Tworestriction fragments, 4 kb and 5 kb in size, aregenerated. Therefore, these endonucleasescleave sequences that are located 4 kb apart.

Restriction endonuclease C cleaves

A

C

C

C B

A + C: 4.5 + 2.0 + 1.5 + 1.0

B + C: 5.5 + 2.0 + 1.0 + 0.5

1

A

C

C B

A + C: 4.5 + 2.0 + 1.5 + 1.0

B + C: 5.5 + 2.0 + 1.0 + 0.5

3

A

C

C B

A + C: 4.5 + 2.0 + 1.5 + 1.0

B + C: 6.0 + 1.5 + 1.0 + 0.5

2

C

A

C

C B

A + C: 4.5 + 2.0 + 1.5 + 1.0

B + C: 6.0 + 2.0 + 0.5 + 0.5

4

C

C

Figure 3.2.1 Restriction mapping of pPROTO (see Example 3.2.1).


3.2.3


pPROTO DNA at three sites. Gel electrophore-sis reveals three fragments that are 1 kb, 2 kb,and 6 kb in length. When pPROTO is digestedwith enzymes A and C, four bands are seen, asexpected. The 6-kb fragment generated by en-zyme C alone “disappears” and is replaced bytwo more rapidly migrating fragments 1.5 and4.5 kb in size, whereas the 1-and 2-kb frag-ments produced by endonuclease C are un-changed. Thus, the A site is localized within the6-kb enzyme C fragment.

At this stage, there are four possible restric-tion maps (Fig. 3.2.1). Within the 6 kb fragmentgenerated by enzyme C, the A site could belocated in two possible positions (1.5 kb fromeither of the two possible ends), and the 1- and2-kb C fragments could be located in two pos-sible orders with respect to the 6-kb fragment.The correct map can be determined from theresults obtained upon cleavage with enzymesB + C. The predictions for each of the possiblemaps are shown in Figure 3.2.1.

To map restriction sites for endonuclease D,the same logic is followed. The process isgreatly simplified once the restriction sites forendonucleases A, B, and C have been mappedas described above. In some cases, ambiguities

in positions of D sites can be resolved byappropriate triple digests.

The general rule is to build up the restriction

map from simple situations where enzymes

cleave once or twice in the DNA to more com-

plex situations where cleavage occurs more

frequently.

Example 3.2.2: Restriction Mapping aCloned DNA Insert within a Plasmidof Known Structure

Frequently, restriction mapping is per-formed on a region of DNA within the contextof surrounding DNA for which the nucleotidesequence and/or restriction map is known. Con-sider the following approach to mappingpCDNA, which contains an insert of cDNA thathas been ligated into the plasmid pBR322 at thePstI site. pBR322, a 4363-bp E. coli plasmidvector, is cleaved once by PstI at a site that is754 bp from the unique EcoRI cleavage site(UNIT 1.5). Utilization of the known restrictionmap for pBR322 permits rapid restriction map-ping of the cDNA insert.

Cleavage of pBR322 with PstI generates asingle 4363-bp DNA fragment. Cleavage ofpCDNA with PstI generates two fragments,

EcoRI

Pst I754 bp

pBR322

4363 bp

3609 bp 4363 bp

EcoRI

Pst I

cDNA

insert 1000bp

pcDNA

5363 bp

4163 bp

300bp

pcDNA

5363 bp

900 bp

Pst I

Pst IEcoRI

EcoRI

EcoRI

Pst I

Figure 3.2.2 Restriction mapping pCDNA (see Example 3.2.2).


3.2.4

Mapping byMultiple


4363 and 1000 bp in size, demonstrating thatthe cDNA insert is 1 kb in size (Fig. 3.2.2).

Cleavage of pBR322 with EcoRI generatesa single 4363-bp DNA molecule. Cleavage ofpCDNA generates three fragments, 300, 900,and 4163 bp in size. Knowledge of the locationof the cDNA insert (cloned into the PstI site)with respect to the vector EcoRI site allows oneto conclude that the cDNA insert has two EcoRIcleavage sites that are located 146 and 446 bpfrom one end of the cDNA.

Similarly, parallel digestions of the recom-binant DNA molecule and the cloning vector,using a panel of restriction endonucleases, per-mit efficient restriction mapping of the DNA ofinterest.

Contributed by Kenneth D. BlochHarvard Medical SchoolBoston, Massachusetts

Current Protocols in Molecular Biology

3.2.5


UNIT 3.3 Mapping by Partial Endonuclease Digestions

BASIC

PROTOCOLA DNA fragment radiolabeled at one of its two ends is purified by gel electrophoresis andsubjected to partial cleavage by a restriction endonuclease. Analysis of the resultingproducts by polyacrylamide (or agarose) gel electrophoresis enables one to define thedistance of restriction sites from the labeled end.

Materials

Reagents and equipment for digesting DNA with restriction enzymes (UNIT 3.1),labeling DNA (UNIT 3.5 or 3.10), agarose or polyacrylamide gel electrophoresis(UNIT 2.5 or 2.7), and autoradiography (APPENDIX 3)

1. Cleave the DNA fragment of interest with a restriction endonuclease that can beexpected to cleave infrequently.

2. “End label” the products of digestion with 32P. 5′ termini can be labeled by successivetreatment with calf intestine phosphatase and T4 polynucleotide kinase (UNIT 3.10),and 3′ termini can be labeled with the Klenow fragment of E. coli DNA polymeraseI (UNIT 3.5) or with T4 DNA polymerase (UNIT 3.5).

Each restriction fragment is labeled at both ends.

3. Cleave fragments with a second restriction endonuclease and fractionate the productsby gel electrophoresis.

4. Purify the DNA fragments that are now radiolabeled at one end. See UNIT 2.7 and 2.6,

respectively, for methods of isolating DNA from acrylamide or agarose gels.

Only the fragments generated by cleavage with both restriction endonucleases will be

labeled at one end. Fragments from step 2 that are not cleaved by the second enzyme

will retain the label at both ends and hence be useless for the subsequent analysis.

5. Partially digest one of the isolated DNA fragments with a restriction enzyme whichcleaves relatively frequently (usually with a 4-bp recognition site).

Because some sites are cleaved more readily than others, it is useful to generate a series

of enzyme reactions in which the DNA is cleaved to various extents. This is easily

accomplished by serially diluting the enzyme, as described in UNIT 3.1.

6. Separate the products of the partial digestion by gel electrophoresis (usually polyacry-lamide) and visualize the bands by autoradiography.

7. Determine the size of the restriction fragments by comparison with radiolabeled DNAfragments of known size.

MspI-cleaved pBR322 DNA (UNIT 1.5) that has been end labeled is an excellent size standard

for fragments less than 650 bp in length.

COMMENTARY

Background InformationThis technique for partial digestion of

DNA fragments radiolabeled at one end israpid and relatively simple for fine structurerestriction mapping. Unlike restriction map-ping by multiple endonuclease cleavage (UNIT

3.2), the analysis is not complicated by thepresence of many cleavage sites for a givenenzyme. However, it can be complicated if

some sites are cleaved much better than others.If the restriction fragment to be mapped has

been generated by two restriction endonu-cleases with different cohesive termini, it maybe possible to radiolabel one end of the frag-ment by “filling in” with the appropriate [α-32P]NTP. For example, a fragment thathas been generated by EcoRI (5′ overhang,AATT) and BamHI (5′ overhang, GATC) can

Contributed by Kenneth D. BlochCurrent Protocols in Molecular Biology (1987) 3.3.1-3.3.2Copyright © 2000 by John Wiley & Sons, Inc.

3.3.1

Mapping byPartial


be radiolabeled, exclusively, at the BamHI siteby using [α-32P]GTP in the reaction.

Critical ParametersHigh salt concentrations can alter the elec-

trophoretic mobility of DNA fragments (espe-cially small fragments). When performing finestructure restriction mapping, it may be neces-sary to “desalt” the sample by ethanol precipi-tation and by washing with 70% ethanol.

The major artifact associated with thismethod is that recognition sites for a givenrestriction endonuclease are not always cleavedwith equal efficiency. This problem becomesmore severe with increased distance of the“inefficient” site to the labeled site becausecleavage at more “efficient” sites becomesmore likely to eliminate the diagnostic frag-ment. Thus, restriction maps generated by thismethod are occasionally “missing” a site. Astandard restriction digest using unlabeledDNA is very useful for confirming the positionsof cleavage.

It is relatively difficult to map cleavage sitesthat are located close to either of the two ends.Sites near the unlabeled end will be very similarin size to the undigested fragment, whereassites near the labeled end will be extremelysmall. These problems can be resolved bychoosing different fragments and/or by usingappropriate gels to visualize small DNA frag-ments.

Anticipated ResultsBy varying the amount of enzyme to pro-

duce different degrees of partial digestion, aseries of bands should be generated. Each bandrepresents the location of a restriction site withrespect to the labeled site.

Time ConsiderationsPreparation of the labeled DNA fragment

should take about 1 to 2 days, and the remainderof the procedure (partial cleavage, gel electro-phoresis, and autoradiography) should take anadditional 1 to 5 days. The locations of restric-

tion sites for 5 to 20 different enzymes caneasily be determined from the same preparationof the labeled DNA fragment.

EXAMPLES

Example 3.3.1: Mapping RestrictionSites by Partial Cleavage ofEnd-Labeled DNA.

Plasmid pPROTO (see sketch below) is di-gested with enzyme A, and the ends of thelinearized molecule are radiolabeled. The DNAis then digested with enzyme B, and the 5-kbfragment is isolated.

The uniquely end-labeled fragment is par-tially digested with enzyme D, and the productsare fractionated by agarose gel electrophoresis.A “ladder” of radiolabeled DNA fragments,2.7, 4.0, and 5.0 kb in size, is evident by autora-diography. This demonstrates conclusively thatenzyme D cleaves pPROTO DNA at sites thatare 2.7 and 4 kb from enzyme A’s cleavage siteas shown below.

A D D B

↓ Å ↓ ↓32P

2.7 kb 1.3 kb 1.0 kb

This result can be confirmed by reversingthe order of restriction enzyme cleavage. Whenthe 32P label is at the B cleavage site, partialdigestion should produce bands of 1.0, 2.3, and5.0 kb.

Key ReferencesBoseley, P.G., Moss, T., and Birnstiel, M.L. 1980.

5′ labeling and poly(dA) tailing. Meth. Enzymol.

65:478-494.

Danna, A.J. 1980. Determination of fragment orderthrough partial digests and multiple enzyme di-gests. Meth. Enzymol. 65:449-467.

Contributed by Kenneth D. BlochHarvard Medical SchoolBoston, Massachusetts


3.3.2


Documents

Digestion of DNA with Restriction - RSI · In principle, 1 U restriction endonuclease completely digests 1 •g of purified DNA in 60 min using the recommended assay conditions. However,