Thiolase Genes of C. acetobutylicum 531

Differential Regulation of Two Thiolase Genes fromClostridium acetobutylicum DSM 792

Revised May 1, 2000; accepted May 1, 2000. *For correspondence. Emailpeter.duerre@biologie.uni-ulm.de; Tel. +49-731-50-22710; Fax. +49-731-50-22719.

J. Mol. Microbiol. Biotechnol. (2000) 2(4): 531-541.

© 2000 Horizon Scientific Press

JMMB Research Article

Klaus Winzer1, Karin Lorenz2, Brigitte Zickner,and Peter Dürre*

Mikrobiologie und Biotechnologie, Universität Ulm, D-89069 Ulm, Germany1present address: School of Pharmaceutical Sciences,University Park, University of Nottingham, NottinghamNG7 2RD, UK2present address: Centeon Pharma GmbH, Postfach1230, D-35002 Marburg, Germany

Abstract

Thiolase of Clostridium acetobutylicum is an importantenzyme involved in both, acid and solventfermentation. Two thiolase genes (thlA and thlB) havebeen cloned and sequenced from Clostridiumacetobutylicum DSM 792, showing high homology toeach other and to thiolases of PHA-synthesizingbacteria. The thlA gene is identical to the gene alreadycloned and sequenced from strain ATCC 824 (Stim-Herndon et al., 1995, Gene 154: 81-85). Using primerextension and S1 nuclease analysis a transcriptionalstart site was identified 102 bp upstream of the thlAstart codon. This site was preceded by a region thatexhibits high similarity to the σ70 consensus promotersequences of Gram-positive and -negative bacteria.Regulation of thlA and thlB was studied at thetranscriptional level to elucidate the specific functionof each gene. Non-radioactive primer extensionanalysis using fluorescein-labelled oligonucleotidesand Northern blot analysis revealed high levels of thlAtranscripts in acid- and solvent-producing cells. Duringan induced shift of a continuous culture from acid tosolvent formation, the transcript level transientlydecreased to a minimum, 3 to 7 h after induction. ThethlA transcript length is about 1.4 kb, indicating amonocistronic organisation, whereas geneticorganization and reverse transcription (RT)-PCRanalysis indicated that thlB forms an operon with twoother adjacent genes, thlR and thlC’. Transcription andregulation of the thlB operon was studied using RT-PCR and showed a very low expression in acid- andsolvent-producing cells. Heterologously expressedclostridial ThlB showed high thiolase activity inEscherichia coli. The N-terminal part of ThlRpossesses a potential helix-turn-helix motif and showssignificant homology to regulatory proteins belongingto the TetR/AcrR family of transcriptional regulators.ThlR possibly acts as a transcriptional repressor ofthlB operon expression. The data provide strong

evidence that ThlA is involved in the metabolism ofboth acid and solvent formation, whereas thephysiological function of ThlB has yet to be elucidated.

Introduction

Clostridium acetobutylicum, a Gram-positive, obligateanaerobe, spore-forming bacterium has been used for theindustrial production of acetone and butanol for a long time.During growth in batch culture the organism typically showsa biphasic fermentation pattern: after producingconsiderable amounts of acetate and butyrate from sugarsin the exponential growth, the organism switches to theproduction of mainly acetone and butanol shortly beforeentering the stationary phase (for reviews, see Jones andWoods, 1986; 1989; Dürre and Bahl, 1996). Thiolase(acetyl-coenzyme A [CoA] acetyltransferase, EC 2.3.1.19)from C. acetobutylicum is involved in both the metabolismof acids and solvents, as it catalyzes the condensation oftwo molecules of acetyl-CoA to one molecule ofacetoacetyl-CoA. During acidogenesis the enzyme controlsthe ratio of acetate and butyrate formation and, thus, theregulation of thiolase activity effects the energy level ofthe cells in this metabolic state. In solvent-producing cells,acetoacetyl-CoA is converted to acetoacetate in a CoAtransferase reaction, leading to the reactivation ofpreviously produced acids. As the level of acetoacetyl-CoAin the cells is low (Boynton et al., 1994), the rate of acidreutilization depends on the rate of acetoacetyl-CoAformation. Important regulatory factors in thiolase activityare thought to be the intracellular concentrations of CoAand acetyl-CoA (Wiesenborn et al., 1988) and regulationmight occur mainly at the enzymatic level. It has beenshown, however, that activity is maximal in batch culturesafter growth ceases (Hartmanis and Gatenbeck, 1984),suggesting additional regulation at the genetic level.

Two thiolases have been described in C. pasteurianum(Berndt and Schlegel, 1975), Escherichia coli (Jenkins andNunn, 1987; Yang et al., 1990), and three enzymes havebeen identified in Ralstonia eutropha (Haywood et al., 1988;Peoples and Sinskey, 1989; Slater et al., 1998; formerlydesignated Alcaligenes eutrophus). Two thiolase geneshave been partially cloned and sequenced from a strain ofthe acid- and solvent-producing C. beijerinckii (formerly C.acetobutylicum strain NCIMB 8052) (sequence informationgratefully received from N. P. Minton, CAMR, Porton Down,UK). In addition, genome-sequencing projects haverevealed that Bacillus subtilis, E. coli, Mycobacteriumtuberculosis and other bacteria contain three or morethiolase gene homologues. However, it has been suggestedthat only one thiolase exists in C. acetobutylicum(Wiesenborn et al., 1988; Petersen and Bennett, 1991). Inthis paper, we present the molecular analysis of two distinctthiolase genes from C. acetobutylicum and their regulationduring the metabolic shift from acid to solvent production.

• MALDI-TOF Mass Spectrometry in Microbiology

Edited by: M Kostrzewa, S Schubert (2016) www.caister.com/malditof

• Aspergillus and Penicillium in the Post-genomic Era

Edited by: RP Vries, IB Gelber, MR Andersen (2016) www.caister.com/aspergillus2

• The Bacteriocins: Current Knowledge and Future Prospects

Edited by: RL Dorit, SM Roy, MA Riley (2016) www.caister.com/bacteriocins

• Omics in Plant Disease Resistance

Edited by: V Bhadauria (2016) www.caister.com/opdr

• Acidophiles: Life in Extremely Acidic Environments

Edited by: R Quatrini, DB Johnson (2016) www.caister.com/acidophiles

• Climate Change and Microbial Ecology: Current Research and Future Trends

Edited by: J Marxsen (2016) www.caister.com/climate

• Biofilms in Bioremediation: Current Research and Emerging Technologies

Edited by: G Lear (2016) www.caister.com/biorem

• Microalgae: Current Research and Applications

Edited by: MN Tsaloglou (2016) www.caister.com/microalgae

• Gas Plasma Sterilization in Microbiology: Theory, Applications, Pitfalls and New Perspectives

Edited by: H Shintani, A Sakudo (2016) www.caister.com/gasplasma

• Virus Evolution: Current Research and Future Directions

Edited by: SC Weaver, M Denison, M Roossinck, et al. (2016) www.caister.com/virusevol

• Arboviruses: Molecular Biology, Evolution and Control

Edited by: N Vasilakis, DJ Gubler (2016) www.caister.com/arbo

• Shigella: Molecular and Cellular Biology

Edited by: WD Picking, WL Picking (2016) www.caister.com/shigella

• Aquatic Biofilms: Ecology, Water Quality and Wastewater Treatment

Edited by: AM Romaní, H Guasch, MD Balaguer (2016) www.caister.com/aquaticbiofilms

• Alphaviruses: Current Biology

Edited by: S Mahalingam, L Herrero, B Herring (2016) www.caister.com/alpha

• Thermophilic Microorganisms

Edited by: F Li (2015) www.caister.com/thermophile

• Flow Cytometry in Microbiology: Technology and Applications

Edited by: MG Wilkinson (2015) www.caister.com/flow

• Probiotics and Prebiotics: Current Research and Future Trends

Edited by: K Venema, AP Carmo (2015) www.caister.com/probiotics

• Epigenetics: Current Research and Emerging Trends

Edited by: BP Chadwick (2015) www.caister.com/epigenetics2015

• Corynebacterium glutamicum: From Systems Biology to Biotechnological Applications

Edited by: A Burkovski (2015) www.caister.com/cory2

• Advanced Vaccine Research Methods for the Decade of Vaccines

Edited by: F Bagnoli, R Rappuoli (2015) www.caister.com/vaccines

• Antifungals: From Genomics to Resistance and the Development of Novel Agents

Edited by: AT Coste, P Vandeputte (2015) www.caister.com/antifungals

• Bacteria-Plant Interactions: Advanced Research and Future Trends

Edited by: J Murillo, BA Vinatzer, RW Jackson, et al. (2015) www.caister.com/bacteria-plant

• Aeromonas

Edited by: J Graf (2015) www.caister.com/aeromonas

• Antibiotics: Current Innovations and Future Trends

Edited by: S Sánchez, AL Demain (2015) www.caister.com/antibiotics

• Leishmania: Current Biology and Control

Edited by: S Adak, R Datta (2015) www.caister.com/leish2

• Acanthamoeba: Biology and Pathogenesis (2nd edition)

Author: NA Khan (2015) www.caister.com/acanthamoeba2

• Microarrays: Current Technology, Innovations and Applications

Edited by: Z He (2014) www.caister.com/microarrays2

• Metagenomics of the Microbial Nitrogen Cycle: Theory, Methods and Applications

Edited by: D Marco (2014) www.caister.com/n2

Caister Academic Press is a leading academic publisher of advanced texts in microbiology, molecular biology and medical research. Full details of all our publications at caister.com

Further Reading

Order from caister.com/order

532 Winzer et al.

Results

Identification, Cloning, and Sequencing of TwoThiolase GenesHeterologous thiolase gene probes from C. beijerinckiiNCIMB 8052 were generated in PCR reactions usingNCIMB 8052 chromosomal DNA and the primer pairs T2A/T2B and T1A/T1B for the thiolase A and the thiolase Bprobe, respectively (sequence information gratefullyreceived from N. P. Minton). In Southern hybridizationexperiments, with HindIII-digested total DNA from differentC. acetobutylicum strains and C. beijerinckii NCIMB 8052,both radiolabelled probes produced identical signalpatterns. The intensity of individual signals did vary,however, depending on the probe used. For strains ATTC824, DSM 792, and DSM 1731 two strong signals at 2.6and 2.0 kbp were observed, whereas very weak signalsfor the strain P262 and just one signal for C. beijerinckiiNCIMB 8052 could be detected, which is in accordancewith the observed strain differences already described(Wilkinson and Young, 1993; Wilkinson et al., 1995; Keis

et al., 1995; Johnson et al., 1997). For the DSM and ATCCstrains the 2.0 kbp signal was dominant with the thiolase Aprobe, whereas the 2.6 kbp signal was strongest with thethiolase B probe, indicating the existence of two differentthiolase genes in these strains. An SspI digest revealedtwo bands for NCIMB 8052 with both probes, whereas inP262 two signals could only be observed with the thlA geneprobe (Figure 1).

Genomic libraries of C. acetobutylicum DSM 792containing HindIII- (Sauer et al., 1994) and partially Sau3AI-digested (Gerischer and Dürre, 1990; Fischer et al., 1993)DNA fragments were screened by hybridization using thesame probes, and several positive clones were detected.Again, the clones identified with both probes were identical.The thiolase A probe gave strongest signals with threeclones containing Sau3AI fragments in vectors pEcoR252(designated pKS5 and pKS10) and in pUC9 (designatedpH12), whereas the strongest signals were obtained withthe thiolase B probe for four clones containing HindIII(designated pKH2, pKH13, and pKH16) and Sau3AIfragments (designated pUG1) in pUC9.

Restriction enzyme mapping of pKS5, pKS10, andpH12 revealed insert lengths of app. 7.8 kbp, 7.4 kbp, and7.2 kbp, respectively. Both ends of the inserts weresequenced and shown to possess identical nucleotidesequences at one end (sequence data not shown), butstarted at different sites within an open reading frame atthe other end. This open reading frame was identical to athiolase gene already cloned and sequenced from the strainATTC 824 (Petersen and Bennett, 1991; Stim-Herndon etal., 1995) and was therefore designated as thlA gene(Figure 2). As revealed by sequence comparison, the thlAgene encoded by pKS5 was not complete, and lacked 43bp at the 5' end. Using HindIII-digested and religated DNAfrom C. acetobutylicum DSM 792 as a circular template,inverse PCR was performed with oligonucleotides 2U1 and2U2 as primers. A 2.0 kbp DNA fragment was obtainedand cloned into pUC18 after digestion with HindIII and XbaI.The cloned fragment contained the thlA 5' end and anincomplete open reading frame (Figure 2), which exhibitedsignificant similarity to the NfrC protein of E. coli (53 %identity, [SwissProt P27828]), OrfX of B. subtilis (53 %identity, [SwissProt P39131]), Cap5p and Cap8p ofStaphylococcus aureus (51 %, [GenBank U81973 andU73374]), EspC of Burkholderia solanacearum (50 %identity, [SwissProt P52641]), and RfbC of Salmonellaborreze (48 % identity, [SwissProt P52642]) at the aminoacid level. This open reading frame was designated asnfrC’ (in this context ‘ indicates truncated genes or openreading frames). The complete sequence of the thlA generegion is available under accession no. AF072734 in theGenBank data base.

6 bp upstream of the AUG start codon of thlA, a putativeribosome-binding site (5'-AGGAGG-3') was identified. Astem-loop structure and a stretch of U’s resembling aprokaryotic rho-independent transcription terminator (Platt,1986), with a free energy of -81 kJ/mol (calculated withthe Fold computer program of the GCG Package accordingto the determination of Freier et al. [1986]), was locatedimmediately downstream of the thlA gene.

Plasmids pKH2, pKH13, and pKH16 containedidentical DNA fragments of 2.7 kbp as revealed byrestriction enzyme mapping and sequence analysis, whichcontained two truncated and two complete open reading

Figure 1. Southern blot analysis of total DNA from various C. acetobutylicumstrains. Upper panel: HindIII-digested DNA was hybridized to radioactively-labelled thlA and thlB gene probes. Lower panel: SspI-digested DNA washybridized to ECL-labelled thlA and thlB gene probes. Arrows indicate sizesof specific fragments. Each lane contained 10 µg of DNA digested with theindicated restriction endonucleases. In case of strain NCIMB 8052 twodifferent DNA preparations have been used.

Thiolase Genes of C. acetobutylicum 533

frames (Figs. 2 and 3). One of the open reading frameswas shown to possess a high similarity to other thiolasegenes, but clearly differed from the thlA gene of C.acetobutylicum, and was therefore designated thlB. Thededuced amino acid sequences of thlA and thlB from C.acetobutylicum DSM 792 exhibited 76% identity and 86%similarity to each other, and showed highest similarities toother bacterial thiolases, most of which are known to beinvolved in biosynthesis, rather than degradation, ofacetoacetyl-CoA (70% identity of ThlA (64% of ThlB) atthe amino acid level to ThlA of Thermoanaerobacteriumthermosaccharolyticum [EMBL Z82038], 64% (61%)identity to PhbA of Pseudomonas sp. 61-3 [DDBJAB014757], 63% (63%) identity to AtoB of Haemophilusinfluenzae [SwissProt P44873], 63% (61%) identity to PhbAof R. eutropha [GenBank J044987], 62% (59%) identity toPhaA of Paracoccus denitrificans [SwissProt P54810], 62%(61%) identity to AtoB of E. coli [SwissProt P76461], 60%(59%) identity to PhbA of Allochromatium vinosum[SwissProt P45369]). Two other open reading frames werelocated directly upstream and downstream of thlB in thesame orientation, and were designated thlR and thlC’,respectively. The N-terminal region of ThlR showedsignificant similarity to proteins belonging to the TetR/AcrRfamily of transcriptional regulators. A typical helix-turn-helix-motif according to the convention of Pabo and Sauer (1984)

is represented by the amino acid sequence INDILSGT(helix) GLP (turn) KGSFYFHFA (helix). The deduced aminoacid sequence of the truncated thlC’ showed no homologyto other sequences available in EMBL and GeneBank databases, but was highly similar to a protein encoded by agene downstream of the thiolase B gene from C. beijerinckii(sequence information gratefully received from N. P.Minton). A divergently transcribed open reading frame ofunknown function, orfX’, was located upstream of thlR. Theinsert of pUG1 did not represent the original arrangementof Sau3AI fragments, as revealed by comparison of PCRfragments amplified from plasmid and chromosomal DNA(data not shown). Therefore, this plasmid contained onlythe part of the thlB gene region which is indicated in Figure2. The complete sequence of the thlB gene region isavailable under accession no. AF072735 in the GenBankdata base.

Putative ribosome-binding sites (5'-AGGAGG-3', 5'-AGGGAG-3', and 5'-AGGAGG-3') were located 8 bpupstream of thlB, 8 bp upstream of thlR, and 6 bp upstreamof thlC’, respectively. However, no such site was found infront of orfX’ (Figure 3).

Determination of Transcription Start PointsThe transcription start point of the thlA gene wasdetermined by primer extension (oligonucleotides 2U5 and

Figure 2. Schematic maps of the DNA regions from C. acetobutylicum DSM 792 containing the thlA gene (A) and the thlB operon (B). A: The insert of pIP11is shown, as well as the partly overlapping inserts of pKS5, pKS10, and pH12. B: The inserts of pKH2, pKH13, pKH16, and the analyzed part of pUG1 (whichhas been shown to contain chromosomal DNA in its native arrangement) is shown. Arrows represent length, location, and orientation of ORFs. The thlA geneand the ORFs which belong to the thlB operon are shaded darkly. A ‘ at the end of an ORF indicates that this ORF is truncated. Putative promoter sequencesare indicated by P and possible stem-loop structures by hairpin symbols. Oligonucleotides (5B2, 3B4, 3B5, IRA, IRB, and 1R6) used for RT-PCR are markedby thick solid bars and the resulting PCR fragments are indicated by lines.

534 Winzer et al.

Figure 3. Nucleotide sequence of the inserts of pKH2, pKH13, pKH16, and the analyzed part of pUG1 representing the DNA region from C. acetobutylicumDSM 792 that contains the thlB operon. The non-coding strand is shown. The thlR, thlB, thlC’, and orfX genes have been translated using the one letter aminoacid code and amino acid symbols are written below the first nucleotide of the corresponding codon. Putative ribosome binding sites are underlined; potentialpromoter regions are marked by thick solid bars below the -10 and -35 regions joined by a line; putative secondary structures are marked by arrows abovethe sequence indicating the length and orientation of the palindromic sequence, disregarding short mismatches.

Thiolase Genes of C. acetobutylicum 535

PrA) and S1 nuclease analysis (oligonucleotide 2U5). Twosignals in positions bp -102 and bp -29, relative to the thlAstart codon were obtained by primer extension experimentsusing the oligonucleotide 2U5. However, only onetranscription start point (position -102) was confirmed byS1 nuclease analysis (Figure 4). The additional signal inposition -29 might be due to nonspecific hybridization of2U5, caused by less stringent hybridization conditions inprimer extension analysis, since it could not be verifiedusing the oligonucleotide PrA (data not shown). Theidentified transcription start point deviated from the startpoint published by Stim-Herndon et al. (1995) by 3 bp(position -105).

Primer extension analysis (oligonucleotides 1U6, 1U7,1U8, 1U9, 1U10), and S1 nuclease analysis(oligonucleotides 1U6 and 1U7) were performed todetermine the thlB and thlR gene transcription start points,but no signals were detected. Since evidence fortranscription of the thlB gene was obtained by RT-PCR(see below), the failure of start point determinations mightbe attributed to a very low thlB transcript level in the mRNApreparations from both, acid- and solvent-producing cells.

mRNA Analysis of the thlA and thlB GenesTo obtain mRNA from cells during the transition from acidto solvent production, samples of cell suspension from acontinuous culture of C. acetobutylicum DSM 1731 weretaken at various time points before and after induction ofsolventogenesis. DSM 1731 was chosen because of itsvery reproducible behaviour in continuous cultureexperiments. Both strains, DSM 792 and 1731, have beenshown to be virtually identical based on availabletranscription signals, gene sequences, biotyping, DNAfingerprint analysis, and DNA-DNA hybridization (Gerischerand Dürre, 1992; Keis et al., 1995; Johnson et al., 1997).pH and product formation were monitored throughout theshift and showed the typical pattern described by Bahl etal. (1982): the pH drop was accompanied by an immediateand drastic decrease in acetate and butyrateconcentrations, and then after several hours acetone andbutanol were produced. Total RNA was isolated from thecell samples and used for the preparation of Northern blots.Hybridizations, with both radiolabelled thlA (BglII/HindIII-fragment of plasmid pKS5; bp position 1101-2011 in Figure2) and thlB probes (HaeIII/HindIII-fragment of plasmidpKH2; bp position 1598-2664 in Figure 2), revealed verysimilar signal patterns (Figure 5). A dominant signalcorresponding to a transcript of 1.4 kb was detected inmRNA preparations of acid- and solvent-producing cells.This size is in accordance with a monocistronic organizationof thlA. The intensity of this signal decreased to a minimumshortly after induction of solventogenesis (3-7h), butincreased again concurrently with the establishment ofsolvent production. In mRNA preparations from solvent-producing cells another strong signal of 0.9 kb was obtainedwith both probes. Additional, but less intensive signals of1.7 and 2.7 kb were also present, particularly with thethiolase B probe (Figure 5), but were also visible with thethiolase A probe after extended exposure of theautoradiogram (not shown). Thus, it was impossible toassign specific signals to the two probes by Northernexperiments due to their high sequence homology.

Figure 4. Mapping of the 5' end of thlA transcripts by S1 nuclease analysis(A) and primer extension analysis (B). (A): 35S-radiolabelled DNA wassynthesized using the oligonucleotide 2U5 and hybridized to 10 µg of totalRNA isolated from cells of acid-producing C. acetobutylicum DSM 1731.After S1 nuclease digestion, 50% (lane 1), 100% (lane 2), and 5% (lane 4)of the radiolabelled DNA were electrophoresed. A control reaction containingradiolabelled DNA, but no RNA is shown in lane 3. (B): The 32P-radiolabelledoligonucleotide 2U5 complementary to the mRNA of the thlA gene washybridized to 10 µg of total RNA isolated from cells of acid-producing C.acetobutylicum DSM 1731. 10% of the resulting cDNA was electrophoresedon the gel presented (lanes 1 and 2). The sequencing ladders were obtainedby using the same oligonucleotide in sequencing reactions. Arrows indicateobserved major signals.

Figure 5. Northern hybridizations using radiolabelled restriction fragmentscomplementary to the thlA gene (upper panel) and thlB gene (lower panel).Each lane contained 10 µg total RNA from C. acetobutylicum DSM 1731,isolated from cells of a continuous culture, taken at various time pointsbefore (0 h = acid-producing cells) and after turning off the pH control.Fragment sizes, as judged by comparison with size markers, are indicatedto the right.

536 Winzer et al.

To differentiate between thlA and thlB transcripts, non-radioactive primer extension analysis was performed, usingfluorescein-labelled oligonucleotide PrA, which resulted inthe formation of thlA-specific cDNA. As the amount of cDNAwas proportional to the concentration of thlA transcripts inthe various mRNA preparations, and the intensity offluorescence depends on the amount of fluorescein,quantification was possible using an A.L.F. sequencer(Porcher et al., 1992). To verify the typical course of theshift experiment at the transcriptional level, thesolventogenesis-associated adc and adhE transcripts were

also analyzed, using the oligonucleotides PrADC andPrADHE. adc and adhE transcript levels both increasedafter the induction of solvent formation (Figure 6). The thlAtranscript level at different time points during the shiftcorresponded well to the pattern of signal intensityobserved at 1.4 kb in the Northern experiments. As thededuced transcript length of thlA is about 1.35 kb, it can beconcluded that this signal indeed represents the thlAtranscript and that thlA is monocistronically organized.

For identification of thlB transcripts and regulatorystudies, RT-PCR was performed using the oligonucleotide

Figure 7. Determination of the thlB mRNA start point (A) and thlB (B)transcript levels during the shift of a continuous culture of C. acetobutylicumDSM 1731 from acid to solvent production by RT-PCR. (A): Theoligonucleotide cThioB2 was used to synthesize cDNA from mRNA of acid-producing cells. Amplification was performed using the oligonucleotide 5B2in combination with oligonucleotides 3B4 (3, 4), 3B5 (5, 6), IRA (7, 8), IRB(9, 10), and 1R6 (11, 12). cDNA (lanes 2, 3, 5, 7, 9, 11) or plasmid pKH2(lanes 4, 6, 8, 10, 12) served as template to compare the fragment sizes.pBR322 digested with AluII (1) and λ DNA digested with PstII (13) wereused as size markers. Absence of contaminating chromosomal DNA wastested with oligonucleotides 3B4 and 5B2 for amplification with no reversetranscriptase being added during the step of cDNA synthesis (2). (B) RT-PCR was performed using the oligonucleotide cThioB2 for synthesis ofcDNA, and oligonucleotides 3B4 and (the fluorescein-labelled) 5B2 foramplification in 18 PCR cycles. RNA samples were taken at different timepoints during the shift (compare Figure 6).

Figure 6. Time course of pH (A), product formation (B), and transcript level(C) during the shift of a continuous culture of C. acetobutylicum DSM 1731from acid to solvent production. (A): The pH-control was turned off at t = 0h (arrow), the pH (=) decreased to 4.3, at which point (at t = 14 h) pH-control was restored. (B): Product pattern in the supernatant of the culture.◊, acetate; ♦, acetone; ■, butanol; ❑, butyrate; O, ethanol. (C): Relativetranscript levels of thlA (■), adc (=), and adhE(❑), determined using thefluorescein-labelled oligonucleotides PrA, PrADC, and PrADHE. The relativetranscript levels do not represent the ratio of the different mRNA species inthe cell (the relative amount of transcripts was determined using differentamounts of internal standards for each mRNA species, and identicalamounts of individual cDNAs of different length give different peak areaswhen fluorescence is measured).

Thiolase Genes of C. acetobutylicum 537

cThioB2 to synthesize the cDNA and various primer pairswere used (3B4/5B2, 3B5/5B2, IRA/5B2, IRB/5B2, and1R6/5B2) for subsequent amplification. To ensure that theresulting PCR products were amplified from cDNA insteadof contaminating chromosomal DNA, control experimentswere performed in which reverse transcriptase was omitted.In the controls no PCR fragments were detected.Amplification of cDNA was possible with the primer pairIRB/5B2, but no PCR products were observed with primers1R6/5B2 (Figure 7), suggesting a 3' end of the cDNAbetween positions 850 bp and 1050 bp within the putativethlR gene (Figure 2). Northern hybridization experimentswere performed to identify thlR transcripts and to determineif thlR and thlB formed a single transcriptional unit andwere responsible for the 1.7 kb and 2.7 kb signals observedwith the thiolase B probe. A radiolabelled PCR fragment,synthesized using primers 1U7 and IRB, was used asprobe, but no signals were detected. Regulation of the thlBgene was, therefore, studied using RT-PCR. cDNA wasamplified in 18 to 20 cycles with the 3B4 and 5B2 primers,resulting in fluorescein-labelled PCR fragments. Figure 7shows the relative amount of PCR products detected onan A.L.F. sequencer. Quantification, achieved by integratingthe peak areas, showed that transcription of thlB wasmaximal at about 10 to 15 h after induction of solventformation. However, the level of thlB transcripts was verylow, compared to the level of thlA transcripts, as PCRamplification of thlB-specific cDNA was required fordetection.

Enzymatic Activity of the thlB Gene ProductIn order to obtain conclusive results for the function of thethlB gene product, this gene was subcloned in several E.coli expression plasmids. A 1302-bp TaqI-HindIII fragment(nt positions 1359-2660 in Figure 3) was cut and isolatedfrom pKH2 and subsequently ligated into AccI/HindIII-digested pUC18 and pUC19, yielding plasmids pUC18-thlB and pUC19-thlB. From the former, an app. 1.3-kbpXbaI-HindIII thlB fragment was cut, isolated, and ligated

into XbaI/HindIII-digested pET21, yielding plasmid pET21-thlB. Recombinant E. coli strains carrying the three newlyconstructed plasmids and a pET21 control were checkedfor expression of the ThlB protein by SDS polyacrylamidegel electrophoresis (PAGE) with and without induction byisopropyl-β-D-thiogalactoside (IPTG). The plasmidscarrying the thlB insert showed in all cases an additionalprotein band at the expected size of app. 42 kDa, whichwas missing in the pET21 control (Figure 8). High specificactivities of more than 4 U/mg protein could be detected instrains carrying pUC18-thlB and pET21-thlB, whereas therespective plasmids without inserts yielded values of only0-0.05 U/mg protein (Table 1). pUC19-thlB with reverseinsertion of the fragment with respect to the lac promotershowed a low activity (0.4 U/mg). The low expression fromthis plasmid and the two other recombinant vectors withoutIPTG induction is most probably due to the AT-rich regionupstream of the thlB gene. This will mimic a -10 region of atypical E. coli promoter. Although a -35 region is definitelymissing, such a promoter half site might initiate the weaktranscription observed. In summary, the subcloning of thlBand enzyme assays of ThlB provide conclusive evidencefor its function as a thiolase.

Discussion

Two thiolase genes have been identified in C.acetobutylicum DSM 792, thlA and thlB, which are verysimilar to each other and show high homology to otherbiosynthetic bacterial thiolases. Two or more differentthiolases have also been identified in other bacteria (Berndtand Schlegel, 1975; Jenkins and Nunn, 1987; Haywood etal., 1988; Peoples and Sinskey, 1989; Yang et al., 1990;Slater et al., 1998), but it has been assumed that only oneis present in C. acetobutylicum (Wiesenborn et al., 1988;Petersen and Bennett, 1991). Previous Southernhybridization results (Petersen and Bennett, 1991),performed under rather stringent conditions, revealed noevidence of additional thiolase genes and Western blotanalysis of whole-cell extracts revealed only one band witha thiolase-specific antibody (Petersen and Bennett, 1991).In addition, no indications of a second thiolase were foundduring purification of the enzyme by Wiesenborn et al.(1988). In this work the existence of two thiolase geneshas been demonstrated using heterologous thiolase probesfrom C. beijerinckii in Southern blot hybridizations andsubsequent cloning and sequencing of the respectivegenes. Since ThlA and ThlB are very similar in molecularsize and amino acid sequence, both enzymes might havebeen indistinguishable in SDS gel electrophoresis and inWestern blot analysis, leading to the assumption that onlyone enzyme is present in this organism.

Table 1. Thiolase Activity of Recombinant E. coli Strains Carrying PlasmidsWith and Without thlB Insert

Plasmid Enzymatic activity [U/mg]

pUC18 0.04pUC18-thlB 4.73pUC19 0pUC19-thlB 0.39pET21 0.05pET21-thlB 4.44

Figure 8. SDS Polyacrylamide gel electrophoresis analysis of recombinantE. coli strains carrying plasmids with and without thlB insert. Lane 1,molecular mass standard; lane 2, pET21 control; lane 3, pET21-thlB withIPTG induction; lane 4, pET21-thlB without IPTG induction; lane 5, pUC18-thlB with IPTG induction; lane 6, pUC19-thlB with IPTG induction; lane 7,pUC18 with IPTG induction. Molecular masses in kDa are indicated to theleft. Bands representing ThlB are indicated by an arrow.

538 Winzer et al.

The thlA gene of C. acetobutylicum DSM 792 isidentical to the thiolase gene already cloned and sequencedfrom the strain ATCC 824 and codes for the enzyme purifiedby Wiesenborn et al. (1988), as deduced from the N-terminal amino acid sequence (Wiesenborn et al., 1988;Petersen and Bennett, 1991). An incomplete open readingframe, designated as nfrC’, was identified upstream of thlA,which is in agreement with the results described by Stim-Herndon et al. (1995) for C. acetobutylicum ATCC 824.NfrC’ from C. acetobutylicum shows high similarity to NfrCfrom E. coli (Kiino et al., 1993) and OrfX (Soldo et al., 1993)from B. subtilis as well as other proteins which have beenpostulated to act as UDP-N-acetyl-glucosamine-2-epimerase. Therefore, a similar function might be expectedfor NfrC from C. acetobutylicum.

The thlA mRNA start point suggested a putativepromoter region, TTGATA (N)17 TATAAT, with high similarityto the σ70 consensus sequence of Gram-negative and -positive bacteria. Attempts to determine the start point forthlB failed, possibly due to very low transcript levels. PCRamplifications, using several primer combinations, providedevidence that one cDNA end is located at least severalhundred base pairs upstream of thlB in the thlR gene.However, the length of the cDNA does not necessarilyrepresent the full length of the mRNA. Prematuretermination of reverse transcription can be caused byseveral factors, including even short RNA stem loopstructures (Boorstein and Craig, 1989). For that reason itcan be postulated that the mRNA start point is locatedupstream of thlR, where a putative σ70 promoter region(TTGACA (N)19 TATAAT) was identified on the basis of DNAsequence analysis (Figure 3). Putative promoter regionsupstream of thlB and thlC’ could not be deduced from thenucleotide sequence, whereas ribosome-binding sites werefound upstream of thlR, thlB, and thlC’, suggesting apolycistronic operon organization of these genes.Nevertheless, the existence of an additional promoterregion directly upstream of thlB could not be ruled out bythe RT-PCR approach used in this study, since only thelength of the longest cDNA product could be estimated.

For investigation of the expression pattern andphysiological function of ThlA and ThlB, mRNA was isolatedfrom cells from a continuous culture taken at various timepoints during the shift from acid to solvent production. FromNorthern blot analyses almost identical signal patterns wereseen with thlA- and thlB-specific probes, probably due tothe high sequence similarity of both genes and theabundance of transcripts. Additional primer extensionexperiments showed that the dominant 1.4 kb signal wasspecific for thlA transcripts, which is in good agreementwith the hypothetical transcript length deduced from themRNA start point determination and the putativetranscription termination structure. In solvent-producingcells another strong signal of 0.9 kb was observed, possiblyrepresenting a degradation product of the thlA transcript.Additional weak signals of 1.7 kb and 2.7 kb were, however,preferably detected with the thlB-specific probe. Sincethese signals could not be reproduced with thlR-specificprobes, it is likely that they are nonspecific and, thus, mightnot represent transcripts of the proposed thlB operon.

Quantification of fluorescein-labelled PCR products onan automatic DNA sequencer has been describedpreviously for the determination of mRNA copy number(Porcher et al., 1992). With this method the range over

which the recorded signal is proportional to the amount oflabelled product is far greater than the scanning ofautoradiograms. It is also less problematic than countingthe radioactivity of gel or blot fragments. Since the level ofthlA transcripts was high during acid- and solvent-production, fluorescence of thlA-specific cDNA could bedetected directly, whereas thlB-specific cDNA had to beamplified. The transient, but marked decrease of the thlAtranscript level, with a minimum 3 to 7 h after induction ofsolventogenesis, can be explained as a result of generegulation, which has not been observed at the level ofenzyme activity determined in crude extracts of batchcultures (Hartmanis and Gatenbeck, 1984). For adhE andadc, which are specifically expressed during solventformation, the same induction pattern was observed asdescribed previously (Gerischer and Dürre, 1992; Sauerand Dürre, 1995). This indicates that the drop in thlAtranscript level was not an artefact due to damaged mRNApreparations or caused by a general decrease in genetranscription during the transition to solvent formation.Since the putative promoter upstream of thlA shows highhomology to the σ70 consensus sequence and the gene isexpressed in E. coli (Petersen and Bennett, 1991), theobserved changes in thlA transcript level can be bestexplained by the action of a repressor protein. The increasein expression during solventogenesis would then requirean inactivation of the repressor or an overruling activity ofan activator. Identification of a putative regulator proteinand its DNA-binding site is currently attempted. Thistranscriptional regulation of thlA (high expression duringacidogenesis, drastic decrease at initiation of the shift,increase of expression at the onset of solventogenesis) isso far unique in C. acetobutylicum. The transcriptionalanalysis presented in this study clearly demonstrates thatThlA is involved in the metabolism of both, acid and solventformation.

RT-PCR revealed maximal thlB transcript levels 10hours after the induction of the shift from acid- to solventformation, being two- to threefold higher compared to RNAfrom either acid- or solvent-producing cells. Since extensivePCR amplification was necessary to obtain signalintensities comparable to those obtained directly from thlA-specific cDNA, the level of thlB transcripts must be verylow. Thus, thlB does not seem to play a significant role inacid and solvent metabolism under the conditionsemployed in this work.

The physiological function of thlB is still unknown,although the gene product was clearly shown to exhibitthiolase activity. The codon usage of thlB is in agreementwith those of highly expressed genes involved in themetabolism of acid- and solvent-production (data notshown), indicating a rapid expression under specificconditions. A second thiolase gene was also identified inseveral other strains of solvent-producing clostridia (Figure1). Furthermore, thlC’ is very similar to a gene downstreamof thlB in C. beijerinckii (sequence information gratefullyreceived from N. P. Minton), thus analogous operons seemto exist in at least some of these strains. Since in C.acetobutylicum production of PHA-like storage compoundshas not been described, the function of an additionalbiosynthetic thiolase, which is not involved in acid- orsolvent formation, remains obscure, whereas the presenceof two genes in aerobic or PHA-synthesizing bacteria canbe explained by the specific function of the respective

Thiolase Genes of C. acetobutylicum 539

enzymes: different thiolases may be involved in thedegradation of fatty acids via β-oxidation compared to thoseinvolved in the biosynthesis of PHA from acetyl-CoA. In E.coli two thiolases are involved in the degradation of shortand long chain fatty acids (Jenkins and Nunn, 1987; Yanget al., 1990). For B. subtilis a σE-dependent operon of atleast five open reading frames has been identified, codingfor gene products homologous to thiolase, 3-hydroxybutyryl-CoA dehydrogenase, acyl-CoAdehydrogenase and a citrate synthase (Bryan et al., 1996).This operon is transcribed in the mother cell compartmentat an intermediate stage of sporulation, but as of yet nospecific function has been assigned. For thlR and thlB noobvious σE consensus promoter sequence could beidentified, but the differential expression of these genesduring sporulation of C. acetobutylicum has still to beinvestigated. Future work will focus on the functionalanalysis of the thlB operon.

Expression of the thlB operon is possibly controlledby a regulator encoded by the thlR gene. The N-terminalregion of ThlR shows significant similarity to transcriptionalregulators of the TetR/AcrR family, the most similar proteins(beside some hypothetical TetR-like proteins) being the A-factor receptor homologues CprA and CprB ofStreptomyces coelicolor A3(2) (Onaka et al., 1998), andLmrR of B. subtilis (Kumano et al., 1997). All TetR-likeproteins that have been analyzed for their regulatoryfunction have been shown to act as repressors. Thus, itseems likely that ThlR has DNA-binding properties andpossibly acts as a transcriptional regulator of the thlBoperon. A putative σ70 promoter region was identifiedupstream of thlR on the basis of sequence comparisons,suggesting that ThlR might regulate the expression of theoperon in some sort of autoregulation. Regulators of theTetR/AcrR family have a particular theme in common: theybind a small molecule, an antibiotic or signal molecule,which after entering the cell will bind to and inactivate therespective repressor protein. It is therefore tempting tospeculate that the thlB operon is expressed in response tothe extracellular accumulation of a signal molecule or othercompounds. This possibility is currently under investigation.

Experimental Procedures

Bacterial Strains, Plasmids, and Growth ConditionsC. acetobutylicum DSM 792, DSM 1731 (Deutsche Sammlung vonMikroorganismen und Zellkulturen GmbH, Braunschweig, Germany), ATCC824 (kindly supplied by E. T. Papoutsakis, Northwestern University,Evanston, Ill.), P 262 (kindly supplied by D. R. Woods, University of CapeTown, Cape Town, South Africa), and C. beijerinckii NCIMB 8052 (NationalCollection of Industrial and Marine Bacteria, Aberdeen, UK) were used asa source of genomic DNA for Southern hybridizations and PCRamplifications. Total RNA was isolated from continuous cultures of C.acetobutylicum DSM 1731. In cloning experiments, E. coli JM109 was usedas the host for pUC18- and pUC19-based vectors (Yanisch-Perron et al.,1985), whereas E. coli BL21 DE3 served as host for pET21 (Novagen Inc.,Madison, Wis.) and its derivative.

In batch culture, C. acetobutylicum was grown under strictly anaerobicconditions at 37°C in clostridial basal medium (O’Brien and Morris, 1971).Continuous cultures were performed with strain DSM 1731, as describedby Bahl et al. (1982). Solventogenesis was induced by turning off the pHcontrol of the continuous culture. The production of acids caused a pHdrop to 4.3, at which point the pH control was turned on again. E. coli wascultivated at 37°C in LB medium or terrific broth medium (Sambrook et al.,1989) supplemented with ampicillin (50 µg/ml), isopropyl-β-D-thiogalactopyranoside (IPTG; 50 µg/ml), or 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal; 40 µg/ml) when required.

Nucleic Acid Isolation and ManipulationDNA of C. acetobutylicum was isolated by the method of Marmur (1960) asmodified by Bertram and Dürre (1989) or by using Genomic-tip 100/Gcolumns (Qiagen GmbH, Hilden, Germany) according to the manufacturer’sinstructions. For isolation of plasmid DNA from E. coli the Plasmid-Midi-Kit(Qiagen) was used. Total RNA of C. acetobutylicum was isolated by the hotphenol-chloroform procedure described by Oelmüller et al. (1990) with themodifications described by Gerischer and Dürre (1992).

DNA was manipulated by standard methods (Sambrook et al., 1989).Restriction enzymes (MBI Fermentas, St. Leon-Rot, Germany) were usedin accordance to the manufacturer’s instructions. Transformation wasachieved by electroporation using a Gene Pulser (BioRad LaboratoriesGmbH, Munich, Germany). Conditions were as follows: Electro-competentcells were prepared as described by Sambrook et al. (1989). 2 µl of DNAsolution were mixed with 40 µl of competent cells, transferred into 0.2-cmelectroporation cuvettes (Bio-Rad), and transformed using the followingconditions: 2.5 kV, 200 Ω, 25 µF. Cells were then suspended in 1 ml LB,incubated for 1 h at 37°C and plated on appropriate selective media.

HybridizationTotal DNA of C. acetobutylicum was digested to completion with therespective restriction enzymes, separated on agarose gels and transferredto nylon membranes (GeneScreen Plus; NEN Research Products, Dreieich,Germany) or, for non-radioactive hybridizations, Hybond-N+ (AmershamBuchler GmbH & Co KG, Braunschweig, Germany) by capillary transfer in10x SSC (1x SSC is 0.15 M NaCl plus 15 mM sodium citrate).Prehybridization and hybridization were performed as described previously(Winzer et al., 1997). Non-radioactive DNA labelling and detection wasachieved using an ECL direct nucleic labelling and detection systems kit(Amersham Buchler) according to the manufacturer’s instructions.

Total RNA for Northern (RNA) blots was separated in denaturingformaldehyde gels and transferred to nylon membranes (GeneScreen Plus)as described by Sambrook et al. (1989). Fragment sizes were estimatedby comparison with an RNA ladder (GIBCO/BRL GmbH, Eggenstein,Germany). Hybridization and washing were performed as described (Winzeret al., 1997).

DNA SequencingFor radioactive sequencing a T7 sequencing kit (Amersham PharmaciaBiotech Europe GmbH, Freiburg, Germany) was used. The dideoxy-terminated fragments were separated on 55-cm wedge-shaped thickness-gradient gels (0.2 to 0.4 mm; 6% [wt/vol] polyacrylamide) with a Macrophorsequencing unit (Amersham Pharmacia Biotech) as recommended by themanufacturer. Non-radioactive sequencing was performed using theAutoRead sequencing kit (Amersham Pharmacia Biotech) and fluorescein-labelled dATP as described by Voss et al. (1992). Fluorescein-labelleddideoxy-terminated fragments were separated on 6% [wt/vol]polyacrylamide gels (0.5 mm thick; 20 cm separation distance) with anA.L.F. DNA Sequencer (Amersham Pharmacia Biotech) using 0.6x TBE(1x TBE is 100 mM Tris, 83 mM boric acid, 1 mM EDTA) at 38 mA, 50°C geltemperature, and 2 or 3 W laser power. For the preparation of polyacrylamidegels a commercial acrylamide solution (SequaGel XR; National Diagnostics,Atlanta, Ga.) was used.

OligonucleotidesSynthesis of oligonucleotides was performed on a Gene Assembler Plus(Amersham Pharmacia Biotech) on 0.2 µmol-capacity columns asrecommended by the manufacturer. 5'-fluorescein-labelled oligonucleotideswere synthesized by using fluorescein amidite (FluorprimeTM; AmershamPharmacia Biotech). After deprotection oligonucleotides were purified bycolumn purification on Sephadex G-25 (NAPTM 5; Amersham PharmaciaBiotech).

The sequence of oligonucleotides is given in the 5' to 3' direction,with the “F” at the 5' end indicating a fluorescein group. Oligonucleotidesfor primer extension and S1 nuclease analysis: PrA(FCGCTGTTCTTACTGCACTAGC, nt positions 1076-1096 in AF072734),PrADC (FAATGGCGTGCTAATTTGTTT, nt positions 3557-3576 in M55392),PrADHE (FGCTTCTTTAATTACCTTGAG, nt positions 2234-2253 inX72831), PrB (FTACTCTGAAACACTAATGGC, nt positions 894-913 inAF072735), 2U5 (TTTATAGCTGTAGCTCC, nt positions 1145-1161 inAF072734), 1U6 (TTACTGCTGCTTGTCTT, nt positions 1610-1626 inAF072735), 1U7 (GGTTTGTTTATTTCGAT, nt positions 1357-1373 inAF072735), 1U8 (CTTCATATATTGCAAAA, nt positions 1193-1209 inAF072735), 1U9 (TTTATTTTTATCCATCC, nt positions 933-949 inAF072735), and 1U10 (CCCTTGGTTGTCTTTGCC, nt positions 728-744in AF072735). Oligonucleotides for PCR: T1A (ATGGTTTATGGGATGCAT,based on sequence information from C. beijerinckii gratefully received fromN. P. Minton), T1B (AATCTAAATCCTCAGCT, based on sequenceinformation from C. beijerinckii gratefully received from N. P. Minton), T2A(TCATGGGATATGGTCCA, based on sequence information from C.

540 Winzer et al.

beijerinckii gratefully received from N. P. Minton), T2B(AAAGTGTAGCTAATCCTT, based on sequence information from C.beijerinckii gratefully received from N. P. Minton), 2U1(GTTTTCTGCTGTTATTC, nt positions 1530-1546 in AF072734), and 2U2(GTAGTTGATACAGATGA, nt positions 1691-1707 in AF072734).Oligonucleotides for RT-PCR: cThioB2 (CCGAATCTAGGAAAT; forsynthesis of cDNA; nt positions 2063-2077 in AF072735), 5B2(FCACTATCTCCCATTCTTTGACCCC, nt positions 1801-1824 inAF072735), 3B4 (CGAAATAAACAAACCAGTCTATTC, nt positions 1359-1382 in AF072735), 3B5 (GAGGAGTAAAACATGAGAGATGTA, nt positions1401-1424 in AF072735), 1R6 (ATCAGGGACAGGGTTGCC, nt positions833-850 in AF072735), IRA (TATACTAGCAAATCGTGC, nt positions 1175-1192 in AF072735), and IRB (GGTTGCCCTTTTGCAGTA, nt positions1032-1049 in AF072735).

Primer Extension AnalysisPrimer extension analysis was carried out as described by Gerischer undDürre (1992) except that SuperScript reverse transcriptase (GIBCO/BRL)was used. Fluorescein-labelled oligonucleotides were used for non-radioactive analysis to compare the relative amount of transcripts in differentRNA preparations from various time points in shift experiments. In this caseall components, except the RNA, were added from a master mix.Denaturation of the cDNA and electrophoretic conditions were performedas described for analysis of RT-PCR.

S1 Nuclease AnalysisFor S1 nuclease analysis single-stranded DNA was synthesized and labelledwith [α35S]dATP using a commercial T7 sequencing kit (AmershamPharmacia Biotech). The sequencing instructions of the manufacturer weremodified as follows: After denaturation of plasmid DNA and annealing ofthe respective oligonucleotide, 3 µl labelling mix, 1 µl [α35S]dATP (10 µCi),and 2 µl T7 polymerase (1.5 U/ml) were added and incubated at 37°C for 3min. After addition of 1 µl of deoxyribonucleoside triphosphates (800 µMeach) and incubation at 37°C for 15 min the reaction was stopped, by phenol-chloroform extraction, and subjected to an ethanol precipitation. The DNApellet was suspended in 20 µl H2O and stored at -20°C. Labelled DNA(0.25 µg) and RNA (10 to 40 µg) were mixed, dried, and incubated at 85°Cfor 10 min after the addition of 15 µl hybridization buffer (40 mM PIPES [pH7.0], 1 mM EDTA, and 400 mM NaCl in 80% [vol/vol] formamide).Hybridization was performed at 40°C for 4 h. RNA and single-strandedDNA were removed by the addition of 300 µl S1 mapping buffer (40 mMNa-acetate [pH 5.0], 250 mM NaCl, 1 mM ZnCl2, 20 U/ml S1 nuclease, and20 µg/ml denatured salmon sperm DNA) and incubation at 30°C for 30min. The reaction was stopped by phenol-chloroform extraction after theaddition of 6 µl 10% (wt/vol) SDS, 30 µl 0.2 M EDTA (pH 8.0), and 30 µl 3 MNa-acetate (pH 8.0) followed by ethanol precipitation and suspension ofthe precipitate in 5 µl H2O.

PCRPCR amplifications were performed in 100 µl volumes as described before(Winzer et al., 1997).

RT-PCRReverse transcription (RT) was carried out as described for the primerextension analysis but using an unlabelled oligonucleotide. PCRamplifications of the resulting cDNA were performed as described (Winzeret al., 1997), with all components except the cDNA (2.5 to 5 µl) being addedfrom a mastermix. One of the primers (5B2; only for quantitative analysis)was labelled with fluorescein, the total reaction volume was 50 µl, theannealing temperature was 55°C, and the number of cycles was 18 to 20(quantitative analysis with an A.L.F. DNA Sequencer [Amersham PharmaciaBiotech]) and 30 to 35 (visual analysis in agarose gels). For quantitativeelectrophoretic analysis 1 to 3 µl of the PCR reactions were mixed withtwice the volume of formamide dye mix (6 mg dextran blue 2.000.000 perml formamide) and applied to a polyacrylamide gel, as described for non-radioactive sequencing, after denaturation at 90°C for 3 min. Theelectrophoretic conditions were as described above, except that the geltemperature was lowered to 43°C. The amount of fluorescein-labelled DNAin different lanes of the polyacrylamide gel could be compared, whenidentical amounts of an internal standard (a fluorescein-labelled PCRfragment, synthesized by using the primers 3B5 and 5B2) were added toeach reaction before denaturation. The observed fluorescence wasproportional to the content of amplified fragment under these conditions.To test for the presence of DNA in the RNA preparations, RT reactions,with no reverse transcriptase added, were subjected to PCR andelectrophoresis.

SDS-PAGE AnalysisElectrophoresis was performed using the Laemmli buffer system essentiallyas described before (Winzer et al., 1997). Molecular mass standard was

‘Kaleidoscope Prestained Standards’ from Bio-Rad, containing myosin (203kDa), β-galactosidase (135 kDa), bovine serum albumin (86 kDa), carbonicanhydrase (41.5 kDa), soybean trypsin inhibitor (33.4 kDa), lysozyme (19.5kDa), and aprotinin (8 kDa).

Enzyme AssaysRecombinant E. coli strains were grown in terrific broth medium at 37°C for4 h to mid-log phase, at which time IPTG (final concentration 1 mM) wasadded. Shaking was continued for another 3 h, and cells were then harvestedby centrifugation (30,000 x g, 4°C, 25 min, repeated once). Cell pelletswere suspended in 100 mM Tris-HCl, pH 7.4. Extracts were prepared bythree times French press (SLM Instruments, Inc., Rochester, NY) treatmentat 140 Mpa. Thiolase activity was determined according to assay B ofWiesenborn et al. (1988). Protein concentration was measured accordingto Bradford (1976) using Serva Blue G-250 as dye reagent and bovineserum albumin as standard protein.

Computer ProgramsSequence analysis and database searches were performed withIntelliGenetics (Menlo Park, Calif.) and Genetics Computer Group (Madison,Wis.) software packages and the NCBI BLAST (http://www.ncbi.nlm.nih.gov)server. For sequence comparisons the programs Gap (complete proteinsequences) or BestFit (for truncated protein sequences) were used. Theresulting peaks of non-radioactive primer extension and RT-PCRexperiments were integrated by using the Fragment Manager program fromAmersham Pharmacia Biotech.

Nucleotide Sequence Accession NumbersThe sequence data reported here have been submitted to the GenBankdata base and assigned accession no. AF072734 (thlA) and AF072735(thlB gene region).

Acknowledgements

We thank J. D. Santangelo and B. Farthmann for stimulating discussions,N. P. Minton for C. beijerinckii thiolase genes sequence information, and A.Kuhn for excellent technical assistance in continuous culture experiments.

This work was supported by a grant from the DeutscheForschungsgemeinschaft and travel support by the DAAD within the British-German ARC program.

References

Bahl, H., Andersch, W., and Gottschalk, G. 1982. Continuous production ofacetone and butanol by Clostridium acetobutylicum in a two-stagephosphate limited chemostat. Eur. J. Appl. Microbiol. Biotechnol. 15: 201-205. (Erratum 17: 73, 1983.)

Berndt, H., and Schlegel, H. G. 1975. Kinetics and properties of β-ketothiolase from Clostridium pasteurianum. Arch. Microbiol. 103: 21-30.

Bertram, J., and Dürre, P. 1989. Conjugal transfer and expression ofstreptococcal transposons in Clostridium acetobutylicum. Arch. Microbiol.151: 551-557.

Boorstein, W. R., and Craig, E. A. 1989. Primer extension analysis of RNA.Methods Enzymol. 180: 347-369.

Boynton, Z. L., Bennett, G. N., and Rudolph, F. B. 1994. Intracellularconcentrations of coenzyme A and its derivatives from Clostridiumacetobutylicum ATCC 824 and their roles in enzyme regulation. Appl.Environ. Microbiol. 60: 39-44.

Bradford, M. M. 1976. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dye binding.Anal. Biochem. 72: 248-254.

Bryan, E. M., Beall, B. W., and Moran, C. P. 1996. A σE-dependent operonsubject to catabolite repression during sporulation in Bacillus subtilis. J.Bacteriol. 178: 4778-4786.

Dürre, P., and Bahl, H. 1996. Microbial production of acetone/butanol/isopropanol. In: Biotechnology, vol. 6, 2nd ed. M. Roehr, ed. VCHVerlagsgesellschaft mbH, Weinheim, Germany. p. 229-268.

Fischer, R. J., Helms, J., and Dürre, P. 1993. Cloning, sequencing, andmolecular analysis of the sol operon of Clostridium acetobutylicum, achromosomal locus involved in solventogenesis. J. Bacteriol. 175: 6959-6969.

Freier, S. M., Kierzek, R., Jaeger, J. A., Sugimoto, N., Caruthers, M. H.,Neilson, T., and Turner, D. H. 1986. Improved free-energy parameters forprediction of RNA duplex stability. Proc. Natl. Acad. Sci. USA 83: 9373-9377.

Gerischer, U., and Dürre, P. 1990. Cloning, sequencing, and molecularanalysis of the acetoacetate decarboxylase gene region from Clostridiumacetobutylicum. J. Bacteriol. 172: 6907-6918.

Gerischer, U., and Dürre, P. 1992. mRNA analysis of the adc gene regionof Clostridium acetobutylicum during the shift to solventogenesis. J.

Thiolase Genes of C. acetobutylicum 541

Bacteriol. 174: 426-433.Hartmanis, M. G. N., and Gatenbeck, S. 1984. Intermediary metabolism in

Clostridium acetobutylicum: levels of enzymes involved in the formationof acetate and butyrate. Appl. Environ. Microbiol. 47: 1277-1283.

Haywood, G. W., Anderson, A. J., Chu, L., and Dawes, E. A. 1988.Characterization of two 3-ketothiolases possessing differing substratespecificities in the polyhydroxyalkanoate synthesizing organismAlcaligenes eutrophus. FEMS Microbiol. Lett. 52: 91-96.

Jenkins, L. S., and Nunn, W. D. 1987. Genetic and molecularcharacterization of the genes involved in short-chain fatty acid degradationin Escherichia coli: the ato system. J. Bacteriol. 169: 42-52.

Johnson, J. L., Toth, J., Santiwatanakul, S., and Chen, J.-S. 1997. Culturesof “Clostridium acetobutylicum” from various collections compriseClostridium acetobutylicum, Clostridium beijerinckii, and two other distincttypes based on DNA-DNA reassociation. Int. J. Syst. Bacteriol. 47: 420-424.

Jones, D.T., and Woods, D.R.. 1986. Acetone-butanol fermentation revisited.Microbiol. Rev. 50: 484-524.

Jones, D. T., and Woods, D. R. 1989. Solvent production. In: Clostridia.Biotechnology Handbooks 3. N. P. Minton and D. J. Clarke, eds. PlenumPress, New York, N.Y. p. 105-144.

Keis, S., Bennett, C. F., Ward, V. K., and Jones, D. T. 1995. Taxonomy andphylogeny of industrial solvent-producing clostridia. Int. J. Syst. Bacteriol.45: 693-705.

Kiino, D. R., Licudine, R., Wilt, K., Yang, D. H., and Rothman-Denes, L. B.1993. A cytoplasmatic protein, NfrC, is required for bacteriophage N4adsorption. J. Bacteriol. 175: 7074-7080.

Kumano, M., Tamakoshi, A., and Yamane, K. 1997. A 32 kb nucleotidesequence from the region of the lincomycin-resistance gene (22˚-25˚) ofthe Bacillus subtilis chromosome and identification of the site of the lin-2mutation. Microbiol. 143: 2775-2782.

Marmur, J. 1960. A procedure for the isolation of deoxyribonucleic acidfrom microorganisms. J. Mol. Biol. 3: 208-218.

O’Brien, R. W., and Morris, J. G. 1971. Oxygen and the growth andmetabolism of Clostridium acetobutylicum. J. Gen. Microbiol. 68: 307-318.

Oelmüller, U., Krüger, N., Steinbüchel, A., and Friedrich, C. 1990. Isolationof prokaryotic RNA and detection of specific mRNA with biotinylatedprobes. J. Microbiol. Methods 11: 73-81.

Onaka, H., Nakagawa, T., and Horinouchi, S. 1998. Involvement of two A-factor receptor homologues in Streptomyces coelicolor A3(2) in theregulation of secondary metabolism and morphogenesis. Mol. Microbiol.28: 743-753.

Pabo, C. O., and Sauer, R. T. 1984. Protein-DNA recognition. Ann. Rev.Biochem. 53: 293-321.

Peoples, O. P., and Sinskey, A. J. 1989. Poly-β-hydroxybutyrate biosynthesisin Alcaligenes eutrophus H16. J. Biol. Chem. 264: 15293-15297.

Petersen, D. J., and Bennett, G. N. 1991. Cloning of the Clostridiumacetobutylicum ATCC 824 acetyl coenzyme A acetyltransferase (thiolase;EC 2.3.1.9) gene. Appl. Environ. Microbiol. 57: 2735-2741.

Platt, T. 1986. Transcription termination and the regulation of geneexpression. Ann. Rev. Biochem. 55: 339-372.

Porcher, C., Maligne, M.-C., Picat, C., and Grandchamp, B. 1992. Asimplified method for determination of specific DNA or RNA copy numberusing quantitative PCR and an automatic DNA sequencer. BioTechniques13: 106-112, 114.

Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989. Molecular cloning: Alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold SpringHarbor, New York.

Sauer, U., Treuner, A., Buchholz, M., Santangelo, J. D., and Dürre, P. 1994.Sporulation and primary sigma factor homologous genes in Clostridiumacetobutylicum. J. Bacteriol. 176: 6572-6582.

Sauer, U., and Dürre, P. 1995. Differential induction of genes related tosolvent formation during the shift from acidogenesis to solventogenesisin continuous culture of Clostridium acetobutylicum. FEMS Microbiol. Lett.125: 115-120.

Slater, S., Houmiel, K. L., Tran, M., Mitsky, T. A., Taylor, N. B., Padgette, S.R., and Gruys, K. J. 1998. Multiple β-ketothiolases mediate poly(β-hydroxyalkanoate) copolymer synthesis in Ralstonia eutropha. J. Bacteriol.180: 1979-1987.

Soldo, B., Lazarevic, V., Margot, P., and Karamata, D. 1993. Sequencingand analysis of the divergon comprising gtaB, the structural gene of UDP-glucose pyrophosphorylase of Bacillus subtilis 168. J. Gen. Microbiol.139: 3185-3195.

Stim-Herndon, K. P., Petersen, D. J., and Bennett, G. N. 1995.Characterization of an acetyl-CoA C-acetyltransferase (thiolase) gene fromClostridium acetobutylicum ATCC 824. Gene 154: 81-85.

Voss, H., Wiemann, S., Wirkner, U., Schwager, C., Zimmermann, J.,Stegemann, J., Erfle, H., Hewitt, N. A., Rupp, T., and Ansorge, W. 1992.Automated DNA sequencing system resolving 1,000 bases with

fluorescein-15-*dATP as internal label. Methods Mol. Cell. Biol. 3: 153-155.

Wiesenborn, D. P., Rudolph, F. B., and Papoutsakis, E. T. 1988. Thiolasefrom Clostridium acetobutylicum ATCC 824 and its role in the synthesisof acids and solvents. Appl. Environ. Microbiol. 54: 2717-2722.

Wilkinson, S. R., and Young, M. 1993. Wide diversity of genome size amongdifferent strains of Clostridium acetobutylicum. J. Gen. Microbiol. 139:1069-1076.

Wilkinson, S. R., Young, M., Goodacre, R., Morris, J. G., Farrow, J. A. E.,and Collins, M. D. 1995. Phenotypic and genotypic differences betweencertain strains of Clostridium acetobutylicum. FEMS Microbiol. Lett. 125:199-204.

Winzer, K., Lorenz, K., and Dürre, P. 1997. Acetate kinase from Clostridiumacetobutylicum: a highly specific enzyme that is actively transcribed duringacidogenesis and solventogenesis. Microbiol. 143: 3279-3286.

Yang, S.-Y., Yang, X.-Y. H., Healy-Louie, G., Schulz, H., and Elzinga, M.1990. Nucleotide sequence of the fadA gene. J. Biol. Chem. 265: 10424-10429.

Yanisch-Perron, C., Vieira, J., and Messing, J. 1985. Improved M13 phagecloning vectors and host strains: nucleotide sequence of the M13mp18and pUC19 vectors. Gene 33: 103-119.