Developments in molecular genetic techniques in fisheries€¦ · Developments in molecular genetic techniques in ... The use of molecular genetic techniques in fisheries research

Reviews in Fish Biology and Fisheries, 4, 272-299 (1994)

Developments in molecular genetic techniques in fisheries

L I N D A K. P A R K * and P A U L M O R A N

National Marine Fisheries Service, Northwest Fisheries Science Center, Coastal Zone and Estuarine Studies Division, 2725 Montlake Boulevard East, Seattle, WA, 98112, USA

Contents

Introduction Molecular genetic markers

Isozymes DNA

Coding and non-coding DNA Non-repetitive and repetitive DNA Mitochondrial DNA Nuclear DNA DNA-level variation Hybridization of DNA molecules

Molecular genetic techniques Gel electrophoresis Restriction enzymes Polymerases

PCR Sequencing

Ligases Comparison of various molecular methods for fisheries applications The future of molecular genetics in fisheries Acknowledgements References

page 272 273

280

287 292 293 293

Introduction

The use of molecular genetic techniques in fisheries research has increased dramatically over the past several years, largely due to the increased availability of techniques and an increased awareness of the value of genetic data. Today, the boundaries of fisheries- related molecular genetic research encompass topics from the identification of markers for stock discrimination (Park et aL, 1993) to the genetics of pathogenic organisms of commercially important species (Meyers et aL, 1992) tothe expression of growth factors during maturation (Duguay et aL, 1992). We cannot hope to cover all of these appli-

*Author to whom correspondence should be addressed.

0960-3166 © 1994 Chapman & Hall

Developments in molecular genetic techniques 273

cations in the space of this review but we would like to at least acknowledge the breadth of research that is being conducted. With that said, we shall focus primarily on molecular methods as they relate to population genetic/evolutionary questions, because most data (in terms of volume and diversity) exist for these applications, and this is our area of research. Research in this area generally involves the characterization of molecular genetic variants that can be used as genetic markers.

The goals of this review are first, to familiarize the reader with the basis of molecular genetic research, and second, to introduce some of the most widely used techniques now being applied to population genetic research, particularly in fish species. The research in our own group has been on the population genetics of Pacific salmon species (Oncorhyn- chus spp.), and the examples we describe tend to reflect that; however, this type of research is being conducted with many different fishes to address a wide range of questions. Our aim is not to make the reader an expert in molecular techniques; rather, we hope to impart a basic understanding of the potentials and limitations of molecular genetic analysis that will enable the reader to better evaluate this type of research. We focus here on the most widely used techniques to date, but we will also speculate on the direction molecular genetic research will take in the next few years.

To further narrow the scope of this review, the molecular techniques covered in this review will be mostly concerned with DNA-level research, which has experienced a sharp growth in recent years. This is not to imply that more traditional, protein-level (isozyme) analyses are obsolete: on the contrary, they are, and will continue to be, the mainstay of fisheries genetics for years to come. But reviews on the application of isozymes in fisheries genetics have been published (Shaklee, 1983; Seeb and Miller, 1990; Utter 1991; Utter and Ryman, 1993), as have detailed descriptions of the practical aspects of this technique (Aebersold et al., 1987; Buth, 1990; Hillis and Moritz, 1990), and we feel there is little need to repeat that information here. Instead, we have tried to focus on techniques that have only recently attained widespread application in fisheries research and we will limit our discussion of isozymes to what is essential to evaluation in the context of the other techniques described.

Molecular genetic markers ISOZYMES

Isozymes are functionally similar but separable forms of enzymes, encoded by one or more loci (Markert and Moiler, 1959). Isozymes that are the products of different alleles at the same locus are termed allozymes. For the past 20 years, fish geneticists have been using protein (isozyme) electrophoresis as their primary tool to characterize population- level genetic variation in various fish species (Avise and Smith, 1974; Allendorf et al., 1976; Winans, 1980; Waples, 1990). The technique was first used to examine blood groups in humans (Smithies, 1955) but was later adopted for use in other species (Sick, 1961; Lewontin and Hubby, 1966; Sartore et al., 1969; Utter et al., 1976). This technique is ideally suited to population studies: it is relatively inexpensive and requires little in the way of specialized equipment, it is a fairly rapid procedure to perform on a large scale, and a large number of unlinked loci that are dispersed throughout the genome (Pasdar et aL, 1984) can be screened simultaneously. Protein electrophoresis can be useful for defining genetic markers for stock identification in fishes, especially anadro- mous species, as evidenced by numerous studies that document differences in protein

274 Park and Moran

allele frequencies between stocks (Allendorf and Utter, 1979; Grant et al., 1984; Beacham et al., 1985; Salini and Shaklee, 1988; Utter and Ryman, 1993; Carvalho and Hauser, 1994; Ward and Grewe, 1994).

A variation of isozyme electrophoresis is the isoelectric focusing (IEF) technique. The charged side chains associated with the amino acids that determine a protein's net charge respond to pH by becoming more or less charged (Kolin, 1955). A protein's isoeleetric point is the pH at which its net surface charge is zero. Instead of being separated according to differences in overall charge at a given pH, proteins are separated according to differences in isoelectric point (Whitmore, 1990). Although this technique has not achieved as widespread use as isozyme electrophoresis, it has been used in species identification studies (Lundstrom and Roderick, 1979; Whitmore, 1986), as well as population-level studies (Smith and Clemens, 1973; Farbrizio, 1987; May and Krueger, 1990).

While protein electrophoresis has provided fisheries geneticists with the most genetic data to date, the technique has certain limitations. The resolution of protein electrophoresis is not always adequate for detecting differences between populations or individuals (Grant and Utter, 1980; Grant, 1984; Utter et aL, 1989). Because of redundancy in the DNA code that dictates protein sequences, all changes in a gene may not result in a change in the overall charge of the protein expressed; thus many genetic variants are not detected by protein electrophoresis. Furthermore, protein electrophoresis is limited to detecting genetic changes that affect genes that actively express proteins detectable with a histochemical stain (Hunter and Markert, 1957; Morizot and Schmidt, 1990). These genes constitute only a small percentage of the whole genome of an animal. The potential amount of genetic variation detectable by DNA methods vastly exceeds the amount detectable by protein methods because DNA sequences are being assayed more directly. Thus, as fisheries geneticists have encountered an increasing number of questions that cannot be resolved with isozymes, DNA methods have generated increasingly more interest. It is worth stating that, although more variability is detectable with DNA methods than with isozyme electrophoresis, the existing data for isozymes in many fish species represent a huge wealth of information that should not be disregarded. Indeed, until a substantial amount of DNA data has been collected for a particular species, an existing isozyme database often represents a more practical source of genetic information.

DNA

DNA is a long, unbranched polymer that is composed of four different subunits: deoxyr- ibonucleotides containing the nitrogenous bases adenine (A), cytosine (C), guanine (G) and thymine (T). Nitrogenous bases can be divided into two categories chemically: A and G are purines, and T and C are pyrimidines. The subunits are usually referred to as nucleotides, nucleic adds, or base pairs (bases in the case of single-stranded DNA). Each nncleotide contains a pentose (5-carbon-ring) sugar and a nitrogenous base. The fifth (5- prime, or 5') carbon of the pentose ring is connected to the third (3-prime, or 3') carbon of the next pentose ring via a phosphate group, and the nitrogenous bases stick out from this sugar-phosphate backbone. This 5'/3' orientation exhibits a polarity along the DNA strand in that all nucleotides in the same strand are arranged in the same way. By convention, DNA sequences are read from 5' to 3' with respect to the polarity of the strand. A DNA molecule is composed of two strands of nucleotides bound together by hydrogen bonds. Because of physical constraints, the nucleotides can only pair up in a


very specific way: A with T, and G with C (Watson and Crick, 1953). For a more detailed description of the DNA molecule, see Watson et al., 1992.

Comparative examination of DNA sequences across divergent taxa clearly show that there are particular classes of sequences common to many organisms. DNA can be classified in many ways - according to its function, its structure, its location, etc. Many of these categories overlap, with a particular segment of DNA falling into several categories at once (Fig. 1). The categories described here are by no means an exhaustive list of the ways DNA sequences are classified, but these should serve to familiarize readers with some of the most commonly used terms.

Coding and non-coding DNA Discrete segments of DNA, generally referred to as 'genes,' encode for the manufacture of proteins (structural, regulatory and enzymatic) and RNA molecules that comprise the organism. The total genomic DNA of eukaryotic organisms can be billions of nucleotides long. Interestingly, in many organisms, most of this DNA does not code for any gene

coding non-coding

introns " regulatory regions

nuclear DNA

rDNA ] mini satellite DNA histones I microsatellite DNA

non-tandem repeats (SINEs and LINEs)

non-repetitive repetitive

mtDNA

ND genes ¢yt b tRNAs

Fig. 1. Schematic representation of some of the classes of DNA sequences that can be identified across diverse taxonomic groups. A few example sequences are provided for each category. This representation involves broad generalization and simplification for the purpose of illustration, and the categories are not drawn to scale. The shaded regions represent the portions of the genome assayed by protein electrophoresis.

276 Park and Moran

product. Even within the DNA sequences that we recognize as genes, there can be regions of non-coding DNA (referred to as introns) interspersed throughout. It is esti- mated that only 1% of the billions of nucleotides in the mammalian genome regulates or codes for essential proteins; consequently, protein electrophoresis is incapable of assaying a majority of the genome. Whereas coding regions can exhibit high degrees of sequence homology in the same gene between distantly related organisms, non-coding sequences are often more variable, presumably because the non-coding sequences are not subject to selective pressures. Because no specific function has been identified for most non-coding stretches of DNA, it is often referred to as 'junk' DNA. However, to view non-coding DNA as completely free from function and/or selection is inappro- priate. Regulatory sequences often do not code for any product, yet play a critical role in gene expression, inducing or permitting the synthesis of a particular gene product in the correct tissue, at the correct time. Furthermore, there may be selective constraints on non-coding DNA sequences that relate to physical conformation of the DNA molecule and function in gene expression or DNA replication.

Non-repetitive and repetitive D N A s

Non-repetitive DNA (sometimes referred to as 'single-copy' or scnDNA) is a DNA sequence that is present only once in the haploid genome. Approximately 70% of the mammalian genome consists of non-repetitive DNA (Alberts et aL, 1983); the remainder of the genome contains DNA that has anywhere from a few to thousands of copies of various sequences.

Satellite DNA, so called because of the way that it was first isolated (Britten and Kohne, 1968), is a repetitive DNA that contains tandemly repeated short nucleotide sequences. The repeat unit may be anywhere from one to a few hundred nucleotides long, and variable numbers of tandem repeats, or VNTRs, have shown so much variation that they can be used as 'fingerprints' in some organisms (Jeffreys et al., 1985a). In some mammals, certain satellite DNAs may occur as millions of copies of the repeat sequence per cell (Alberts et aL, 1983). Minisatellites contain repeat units from ten to a hundred nucleotides along (Jeffreys et al., 1985b) and are highly polymorphic (Taggart and Ferguson, 1990; Bentzen et al., 1991). Microsatellites contain smaller repeat units, usually one to four nucleotides long, and are variable as well (Tautz, 1989; Bentzen and Wright, 1993); however, research on microsatellites is fairly new and not much information is available on their degree of variation.

Interspersed repeated DNA (long and short interspersed repetitive elements, LINEs and SINEs, respectively) also occurs multiple times (sometimes hundreds of thousands of times) throughout the genome (Singer, 1982), but constitutes a smaller part of the genome than satellite DNAs. Unlike satellite DNA, the repeated copies are scattered around the genome, not tandemly repeated. Some evidence exists that points to retroviral origins of certain SINEs (Okada, 1991; Ohshima et al., 1993). Because insertions of these elements are assumed to be random, the insertion of an element in a Specific site could be viewed as a rare event. Based on this premise, SINEs have been used as charac- ters in phylogenetic analyses (Murata et aL, 1993). Certain coding regions whose products are required in large quantities by the organism (e.g. ribosomal DNA and histone genes) are highly repetitive, and because there are sometimes hundreds of mitochondria per cell, mitochondrial DNA is also considered repetitive.

In terms of function, satellite DNA is considered to be non-coding (Britten and


Kohne, 1968). Both the non-repetitive and interspersed repeat DNA contain coding and non-coding sequences, but the majority of vertebrate DNA is non-coding. Although non-repetitive DNA makes up the majority of the genome, it can be difficult to study because a particular sequence represents such a small fraction of the total genome. A 10 kilobase (kb) single copy sequence is less than 0.0002% of the entire genome of a typical bony fish (Ohno, 1974). The significance of this is that in order to study a particular DNA sequence, it is necessary to amplify it or otherwise purify it from non-target sequences. Consequently, comparatively few population-level data exist for non-repetitive sequences in fish.

Mitochondrial D N A

For several reasons, one of the most studied portions of the genome in animals (for population or evolutionary studies) is the mitochondrial DNA (mtDNA) (Wilson et al., 1985; Avise, 1986). Mitochondda are cytoplasmic orgauelles in eukaryotic cells where respiration takes place. Mitochondria have their own DNA, which contains numerous genes vital for cell respiration and other functions. It is physically separate from the rest of the cell's DNA, which resides within the nucleus, and this physical separation makes it relatively easy to isolate the 16000 to 20000 base pair circular mtDNA molecule from the billions of other nucleotides in the genome. As well as being compact in size, mtDNA is haploid; that is, each mitochondrion contains only one type of mtDNA (with a few notable exceptions, e.g. Bentzen et al., 1988). Mitochondria are cytoplasmicaHy inherited, and the cytoplasm of an ovum is derived from the female, thus mtDNA is predomi- nantly inherited maternally (see Gyllensten et at, 1991, and Margoulas and Zouros, 1993, for exceptions). Because there is little or no paternal contribution of mtDNA in most organisms, and no known recombination between mitochondrial genomes (Arise, 1994), mtDNA is clonaUy inherited. All of these factors combine to reduce the effective population size for mtDNA to one-fourth of that for the nuclear genes of the same organism (Nei and Tajima, 1981). A smaller effective population size means that genetic drift can cause frequency differences between isolated gene pools more readily in mtDNA than in nuclear DNA. In many organisms, the mtDNA also seems to accumulate mutations more rapidly than do single-copy nuclear genes (Brown et at, 1979, but see Lynch and JarreU, 1993). In other words, it provides markers with greater variability and sensitivity to drift, and is therefore more likely to show differences between populations/ species; this makes the mitochondrial genome attractive for both systematic (Shedlock et at , 1992; Banks et al., 1993; Lockwood et at , 1993; Moran et al., 1994) and population genetic studies (Avise et at , 1986; Geller et at , 1993; Zwanenburg, 1993). Certain marine species appear to have less-variable mitochondrial genomes than freshwater or terrestrial species (Ovenden, 1990); however, more species need to be examined before generalizations can be made.

Because different regions of the mitochonddal genome evolve at different rates, certain regions of the mtDNA have been targeted for certain types of studies. The cytochromb and ND genes have been examined in a number of species (Cart and Marshall, 1991; Brown et at , 1993; Cronin et at , 1993; Park et at , 1993) as they are reported to exhibit variability on the population level. The D-loop has also been targeted for population studies because it is highly variable in mammals, but this is not necessarily the case with fish (Nielsen et at , 1994; Park et al., 1993; Cart and Hall, pets. comm.). The mitochondrial ribosomal genes evolve more slowly and have been used for species-

278 Park and Moran

or even family-level studies (Geller et al. 1993; Milinkovitch et aL, 1993). It should be noted, however, that although the mitochondrial genome contains over thirty genes, it is treated as a single locus in population genetic analyses because of the absence of recombination in the mtDNA molecule.

Nuclear DNA

The nuclear genome in bony fishes is about 0.3-4.0 billion base pairs in size (Olmo, 1974), whereas mitochondrial genomes range from 17.0 to 18.0 thousand base pairs. Isozyme electrophoresis by definition surveys genetic variation in protein-coding regions of the nuclear and mitochondrial genomes, but, until now, much of the DNA research that has been conducted on fish species has involved only the mitochondrial DNA. Nuclear DNA (nDNA) represents a wealth of genetic information that researchers in fish population genetics have only begun to exploit. The reasons for the disparity between mtDNA and nDNA studies in population genetics are partly historical - researchers tend to duplicate the methods of successful studies for other organisms - and partly practical: mtDNA is easy to isolate and its haploid nature circumvents certain complications that can make interpretation of data difficult (i.e. recombination, heterozygosity, etc.). Today, many researchers are attempting to look at sequence variation in the nuclear genome using various strategies: examining introns, pinpointing specific genes, looking at repetitive sequences, etc. It is a much more arduous process, but the potential for detecting variation is much greater, and if genetic differences exist, mDNA studies are more likely to detect them.

In salmonids in particular we encounter difficulties with looking at nuclear DNA because of an event that occurred during the evolution of the family: at some point in the past, the common ancestor to all salmonids changed its chromosomal state, or its ploidy level. The ancestor of all modern salmon experienced a genome duplication event about 25-100 million years ago (mya) (Allendorf and Thorgaard, 1984), resulting in four copies of each chromosome and, hence, four copies of every gene. In a process that is still proceeding, the genomes of most of the species in the family have reverted, i.e. the chromosomes mostly behave in a diploid fashion. Duplicate loci may become nonfunc- tional through the accumulation of mutations while the other copy maintains the original function. Indeed, approximately 50% of the additional loci created by the doubling of the genome in salmonids are no longer detectable by their protein products (Allendorf and Thorgaard, 1984). However, extra copies of many genes do remain~ This polyploidization and subsequent 'diploidization' has been documented in other fish species as well (Wolf et al, 1969; Ferris and Whitt, 1977). Polyploidy, ancestral or otherwise, can cause some problems when it comes to searching for and interpreting DNA level variation. For instance, if it is unknown whether the DNA of interest is present in two copies, or four (or more) copies, the interpretation of molecular variation is often complicated.

DNA-level variation

Variation at the DNA level can be generalized into two categories: base substitutions and insertions/deletions. The simplest form of variation is a single nucleotide substitution or point mutation, where one nucleotide is substituted for another. A change this small may seem insignificant, but a single nucleotide substitution in the human haemoglobin gene results in the single amino acid change in haemoglobin that is responsible for sickle cell anaemia. In this case, a change in one out of 4 billion nucleotides makes a dramatic


difference to the individual. Given that there are only four nucleotides that constitute DNA, it follows that there are only three possible substitutions that can occur in a point mutation; however, all outcomes are not equally likely to occur. A substitution from a purine to a purine or from a pyrimidine to a pyrimidine is known as a transition, whereas a substitution from a purine to a pyfimidine, or vice versa, is known as a transversion. If substitutions were completely random, one would expect transversions to occur twice as often as transitions (a substitution from A to G would be a transition, whereas A to C and A to T are both transversions). Yet among closely related organisms, the opposite is true: transitions occur more often than do transversions. How much more often depends upon the particular DNA sequence and the time since the sequences being compared have shared a common ancestor.

The other type of change that can occur within a D N A sequence is an insertion or deletion of one or more nucleotides. The terms 'insertion' and 'deletion' are relative descriptions - that is, they are used to describe differences between two or more sequences. The actual insertion/deletion can be a single nucleotide, or it can be hundreds or thousands of nucleotides long. The sequence on either side of an insertion or deletion is identical in the two regions being compared. A common type of insertion/deletion mutation is copy number variation. Again, the sequence on either side of the variant region is the same in different individuals; however, the variation results from a difference in the number of copies of a basic unit, or core sequence, and hence, in the overall length of the insertion/deletion (see description of VNTR's p. 289). Another type of insertional variation is seen with the incidence of insertion of some multi-copy elements (e.g. Alu sequences). Some of these elements display a high degree of polymorphism at specific insertion sites (Perna et al., 1992; Novick et aL, 1993).

Hybridization of DNA molecules

In native conditions, DNA virtually always exists as a double-stranded molecule with two complementary strands (Watson et al., 1992). The hydrogen bonds can be broken, however, and the strands separated, or denatured, simply by heating (Doty et al., 1960). No chemical change takes place so, as the DNA cools, the complementary strands will eventually anneal, or come back together again. Under experimental conditions, hybrid D NA molecules can be formed between two strands of D N A from different individuals that have some fraction of mismatched base pairs (Schildkraut et al., 1961); annealing of two non-identical strands is called hybridization. The stability of the association of two strands that are not perfectly complementary depends on factors such as percent of mismatch, length of sequence, or temperature. Researchers can manipulate experimental conditions to promote or prevent the hybridization of DNA molecules depending on the degree of complementarity. This has important implications for many of the methods used to study DNA. Southern blotting, PCR, and DNA sequencing are all methods that depend upon DNA hybridization/annealing.

DNA-level research in fish is still in its infancy, so existing databases of D N A sequences are relatively depauperate in fish sequences of any sort; however, a fair amount of comparative data is available, and until more data have been accumulated for fisheries species, we must extrapolate from information on other organisms. Trends deduced through comparisons of the DNA sequences from humans, frogs, fruit flies, and plants are likely to hold true for fish as well. This information is used to construct

280 Park and Moran

universal PCR primers that amplify an orthologous gene in a wide range of organisms (Koeher et al., 1989; Park et a t , 1993). The primers are designed for conserved sequences that flank a region that is more variable. This approach has also been used to study specific genes and regions associated with coding sequences (Devlin, 1993; Forbes et al., 1994).

Molecular genetic techniques

This section presents a broad overview of techniques currently being implemented for molecular genetic research in fisheries. We wish to emphasize that this is not intended as a laboratory manual nor even as an exhaustive treatment of the techniques available - there are many more sophisticated permutations of the basic techniques described here. A simplified molecular explanation of various methods is presented, along with comparisons of techniques that take into account practical considerations (what kind of information is provided, what the strengths and limitations of the technique are, etc.). For more information and for detailed lab protocols, there are many excellent laboratory manuals currently available (Aebersold et al., 1987; Sambrook et aL, 1989; Hillis and Moritz, 1990; Ausubelle et al., 1993).

The foundation of most modern molecular techniques rests on two fundamental procedures. The first is the separation of DNA fragments with the intent of isolating or visualizing a particular fragment(s) of interest, and the second is the manipulation of molecules through the use of various enzymes (this applies mainly to DNA techniques). To date, the major separation technique has been gel electrophoresis, though more sophisticated methods (size fractionation columns, magnetic bead separation, etc.) are becoming available (Ahmed et al., 1992; Espelund and Jakobson, 1992; Fitzgerald et aL, 1992). As far as enzymatic manipulation, there are three principal classes of enzymes that are most important to understand: restriction enzymes, used to cleave DNA; polymerases, used to synthesize new strands of DNA; and ligases, used to join two strands of DNA together. Other types of enzymes exist, but are not critical to as many applications as those mentioned above.

G E L E L E C T R O P H O R E S I S

The principle of electrophoresis is the same in protein analyses and DNA studies: the separation of macromolecules in an aqueous solution when exposed to an electric field. In protein electrophoresis, alternative forms of a given protein are separated based on differences in their net charge (a function of their amino acid sequence), size and shape. DNA molecules are all negatively charged, thus DNA fragments are separated based on differences in size and shape alone. In what can be viewed as a molecular sieving process, small fragments move through the gel relatively quickly, whereas larger fragments are inhibited by the gel matrix and thus move more slowly. Isozymes are usually run on starch gels; DNA is typically run on either agarose or polyacrylamide gels, depending on the size of the fragments being separated. Isozymes are stained with a wide variety of stains, depending upon the locus being visualized. Typically for DNA, fragments in a gel are visualized by staining with a dye such as ethidium bromide. When exposed to ultrav- iolet light, ethidium bromide bound to DNA will fluoresce, producing a bright orange image against a dark background. Staining with silver oxide has also become more common. Silver staining of DNA fragments produces dark images that are visible in ambient light.


DNA staining methods are non-specific means of detecting D N A fragments; that is, they stain all DNA fragments present, and do not distinguish one sequence from another. When relatively few fragments are to be visualiTed on all electrophoretic gel, these are simple, convenient procedures. Restriction digests of small DNA fragments which result in a limited number of discrete fragments can be stained and visualiTed directly by this approach; PCR products are also amenable to this technique. Total genomic DNA, however, is a different matter. The eukaryotic genome is so large that digestion with a typical restriction enzyme produces hundreds of thousands, or millions, of fragments. When these are stained, no discrete fragments are visible: rather, the DNA appears as a continuous smear on the gel with a wide spectrum of sizes present. To examine RFLPs (restriction fragment length polymorphisms - p. 282 ) in nuclear DNA, it is necessary to visualize only particular fragments and exclude the many thousands of others that comprise the smear. The hybridization of Southern blots with specific probes provides such a method (Southern, 1975).

In this procedure, DNA fragments are separated by gel electrophoresis. Rather than using a stain and visualizing the fragments directly, however, a labelled probe is used that is complementary to the fragment of interest. In the case of DNA research, a probe is generally a cloned segment of DNA with a sequence homologous to the DNA of interest, though recently, PCR products and synthetic oligonucleotides are gaining more use as probes. The genomic fragments in the gel are denatured into single strands, transferred (blotted) onto a solid support, and exposed to a solution containing the labelled probe. The Probe is subsequently washed away, but some of it will anneal, or hybridize, to the fragments that exhibit sufficient complementarity. Becausse the probe is labelled, visuali- zation of the label (radionucleotide, fluorescent tag, etc.) will reveal only the fragments of interest. Conditions can be manipulated to allow the use of probes with only limited sequence similarity to particular fragments. Many such probes have been isolated from a vast array of organisms, and if enough sequence similarity exists between sequences of the fish and the organism from which the probe was isolated, hybridization will occur between the fish DNA and the probe. This permits a gene from one species to be used to study the same gene in another species. A probe may hybridize at a single position on a single chromosome or at two or more positions in the genome. A probe that exhibits the latter pattern is referred to as a 'multilocus probe' and is often derived from a repeat element.

R E S T R I C T I O N E N Z Y M E S

Restriction enzymes are used to cut, or digest, DNA strands at locations that are specific to each enzyme. An enzyme recognizes a particular sequence, usually four to eight nucleotides long, deemed its recognition site. The enzyme will cleave a DNA strand each time that recognition site occurs (Fig. 2(a)), resulting in a number of DNA fragments. Many enzymes cut DNA in an asymmetric fashion; that is, they don't cut both strands of the molecule in the same place. Thus, the ends of the two pieces of DNA created by the restriction enzyme will have short single-stranded 'overhangs' that are characteristic of the individual enzyme (Fig. 2(b)). These overhangs are known as 'sticky ends' because fragments that have been cut by the same enzyme will have identical ends and can be joined with each other (see section on ligases).

In addition to being a general tool for recombinant 'cutting and pasting' of DNA molecules, restriction enzymes can be used to detect DNA variation between individuals

282

EcoRIsites~/~ (b)

Cleavage

Park and Moran

(c)

Electrophorefic separation

A B

m m m m u m m m

m

mmmm

mmmm m m m

Largest

Smallest

Fig. 2. Restriction enzyme digestion and electrophoretic separation of resulting DNA fragments. Suppose that a DNA molecule has three EcoRI sites as in (a). At every position in the DNA molecule where the sequence GAATrC occurs (open rectangles), the restriction enzyme will cleave as in Co), producing, in this case, four fragments separated on an agarose gel (lane A in (c)). If an alternative allele exists in the population that lacks the circled restriction site in (a), the two middle fragments in the A profile will not be cleaved and will be seen as the single larger fragment in the B profile.

and between populations. Fragments produced by a restriction digest can be separated by gel electrophoresis, and differences in the pattern of the fragments between individuals are called restriction fragment length polymorphisms (RFLPs) (Fig. 2(c)). An RFLP may result from a base substitution that causes the gain or loss of a restriction site, or from an insertion/deletion mutation (often a reflection of copy number variation in a repeat array contained within a restriction fragment). If a base substitution occurs in the recognition sequence of a particular restriction site, the enzyme will no longer cleave the DNA at that position, producing a single large fragment rather than two smaller ones (Fig. 2(c)). Conversely, a base substitution might result in the creation of a recognition site, and a large fragment will be digested into two smaller fragments. For a more detailed discussion of RFLP analysis, see Dowling et al. (1990).

P O L Y M E R A S E S

Polymerase enzymes are used in several molecular techniques, most notably in the polymerase chain reaction (PCR) and DNA sequencing. As indicated above, polymer-


ases catalyse the synthesis of new strands of DNA. However, DNA is not produced spontaneously; DNA polymerases can only catalyse the formation of a new strand of DNA in the presence of a preexisting DNA template, the new strand will be complementary to the sequence of the template, and synthesis can only occur in a 5’ to 3’ direction (Fig. 3). Furthermore, polymerases cannot initiate synthesis at any point, but can only add nucleotides to the end of a strand that is ‘bound’ to a template. To fulfil this requirement in experimental conditions, researchers use ‘primers’ - short (usually 10-30 nucleotides), single-stranded sequences that are complementary to the beginning of the sequence to be synthesized - to give the polymerase a starting, or ‘priming’, point for synthesis. Individual nucleotides are added to the primer sequence by the polymerase in a 5’ to 3’ direction to form a new chain. This reaction is remarkably fast; nucleotides are added to the growing strand at a rate of 50-100 per second. More complete explanations of polymerases can be found in texts such as Lewin (1990) or Watson et al. (1992). Many different types of polymerases have been identified and isolated, but the most revolutionary of these are the thermostable polymerases.

PCR The first thermostable polymerase identified was originally isolated from geothermal vent organisms. Polymerases of this type are able to withstand high temperatures that would normally inactivate most enzymes. A technique that has taken advantage of the heat- stable nature of these polymerases is the polymerase chain reaction, or PCR (MuIlis et aL, 1986; Saiki et al., 1988). PCR is a rapid and simple method used to amplify a particular sequence of DNA, and is among the most significant advances in molecular biology in recent years. In PCR, a minute amount of DNA serves as a template for producing copies of a particular sequence of interest. The template is combined with two primer sequences and the four nucleotide subunits in the presence of a thermostable polymerase. The reaction is heated until the two strands of the DNA template dissociate, or denature, and become single-stranded. The reaction is then cooled, allowing the primers to anneal to the template. The primers are designed such that they are complementary to sequences

Fii. 3. Generalized schematic of polymerase eoyme activity. The ellipse m&s the enzyme moving from left to right along a single-strauded DNA template below it. Nucleotides, free in solution, are bound by the polymerase and added to the primer (shaded) to form the compk~~~tary strand, All known polymerases require a free 3’ hydroxyl group and tbereke will only p@merke in the 5’ to 3’ direction (left to right in the example above).

284 Park and Moran

that flank the region to be amplified. One primer is made complementary to one strand, while the second primer is complementary to the other strand. Furthermore, the primers are designed so that when DNA synthesis occurs (in a 5' to 3' direction), it occurs across the region of interest and towards the other primer, forming two new double-stranded DNAs from the original template (Fig. 4). This entire process is repeated over and over, with the newly synthesized strands becoming templates for further synthesis in subsequent cycles of replication (hence the term 'chain reaction'). Because the DNA sequence of interest is doubled at each cycle, 30 cycles result in greater than a millionfold increase in the concentration of the target sequence. This technique enables researchers to study DNA sequences when only minute samples of tissue are available. This has important applications in fisheries research. For example, specific DNA sequences can be amplified and studied from archived material, such as scales or museum specimens. PCR also enables non-destructive assaying of valuable or scarce individuals by providing the means to analyse small samples of fin or scale tissue. In addition, PCR has been used as a detection method for the presence of pathogenic bacteria and viruses in hatchery/aquaculture situations (Winton, 1992; Knibb et al., 1993). For additional practical considerations and

Original template

1 Denature

2 Anneal primers ~ mmm

Extend primers ~ ' I

Denature and anneal

m m

i

m m

5 Extend primers

Fig. 4. Diagrammatic representation of the polymerase chain reaction (pCR). The DNA template is heat-denatured (step 1) followed by cooling, which allows short synthetic primers to anneal to each of the complementary strands (2). The primers are then extended by a thermostable polymerase, resulting in duplication of the template (3). This heating and cooling cycle is repeated 20 to 40 times (4). In each cycle, the newly synthesized DNA strands become templates for the next replication (5), thus producing over a millionfold amplification of the original target sequence. Because of its sensitivity, PCR allows genetic typing from minute tissue samples such as a few scales or tiny fin clips.


example applications of PCR, see Innis et al. (1990). Variation in PCR conditions (e.g. amount of template, magnesium concentration) can also give inconsistent results in the number or even the presence/absence of bands (Ellsworth et al., 1993).

Sequencing

In addition to their use in PCR, DNA polymerases are also used in direct sequencing of DNA. The most common method of DNA sequencing is the dideoxy-termination method (Sanger, 1979). In this procedure, a primer is used to initiate synthesis of new strands of DNA; unlike PCR, however, only one primer is used and thus only one of the two strands is synthesized. In addition to the regular nucleotides used in a normal synthesis reaction, modified (dideoxy) nucleotides are added to a sequencing reaction. The modification of these nucleotides prevents the formation of the phosphate bond that would link the next nucleotide of the chain, thus synthesis is terminated upon the addition of a modified nucleotide (hence the term 'dideoxy-termination'). A sequencing reaction comprises four identical synthesis reactions carried out in separate tubes with a different modified nucleotide added to each of the four tubes. All four regular nucleotides are present in each tube, but the modified nucleotides are present in a ratio that favours their incorporation at a low frequency. For simplicity's sake, we will consider just the reaction containing the dideoxy-C nucleotide (abbreviated ddCTP). The primer anneals to the template and the polymerase begins to synthesize a new strand of DNA. When the incorporation of a C-nucleotide into the new strand is required, the polymerase may add the regular nucleotide, in which case polymerization continues, or a ddCTP may be added, resulting in termination of synthesis (Fig. 5(a)). Each time a C is to be incorporated into the strand, a small fraction of the synthesis reactions will be terminated. The result is a population of fragments of different sizes, each corresponding to the distance of a C-nucleotide from the primer. These fragments are labelled by either radioactive or fluorescent detection methods, and when the fragments from the four different tubes (each incorporating a different dideoxy nucleotide) are separated side-by- side on a high-resolution electrophoretic gel, their relative positions reveal the sequence in which the nucleotides are encountered by the polymerase (Fig. 5(b)).

Sequencing long stretches of DNA or numerous templates has become more feasible with the advent of cycle and automated sequencing. Cycle sequencing is a combination of PCR and sequencing where the annealing and extending steps are performed over and over using the same template (similar to how PCR amplifies a large amount of product from the same template). This enables sequencing from a much smaller amount of template than with the standard protocol. Unfortunately, it also combines the vagaries of both techniques and often requires a lot of optimization. Automated sequencers use different coloured, fluorescently labelled, dideoxy terminators that enable all four sequencing reactions to be run in a single lane. The sequencers are extremely expensive, however (more than S100000 US), and their cost prohibits their widespread use.

L 1 G A S E S

The last of the three principal categories of enzymes used to manipulate DNA is the ligase class. As indicated above, these enzymes are able to join two strands of DNA together. Typically, ligases are used by the cell to repair breaks in the sugar-phosphate backbone of damaged DNA molecules, or in some cases, to synthesize new strands of DNA by joining larger fragments. Like polymerases, ligases do not act spontaneously;

286 Park and Moran

temp~te ~ ~ ~ T ~ T ~ T ~ pHmer

Add nucleotides and polymerase

ddG ddA ddT ddC Template/Product

dd~?l~T~_

dd999T ~gT g-_ dd99Tg99TA, gTg_

(b) Sequencing gel

Labelled strands G A TC A -- d~C?TCC?T'A?TC=

ddC C m ! | i i l | i i I | i

G m d d , G . , , , , , , , , ~

T m m d d ' r , , . , , , . , , ~

i ddC C m I I I I I I I J

ddC C m m ' ' ' ' ' ' ' ~ .

ddG G m m ' ' ' ' ' ~ .

ddT T m ' ' a ' '

ddA

Fig. 5. Sanger dideoxy chain termination sequencing. (a) Illustrates the products of the sequencing reaction taking place in the ddC tube. The polymerase extends the primer, randomly incorporating either a normal dC base or a modified ddC base. At every position where a didcoxy-C nuclcotide (ddCTP) is inserted, polymerization terminates, resulting in a population of fragments of different lengths; the length of each is a function of the relative distance of the modified base from the primer. Co) Electrophoretic separation of the products of all four reaction tubes above (ddG, ddA, ddT and ddC), run in individual lanes. The bands on the gel represent the respective fragments shown to the right. The sequence to the left of the gel (read from bottom to top) is the complement of the original template.

with a few exceptions, ligases only act on double-stranded molecules, and only on one strand of a molecule at a time. The two ends to be joined must be bound adjacent to one another on the complementary strand. The ligase creates the bond between the two nucleotides on the ends 6T the two strands, forming one contiguous piece of DNA. Often ligases are used to join pieces of DNA that have been digested with the same restriction enzyme and thus have identical 'sticky ends'.

A major application of ligases is in molecular cloning. Like PCR, cloning is a method of amplifying a particular DNA sequence of interest so that it may be studied further - sequenced, cut with restriction enzymes, etc. Cloning involves the insertion of the desired DNA fragment into self-replicating constructs known as vectors. Vectors are simply DNA molecules that have the ability to enter into a bacterial host (yeast is also used in


specialized applications) and multiply along with the host as it replicates itself. In this way, we take advantage of the exponential growth of a bacterial culture to amplify specific pieces of DNA. A large variety of highly engineered vectors are available for a wide range of uses. In a typical case, the vector is cleaved with a restriction enzyme, as is the piece of DNA to be cloned. When the DNA of interest is combined with the cleaved vector, the respective 'sticky ends' created by the restriction enzyme will come together. Aligase can then join the two pieces of DNA, and the insert becomes part of the vector, to be amplified when inserted into a bacterial host.

In a different type of application, ligase has been used to assay for previously ident- iiied point mutations in specific fragments of DNA. The oligonucleotide ligation assay (OLA) uses the ligation of two DNA fragments to indicate the presence of a particular nucleotide at a given point in a sequence (Nickerson et al., 1990). Briefly, in the presence of ligase, small oligonucleotides (single-stranded DNA around 20-30 nucleotides in length), or oligos, that are complementary to adjacent sequences of a template are annealed to the DNA to be assayed. The oligos are designed so that the point mutation occurs at the juxtaposition of the adjacent ends. If the oligos are completely complementary to the target sequence, including the mutated nucleotide, then ligation will OCCUr.

Comparison of various molecular methods for fisheries applications

As can be seen from the above descriptions, a very wide range of techniques is now available for looking at fisheries genetic questions. Choosing which technique to use is heavily dependent on the question being addressed, and the trade-offs between various methods often make this decision a difficult one. It is best to keep in mind that the technique and the question must share a 'window' of resolution, i.e. it is not useful to be able to discriminate individuals from one another (say, with DNA fingerprinting) when addressing a question at the between-population level.

The wealth of isozyme data that currently exists for many fishes gives a considerable advantage to researchers planning new isozyme studies with these species. Many systems have been optimized and researchers can make an informed guess as to where their efforts should be directed in order to maximize results. Isozyme analysis has been the standard molecular technique in population genetic research and this technique has been enormously successful for three primary reasons. First, it is inexpensive, particularly relative to other molecular genetic methods. Although it is difficult to generalize cost on a per sample, per locus basis due to the variation in the cost of particular stains, on a production scale, a single fish can be analysed for 20-100 loci for between five and ten dollars (SUS) worth of chemicals (P. Aebersold, pets. comm.). The second major asset of protein electrophoresis is that the method allows for quick processing times. A laboratory can assay hundreds of samples per day for many different loci, and this translates to low labour costs as well. Although scoring of isozymes takes experience, Mendelian inheritance of variant electromorphs can usually be inferred with reasonable confidence; however, reproducibility of results between laboratories cannot be taken for granted (Shaklee and White, 1991). The third principal asset of isozyme analysis is not inherent to the method itself, but is nevertheless quite important. Isozyme data often constitute the largest existing genetic data set for many organisms, both within and between species. Electrophoresis buffer/stain systems are generally useful across broad taxonomic groups,

288 Park and Moran

from fish to decapods to molluscs (Menzies, 1981; Mitton and Koehn, 1985; Todd and Hatcher, 1993; Ward and Elliott, 1993). While DNA isolation and manipulation methods are generally the same between organisms, primers and probes that work on a wide range of organisms can require much more optimization, as they can be affected by genome organization/composition (e.g. amount of repetitive DNA, gene duplications).

Unfortunately, protein electrophoresis has a few drawbacks that make it less than ideal in some situations. Tissue collection and storage are of tantamount importance because protein electrophoresis can only assay enzymatically active proteins; in many field collection situations, this can pose a problem. Furthermore, many important loci are assayed from organs such as the heart or liver, and thus may require killing the animal (though this is not always necessary for isozyme analysis; Morizot et al., 1990). In hatchery situations, killing animals is not a large concern, but when assaying rare or endangered populations, it is not an option, especially in light of the number of samples necessary to make statistically valid inferences about genetic structure. Protein electrophoresis also surveys such a small portion of the genome that sufficient variation may not exist in assayable loci to discriminate between recently diverged populations.

As mentioned earlier, DNA methods have been investigated for their utility in addressing problems that have proven intractable with isozymes. However, for organisms that have an existing isozyme database, a number of factors should be considered before turning to DNA methods over protein electrophoretic analysis. One of the most critical factors, and one that is often overlooked, is the time frame for generating data. Because organisms other than the most commercially important species have little in the way of existing DNA data, a researcher may find that he/she must make several attempts (various probes, different parts of the genome, different primers, etc.) to find a suitable (in terms of degree of polymorphism) genetic marker for a particular species. This is, of course, true for isozymes as well, but many more data have been amassed for a wider range of organisms and large numbers of loci can be screened rapidly. In cases where data need to be generated immediately, protein electrophoresis is often the most viable option. For instance, the genetics laboratories at the Northwest Fisheries Science Center have access to extensive isozyme databases for five species of Pacific salmon. Petitions have been filed to list populations of all five of those species under the U.S. 'Endangered Species Act'. Although we have generated DNA markers for most species of Pacific salmon, we lack a sufficient database, spatially and temporally, to address the petitions in the time frame required (1 year after filing). Research on DNA markers is proceeding in several laboratories in the Pacific north-west, including ours, and several markers relating specifically to petitioned and listed populations have been identified, but the bulk of the genetic analysis for these petitions continues to be conducted via protein electrophoresis. That is not to say that DNA research should not be pursued - on the contrary! We hope that the DNA-based genetic data continue to grow at an exponential rate; however, we would like to stress that it isn't always necessary to jump onto the DNA 'bandwagon'.

When DNA-level research is deemed appropriate, whether in conjunction with or in lieu of protein electrophoresis, careful thought should be given to the methods chosen: should you use mtDNA or nDNA? VNTRs or specific genes? PCR or RFLPs (or both)? Several factors should influence your decision. Figure 6 and Table 1 help to summarize the differences between several of the techniques mentioned here. Figure 6 illustrates the kind of variation that can be assayed with each of the methods listed. Table 1 compares several combinations of methods/types of DNA for practical issues as well as types of

Developments in molecular genetic techniques

1. ACTACTACTACTACTACTACTGAATFC . . . . 1000bp-- -GTTTACAATGGTG

2. ACTACTACTACTACTACTGAATrC . . . . 1000bp- - -GITTACAATGGTG

3. ACTACTACTACTACTC~ZkA TTC . . . . 1000bp---GTTTACAATGGTG

4. ACTACTACTACTACTGAACTC . . . . 1000bp---GTTTAGAATGGTG

5. ACTACTACTACTACTGAACTC . . . . 1 O00bp---GTTTATAATGGTG

OLA microsatellites allele-specific PCR VNTRs RFLPs RAPDs sequencing

1 1,2,3 1,2,3 1 2 4,5 4 2

3,4,5 5 3 4 5

289

Fig. 6. Alternative molecular methods differ markedly in their ability to detect various types of DNA sequence polymorphism. Above are examples of five different sequences that represent alternative alleles at a particular locus. A number of molecular techniques are listed, followed by an indi- cation of their ability to discriminate the various DNA sequences, For example, a microsatellite assay would distinguish only three of the five alleles, grouping alleles 3, 4, and 5 together. An RFLP analysis would be unable to differentiate between the small microsatellite length differences and would group alleles according to presence/absence of the restriction site (underlined). The assays that depend on primer or oligonucleotide specificity will yield presence/absence of a band (or captured reporter) depending on the sequence at a particular site, but no information about the surrounding nucleotides. DNA sequencing would discriminate all five sequences as unique alleles; however, extensive sequencing is generally not practical for the kinds of large-scale population studies that are common to fisheries research.

questions that are appropriate for the level of resolution. For instance, the number of individuals to be assayed is an important factor to consider. A project that involves hundreds or thousands of samples should avoid using sequencing as the assay technique. Southern blotting and probing also slows down the data-collection process, therefore probing with single or multi-locus probes is not ideal, even with the ability to screen the same gel with several probes. As might be predicted, no one technique is optimal for everything. If at all possible, a strategy that combines several techniques and targets several types of sequences is advisable.

One class of VNTR loci, the mini.~atellites, has generated a great deal of interest in fisheries research (Wright, 1990; Franck et aL, 1991). These hypervariable sequences have generally been assayed by using Southern blot analysis with a conserved core repeat probe. The procedure widely known as 'DNA fingerprinting' reveals enormous variability in a wide range of organisms. Mutation rates and heterozygosities for these sequences are among the highest reported (Jeffreys et aL, 1988; Kelly et aL, 1990). The often individual-specific patterns produced with some minisatellite probes are ideal for parentage analysis and pedigree consm~etion. However, because multiple loci are assayed simultaneously, it is usually impossible to assign allelism to specific variant fragments. Without the ability to characterize allele frequencies among populations or to evaluate fits to Hardy-Weinberg equilibrium, much of the power of more traditional molecular methods, such as allozyme or mtDNA analysis, is lost. Multilocus polymorphic markers

{}

° ~

O

O

8

t 8

o

¢1}

i

O

il: I-

~ Z ~ " D ~ 0

I~ Z t M

~ z ~

~ Z ~z~ Z Z

~Z

~ z ~ b z g ~ ~ A

~ Z ~ ' ~ov

~ ° v ~

Z

i b

i


(including RAPDs (Williams et al., 1991)) have been valuable in studies of highly inbred strains (Kuhnlein et aL, 1989, 1990; Brockman et al., 1993), however, their application to population genetic studies remains problematic (Lynch, 1988).

In an effort to simplify the complexity of multilocus DNA fingerprints, many researchers have sought to isolate particular VNTR loci for analysis (by a variety of means) independent of other repeat arrays with the same core sequence. These approaches are commonly used in humans (Litt and White, 1985; White et al., 1985; Nakamura et al., 1987; Hubert et al., 1992) but have only recently been extended to fishes (Taggart and Ferguson, 1990; Stevens et al., 1993). The dissection of individual loci looks especially interesting with respect to microsatellites (Litt and Luty, 1989; Tautz, 1989; Weber and May, 1989). These loci are amplified by PCR, and allelic variants are evident as differences in the sizes of PCR products. Primers for microsateUite loci have been successfully developed for salmonids and tilapiine fishes (Franck et al., 1991) and work is now in progress in a number of laboratories to extend this technique. Preliminary work in fishes indicates that there are many thousands of copies of the simple sequence repeats that comprise microsatellites and that in most species they appear to be dispersed throughout the genome. They are highly polymorphic with, for example, six to eight alleles at each of two loci in rainbow trout, Oncorhynchus mykiss (P. Bentzen, pers. comm.). One drawback to these markers, however, is that they are generally fairly narrow in taxon specificity.

PCR-based assays are proliferating rapidly and have become the star approach in molecular genetics research because of their speed of sample processing, their ability to sample non-destructively, their range of specificity, and their flexibility in terms of sample quality/quantity. However, though PCR is an amazingly flexible technique, it has a few limitations that would indicate the use of other techniques in some situations. Single-locus PCR assays require sequence information (to design the primers) that is not always available, or takes time to generate. With a limited database of sequences, it might take a long time to identify several loci that would be suitable for a given study. Another limitation of PCR that is often overlooked is the size of the fragments that can be amplified with this technique. Sequences longer than a few thousand base pairs are difficult to amplify, whereas cloning with appropriate vectors allows amplification of sequences that are tens or hundreds of thousands of base pairs in length. Thus, with Southern blotting and a cloned probe, one can assay larger stretches of sequences at once than with PCR. If variation is minimal, looking at small stretches of DNA using PCR may not be efficient. Larger fragments are also essential to the study of genome organization, as genes can often be thousands of base pairs in length. Finally, contamination of a PCR reaction by trace amounts of foreign DNA (i.e. DNA from another organism, previously amplified PCR product, etc.) may produce products indistinguishable from those produced or expected from the target DNA, or may even compete with the desired template if quan- tifies are limited (Kwok and Higuchi, 1989; P~i~ibo, 1989).

Sequencing obviously gives the highest level of resolution of any of the methods described. When combined with PCR, many nucleotides can be sequenced very rapidly. But nucleotides are only assayed in stretches of a few hundred at a time. If mutation occurs randomly only every thousand or so base pairs, a large proportion of a sequence may have to be surveyed to distinguish closely related individuals. Again, methods that assay larger portions of the genome or multiple loci at a time might be more fruitful in such situations. RFLP analysis surveys sequences in short stretches at a time (at the

292 Park and Moran

recognition sites), but can do so across thousands of base pairs at once. A sizable battery of restriction enzymes with different recognition sites can assay sequences fairly effi- ciently. Unfortunately, the technique depends upon the limitations imposed by gel electrophoretic separation of different-sized molecules. In a standard RFLP analysis, it can be difficult to distinguish fragments that vary from one another by fewer than 50 nucleotides. Thus, variation in restriction sites that occur within 50 nucleotides of each other might not be detected.

The above comparisons were obviously not an exhaustive list of all of the pros and cons of all the techniques, but should reveal the kind of factors that are important when considering methods to be used in a molecular genetic study. The techniques we have described are the fundamental building blocks of a vast array of more complex procedures. One project in our laboratory combines PCR, restriction digestion, and gel electrophoresis to search for variation in introns of specific genes. Another aspect of our research combines PCR with direct DNA sequencing to search for point mutations that we can survey via a ligase-based assay. Techniques are constantly evolving, and new methods of detecting variation - such as heteroduplex analysis, or single strand confor- mational polymorphisms - are constantly being developed. It is impossible to keep up with all of them. What is important is to understand the limitations of the general principles that we have described and to realize that most new techniques are permutations of a few basic ones.

The future of molecular genetics in fisheries

Despite the fact that molecular genetic tools have been used in fisheries research for over two decades, they are still in the early stages of development. Isozyme techniques are well established and have been exploited advantageously for many species; but the data and trained personnel for DNA-level research are just achieving the critical mass necessary for the area to make significant advances. Although not strictly fisheries related, the number of researchers using fish as model systems is increasing (Powers, 1989), and the accumulation of molecular data on fish species in general can only aid in fisheries- directed research. The range and availability of techniques are also increasing, and this will allow us to assay more loci, for more individuals, faster than ever before. In the near future, enough databases and markers will exist so that non-invasive (probably PCR- based) strategies will be employed to quickly characterize everything from hatchery fish to larval pelagic fish to individuals from endangered populations. But the impact of molecular genetics on fisheries will not stop there. Our ability to examine and manipulate molecules has increased phenomenally - if we choose, we can even make transgenic fish (Devlin, 1993), or express recombinant fish proteins (Moriyama et aL, 1993). Research using these techniques can help elucidate the roles of various genes in reproduction, growth, etc. Recently, it has been reported that a fish species (Fugu rubripes, Brenner et al., 1993) has one of the smallest and simplest vertebrate genomes known. If this becomes a model system for genome-level research, molecular genetic fisheries research should accelerate by leaps and bounds. This may sound too basic, with very little emphasis on application, but is not the behaviour of the genes and the molecules that are of real interest. All of these things combine to help increase our understanding of the biology of the organisms we study. For this reason, molecular genetic research should b e strongly supported, for it is vital to the long-term management of fisheries resources.


Acknowledgements

The authors would like to thank the reviewers and the editors for their extensive contrib- utions to this paper.

References

Aebersold, P.B., Winans, G.A., Teel, D.J., Milner, G.B. and Utter, F.M. (1987) Manual for starch gel electrophoresis: a method for detection of genetic variation. NOAA Tech. Rep. NMFS 61, 1-19.

Ahmed, A.R., Olivier, G.W., Adams, G., Erskine, M.E., Kinsman, R.G., Branch, S.K., Moss, S.H., Notarianni, L.J. and Pouton, C.W. (1992) Isolation and partial purification of a melanocyte- stimulating hormone receptor from B16 murine melanoma cells. A novel approach using a cleavable biotinylated photoactivated ligand and streptavidin-coated magnetic beads. Biochem. J. 286, 377-82.

Alberts, B., Bray, D., Lewis, J., Raft, M., Roberts, K. and Watson, J.D. (1983) Molecular Biology of the Cell, New York: Garland. 1146 pp.

Allendorf, F.W. and Thorgaard, G.H. (1984) Tetraploidy and the evolution of salmonid fishes. In Turner, B.J., ed. Evolutionary Genetics of Fishes. New York: Plenum Press, pp. 1-53.

Allendoff, F.W. and Utter, F.M. (1979) Population genetics of fish. In Hoar, W., Randall, D. and Brett, R., eds. Fish Physiology, Vol. 8 New York: Academic Press, pp. 136-87.

Allendorf, F.W., Ryman, N., Stennek, A. and Staid, G. (1976) Genetic variation in Scandinavian brown trout (Salmo trutta L.): evidence of distinct sympatric populations. Heriditas 83, 73-82.

Ausubelle, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (eds) (1993) Current Protocols in Molecular Biology. New York" Wiley.

Avise, J.C. (1986) Mitochondrial DNA and the evolutionary genetics of higher animals. Phil. Trans. R. Soc. 312B, 325--42.

Avise, J.C. (1994) Molecular Markers, Natural History and Evolution. New York: Chapman and Hall. 511pp.

Avise, J.C. and Smith, M.H. (1974) Biochemical genetics of sunfish. I. Geographic variation and subspecifie intergradation in the bluegill Lepomis macrochirus. Evolution 28, 42-56.

Avise, J.C., Helfman, G.S., Saunders, N.C. and Hales, L.S. (1986) Mitochondrial DNA differentiation in North Atlantic eels: population genetic consequences of an unusual life history pattern. Proc. Natl Acad. Sci. USA 83, 4350-54.

Banks, M.A., Waters, C. and Hedgeeock, D. (1993) Discrimination between closely related Pacific oyster species (Crassostrea) via mitochondrial DNA sequences coding for large subunit rRNA. MoL mar. Biol. Biotech. 2, 44-50.

Beacham, T.D., Withler, R.E. and Gould, A.P. (1985) Biochemical stock identification of chum salmon (Oncorhynchus gorbuscha) in southern British Columbia and Puget Sound. Can. J. Fish. aquat. Sci. 42, 1474.

Bentzen, P., Leggett, W.C. and Brown, G.C. (1988) Length and restriction site heteroplasmy in the mitochondrial DNA of American shad (Alosa sapidissima). Genetics 118, 509-18.

Bentzen, P., Harris, A.S. and Wright, J.M. (1991) Cloning of hypervarlable mini~atellite and simple sequence microsatellite repeats for DNA fingerprinting of important aquacultural species of salmonids and tilapia. In Burke, T., Doll, G.A., Jeffreys, J. and Wolf, R., eds. DNA Finger- printing Approaches and Applications. Basel: Birkhauser Verlag, pp. 243-62.

Bentzen, P. and Wright, J.M. (1993) Nucleotide sequence and evolutionary conservation of a minisatellite variable number tandem repeat cloned from Atlantic salmon. Salmo salar. Genome 36, 271-7.

Brenner, S., Elgar, G., Sandford, R., Macrae, A., Venkatesh, H. and Aparicio, S. (1993) Character-

294 Park and Moran

ization of the pufferfish (Fugu) as a compact model vertebrate genome. Nature, Lond 366, 265-8.

Britten, R3. and Kolme, D. (1968) Repeated sequences in DNA. Science 161, 529-40. Brockmann, (3., Buitkamp, J., Bunger, L., Epplen, J.T. and Schwerin, M. (1993) DNA finger-

printing of trait-selected mouse lines and linkage analysis in reference families. EXS 6I, 403- 10.

Brown, 3.R. Beckenbach, A.T. and Smith, M.J. (1993) Intraspecific DNA sequence variation in the mitochondrial control region of white sturgeon (Acipenser transmontanus). MoL Biol. Evol. 10, 326-41.

Brown, W.M., George, M. jun. and Wilson, A.C. (1979) Rapid evolution of mitochondrial DNA. Proc. Natl Acad. Sci. USA 76, 1967-71.

Buth, D.(3. (1990) Genetic principles and the interpretation of electrophoretic data. In Whitmore, D.H., ed. Electrophoretic and lsoelectric Focusing Techniques in Fisheries ManagemenL Boston: CRC Press, pp. 1-21.

Carr, S.M. and Marshall, H.D. (1991) Detection of intraspecific DNA sequence variation in the mitochondrial cytochrome b gene of Atlantic cod (Gadus morhua) by the polymerase chain reaction. Can. J. Fish. aquat. Sci. 48, 48-52.

Carvalho, (3.R. and Hauser, L. (1994) Molecular genetics and the stock concept in fisheries. Rev. Fish Bio£ Fish. 4, 326-50.

Cronin, M.A., Spearman, W.J., Wilmont, R.L., Patton, J.C. and Bickham, J.W. (1993) Mitochon- drial DNA variation in chinook (Oncorhynchus tshawytscha) and chum salmon (O. keta) detected by restriction enzyme analysis of polymerase chain reaction (PCR) products. Can. J. Fish. Aquat. ScL 50, 708-15.

Devlin, R.H. (1993) Sequence of sockeye type I and 2 growth hormone genes and the relationship of rainbow trout with Atlantic and Pacific salmon. Can. J. Fish. aquat. Sci. 50, 1738-48.

Doty, P., Marmur, J., Eigner, J. and Schildk_raut, C. (1960) Strand separation and specific recombination in deoxyribonucleic acids: physical chemical studies. Proc. Nail Acad. Sci. USA 47, 461-76.

Dowling, T.E., Moritz, C. and Palmer, J.D. (1990) Nucleic acids II: restriction site analysis. In Hillis, D.M. and Moritz, C., eds. Molecular Systematics. Sunderland, MA: Sinauer, pp. 250- 317.

Duguay, S.J., Park, L.K., Samadpour, M. and Dickoff, W.W. (1992) Nucleotide sequence and tissue distribution of three insulin-like growth factor I prohormone in salmon. Mol. Endocrin. 6, 1202-10.

Ellsworth, K., Rittenhouse, D. and Honeycutt, R.L. (1993) Artifactual variation in randomly amplified polymorphic DNA banding patterns. Biotechniques 14, 214-17.

Espelund, M. and Jakobson, K.S. (1992) Cloning and direct sequencing of plant promoters using primer-adapted mediated PCR on DNA coupled to a magnetic solid phase. Biotechniques I3, 74-81.

Fabrizio, M.C. (1987) Contribution of Chesapeake Bay and Hudson Bay stocks of striped bass to Rhode Island coastal waters as determined by isoelectric focusing of eye lens proteins. Trans. Am. Fish. Soc. II6, 588.

Fenis, S.D. and Whitt, (3.S. (1977) Loss of duplicate gene expression after polyploidization. Na- ture, Lond. 265, 258-60.

Fitzgerald, M.C., Skowron, P., Van Etten, J.L., Smith, L.M. and Mead, D.A. (1992)Rapid shotgun cloning utilizing the two base recognition endonuclease CviJI. Nucleic Acids Res. 20, 3753-62.

Forbes, S.H., Knudsen, K.L. and Allendorf, F.W. (1994) Genetic variation in cobo salmon detected by PCR amplification of growth hormone gene introns. In Park, L.K., Moran, P. and Waples, R.S., eds. Applications of DNA technology to the management of Pacific salmon. U.S. Dept Commer., NOAA tech. Memo. (in press).

Franck, J.P.C., Harris, A.S., Bentzen, P., Denovan-Wright, E.M. and Wright, J.M. (1991) Organi-


zation and evolution of satellite, minisatellite and microsatellite DNAs in teleost fishes. In Maclean, N., ed. Oxford Surveys on Eukaryotic Genes, Vol. 7. Oxford: Oxford Univ. Press, pp. 31-82.

Geller, J.B., Carlton, J.T. and Powers, D.A. (1993) Interspecific and intrapopulation variation in mitochondrial ribosomal DNA sequences of Mytilus spp. (Bivalvia: Mollusca). Mol. mar. Biol. Biotech. 2, 44-50.

Grant, W. (1984) Biochemical population genetics of Atlantic herring. Copeia 1984, 357-64. Grant, W.S. and Utter, F.M. (1980) Biochemical genetic variation in walleye pollock (Theragra

chalcogramma) and population structure in the southeastern Bering Sea and Gulf of Alaska. Can. J. Fish. aquat. Sci. 37, 1093-1100.

Grant, W.S., Teel, D.J. and Kobayashi, T. (1984) Biochemical population genetics of Pacific halibut (Hippoglossus stenolepis) and comparison with Atlantic halibut (H. hippoglossus). Can. J. Fish. aquat. Sci. 41,1083-8.

Gyllensten, U., Wharton, D., Josefsson, A. and Wilson, A.C. (1991) Paternal inheritance of mito- ehondrial DNA in mice. Nature, Lond 352, 255-7.

Hillis, D.M. and Moritz, C. (1990) Molecular Systematics. Sunderland, Ma: Sinauer. 588 pp. Hubert, R., Weber, J.L., Schmitt, K., Zhang, L. and Arnheim, N. (1992) A new source of polymor-

phic DNA markers for sperm typing: analysis of microsatellite repeats in single cells. Am. J. hum. Gent. 51, 985-981.

Hunter, R. and Markert, C. (1957) Histochemical demonstration of enzymes separated by zone electrophoresis in starch gels. Science 125, 1294-5.

Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. (1990) PCR Protocols: a Guide to Methods and Applications. San Diego, Ca: Academic Press. 482 pp.

Jeffreys, A.J., Wilson, V. and Thein, S.L. (1985a) Hypervariable 'minisatellite' regions in human DNA. Nature, Lond 316, 67-73.

Jeffreys, A.J., Wilson, V. and Thein, S.L. (1985b) Individual-specific 'fingerprints' of human DNA. Nature, Lond 316, 76-9.

Jeffreys, A.J., Royle, N.J., Wilson, V. and Wong, Z. (1988) Spontaneous mutation rates to new length alleles at tandem repetitive hypervariable loci in human DNA. Natur~ Lond 332, 278- 81.

Kelly, R., Bulfield, G., Collick, A., Gibbs, M. and Jeffreys, A.J. (1989) Characterization of a highly unstable mouse minisatellite locus: evidence for somatic mutation during early development. Genomics 5, 844-56.

Knibb, W., Colorni, A., Ankaoua, M., Lindell, D., Diamant, A. and Gordin, H. (1993) Detection and identification of a pathogenic marine mycobacterium from the European seabass Dicen- trarchus labrax using polymerase chain reaction and direct sequencing of 16S rDNA sequences. Mol. mar. Biol. Biotech. 2,225-32.

Kocher, T., Thomas, W.K., Meyer, A., Edwards, S.V., Paabo, S., Villablanea, F.X. and Wilson, A.C. (1989) Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc. NatlAcad. Sci. USA 86, 6196-6200.

Kolin, A. (1955) Isoelectric spectra and mobility spectra: a new approach to electrophoretic separation. Proc. NatlAcad. Sci. USA 41, 101.

Kuhnlein, U., Dawe, Y., Zadworny, D. and Gavora, J.S. (1989) DNA fingerprinting: a tool for determining genetic distances between strains of poultry. Theor. appl. Genet. 77, 669-72.

Kuhnlein, U., Zadworny, D., Dawe, Y., Fairfull, R.W. and Gavora, J.S. (1990) Assessment of inbreeding by DNA fingerprinting: development of a calibration curve using defined strains of chickens. Genetics 125, 161-5.

Kwok, S. and Higuchi, R. (1989) Avoiding false positives with PCR. Nature, Lond 339, 237-8. Lewin, B. (1990) Genes IV. New York: Oxford Univ. Press. 857 pp. Lewontin, R.C. and Hubby, J. (1966) A molecular approach to the study of genic heterozygosity in

natural populations. II. Amount of variation and degree of heterozygosity in natural

296 Park and Moran

populations of Drosophila pseudoobscura. Genetics 54, 595-609. Litt, M. and Luty, J.A. (1989) A hypervariable microsatellite revealed by in vitro amplification of

dinucleotide repeat within the cardiac muscle actin gene. Am. J. Hum. Gen. 44, 397-401. Litt, M. and White, R.L. (1985) A highly polymorphic locus in human DNA revealed by cosmid-

derived probes. Proc. Natl AcacL Sci. USA 82, 6206-10. Lockwood, S.F., Dillinger, R.E. jun., Birt, T.P. and Snyder, T.P. (1993) Phylogenetic relationships

among members of the Coregoninae inferred from direct sequencing of PCR-amplified mitochondrial DNA. Can. J. Fish. aquat. Sci. 50, 2112-18.

Lundstrom. R.C. and Roderick, S.A. (1979) Fish-species identification by thin-layer isolectric focusing of sarcoplasmic proteins. Sci. Tools 26, 38.

Lynch, M. (1988) Estimation of relatedness by DNA fingerprinting. Mol. Biol. Evol. 5, 584-99. Lynch, M. and JarreU, P.E. (1993) A method for calibrating molecular clocks and its application to

animal mitochondrial DNA. Genetics 135, 1197,1208. Margoulas, A. and Zourous, E. (1993) Restriction site heteroplasmy in anchovy (Engraulis encrasi-

colus) incidental biparental inheritance of mitochondrial DNA. Mol. Biol. Evol. 10, 319-25. Markert, C.L. and Moller, F. (1959) Multiple forms of enzymes: tissue, ontogenetic, and species-

specific patterns. Proc. Natl AcacL Sci. USA 45, 753-63. May, B. and Krueger, C.C. (1990) Use of allozyme data for population analysis. In Whitmore,

D.H., ed. Electrophoretic and lsoelectric Focusing Techniques in Fisheries Management. Boston: CRC Press, pp. 157-71.

Menzies, R.A. (1981) Biochemical population genetics and the spiny lobster larval recruitment problem: an update. Proc. Gulf Carib. Fish. Inst. 33, 230-43.

Meyers, T.R., Sullivan, J., Emmenegger, E., FoileR, J., Short, S., BaRs, W.N. and Winton, J.R. (1992) Identification of viral hemorrhagic septicemia virus isolated from Pacific cod Gadus macrocephalus in Prince William Sound, Alaska, USA. DIS. aquat. Org. 12, 167-75.

Milinkovitch, M.C., Orti, G. and Meyer, A. (1993) Revised phylogeny of whales suggested by mitochondrial ribosomal DNA sequences. Naturg Lond. 361, 346-8. ~

Mitton, J.B. and Lewis, W.M. jun. (1985) Shell shape variation in the blue mussel, Mytilus edulis L., and its association with enzyme heterozygosity. J. exp. mar. Biol. Ecol. 90, 73-90.

Moran, P., Kornfield, I. and Reinthal, P.N. (1994) Molecular systematics and radiation of the haplochromine cichlids (Teleostei: Perciformes) of Lake Malawi. Copeia 1994, 274-88.

Moriyama, S., Duguay, S.J., Conlon, J.M., Duan, C., Dickhoff, W.W. and Pilsetskaya, E.M. (1993) Recombinant coho salmon insulin-like growth factor I. Expression in Escherichia coli, purification and characterization. Eur. J. Biochem. 218, 205-11.

Morizot, D.C. and Schmidt, M. (1990) Starch gel electrophoresis and histochemical visualiTation of proteins. In Whitmore, D.H., ed. Electrophoretic and lsoelectric Focusing Techniques in Fish- eries Management. Boston: CRC Press, pp. 23-80.

Morizot, D.C., Schmidt, M.E., Carmichael, G.J., Stock, D.W. and Williamson, J.H. (1990) Minimally invasive tissue sampling. In Whitmore, D.H., ed. Electrophoretic and lsoelectric Focusing Techniques in Fisheries ManagemenL Boston: CRC Press, pp. 143-56.

Mullis, K., Faloona, F., Scharf, S., Salki, R., Horn, G. and Erlich, H. (1986) Specific enzymatic amplication of DNA in vitro: the polymerase chain reaction. Cold Spring Harbor Sym. quant. Biol. 51, 263-73.

Murata, S., Takasaki, N., Saitoh, M. and Okada, N. (1993) Determination of the phylogenetic relationships among Pacific salmonids by using short interspersed elements (SINEs) as temporal landmarks of evolution. Proc. Natl Acac£ Sci. USA 90, 6995-9.

Nakamura, Y., Leppert, M., O'Connell, P., Wolff, R., Holm, T., Culver, M., Martin, C., Fujimoto, E., Hoff, M., Kumlin, E. and White, R. (1987) Variable number tandem repeat (VNTR) markers for human gene mapping. Science 235, 1616-22.

Nei, M. and Tajima, F. (1981) DNA polymorphism detectable by restriction endonucleases. Gen- etics 105, 207-17.


Nickerson, D.A., Kaiser, R., Lappin, S., Stewart, J., Hood, L and Laadcgr,m, U. (1990) Auto- mated DNA diagnostics using ELISA-based oligonudeotide ligation assay. Proc. Natl Acad. Sci~ USA 87, 8923-7.

Nielsen, J.L., Thomas, W.K., Gan, C. and Tupper, D. (1994) Intrapopulation differences found in California steelhead using direct sequence of mtDNA. In Park, L.K., Moran, P. and Waples, R.S., eds. Applications of DNA technology to the management of Pacific salmon. U.S. Dept Commer., NOAA tech. Memo (in press).

Novick, G.E., Gonzalea, T., Garrison, J., Novick, C.C., Batzer, M.A., Deininger, P.L. and Herrera, R.J. (1993) The use of polymorphic Alu insertions in human DNA fingerprinting. EXS 67, 283-91.

Ohno, S. (1974) Chordata 1: Protochordata, Cyclostomata and Pisces. Animal Cytogenetics 4, 1- 92.

Ohshima, K., Koishi, R., Matsuo, M., and Okada, N. (1993) Several short interspersed repetitive elements (SINEs) in distant species may have originated from a common ance,~-al retrovirus: Characterization of a squid SINE and a possible mechanism for generation of tRNA-derived retroposons. Proc. Natl. Acaa~ Sci. USA 90, 6260-4.

Okada, N. (1991) SINEs: short interspersed repeated elements of the eukaryotic genome. Trends Ecol. Evol. 6, 358-61.

Ovenden, J.R. (1990) Mitochondrial DNA and marine stock assessment. Aust. J. mar. Freshwat. Res. 41, 835-53.

Piiibo, S. (1989) Ancient DNA: extraction, characterization, molecular cloning, and enzymatic amplification. Proc. NatlAca~ Sci. USA 86, 1939-43.

Park, L.K., Brainard, M.A. and Dightman, D.A. (1993) Low levels of intraspecific variation in the mitochondrial DNA of chum salmon (Oncoryhnchus keta). Mol. mar. Biol. Biotech. 2, 362- 70.

Pasdar, M., Philfip, D.P. and Whitt, G.S. (1984) Linkage relationships of nine enzyme loci in sunfishes (Lepomis; Centrarchidae). Genetics 107, 435-46.

Perna, N.T., Batzer, M.A., Deininger, P.L. and Stoneking, M. (1992) Alu insertion polymorphism: a new type of marker for human population studies. Hum. Biol. 64, 642-8.

Powers, D.A. (1989) Fish as model systems. Natur~ Lond 246, 352-8. Saiki, R.K., Gelfand, D.H., Stoffel, S., Seharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and

Erlich, H.A. (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-90.

Salini, J. and Shaklee, J.B. (1988) Genetic structure of barramundi (Lates calcarifer) stock from northern Australia. Aust. J. mar. Freshwat. Res. 39, 317.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (eds.) (1989) Molecular Cloning; a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Lab. Press.

Sanger, F., Niclden, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibi- tors. Proc. Natl Aca~ Sci. USA 74, 5463-7.

Sartore, G., Stormont, C., Morris, B.G. and Grander, A.A. (1969) Multiple electrophoretic forms of carbonic anhydrase in red cells of domestic cattle (Bos taurus) and American buffalo (Bison bison). Genetics 161, 823-31.

Seeb, J.E. and Miller, G.D. (1990) The integration of allozyme and genomic manipulations for fish culture and management. In Whitmore, D.H., ed. Electrophoretic and Isoelectric Focusing Techniques in Fisheries Management Boston: CRC Press, pp. 265-79.

Schildkraut, C.L., Marmur, J. and Dory, P. (1961) The formation of hybrid DNA molecules, and their use in studies of DNA homologies. J. tool. Biol. 3, 595-6 17.

Shaklee, J.B. (1983) The utilization of isozymes as gene markers in fisheries management and conservation. In Isozymes: Current Topics in Biological and Medical Research, Vol. 11. New York: Alan R. Liss, pp. 213-47.

Shaklee, J.B. and White, B.A. (1991) Need for replicated electrophoretic analysis in multiagency

298 Park and Moran

genetic stock identification (GSI) programs: example from a pink salmon (Oncorhynchus gorbuscha) GSI fisheries study. Can. J. Fish. aquat. Sci. 48, 1391-407.

Shedlock, A.M., Parker, J.D., Crispin, D.A., Pietsch, T.W. and Burmer, G.C. (1992) Evolution of the ~lmonid mitochondrial control region. MoL Phylo. Evol. 1, 179-92.

Sick, K. (1961) Haemoglobin polymorphism in fishes. Nature, Lond. 192, 894-6. Singer, M.F. (1982) SINEs and LINEs: highly repeated short and long interspersed sequences in

mammalian genomes. Cell28, 433--4. Smith, A.C. and Clemens, H.B. (1973) A population study by proteins from the nucleus of bluefin

tuna eye lens. Trans. Am. Fish. Soc. 102, 578. Smithies, O. (1955) Zone electrophoresis in starch gels: group variations in the serum proteins of

normal individuals. Biochem. J. 61, 629-41. Southern, E.M. (1975) Detection of specific sequences among DNA fragments separated by gel

electrophoresis. J. tool Biol. 98, 503-17. Stevens, T.A., Withler, R.E., Goh, S.H. and Beacham, T.D. (1993) A new multilocus probe for

DNA fingerprinting in chinook salmon (Oncorhynchus tshawytscha), and comparisons with a single-locus probe. Can. J. Fish. aquat. Sci. 50, 1559-67.

Taggart, and Ferguson, A. (1990) Hypervariable minisatellite DNA single locus probes for the Atlantic salmon, Salmo salar. L. J. Fish. BioL 37, 991-3.

Tautz, D. (1989) Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Res. 17, 6463-71.

Todd, T.N. and Hatcher, C.O. (1993) Genetic variability and glacial origins of yellow perch (Perca flavescens) in North America. Can. J. Fish. aquat. Sci. 50, 1828-34.

Utter, F.M. (1991) Biochemical genetics and fishery management: an historical perspective. J. Fish Biol. 39 (Supp. A), 1-20.

Utter, F.M. and Ryman, N. (1993) Genetic markers and mixed stock fisheries. Fisheries 18, 11-21. Utter, F.M., Aliendorf, F.W. and May, B.P. (1976) The use of protein variation in the management

of salmonid populations. In Taber, R.C. and Brunnell, F., eds. Proc. 41st N. Am. Wildlife Conf., pp. 373-84.

Utter, F.M., Milner, G., Stir, G. and Teel, D. (1989) Genetic population structure of chinook salmon in the Pacific Northwest. Fishery Bull., U.S. 87, 239-64.

Waples, R.S. (1990) Temporal changes of allele frequency in Pacific salmon: implications for mixed stock fishery analysis. Can. Y. Fish. aquat. Sci. 47, 968-76.

Waples, R.S., Winans, G.A., Utter, F.M. and Mahnken, C. (1990a) Genetic monitoring of Pacific salmon hatcheries. In Genetics in aquaculture: proceedings of the sixteenth U.S.-Japan meeting on aquaculture, Mie, Japan. NOAA tech. Rep. NMFS 92, pp. 20-21.

Waples, R.S., Winans, G.A., Utter, F.M. and Mahnken, C. (1990b) Genetic approaches to the management of Pacific salmon. Fisheries 15, 19-25.

Ward, R.D. and Elliott, N.G. (1993) Heterozygosity and morphological variability in the orange roughy, Hoplostethus atlanticus (Teleostei: Trachichthyidae). Can. J. Fish. aquat. Sci. 50, 1641-9.

Ward, R.D. and Grewe, P. (1994) Appraisal of molecular genetic techniques in fisheries Rev. Fish Biol. Fish. 4, 300-25.

Watson, J.D., Gilman, M., Witkowski, J. and Zoller, M. (1993) Recombinant DNA, 2rid edn. New York: W.H. Freeman and Co. 626 pp.

Weber, J.L. and May, P.E. (1989) Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. Am. J. Hum. Gen. 44, 388-96.

Welsh, J. and McClelland, M. (1991). Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res. 18, 7213-18.

White, R., Leppert, M., Bishop, D.T., Barker, D., Burkowitz, J., Brown, C., Callahan, P., Holm, T. and Jeromiuski, L. (1985) Construction of linkage maps with DNA markers for human chromosomes. Nature, Long 313, 101-5.


Whitmore, D.H. (1986) Identification of sunfish species by muscle protein isoelectric focusing. Comp. Biochem. Physiol. 84B, 177.

Whitmore, D.H. (1990) I ~ focusing of proteins. In Whitmore, D.H., ed. Electmphoretic and Isoelectric Focusing Techniques in Fisheries Management. Boston: CRC Press, pp. 81- 105.

Whitmore, D.H., Cotton, R. and Sheridan, K. (1990) DNA fingerprinting. In Whitmore, D.H., ed. Electrophoretic and Isoelectric Focusing Techniques in Fisheries Management. Boston: CRC Press, pp. 131--41.

Williams, J.G.K., Kubelik, A.R., Lival, K.J., Rafalski, J.A. and Tingey, S.V. (1991) DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. NucleicA cids Res. 18, 6531- 5.

Wilson, A.C., Cann, R.L., Carr, S.M., George, M., Gyllensten, U.B., Helm-Bychowski, K.M., Higuchi, R.G., Palumbi, S.R., Prager, E.M., Sage, R.D. and Stoneking, M. (1985) Mitochon- drial DNA and two perspectives on evolutionary genetics. Biol. J. Linn. Soc. 26, 375-400.

Winans, G.A. (1980) Geographic variation in the milkfish Chanos chano& I. Biochemical evidence. Evolution 34, 558-74.

Winton, J.R. (1992) The application of molecular biology to the detection of infectious hemato- poietic necrosis virus. In Proceedings of the US-Japan meeting on aquacultur~ Mie, Japan. NOAA tech. Rep. NMFS 111, pp. 53-6.

Wolf, U., Ritter, H., Atkin, N.B. and Ohno, S. (1969) Polyploidization in the fish family Cyprin- idae, order Cypriniformes. I. DNA content and chromosome sets in various species of Cyprin- idae. Humangenetik 7, 240-44.

Wright, J.M. (1990) DNA fingerprinting in fishes. In Hochachka, P. and Mommsen, T. eds. Bio- chemistry and Molecular Biology of Fishes, Vol. 2. Elsevier, pp. 57-91.

Zwanenburg, K.C.T., Bentzen, P. and Wright, J.M. (1992) Mitochondrial DNA differentiation in western North Atlantic populations of haddock (Melanogrammus aeglefinus). Can. J. Fish. aquat. Sci. 49, 2527-37.

Accepted 23 February 1994

Documents

Developments in molecular genetic techniques in fisheries€¦ · Developments in molecular genetic techniques in ... The use of molecular genetic techniques in fisheries research