Development of Novel Oligonucleotide Therapeutic Molecules ...researchrepository.murdoch.edu.au/id/eprint/42397/1/Larcher2018.pdfdevelop the use of synthetic catalytic oligonucleotides

Development of Novel Oligonucleotide Therapeutic Molecules

Targeting microRNAs for Tackling Brain Cancers

Leon Maria Larcher

(32201239)

Bachelor of Science in Molecular Biology and Biomedical Science

Supervisor:

Dr Rakesh N. Veedu

Division of Research and Development, Centre for Comparative Genomics

This thesis is presented for the degree of Bachelor of Science Honours, School of Veterinary

and Life Science, of Murdoch University, 2018

Declaration

I declare that this thesis is my own account of my research and contains as its main

content work which has not previously been submitted for a degree at any tertiary

education institution.

Leon Maria Larcher

(June, 2018)

III

Abstract

MicroRNAs are short non-coding RNA molecules ( ̴ 22 nucleotides) which are

important in regulating numerous metabolic and cellular pathways responsible for cell

proliferation, differentiation and survival. Due to the malignant nature of many cancer

types, conventional treatment approaches face a number of challenges. In

Glioblastoma Multiforme (GBM) localisation in the brain results in additional

treatment challenges, such as, limited capacity for the brain to repair itself after

treatment, ineffective drug delivery through the blood brain barrier, and neurotoxicity

of chemotherapy. MicroRNA signature have been shown to be dysregulated in

cancers. Interestingly, restoration of these dysregulated miRNA have been shown to

abrogate and even reverse malignant phenotypes. In addition, it has been shown that

miRNAs contribute to responses to drug therapy and are themselves modified by these

drug therapies. There are a number of approaches targeting miRNAs that have shown

great promise in cancer therapy. However, there are still key challenges that need to

be overcome before the wide spread use of these technologies. In this project we

develop the use of synthetic catalytic oligonucleotides (DNAzyme), which can bind

and cleave target miRNAs. Following cleavage, the DNAzyme is free to continue their

action, thus reducing the quantity of molecule needed to have a therapeutic effect. Two

miRNA targets were selected in our study, namely, miR-21 and miR-494, which were

selected following a comprehensive review of known miRNAs in GBM from the

literature, miR-21 and miR-494 were selected due to their high overexpression and

oncogenic roles (roles in growth, proliferation, invasion, and apoptosis) within GBM.

In vitro cleavage analysis, revealed effective cleavage of the miRNA precursor (pre-

miRNA) strands by three DNAzymes in a dose-dependent manner. In cell (U87MG,

MDA-MB231) cleavage analysis revealed efficient knockdown of miR-21 using

IV

RNV541, however an increase in expression was observed when targeting miR-494

in cell (Huh-7) using RNV537 and RNV538. Concentration, structure, length, cell

type and transfection reagent used can all influence transfection outcomes. Overall,

the project showed that DNAzymes RNV541 efficiently cleaved miR-21 in vitro and

inhibited the expression in cell. However cleavage of miR-494 was inducible only in

vitro using both RNV537 and RNV538.

V

Table of Contents

Title Page...................................................................................................................... I

Declaration ................................................................................................................. II

Abstract ..................................................................................................................... III

Table of Contents ...................................................................................................... V

List of Figures ........................................................................................................... XI

List of Tables ......................................................................................................... XIII

Abbreviations ........................................................................................................ XIV

Acknowledgments ................................................................................................XVII

1. Introduction .......................................................................................................... 18

1.1. MicroRNAs (miRNA) as therapeutic targets .............................................. 19

1.2. MicroRNA Biogenesis ................................................................................ 21

1.3. MicroRNA Function/mechanism/mode of action ....................................... 22

1.4. MicroRNA: complex regulatory networks and compensatory

mechanisms ............................................................................................................ 32

1.5. miRNAs up regulated in solid cancers ........................................................ 34

1.5.1. miR-21 ................................................................................................. 34

1.5.1.1. Glioblastoma ...................................................................................... 34

1.5.1.2. Breast cancer ...................................................................................... 37

1.5.1.3. Glioma ................................................................................................ 38

1.5.2. miR-494 ............................................................................................... 39

VI

1.6. Nucleic-Acid Based Therapeutics ............................................................... 40

1.6.1. Antisense oligonucleotides ............................................................... 41

1.6.2. siRNA ............................................................................................... 41

1.6.3. AntimiRs and miRNA mimics ......................................................... 41

1.6.4. Nucleic acid aptamers....................................................................... 42

1.6.5. Synthetic catalytic oligonucleotides - DNAzymes/ribozymes ......... 42

1.6.6. Limitations ........................................................................................ 43

1.7. miRNA Modulation ..................................................................................... 44

1.7.1. Common approaches ............................................................................ 44

1.8. Hypothesis and Aims ................................................................................... 44

1.8.1. Hypothesis ............................................................................................ 44

1.8.2. Aims ..................................................................................................... 45

2. Materials and Methods ........................................................................................ 47

2.1. Materials and Reagents ................................................................................... 47

2.1.1. DNAzymes................................................................................................ 47

2.1.2. Cleavage analysis ...................................................................................... 47

2.1.3. Polyacrylamide gel ................................................................................... 47

2.1.4. Primers ...................................................................................................... 47

2.1.5. Housekeeping genes and Controls ............................................................ 48

2.1.6. Cell culture ................................................................................................ 48

2.1.7. Transfection .............................................................................................. 49

VII

2.1.8. RNA extraction ......................................................................................... 50

2.1.9. RT-PCR .................................................................................................... 50

2.1.10. q-PCR...................................................................................................... 51

2.1.11. Cell resurrection ...................................................................................... 51

2.1.12. Microscopy ............................................................................................. 51

2.2. Methods ........................................................................................................... 52

2.2.3. Polyacrylamide gel electrophoresis .......................................................... 54

2.2.3.1. Prepared polyacrylamide gel mix....................................................... 54

2.2.3.2. Preparing plates .................................................................................. 54

2.2.3.3. Complete gel mix was made .............................................................. 54

2.2.3.4. Poured gel .......................................................................................... 55

2.2.3.5. Gel tank set up .................................................................................... 55

2.2.3.6. Image analysis of the gel from in vitro cleavage assay ...................... 55

2.2.4. Cell resurrection ........................................................................................ 56

2.2.4.1. General ............................................................................................... 56

2.2.4.2. Cell resurrection ................................................................................. 56

2.2.5. U87MG and Huh-7 cell culture/subculture .............................................. 56

2.2.5.1. Plating cells ........................................................................................ 56

2.2.5.2. Counting cells .................................................................................... 57

2.2.6. Transfection reagent efficiency analysis/optimisation ............................. 58

2.2.6.1. Transfection for Microscopy .............................................................. 58

VIII

2.2.6.2. Transfection of U87MG and Huh-7 cells .......................................... 60

2.2.7. Fluorescent Microscopy ............................................................................ 61

2.2.7.1. Cell Preparation and Hoechst staining ............................................... 61

2.2.8. Transfection .............................................................................................. 61

2.2.8.1. Transfection for RNA extraction ....................................................... 61

2.2.8.2. Transfection of U87MG, MDA-MB231, and Huh-7 cells with

Lipofectamine 3000® P3000 reagent ............................................................. 62

2.2.9. RNA extraction ......................................................................................... 62

2.2.9.1. General ............................................................................................... 62

2.2.9.2. Cell Collection for RNA extraction ................................................... 62

2.2.9.3. RNA extraction .................................................................................. 62

2.2.10. RT-PCR and q-PCR ................................................................................ 63

2.2.10.1. RT-PCR ............................................................................................ 63

2.2.10.2. q-PCR ............................................................................................... 63

2.2.11. Data analysis ........................................................................................... 64

2.2.11.1. q-PCR Raw Data Analysis ............................................................... 64

3. Results ................................................................................................................... 65

3.1. Initial DNAzyme Construct screening ............................................................ 65

3.1.1. miR-494 Targeting constructs (RNV533-RNV538) ............................. 66

3.1.2. miR-21 Targeting Constructs (RNV539, RNV540, RNV541, and

RNV542) #1 .................................................................................................... 68

IX

3.1.3. miR-21 Targeting Constructs (RNV539, RNV540, RNV541, and

RNV542) #2 .................................................................................................... 70

3.1.4. miR-21 and miR-494 Targeting Constructs (RNV537, RNV538, and

RNV541) #1 .................................................................................................... 71


RNV541) #2 .................................................................................................... 73

3.2. In Cell Transfection Reagent Efficiency Test ................................................. 74

3.2.1. Transfection Reagent efficiency in U87MG cell line ............................... 74

3.2.2. Transfection reagent efficiency test Huh-7 cell line ................................. 76

3.3. In Cell Cleavage Analysis ............................................................................... 78

3.3.1. Treatment of Huh-7 cells with RNV537 targeting miR-494 .................... 79

3.3.2. Treatment of U87MG cells with RNV537 targeting miR-494 ................. 80

3.3.3. Treatment of Huh-7 cells with RNV538 targeting miR-494 .................... 81

3.3.4. Treatment of U87MG cells with RNV541 targeting miR-21 ................... 82

3.3.5. Treatment of MDA-MB231 cells with RNV541 targeting miR-21 ......... 83

4. Discussion .............................................................................................................. 84

4.1. Principal findings ............................................................................................ 84

4.2. Selection of Transfection Reagent .................................................................. 85

4.2.1. U87 MG .................................................................................................... 86

4.2.2. Huh-7 ........................................................................................................ 86

4.3. DNAzyme Concentration and Chemistry ........................................................ 87

4.3.1. DNAzyme chemistry ................................................................................ 87

X

4.3.1.1. miR-494 targeting DNAzymes .......................................................... 89

4.3.1.2. miR-21 targeting DNAzymes ............................................................ 91

4.3.2. DNAzyme concentration and cellular environment ................................. 92

4.3.2.1. miR-494 targeting DNAzymes .......................................................... 92

4.3.2.2. miR-21 targeting DNAzymes ............................................................ 94

4.4. Limitations ....................................................................................................... 94

4.5. Future directions and implications .................................................................. 95

4.5.1. Cell viability assay .................................................................................... 95

4.5.2. Experimental modifications ...................................................................... 96

4.5.3. Mouse models ........................................................................................... 96

4.5.4. Implications .............................................................................................. 96

5. Conclusion ............................................................................................................. 98

6. References ............................................................................................................. 99

7. Appendices .......................................................................................................... 116

XI

List of Figures

Figure 1.1. MicroRNA Biogenesis. ........................................................................... 22

Figure 1.2. MicroRNA mode of action ..................................................................... 24

Figure 1.3. 10-23 and 8-17 catalytic motif DNAzymes ............................................ 42

Figure 1.4. Illustration of DNAzyme-based RNA cleavage ..................................... 43

Figure 2.1. Flowchart of experimental pipeline for the study ................................... 52

Figure 2.2. Illustration of Pre-miRNA Structure....................................................... 53

Figure 2.3. Cell count calculation ............................................................................. 58

Figure 2.4. Illustration of workflow for transfection of cells .................................... 60

Figure 3.1. In vitro cleavage assay of RNV533, 534, 535, 536, 537, and 538

targeting miR-494-3p. A) RNV533, 534, 535, and 536. B) RNV537 and 538. C)

Densitometry analysis of gels RNV537 and 538 ....................................................... 66

Figure 3.2. In vitro cleavage assay of RNV539, 540, 541, 542 targeting miR-21. A)

RNV539, 540, 541, and 542. B) Densitometry analyis of gels RNV539, 541, and 542

.................................................................................................................................... 68

Figure 3.3. In vitro cleavage assay of RNV539, 540, 541, and 542 targeting miR-21.

A) RNV539, 540, 541, and 542. B) Densitometry analysis of gel RNV541. ............ 70

Figure 3.4. In vitro cleavage assay of RNV537, 538, and 541 targeting miR-494 and

miR-21 respectively. A) RNV537, 538, and 541. B) Densitometry analyis of gels

RNV537, 538, and 541 .............................................................................................. 71

Figure 3.5. In vitro cleavage assay of RNV537, 538, and 541 targeting miR-494 and

miR-21. ...................................................................................................................... 73

Figure 3.6. Transfection reagent efficiency test U87MG cell line. A) Experiment one

U87 cells. B) Experiment two, conducted with all transfection reagent and same

experimental conditions ............................................................................................. 75

XII

Figure 3.7. Transfection reagent efficiency test Huh-7 cell line ............................... 77

Figure 3.8. q-PCR analysis of normalized miR-494 expression in Huh-7 cells

following treatment with RNV537............................................................................. 79

Figure 3.9. q-PCR analysis of normalized miR-494 expression in U87MG cells


Figure 3.10. q-PCR analysis of normalized miR-494 expression in Huh-7 cells


Figure 3.11. q-PCR analysis of normalized miR-21 expression in U87MG cells


Figure 3.12. q-PCR analysis of normalised miR-21 expression in MDA-MB231

cells following treatment with RNV541 .................................................................... 83

Figure 4.1. Schematic illustration of the 10-23 catalytic motif DNAzymes binding

target mature miRNA sequence. A) miR-494-3p targeting DNAzymes. B) miR-21-

5p targeting DNAzymes ............................................................................................. 89

XIII

List of Tables

Table 1.1. Dysregulated microRNAs associated with solid cancers in Brain, Breast

and Liver cancer. ........................................................................................................ 25

Table 2.1. DNAzyme master mix reaction volumes. ................................................ 54

Table 2.2. Volumes of PBS, trypsin, media for each culture vessel. ........................ 57

Table 2.3. Reaction mix for each transfection reagent efficiency test ...................... 59

Table 3.1. Sequences and targets of DNAzyme constructs. ...................................... 65

Table 3.2. Sequences of template strands. ................................................................. 65

XIV

Abbreviations

Full gene names not included in text, given in Appendix I.

GBM Glioblastoma Multiform

HCC Hepatocellular Carcinoma

ONC Oncogene

TS Tumor Suppressor gene

U87MG Glioblastoma Multiform cell line

Huh-7 Hepatocellular carcinoma cell line

MCF-7 Michigan Cancer Foundation 7 (breast cancer cell

line)

MDA-MB231 Mammary gland/breast adenocarcinoma

miR/miRNA MicroRNA

Pri-miRNA Primary microRNA

Pre-miRNA Precursor microRNA

AO Antisense Oligonucleotide

siRNA Small interfering RNA

RNAi RNA Interference pathway

UTR Untranslated Region

TEMED Tetramethylethylenediamine

FLB Formamide loading buffer

PBS Phosphate Buffered Saline

RT Reverse transcriptase

EMEM Eagles minimum essential medium

DMEM Dulbeccos modified eagle media

XV

FBS Foetal bovine serum

L3KP3K Lipofectamine® 3000 and P3000

L3K Lipofectamine® 3000

L2K Lipofectamine® 2000

iMAX Lipofectamine® RNAiMAX®

fugene FuGENE®

rcf Relative centrifugal force

KD Knock down

XPO-5 Exportin 5

RISC RNA induced silencing complex

AGO Argonaute protein

DGCLR8L DiGeorge syndrome Critical Region gene

PDCD4 Programed cell death 4 gene

FBOXO11 F-box subfamily lacking a distinct unifying domain

TPM1 Tropomyosin 1

EGFR Epithelial growth factor receptor

PDGF-α Platelet derived growth factor receptor α

RTK Receptor tyrosine kinases

Daam1 Disheveled associated activator of morphogenesis 1

DKK3 Dickkopf-3 gene

NEO1 Neogenin

HK2 Hexokinase 2

PDE8A Phosphodiesterase 8A

UVRAG UV radiation resistance associated gene

NKIRAS2 NF-κB inhibitor interacting Ras-like 2

XVI

PUMA (BBC3) p53 Up Regulated Modulator of Apoptosis

bp Base pair

DNA Deoxyribonucleic acid

RNA Ribose nucleic acid

PCR Polymerase chain reaction

PAGE Polyacrylamide gel electrophoresis

FL Full length

EphA8 Eph tyrosine kinase receptor A8

TRAIL (TNF)-related apoptosis inducing ligand

PLK1 Polo-like kinase 1

CCNB1 Cyclin B1

CDC2 Cell-division cycle 2

CDC20 Cell-division cycle 20

TOP2A Topoisomerase II alpha

TIMP3 Tissue Inhibitor of Metalloproteinase 3

BCL6 B-cell Lymphoma 6 protein

HNRPK Heterogeneous Nuclear Riobonucleoprotein K

TAp63 Tumor protein P63

ANp32A Acidic Nuclear phosphoprotein 32 family member A

LRRFIP LRR Binding FLII Interacting Protein 1

FASLG Fas Ligand

RECK Reversion inducing Cysteine rich protein with Kazal

motifs

MgCl2 Magnesium chloride

DMSO Dimethyl Sulfoxide

XVII

Acknowledgments

I would like to thank a number of important people that have supported and

encouraged me throughout this year. Firstly, I would like to thank Dr Rakesh Veedu

for giving me the opportunity to work on this project and for all the effort he has put

into editing my work and providing me with guidance.

I would also like to thank the members of RNV lab group especially Bao Tri Le,

Madhuri Chakravarthy and Kamal Rahimizadeh, who have not only taught me the

various laboratory techniques, but have also showed much patience, were always

available to help, and by doing so, made my time in the lab very enjoyable.

I would also like to thank the member of the Centre for Comparative Genomics for

creating a friendly and welcoming environment, always being ready to answer any

questions I may have.

Lastly, I would like to thank my parents Josephina and Jean-Claude Larcher for their

endless support. Without their encouragement and faith in my abilities, I would not be

where I am today.

18

1. Introduction

In 2018, there was an estimated 1,735,350 new cancer cases and 609,640 resultant

deaths (1). There is an approximate 439 new cancer cases per 100,000 men and women

per year, and 163 deaths per 100,000 men and women per year (2011-2015)(1).

Glioblastoma multiforme (GBM) is a highly aggressive primary brain tumor, GBM

has an incidence of 2-3 people per 100,000 adults per year making it the most common

primary brain tumor (2), accounting for nearly 40% of all central nervous system

malignancies and 52% of all primary brain tumors (2-5). Due to the malignant nature

of many cancer types, conventional combinational treatments including surgery,

radiation, and chemotherapy face a number of treatment challenges, such as radiation

and/or chemoresistance, and inconsistent responses to therapies. Due to the malignant

nature of GBM and localisation in the brain there exist additional treatment challenges

including, limited capacity of the brain to repair itself after treatment, ineffective drug

delivery through the blood brain barrier, and neurotoxicity of chemotherapy’s (2, 5).

Outcomes for GBM patients remain grim, with a 5-year survival rate of less than 10%

compared with the 67% overall 5-year survival rate of patients with cancer of any site

(1). Until these treatment challenges are overcome, conventional therapies will remain

ineffective in clearing GBM cancerous cells, therefore only provide marginal

improvement in quality of life and life expectancy. The lack of effective treatments

illustrates the dire need for the development of targeted and specific therapies tackling

GBM and other difficult malignancies.

Cancer (carcinogenesis) is a multistep process in which normal cells undergo genetic

changes that progress them through a series of initiation steps into malignant states,

then progression into invasive cancer that can metastasize through the body. The

19

resultant cellular transformations has several distinct characteristics that enables cells

to proliferate excessively in an autonomous manner; first, the cells gain the ability to

proliferate independent of growth signals and become unresponsive to inhibitory

growth signals. Secondly, the cells can evade apoptotic pathways and overcome

intrinsic cellular replication limits. Lastly, the cells can sustain angiogenesis and gain

the ability to form new discontinuous colonies within the primary tumor. These

characteristics are features of all cancers (6).

Cancer initiation and progression is associated with dysregulation of genes involved

in cell proliferation, differentiation and apoptosis. Genes associated with cancer

development are characterized as oncogenes and tumor suppressors. Oncogenes result

from mutated proto-oncogenes, genes normally coding for transcription factors,

growth factors, growth factor receptors, chromatin remodelers, apoptosis regulators or

signal transducers. These genetic (oncogenes) alterations amplify the gene, alter

promoters/enhancers to increase gene expression or alter protein structure to a

permanent active state, providing a growth advantage that can drive tumorigenesis.

Conversely, tumor suppressor gene products have regulatory roles in biological

processes. Mutations causing loss or reduction of function of tumor suppressor’s

results in dysregulation associated with cancer.

1.1. MicroRNAs (miRNA) as therapeutic targets

Recently the definition of oncogenes and tumor suppressors has been expanded to non-

protein coding RNAs called miRNAs, which play a central role in regulating numerous

metabolic and cellular pathways responsible for cell proliferation, differentiation,

migration, and survival.

20

Dysregulation of miRNA expression profiles has been associated in most, if not all,

tumors. However, the specific classification of miRNA as oncogenes or tumor

suppressors can be difficult because of intricate temporal and spatial expression

patterns. It is not always clear if the altered miRNA patterns are the direct or indirect

causes of the cancer, or due to secondary changes in cellular phenotypes. Moreover, a

single miRNA can regulate multiple targets and add additional layer of complexity.

This coupled with tissue specific expression could implicate a single miRNA as a

tumor suppressor in one context and an oncogene in another. Generally, up-regulated

miRNAs in tumor cells are considered oncogenic miRNAs (oncomiRs), which can

silence tumor suppressor genes. Conversely, some miRNAs, which are often down-

regulated in cancers, can inhibit tumor progression and are termed tumor suppressor

miRs. These miRNAs target mRNA of some oncogenes and inhibit the carcinogenic

effect by repressing the translation of them.

MicroRNA signatures have not only been shown to be dysregulated in cancers, but

interestingly, restoration of these dysregulated miRNAs have been shown to abrogate

and even reverse the malignant phenotype of cancers, moreover, it has been shown

that miRNAs contribute to responses to drug therapy and are themselves modified by

drug therapy. Herein, we review how miRNAs are produced and their biological

function, highlight oncogenic miRNAs in solid cancers (Table 1.1), and present

evidence demonstrating that restoration of dysregulated miRNAs to normal levels can

reduce and reverse the malignant phenotype of a variety of solid cancers. Lastly, we

will highlight some current miRNA targeting strategies and some of their limitations.

21

1.2. MicroRNA Biogenesis

MicroRNAs are encoded by nuclear DNA and are typically transcribed by RNA

polymerase II or III, producing capped and polyadenylated long primary transcripts,

termed primary miRNA (pri-miRNA) (7). The pri-miRNA folds into a large stem-loop

structure via intramolecular base pairing (8) with single stranded RNA extensions at

both ends (9-11), pri-miRNA is then cleaved by the microprocessor protein complex,

consisting of the RNase III endonuclease Drosha and the double-stranded RNA-

binding protein DGCR8(DiGeorge syndrome critical region gene 8) (7, 12-15)(Figure

1.1). This process results in the generation of a precursor miRNA (pre-miRNA)

hairpin 60-120 nucleotides in length (7, 14). Pre-miRNA assembles into a complex

with the nucleocytoplasmic transporter factor Exportin-5 (XPO5) and Ran/GTP,

which prevents nuclear degradation and facilitates translocation from the nucleus (16-

20)(Figure 1.1). The pre-miRNA undergoes further processing in the cytoplasm by

the RNase II enzyme Dicer complex. Dicer cleaves the hairpin loop, producing a ~ 22

nucleotide miRNA duplex, consisting of a passenger stand and a mature miRNA

strand (guide strand). Association of Dicer with RNA-binding domain factors, PACT

or TRBP, can also produce slightly different sized miRNAs, termed isomiRs, which

have altered target-binding specificities (21). Following mature miRNA formation, the

duplex is unwound, while the passenger strand is normally degraded, the other mature

miRNA strand (guide strand) of the duplex is then loaded onto argonaute protein

(Ago1-4) and incorporated into the RNA-induced silencing complex (RISC)(Figure

1.1). Within RISC, the miRNA serves as a template for recognizing its complementary

mRNA molecules (22), miRISC binds target mRNA through Watson-crick base-

pairing between the guide strand and the 3’-Untranslated region (UTR) of the target

(23, 24), target recognition relies heavily on base-pairing between the seed sequence

22

(residues 2-8 at the 5’end) of the miRNA guide (25-28). The miRISC may be found

in the nucleus where it is thought to regulate pre-mRNA (29).

Figure 1.1. MicroRNA Biogenesis. MicroRNAs are encoded by nuclear DNA, transcribed by

RNA polymerase II or III, producing capped and polyadenylated primary transcripts (pri-

miRNA). The pri-miRNA folds into a stem-loop structure, with single stranded RNA extension

on both ends. Pri-miRNA is then cleaved by the microprocessor complex consisting of Drosha

and DGCR8, producing precursor miRNA (pre-miRNA).Pre-miRNA assembles into a complex

with the nucleocytoplasmic transporter Exportin-5(XPO5) and Ran/GTP. Once the cytoplasm

pre-miRNA is further processed by Dicer complex, which cleaves the hairpin loop, producing

the mature RNA. The mature RNA is unwound, the passenger stand is degraded, while the

other strand is loaded into argonaute protein (Ago1-4) and incorporated into the RNA-

induced silencing complex (RISC), the miRNA serves as a guide strand and allows mRNA

target recognition. Binding of RISC to its target mRNA results in degradation and/or

translational repression of the target gene.

1.3. MicroRNA Function/mechanism/mode of action

Binding of miRISC complex to its target mRNA results in degradation and/or

translational repression of target genes by slicer-independent or slicer-dependent

silencing. In slicer-dependent silencing miRNA directed mRNA cleavage is catalysed

by Ago2 (Figure 1.2), when the target and miRNA are extensively base-paired over

23

regions including the seed and bases 10-11 of the guide (30-35). Cleavage products

are degraded by one of two processes responsible for bulk cellular mRNA degradation,

both begin with the deadenylation of the mRNA to remove the poly(A) tail(30, 36).

Subsequent degradation can occur via the exosome, a multi-protein complex with 3’to

5’ exonuclease activity. Alternatively, the mRNA can undergo decapping by the

enzymes DCP1 and DCP2 which facilitates 5’-to-3’ degradation by the

exoribonuclease Xrn1p (30, 37)(Figure 1.2).

In slicer-independent silencing, multiple complementary sites with imperfect base-

pairing create bulges in the RNA duplex inhibit the slicer activity of Ago2 (9, 23, 30,

38-40) and propels slicer-independent gene silencing mechanisms. MicroRNA can

repress translation directly pre- or post- translation initiation which is determined by

the target mRNA promoter (41). Alternatively, miRNA can repress translation

indirectly by segregating mRNA away from ribosomes to cytoplasmic foci (P-bodies)

(42-48) and accelerating deadenylation and decapping processes independent of slicer

activity affecting translation initiation efficiency and/or transcript stability (49-52).

Ultimately, mRNA can be isolated for storage or be targeted for decay via Xrn1p or

24

exosome degradation (35, 49). Stored mRNA can return to active translation or be

targeted for degradation (Figure 1.2).

Figure 1.2. MicroRNA mode of action. miRISC binds to its mRNA target resulting in

degradation and/or translational repression of target genes by either slicer-independent or

slicer-dependant silencing. When miRNA are extensively base-paired slicer-dependent

silencing mechanisms proceed. Deadenylation of mRNA occurs, removing the poly(A) tail.

Subsequent degradation can occur via the exosome, alternatively, the mRNA can undergo

decapping and degradation via Xrn1p. In slicer-independent silencing, multiple

complementary sites with imperfect base-pairing create bulges in the RNA duplex propelling

slicer-independent gene silencing mechanisms. MicroRNA can repress translation determined

by the target mRNA promoter. Alternatively, miRNA can repress translation indirectly by

segregating mRNA into P-Bodies. Ultimately mRNA can be isolated for storage or be targeted

for decay via Xrn1p or exosome degradation.

25

Table 1.1. Dysregulated microRNAs associated with solid cancers in Brain, Breast

and Liver cancer.

microRNA

(miR)

Up/down

regulated

and

ONC/TS

Function Targets Deregulation

in cancer

types

Reference

miR-15a Up Glioma (53, 54)

miR-15b Down CCNE1,

NRP-2,

MMP3,

Glioblastoma,

Glioma

(55-59)

miR-16-1 Down Apoptosis,

Tumorigen

esis

Wt1, Rab9B Glioma/ GBM (53, 60-62)

miR-16 Up Glioma (53)

miR-7 Down, TS Invasivenes

s, Viability

AKT GBM, breast

cancer

(63, 64)

Let 7

(a,b,c,d,e,

f,g,u)

Down, TS Apoptosis,

Tumorigen

esis

RAS,

HMGA2

Lung and

breast cancer

and in a

variety of solid

and

hematopoietic

malignancies,

(65-67)

miR-29 Down, TS Apoptosis,

Proliferatio

n, Invasion,

PDPN breast cancer,

GBM

(68-70)

miR-29 Up Apoptosis,

Proliferatio

n, Invasion

MCL1 GBM (70)

miR-34 Down, TS Breast cancer (67)


Proliferatio

n

SMAD4,

FRAT1,

BCL2

Ependymomas

, meningioma

(71-73)


Proliferatio

n,

Migration

ERG, CTGF,

ABCG2

Breast cancer,

GBM, glial

and glioma

cells

(74-76)

miR-145 Up GBM (77)

miR-

221/222

Down,

ONC

GBM (78, 79)

26

miR221/2

22

Up Apoptosis,

Proliferatio

n ,

Invasion,

Migration,

Survival

P27, p57,

PTEN,

TIMP3,

p27Kip1,

PUMA,

PTPμ,

CDKN1B,

CDKN1c,

MGMT,

SEMA3B

Hepatocellular

carcinoma,

high grade

glioma, GBM,

rhabdoid

tumors,

schwannoma

(80-101)

miR-155 Up, ONC Apoptosis,

Proliferatio

n,

Migration ,

Invasion,

Metastasis,

chemoresist

ance

GABRA1,

MAPK13,

MAPK14,

FOXO3a,

MXI1, Wee1

Breast cancer,

chordoma,

sporadic

pituitary

adenomas,

Glioma/GBM

(102-111)

Cluster

miR-17-

92

Up, ONC Proliferatio

n

E2F1, CTGF Breast cancer,

astrocytic

glioma

(112-114)

miR-92b Up Apoptosis,

Proliferatio

n. Invasion,

Growth

DKK3, NLK Glioma (115, 116)


Proliferatio

n,

Migration

Tumorigen

esis

PTEN,

PDCD4,

TPM1,

TIMP3

Glioblastomas,

breast,

schwannomas,

liver cancer,

meningioma

(74, 86, 101, 117-

122)

miR-363 Up Survival BIM, CASP3 GBM stem

cells

(123)


Proliferatio

n, Invasion

PHLPP2 Glioma

(124)

miR-381 Up Proliferatio

n

LLRC4 Glioma (125, 126)

miR-455-

3p

Up Chemoresis

tance

SMAD2 GBM (127, 128)


Proliferatio

n

CASP3,

CASP9

GBM (123)

miR-603

Up Proliferatio

n,

Chemoresis

tace

MGMT,

WIF1,

CTNNBIP1,

Glioma, GBM (129, 130)

miR-655 Up Invasion SENP6 GBM (131)

27

miR-33a Up Proliferatio

n, Survival

PDE8A,

UVRAG

GBM stem

cells


n

Wee1 Sporadic

pituitary

adenomas

(110)

miR-720 Up Schwannoma (101)

miR-301a Up Invasion SEPT7 Glioma (132)


Proliferatio

n, Invasion,

Migration,

Growth

SPRY4/RAF

1,

NKIRAS2,

PTEN

Glioma (133-136)

miR-210 Up Survival,

Chemoresis

tance

HIF3A GBM (53, 108, 137)

miR-494 Up, ONC

Proliferatio

n, Invasion

Metastasis,

Migration

PTEN,

CXCR4,

PLK1, PAK1

Hepatocellular

carcinoma,

Breast cancer

(138-141)

miR-200c Up PTEN Pituitary

adenoma

(142)


Proliferatio

n,

Metastasis,

Angiogenes

is

Bmi-1, RTK

EGFR,

PDGF-α,

p70S6K1,

E2F3a

Glioma/GBM,

medulloblasto

ma

(86, 143-149)


Proliferatio

n

Invasivenes

s,

Metastasis

Bmi-1(PI3K-

AKT-mTOR

pathway),

RTK,

EGFRPDGF

Ra, PTEN,

Wee1

GBM,

medulloblasto

ma, pituitary

tumor,

sporadic

pituitary

adenomas

(86, 110, 143,

146)

miR-409 Up Meningioma (150)

miR-181c Up Destruction

of blood

brain

barrier

PDPK1 Metastatic

cancer cells

(151)

miR-181a

and miR-

181b

Down, TS Apoptosis,

Proliferatio

n, Invasion

Glioma (86, 152)


Proliferatio

n, Invasion,

Angiogenes

BCL2L12,

HIF2A,

MET,

Glioma, GBM (125, 153-155)

28

is,

Chemoresis

tance,

Stemness

CYLD,

LRRC4

miR-125b Down Proliferatio

n

CD6K,

CDC25A,

E2F2

Down in U251

glioma stem

cells. CD133-

positive cells

(156-160)


Proliferatio

n, Invasion,

cell

viability

Bmf, MMP9,

MMP2,

MAZ, LIN28

Glioma (U343

and SUE3),

breast cancer

(160-166)

miR-

10a/b

Up, ONC Apoptosis,

Migration/

metastasis,

Invasion,

Proliferatio

n, cell cycle

arrest

HOXD10d,

Rhoc, uPAR,

BCL3L11/Bi

m,

TFAP2C/AP

-2γ,

CDKN1A/p2

1,

CDKN2A/p1

6,

p21WAF/1/C

ip1, CSMD1,

EphA8

Glioma, GBM,

breast cancer

(99, 167-178)


Cell growth

PI3K/AKT,

CAB39

Glioblastoma (179, 180)


Invasion,

cell cycle

arrest, cell

growth, cell

viability

CAB39,

LKB1

Glioblastoma,

pancreatic

cancer, glioma

(181-183)

miR-431 Up Schwannoma (101)


n,

Migration,

Invasion,

Stemness,

Survival,

Chemoresis

tance,

Stress

response

CAMTA1,

PTEN,

MDM2

Glioma, GBM,

ependymoma

(53, 71, 78, 184-

186)

miR-218-

2

Up Proliferatio

n, Invasion,

Migration

CDC27 Glioma (187)

miR-93 Up, ONC Proliferatio

n,

Migration,

angiogenesi

ITGB3,

PTEN,

PHLPP2,

FOXO3

GBM, glioma,

astrocytoma

(188-193)

29

s,

Stemness,

Survival,

miR-381 ONC Proliferatio

n, Growth

LRRC4 glioma (126)



miR-

244/452

cluster

Up Proliferatio

n,

Radiosensit

ivity,

Anchorage

independen

t growth

Medulloblasto

ma

(194)

miR-

182/183/9

6 cluster

Up Apoptosis,

Proliferatio

n, Growth,

Shh

signalling

pathway,

AKT1,

AKT2

Medulloblasto

ma

(194-196)


Growth

ERG2 Meningioma (197)

miR-124

and miR-

137

Down Glioblastoma,

astrocytoma

(198)



miR-30e* Up IκBα Glioma (199)

miR-30a Up Apoptosis,

Proliferatio

n, Invasion,

Stemness

SOCS3,

SEPT7

Glioma(U87) (200-202)


n, Invasion

PHLPP2 Glioma (124, 203)

miR-9/9* Up Chemoresis

tance/Chem

osensitivity

CAMTA1 Glioma, GBM (53, 184, 204)

miR-

18a/a*

Up Apoptosis,

Proliferatio

n, Invasion,

Migration,

Stemness

NEO1,

DLL3,

CTGF,

SMAD3

Glioma, GBM (205-207)

30

miR-

19a/b


n, Survival

PTEN Glioma,

astrocytic

glioma

(53, 208)


Proliferatio

n,

Migration

IGFR1 GBM (209)

miR-323 Up GBM (108)


n, Invasion

SFRP1 glioma (210)

miR-329

Down Apoptosis,

Proliferatio

n, Survival

E2F1 Glioma (211)


Proliferatio

n, Survival

E2F1 Glioma, GBM (108)


Proliferatio

n, Invasion,

Migration

SH3GL2 GBM (212, 213)

miR-335 Down Proliferatio

n

Metastasis,

Growth

SOX4 Breast cancer (214)


Proliferatio

n,

Growth,

Invasion,

Survival,

Stemness

Daam1,

PAX6, Rb1

Glioma,

Astrocytoma,

Meningioma

(215-219)

miR-135

(a,b)

Up Ependymoma (71, 220-222)

miR-20a Up, ONC Invasion TIMP2 (53, 78, 223)


Proliferatio

n, Invasion

ST7L Glioma (54, 224)

miR-25 Down,

ONC

Invasion MDM2,

TSC1

GBM (225)

miR-25 Up, ONC Proliferatio

n, Viability

CDKN1C,

NEFL

Glioma (53, 226, 227)

miR-27a Up, ONC Proliferatio

n, Invasion

FOXO3a GBM (228)

miR-27a Down Apoptosis (229)

31


Proliferatio

n, Invasion

(230)

miR-28 Up (53)

miR-100 Down Apoptosis,

Proliferatio

n

SMRT/NCO

R2

Glioma (231)

miR-100 Up Radioresist

ance

ATM, PLK1 Glioma(MO59

J cell line),

Medulloblasto

ma

(232, 233)

miR-106a Down, TS Proliferatio

n,

Metabolism

SLC2A3 GBM (234)

miR-106

(a,b)


n, Invasion,

Migration,

Tumor

sphere

formation

TIMP2,

MCM7,

EZH2

Glioma(CD13

3+),

Medulloblasto

ma,

meningioma,

ependymoma

(150, 223, 235,

236)

miR-130b Up Stemness MST1,

SAV1

GBM (53, 237)

miR-132 Up GBM, Glioma (238, 239)


n, Invasion,

Migration

ADAM9 Glioma (220)

miR-140

(3p)

Up, ONC Invasion,

Recurrence

GBM,

Chordoma

(53, 167, 240-

242)

miR-143 Down Migration,

angiogenesi

s,

Chemoresis

tance,

Stemnesss,

glycolysis

HK2, RAS Glioma and

GBM stem-

like cells

(243, 244)

miR-143 Up Invasion GBM

(subpopulation

s)

(77)


n, Invasion,

Migration

MMP16 Glioma (245, 246)

miR-146 Up NOTCH1 Glioma (78)

miR-148a Up, ONC Proliferatio

n,

Stemness,

Angiogenes

is

FIH1 GBM,

chordoma,

medulloblasto

ma

(78, 194, 240,

247)

32


n,

Radiosensit

ivity,

Anchorage

independen

t growth

SMAD3 GBM,

medulloblasto

ma

(78, 194, 248)


Proliferatio

n

Increase in

TMZ-resistant

GBM

(78)


Proliferatio

n

NFKBIA GBM, glioma (78, 79, 249-251)

miR-594 Ependymoma (71)

miR-501 Up Chemoresis

tance

Neuroblastoma (252)

miR-188 Up Chemoresis

tance

Neuroblastoma (252)

miRNAs that show upregulation in one type of cancer were included if

downregulation occurred in another cancer type.

1.4. MicroRNA: complex regulatory networks and compensatory

mechanisms

A single microRNA has the ability to target and regulate hundreds, possibly thousands

of genes (Table 1.1), making it difficult to determine which genes are direct targets of

a single miRNA. A single mRNA target contains potential binding sites for multiple

individual miRNAs; therefore, a single gene can be regulated simultaneously or

sequentially by multiple miRNAs, the way in which microRNAs can regulate target

mRNAs is by both repressing translation and inducing mRNA degradation which adds

to the complexity of miRNA mediated gene regulation. Due to the large variety in

miRNA targets and mode of action a single miRNA may play distinct roles in different

tissues. These difference may also occur within varying differentiation states of cells,

33

in one state a miRNA could function as an oncomiR, at the same time in another state

this miRNA acts as a tumor suppressor.

Due to the ability of miRNAs to target many mRNAs, modulation of a single miRNA

may have diverse effects, within and between diverse cellular pathways/phenotypes,

posing an advantage over more traditional single gene targeting approaches. However,

with high functional complexity targeting certain miRNAs may have unforeseen and

unintended off-target effects. An example of these off-target effects are within difficult

to treat malignancies typically associated with low survival rates. Patients may show

remission shortly after the commencement of treatment, however the cancer may have

a sudden and severe recurrence, usually resulting in chemo/radio-resistance of the

malignancy to the previously effecting treatments resulting in rapid patient

deterioration and death. miRNAs have been shown to influence response to and

themselves be influenced by treatments. One explanation for the sudden tumor

resistances in patients may be due to the treatment targeting miRNAs. Treatment(s)

blocking certain key pathways by targeting miRNAs may cause compensatory

mechanisms to occur within the cell/tumor. Due to the cell’s need for these miRNAs

and pathways (“oncomiR addiction”) for growth, proliferation, invasion etc., the cells

will seek to replace these molecules/pathways (compensation). The emergence of

alternative pathways, not normally active/present drives the malignant progression,

unhindered by treatments targeting now obsolete pathways and molecules.

34

1.5. miRNAs up regulated in solid cancers

Studies have shown that knockdown of these aberrantly expressed miRNAs can

alleviate and even reverse the malignant phenotype of solid cancers such as

glioblastoma and others.

1.5.1. miR-21

miR-21 has been extensively studied, and has been shown to target multiple molecular

targets within the same, as well as a variety of, cellular pathways. miR-21 is a potent

oncomiR, and is one of the most frequently overexpressed miRNA in human

glioblastoma cell lines (86, 118, 253-255) and a variety of cancer types compared to

noncancerous tissues including; glioma, breast cancer (74, 120), hepatocellular

carcinoma (HCC)(117), pancreatic cancer (256), acute myeloid leukaemia

(AML)(257), and schwannomas (101, 122). miR-21 overexpression is an important

biomarker of poor prognosis in human malignancies (258): in GBM and colon

adenocarcinoma miR-21 is inversely correlated with patient survival and tumor

grading (79, 121, 259-261). In breast cancer, in addition to poor prognosis,

overexpression of miR-21 is significantly correlated with advanced clinical stage, and

lymph node metastasis (262), moreover, miR-21 has been shown to target a large

number of genes through 3’-UTR complementarity of their respective mRNAs.

1.5.1.1. Glioblastoma

Gaur et al. demonstrated that downregulation of miR-21 in glioblastoma-derived cell

lines results in increased expression of its target, programmed cell death 4 (PDCD4),

a known tumor suppressor gene. Data suggests that either downregulation of miR-21

or overexpression of PDCD4 leads to decreased proliferation, increased apoptosis and

35

decreased colony formation on soft agar. Using a GBM xenograft model in immune-

deficient nude mice, it was observed that in glioblastoma-derived cell lines in which

miR-21 levels are downregulated, showed that PDCD4 is overexpressed, and the cell

lines exhibited decreased tumor formation and growth. Transfection of GBM-cell lines

with anti-miR-21 and siRNA to PDCD4, confirmed that the tumor growth is

specifically regulated by PDCD4 (263). Costa et al. corroborated these results,

demonstrating that increased levels of tumor suppressors PTEN and PDCD4,

Caspase3/7 activation and decreased tumor cell proliferation resulted after GBM

(U87) samples were treated with an oligonucleotide-mediated miR-21 silencer.

Furthermore, miR-21 has a role in resistance to conventional therapeutics. miR-21

silencing enhanced the anti-tumoral effect of tyrosine kinase inhibitor sunitnib,

However, no therapeutic benefit was observed when coupling miR-21 silencing with

the chemotherapeutic temozolomide (264, 265). Li et al. showed that miR-21

downregulation led to enhanced cytotoxicity’s of VM-21 against GBM (U373) cells

(266).

Zhou et al. reported miR-21 downregulation and found that apoptosis was induced

and cell-cycle progression was inhibited in vitro in GBM (U251-PTEN mutant and

LN229-PTEN wild type) cell lines and tumors from antisense-treated U251 cells were

supressed in vivo (253). Antisense-miR-21-treated cells showed an increase in the

level of endogenous PTEN protein, and a decreased expression of EGFR, activated

Akt, cyclin D, and Bcl-2, which is consistent with blocked G1/S transition in early

apoptosis. There was also an observed decrease in STAT3 protein in both U251 and

LN229 GBM cells. Loss of functional PTEN leads to increase activity of the Akt and

the mammalian target or rapamycin (mTOR) kinase pathways, which can promote

both tumor cell survival and proliferation through phosphorylation and activation of

36

several downstream mediators. Thus it was hypothesised that GBM cells with wild-

type PTEN should have a better response to antisence-miR-21 treatment compared

with PTEN mutant or deleted GBM cells. Surprisingly, it was observed that similar

growth-inhibition effects in both U251 and LN229 cells using MTT assay, suggesting

that some of the effects of miR-21 inhibition may be independent of PTEN.

Microarray analysis showed that the knockdown of miR-21 significantly altered

expression of 169 genes involved in nine cell-cycle and signalling pathways (253).

Overall, this paper demonstrated that downregulation of miR-21 leads to the induction

of apoptosis and the inhibition of cell-cycle progression in vitro and the suppression

of tumors in U251 cells in vivo.

Chan et al. demonstrated that knockdown of miR-21 in cultured glioblastoma cells

triggers activation of caspases and leads to increased apoptotic cell death, this data

suggests that aberrantly expressed miR-21 may contribute to the malignant phenotype

by blocking expression of critical apoptosis-related genes (118). It appears that miR-

21 plays a critical role in GBM cell lines (U251) regulating cell growth and apoptosis,

and has been indicated to regulate cell cycle independent of PTEN.

Yang et al. showed that miR-21 knockdown in GBM cells inhibited cell proliferation

in vitro and markedly inhibited tumor formation in vivo. Insulin-like growth factor

(IGF)-binding protein-3 (IGFBP3) was identified and validated as a target of miR-21.

Overexpression of IGFBP3 in glioma cells inhibited cell proliferation in vitro and

inhibited tumor formation of glioma xenografts in vivo. The critical role that IGFBP3

plays in miR-21-mediated actions was demonstrated by a rescue experiment, in which

IGFBP3 knockdown in miR-21 knockdown GBM cells restored tumorigenesis.

Examination of tumors from GBM patients showed that there was an inverse

relationship between IGFBP3 and miR-21 expression and that increased IGFB3

37

expression correlated with better patient survival (259). Papagiannakopoulos et al.

demonstrated that miR-21 targets multiple important components of the p53, TGF-

beta, and mitochondrial apoptosis tumor-suppressive pathways. Moreover

downregulation of miR-21 in GBM cells leads to de-repression of these pathways,

resulting in growth repression, increased apoptosis, and cell cycle arrest, furthermore

it was show that these phenotypes are dependent on two of the miR-21 targets

validated in this study, HNRPK and TAp63 (254). Lastly, miR-21 was shown to target

ANP32A, in both GBM and Prostate carcinoma cells. miR-21 expression clearly

increased the invasiveness of LNCaP cells, this effect was observed in part following

ANP32A downregulation, moreover enhanced ANP32A expression compensated for

the effect of anti-miR-21 treatment on cell viability and apoptosis (267). miR-21

consistently plays a central role in regulation of cell proliferation , tumor formation

and apoptosis within GBM cells and tumors, through modulation of several validated

targets.

1.5.1.2. Breast cancer

miR-21 also exerts an oncogenic role in some breast cancer cells by the targeting of

PDCD4, Frankel et al. demonstrated reduced cell growth in MCF-7 breast cancer cells

by inhibition of miR-21, PDCD4 was confirmed as a target of miR-21 in breast cancer

(119). Moreover, Lu et al. Demonstrated miR-21 targeting of PDCD4 gene. They

cloned a full length 3’-UTR of human PDCD4 downstream of a reporter and found

that miR-21 downregulated, whereas a modified Antisense RNA to miR-21

upregulated reporter activity. Deletion of the putative miR-21 binding site (miRNA

regulatory element-MRE) from the 3’-UTR of PDCD4 or mutations in the MRE

abolished ability of miR-21 to inhibit reporter activity (268).

38

1.5.1.3. Glioma

Gabriely et al. showed that miR-21 regulated multiple genes; RECK and TIMP3,

which are associated with glioma apoptosis, migration, and invasion. RECK and

TIMP3 genes are known suppressors of malignancy and inhibitors of matrix

metalloproteinases (MMPs). Inhibition of miR-21 with AOs leads to elevated RECK

and TIMP3 therefore reduces MMP activities in vitro and in human mouse model.

Moreover, downregulation of miR-21 in glioma cells leads to decreases of their

migratory and invasion abilities (269).

Yang et al. identified and validated a member of the F-box subfamily lacking a distinct

unifying domain (FBOXO11) as a direct target of miR-21, the expression of miR-21

and FBXO11 inversely correlated in tumor tissue. This expression is also correlated

with patient survival and tumor grade, higher FBXO11 expression correlated with

better patient survival and lower tumor grade, conversely high miR-21 levels

correlated with low patient survival and high tumor grade. FBXO11 is a component

of the SKP1-CUL1-F-box ubiquitin ligase complex that targets proteins for

ubiquitination and protosomal degradation. Previously FBOXO11 was shown to act

as a tumor suppressor, promotes apoptosis and mediates the degradation of the

oncogenic protein BCL6. FBXO11 plays a critical role in tumorigenesis. When

FBOX11 is silenced in miR-21KD (Knock down) cancer cells, it restored their high

tumorigenicity (260). Zhu et al. identified tumor suppressor tropomyosin 1 (TPM1) as

a target gene of miR-21, demonstrating the presence of a putative miR-21 binding site

at the 3’-UTR of TPM1 variants V1 and V5, moreover deletion of the binding site

abolished the effect of miR-21. RT-PCR showed no difference of TPM1 at the mRNA

levels, suggesting translational regulation (120). Overexpression of TPM1 in breast

cancer MCF-7 suppressed anchorage independent growth, thus downregulation of

39

TPM1 by miR-21 may explain, in part, why suppression of miR-21 can inhibit tumor

growth (120).

These studies have shown that downregulation of miR-21 resulted in increase in

apoptosis, cell cycle arrest (253, 254), inhibited proliferation and tumor formation

(270). Furthermore, increase in miR-21 targets occurred; PDCD4(263), AKT, Cyclin

D, BCL2, PTEN (253, 264), FASLG (255), and LRRFIP, these targets play key roles

in one or more cellular functions; invasion, growth, tumorigenesis, or apoptosis. These

findings have highlighted the central role miR-21 and other miRNAs play, presenting

new approach to modulating the metastatic characteristics of cancers.

1.5.2. miR-494

MicroRNA 494 (miR-494) has been shown to be dysregulated in a variety of solid

cancers including; brain, lung, oral, gastric, colon, liver, pancreatic, and ovarian

cancers. Li, X et al. reported elevated levels of miR-494 in human brain glioma tissue

compared to normal brain tissues (271). miR-494 has been shown to have an

oncogenic role in these cancers functioning in tumor; invasion, progression and

tumorigenesis. miR-494 is frequently overexpressed in malignant tumor types, high

expression is often associated with poor prognosis (272). It was demonstrated that

overexpression was correlated with adverse clinical stage and the presence of distant

metastasis (273, 274) in gliomas, colorectal cancer, epithelial ovarian carcinoma, non-

small-cell lung cancer (273-276).

Down regulation of miR-494 expression was shown to inhibit invasion, proliferation

and promote apoptosis in glioma cells (271). Lie et al. showed that miR-494 protein

expression decreased PTEN protein expression. PTEN acts as an inhibitory protein in

the PI3K/AKT pathway modulating the effect of growth factors and reducing cell

40

growth, thus downregulation of PTEN by miR-494 increases cell growth in cancer

cells. Liu et al also showed that PTEN targeting by miR-494 has been demonstrated

in a variety of solid cancers, and showed that miR-494 binds 3’UTR of the PTEN

mRNA and represses its translation(138). miR-494 has also been shown to target other

proteins responsible for invasion, progression, apoptosis and tumorigenesis such as;

c-myc (275, 277), SRT1 (277), caspase-3/7 (278), KIT (receptor tyrosine kinase

family)(279), BAG-1 (280), secretagogin (SCGN)(281), BIM, Insulin like growth

factor 1 (IGF1R)(274), CLPTM1L (282), tumor necrosis factor (TNF)-related

apoptosis inducing ligand (TRAIL)(283), furthermore, it was verified that miR-494

modulates the protein levels of six genes involved in the G2/M transition: polo-like

kinase1 (PLK1), cyclin B1 (CCNB1), cell-division cycle 2 (CDC2), cell-division

cycle 20 (CDC20), topoisomerase 11 alpha (TOP2A)(284), and PTTG1.

1.6. Nucleic-Acid Based Therapeutics

Nucleic-acid based technologies are typically synthetic oligonucleotides of 8-50

nucleotides in length. These synthetic oligonucleotides bind to RNA through Watson-

Crick base pairing to alter the expression of target RNAs and proteins.

RNA targeting strategies include chemically modified oligonucleotides

(antimiRs/antagomiRs), miRNA sponges, small molecule, siRNA, miRNA masks,

and aptamers. These approaches for targeting miRNAs have shown promise and have

attracted significant interest in recent years for tackling several diseases (285), with a

number of clinical trials being conducted focusing on miRNA targeting technologies.

Below we briefly highlight nucleic-acid based therapeutics. An in-depth look at

miRNA targeting strategies has been well covered in a review article by Ji et al. (286).

41

1.6.1. Antisense oligonucleotides

Antisense oligonucleotides (AOs) are short single-stranded synthetic

oligonucleotides, which can specifically target an mRNA transcript to regulate protein

expression. There exist a number of antisense mechanism including RNase H

recruitment and cleavage of mRNA, modulation of splicing in pre-mRNA, and steric

blockade of either mature or pre-mRNA. RNase H mediated cleavage involves

designing short DNA oligonucleotide that binds to target mRNA and forms a RNA-

DNA duplex (287). The duplex is recognized and cleaved by endogenous RNase H

(288). While the concept is simple, the efficiency is moderate.

1.6.2. siRNA

Small interfering RNA (siRNA) are a class of double-stranded RNA molecules, 20-25

nucleotides in length, similar to miRNA. siRNA function within the RNA interference

(RNAi) pathway, which assemble into RNA-induced silencing complex (RISC) to

silence gene expression (287, 289).

1.6.3. AntimiRs and miRNA mimics

AntimiRs are a class of chemically engineered oligonucleotides that prevent target

molecules from binding to a desired site on an mRNA molecules (steric blocking

mechanism) or by hybridisation to miRNA. AntimiRs modulate RNA and protein

expression by targeted inhibition of endogenous miRNAs (290, 291). miRNA mimics

modulate RNA and protein expression by acting like their endogenous miRNA

counterparts.

42

1.6.4. Nucleic acid aptamers

Aptamers are short single stranded RNA or DNA oligonucleotides with unique three-

dimensional structure that bind to targets with high affinity and specificity. Aptamers

can be developed against a variety of targets ranging from small molecules to complex

proteins over whole cells. Aptamers can be used for therapeutics, and diagnostics

(biosensors and molecular imaging). Although they have not been used to target

miRNAs, aptamers can be developed to deliver miRNAs or antimiRs to cells (292).

1.6.5. Synthetic catalytic oligonucleotides - DNAzymes

DNAzymes also known as AntimiRzymes, consist of two binding arms with

complementary to its target sequence, which hybridise with its target RNA, and a

catalytic core between the binding arms to catalyse the cleavage of the target mRNA

at the phosphodiester bond at any purine-pyrimide or purine-purine junction,

providing highly specific targeted cleavage of target molecules. There are two main

types of catalytic domains the 8-17 and 10-23 enzymes (Figure 1.3), of 13 and 15

nucleotides in length respectively (293).

Figure 1.3. 10-23 and 8-17 catalytic motif DNAzymes. Adapted from Chakravarthy et al.

2017. (285).

43

An advantage catalytic oligonucleotides have over AOs and siRNA is that once bound,

cleavage occurs, freeing up the catalytic molecule to continue its action (Figure 1.4),

thus reducing concentrations of molecules needed to enter the tumor to have a similar

therapeutic effect, another advantage is the ability of DNAzyme to bypass the cellular

machinery, being self-catalytic, thus are not reliant on endogenous nucleases.

Synthetic catalytic oligonucleotides (DNAzymes) have already shown promise in

targeting Integrin alpha-4 RNA in primary human fibroblasts, demonstrating a 92%

reduction in expression of ITGA4 transcript following targeting of exon 9 (285).

Figure 1.4. Illustration of DNAzyme-based RNA cleavage. Adapted from Chakravarthy et al.

2017. (285).

1.6.6. Limitations

Each approach has its distinct advantages and caveats. One of the caveats of Antisense

oligonucleotides and siRNAs is that they exert their effects by targeting and binding

to the miRNA molecules. Although effective, once they have bound, they are

essentially “consumed”, thus require continuous administration and high abundance

44

within the system. This is particularly challenging when using these technologies

against brain tumors, where the blood-brain and blood-tumor barriers prevent the

accumulation of therapeutic drug concentrations. A form of catalytic oligonucleotide

as described above (1.6.5) would have a distinct advantage in this regard.

1.7. miRNA Modulation

1.7.1. Common approaches

There currently exists two main approaches to specifically target miRNAs; the first

aim is to replace downregulated miRNAs. miRNA replacement strategies include

miRNA mimics and miRNA expression vectors, restoration of these tumor suppressor

miRNAs to normal levels will help the cells return to a non-malignant phenotype. The

second approach aims to reduce and/ or inhibit the expression of upregulated miRNAs

which usually function as oncogenes in malignancies. Modulation approaches include

antimiRs, miRNA mimics, and DNAzymes.

1.8. Hypothesis and Aims

1.8.1. Hypothesis

Studies on several key oncogenic miRNAs, shown to play vital roles in cancer

progression, invasion, metastasis, apoptosis, and tumorigenesis have been summarised

above. MicroRNAs play key regulatory roles, and are found dysregulated in a number

of diseases, suppression/restoration of either up or down regulated miRNAs to normal

levels in many cases, abrogates and can even reverse the effects of cancer. This is

possibly true of other diseases, such as cardiovascular, metabolic, and neurological

diseases. We have also highlighted the variety of mRNA targets and the large range

45

of biological mechanisms and pathways a single miRNA has, which is both a

tremendous advantage and disadvantage.

miRNAs provide potential therapeutic targets, utilising antisense technologies, such

as mimics and antisense oligonucleotides for the restoration/suppression

(downregulation of upregulated miRNAs or upregulation of downregulated miRNAs)

of appropriation miRNAs could prove to be a highly specific and effective treatment

or therapy for patients suffering cancer, where conventional treatments remain

ineffective. However limitations in these strategies remain, but may be addressed by

the development of novel catalytic oligonucleotides. We hypothesize that DNAzymes

have the ability to target and cleave miRNAs in vitro and in cell, moreover, DNAzyme

induced miRNA reduction will cause a reduction of tumor progression, invasion,

metastasis, apoptosis and tumorigenesis.

1.8.2. Aims

Our first aim is to identify novel catalytic DNA molecules for targeting and inhibiting

miRNAs that are overexpressed in glioblastoma. We aim to comprehensively compile

a list of miRNAs of interest from published literature that show overexpression and

ability to inhibit or prevent cancer spread (Table 1.1). From this comprehensive table,

the best miRNA targets (miR-21 and miR-494) will be selected for and DNAzymes

designed. miR-21 and miR-494 were selected due to both miRNAs being studied

extensively, and both showing that dysregulation plays a key role in tumor growth,

invasion, and proliferation.

The primary aim of this project is to test the ability of DNAzymes to target miRNAs,

specifically miR-21 and miR-494 in vitro. Moreover there is no information on

whether DNAzyme can target and cleave miRNAs within the cellular environment,

46

the secondary aim of this project is to test the ability of DNAzymes to cleave miR-21

and miR-494 in a number of cells lines including; glioblastoma, liver and breast

cancer. Following confirmation of DNAzyme function, we aim to quantify the

expression levels of target miRNAs to evaluate the efficiency of our DNAzymes in

cell.

47

2. Materials and Methods

2.1. Materials and Reagents

2.1.1. DNAzymes

• Constructs RNV533-538 (miR-494), and RNV539-542 (miR-21), were

designed and kindly provided by Dr. Rakesh N. Veedu. Ordered from

Integrated DNA Technologies (IDT, Singapore).

2.1.2. Cleavage analysis

• Template RNA strands (miR-494, miR-21) (IDT, Singapore)

• Buffer (Mg2+) (Sigma-Aldrich, Sydney, Australia)

• Molecular grade H2O (Sigma-Aldrich, Sydney, Australia)

• 1.5mL Microcentrifuge tube (Sarstedt, Nümbrecht, Germany)

2.1.3. Polyacrylamide gel

• Polyacrylamide gel mix (PAGE): 7M urea, 40% acrylamide, 10X TBE

(Tris/Borate/EDTA), (BIO-RAD, Sydney, Australia), deionised H2O (dH2O)

• Ammonium persulfate (Sigma-Aldrich, Sydney, Australia) solution (10%)

• Tetramethylethylenediamine (TEMED) (Sigma-Aldrich, Sydney, Australia)

• Formamide loading buffer (FLB) (Sigma-Aldrich, Sydney, Australia)

• 1X TBE buffer diluted from 10X TBE stock (ThermoFisher Scientific,

Melbourne, Australia)

• Fusion FX vilber-lourmat (Fisher-biotech Australia, Perth, Australia)

2.1.4. Primers

• RNU44, RNU48, RNU6B, miR-21, and miR-494 (Applied Biosystems,


48

2.1.5. Housekeeping genes and Controls

• RNV174 (Scrambled Sequence) (IDT, Singapore)

• RNV25 (Scrambled Sequence) (IDT, Singapore)

• RNU44, RNU48, RNU6B TaqMan™ MicroRNA Assays (Applied

Biosystems, Melbourne, Australia)

2.1.6. Cell culture

• Human malignant glioblastoma multiform (U87MG) cell line was ordered

from Cell Bank Australia (Sydney, Australia)

• Hepatocellular carcinoma (Huh-7) cell line was kindly provided by Dr.

Bernard Callus, originally bought from American Type Culture Collection

(ATCC, Manassas, USA)

• Human breast adenocarcinoma (MDA-MB231) cell line was ordered from

ATCC (Manassas, USA)

• 1X Phosphate buffer saline (PBS) was made using a 1X PBS tablet (Sigma-

Aldrich, Sydney, Australia), dissolved with 500mL Milli-Q H2O (Sigma-

Aldrich, Sydney, Australia)

• 1X Trypsin diluted from 10X Trypsin (Sigma-Aldrich, Sydney, Australia)

• Neutralisation Media: Dulbecco’s Modified Eagle Media (DMEM)

supplemented with 10% Horse Serum (HS) (ThermoFisher Scientific,


• U87 Growth media: Eagle’s Minimum Essential Medium (EMEM)

supplemented with 10% Foetal Bovine Serum (FBS) (ThermoFisher

Scientific, Melbourne, Australia)

49

• Huh7 and MDA-MB231 Growth media: DMEM supplemented with 10%

FBS

• GlutaMAX™ supplement (ThermoFisher Scientific, Melbourne, Australia)

• NuNc™ EasYFlask™ 25cm2, 75cm2 , 175cm2 Nunclon™ Delta Surface

(ThermoFisher Scientific, Melbourne, Australia)

• NuNc™ Dish 10cm2 Nunclon™ Delta Surface (ThermoFisher Scientific,


• 24-well plate Nunclon™ Delta Surface (ThermoFisher Scientific, Melbourne,

Australia)

• Trypan blue stain (Life Technologies, Melbourne, Australia)

2.1.7. Transfection

• Opti-MEM™ reduced serum media, GlutaMAX™ supplement (ThermoFisher

Scientific, Melbourne, Australia)

• Lipofectamine® RNAiMAX Transfection Reagent (In Vitro Technologies,


• Lipofectamine® 3000 and P3000 (In Vitro Technologies, Melbourne,

Australia)

• FuGENE® HD Transfection Reagent (Promega, Sydney, Australia)

• Lipofectamine® 2000 reagent (In Vitro Technologies, Melbourne, Australia)

• Lipofectin® Reagent (In Vitro Technologies, Melbourne, Australia)

• Growth media as described in section 2.1.6.

• DNA constructs from IDT as described in section 2.1.1.

• Template stands as described in section 2.1.1.

• Sterile T25cm2, T75cm2 Flasks and T175cm2 as described in 2.1.6.

50


2.1.8. RNA extraction

• RNAaseZap™ (Sigma-Aldrich, Sydney, Australia)

• mirVana™ PARIS™ mirVana™ Protein and RNA Isolation System kit

(Invitrogen, Melbourne, Australia): Cell disruption buffer, 2X Denaturing

solution, Wash solution 1, 2/3, Elution buffer

• Acid-Phenol: CHCl3 (Invitrogen, Melbourne, Australia)

• Ethyl alcohol, pure (Sigma-Aldrich, Melbourne, Australia)

• 2.0mL Graduated microtubes, Natural (SSI bio, Sacramento, USA)

• Filter cartridges (Invitrogen, Melbourne, Australia)

• Collection tubes (Ambion, Melbourne, Australia)

• TE buffer pH 8 (Invitrogen, Melbourne, Australia)

2.1.9. RT-PCR

• 10X RT buffer (Applied Biosystems, Melbourne, Australia)

• dNTPs(100mM) (Applied Biosystems, Melbourne, Australia)

• RT custom primer pool (Applied Biosystems, Melbourne, Australia)

• TaqMan™ MicroRNA Reverse Transcription Kit (Applied Biosystems,


• RNAase inhibitor (Applied Biosystems, Melbourne, Australia)

• Multiscript reverse transcriptase (RT)(Applied Biosystems, Melbourne,

Australia)

• Molecular grade H2O (Sigma-Aldrich, Sydney, Australia)


• 0.2mL PCR tubes (SSI bio, Sacramento, USA)

51

• C1000™ Thermal cycler (BIO-RAD, Sydney, Australia)

2.1.10. q-PCR

• TaqMan™ Universal Master Mix II, no UNG (Applied Biosystems,


• 20X TaqMan® MicroRNA Assay (miR-21, miR-494) (Applied Biosystems,


• Hard-Shell® 96-well PCR microplate (BIO-RAD, Sydney, Australia)

• Optimal film (BIO-RAD, Sydney, Australia)

• dH2O

• C1000™ Thermal cycler, CFX96™ real-time system (BIO-RAD, Sydney,

Australia)

2.1.11. Cell resurrection

• Serum free DMEM (ThermoFisher Scientific, Melbourne, Australia)

• DMSO (Dimethyl Sulfoxide) (Sigma-Aldrich, Sydney, Australia)

• Cell Resurrection media: DMEM supplemented with 10% FBS

(ThermoFisher Scientific, Melbourne, Australia)

2.1.12. Microscopy

• Hoechst Solution (bisBenzimide H Trihydrochloride) (Sigma-Aldrich,

Sydney, Australia)

• Colourless Opti-MEM™ (ThermoFisher Scientific, Melbourne, Australia)

• 1X PBS made in house as in 2.1.6

• Eclipse TS100 microscope (Nikon Australia, Sydney, Australia)

52

2.2. Methods

Figure 2.1. provides a flow chart of the experimental pipeline for the study, from target

identification and selection, to transfection reagent optimisation, in vitro and in cell

cleavage analyses to address the three main aims, details of these methods are provided

in the following sections.

Figure 2.1. Flowchart of experimental pipeline for the study. This Includes target

transfection reagent optimisation and subsequent microscopy. Orange boxes signify the

three project aims.

2.2.1. miRNA selection

To select target miRNAs, a comprehensive review on miRNAs was conducted (Table

1.1). The criteria for the review included; miRNA must be overexpressed in GBM and

possibly other cancers/diseases, miRNA must have an oncogenic role within the

disease. Following the literature review, miR-21 and miR-494 were selected, not only

are they overexpressed in GBM and numerous other cancers, but they also exhibit

53

strong oncogenic roles being involved in; proliferation, invasion, growth and apoptosis

as reported in section 1.5. We selected the 5’ strand of the respective miRNAs (miR-

21-5p and miR-494-3p) because previous reports indicate the 5’ strand codes for the

mature miRNA sequence (Figure 2.2).

Figure 2.2. Illustration of Pre-miRNA Structure. The mature miRNA strand is shown in red

and green, the passenger strand is shown in blue and purple.

2.2.2. In Vitro Cleavage Assay (DNAzyme screening)

2.2.2.1. Cleavage Reaction

4.4µL of 20uM DNAzyme was incubated with equal molar concentrations of FAM-

conjugated miRNA template RNA in 5µl of buffer containing Mg2+ divalent cations

(10mM MgCl2) at 37°C (Table 2.1). The reaction was stopped by adding 10µL of

Formamide to 10µL of the reaction mixture at 0, 30, 60, 120, and 180 minutes. A

Scrambled sequence (RNV174) was used as negative control and the untreated

samples did not contain any DNAzymes. The reaction mixtures were separated on a

15% polyacrylamide gel/7M urea for 50 minutes at 13W. The gel was visualised using

the Fusion FX Vilber Lourmat Imager.

54

Table 2.1. DNAzyme master mix reaction volumes.

2.2.3. Polyacrylamide gel electrophoresis

2.2.3.1. Polyacrylamide gel mix

7M urea (42g) was dissolved into 37.5ml of 40% acrylamide and 10mL 10X TBE in

a 100mL glass bottle, using a magnetic stirrer and topped up to 100mL with deionised

H2O. Gel mix was stored at 4°C until use.

2.2.3.2. Preparing plates

Glass plates were washed with water and then sprayed with ethanol. Slides were dried.

Glass plates were then placed together with masked tape side placed on the inside,

plates were then placed into the chamber with opposite side balanced with a buffer

dam and locked into place. H2O was added between slides to ensure there was no

leakage, H2O was then poured out and plates dried.

2.2.3.3. Complete gel mix was made

For a single gel plate 10mL Polyacrylamide gel mix, 60µL 10% ammonium persulfate

solution, and 12µL TEMED were added into a 50mL tube and mixed.

Reagents Volume(μL)

Buffer (Mg2+ to catalyse the reaction) 5

DNAzyme (20μM) 4.4

RNA (20μM) 4.4

H2O 36.2

55

2.2.3.4. Gel Casting

Using a transfer pipette, the gel mix was poured between the glass plates. An

appropriately sized comb was inserted half way. The small remainder of gel mix left

in the 50mL tube was retained, and used to evaluate if the gel had polymerised. Once

the gel had hardened, the comb was removed.

2.2.3.5. Gel tank set up

Gel plate chamber (glass plates and hardened gel mix) was placed into the gel tank.

The gel tank was then filled with 1X TBE, to the indicated line (approximately two

thirds full). Wells were flushed with 1X TBE by pipetting up and down a few times.

The gel was pre-run at 13W for 30 minutes. Wells were flushed again following the

pre-run, 10µL of each sample was loaded into each well and the gel was run at 13W

for 25-35 minutes. Once the final run had completed, the gels were removed from their

chambers and visualised using the Fusion FX Vilber Lourmat Imager (ThermoFisher

Biotech) under Bao protocol (Fluorescent samples, exposure time: 0 to 4 sec, serial

mode: Incremental, Number of Images: 5).

2.2.3.6. Image analysis of the gel from in vitro cleavage assay

Densitometry was conducted using Image J Software to measure the band intensity.

The band intensity of the full length RNA bands for different time points were

measured and normalised to the combined band intensity of both cleaved and full

length RNA bands for different time points and plotted on excel (Microsoft) as the

percent of uncleaved RNA. The same analysis was repeated to calculate percentage of

cleaved RNA.

56

2.2.4. Cell resurrection

2.2.4.1. General

Cell culture work was performed under sterilised conditions in a class II biological

safety cabinet (fume hood). The cells were grown and maintained in a humidified 37°C

incubator at 5% CO2. All instruments were sterilised prior to use by spraying with

70% ethanol. All media including; DMEM and FBS were prewarmed to 37°C before

use.

2.2.4.2. Cell resurrection

The cells suspension was brought down from liquid nitrogen or -80°C, cell suspension

was stored in esky containing dry ice and moved to PC2 laboratory. In a class II

biosafety cabinet a 15mL tube was prepared with cell resurrection media as described

in 2.1.6. The vial of cell suspension was then thawed in a 37°C waterbath. Once

thawed, 1mL of cell suspension was added to the 15mL tube containing cell

resurrection media (DMEM supplemented with 10% FBS) to neutralise the DMSO.

The 15mL was then centrifuged at 1000 rcf for 5 minutes, supernatant was discarded

and cell pellet was resuspended in 1mL cell resurrection media as described in 2.1.6.

Cell suspension was then added to a T75cm2 Flask containing Cell resurrection media.

The flask was incubated at 37°C in 5% CO2/air.

2.2.5. U87MG and Huh-7 cell culture/subculture

2.2.5.1. Plating cells

When U87, MDA-MB231, and Huh-7 reached 70-80% confluence, they were seeded

into a combination of T25cm2, T75cm2, T175cm2 flasks and 10cm2 plates (only Huh-

7) in growth media for the subsequent transfection using the following method. Cell

57

culture media was removed (aspirated) from the culture flask and PBS was used to

wash the flask (exact volumes for each flask in Table 2.2). Cells were then detached

from the flask by treatment with 1X trypsin and incubated for approximately 2 minutes

at 37°C. Following incubation, the cells were checked under the microscope to ensure

that the cells were detached from the flask surface. Neutralisation media (1:1 ratio

with trypsin) was then added (Table 2.2), to neutralise the trypsin. The cells were then

transferred to a 15mL tube and centrifuged at 1000 rcf for 2.5 minutes, forming a cell

pellet. The supernatant was then removed and discarded, and the cell pellet was

resuspended in approximately 1mL growth media. For maintenance, approximately

50% of cells were added back into the flask with growth media (Table 2.2), 10%

glutaMAX™ supplement was added with media for Huh-7 cells, the other 50% were

discarded. To determine the cell number, cells were counted using a haemocytometer.

Table 2.2. Volumes of PBS, trypsin, media for each culture vessel.

2.2.5.2. Counting cells

For plating, approximately 10µL aliquot of cell suspension was transferred into a

sterile 1.5mL tube. On a parafilm a 1:4, 1:8, or 1:10 dilution of tryphan blue and cell

suspension was made depending on estimated cell number. 10µL of the diluted cells

was taken and pipetted under the coverslip on the hemocytometer. Under the

microscope four corners of the square were counted, and cell number calculated

T25cm2 Flask

T75cm2 Flask

T175cm2

Flask 10cm2 Plate = (T60 cm2)

1X PBS(mL) 2-3 7-10 10 3-5

Trypsin(mL) 2 3 5 2

Neutralisation Media(mL)

2 3 5 2

Culture Media(mL) Total

5 10 18-20 5-7

58

(Figure 2.2). Once cell number was obtained cell growth media was used to make the

desired dilution of cell suspension.

1. Calculate the number of cells present/ml:

• (𝐶𝑜𝑟𝑛𝑒𝑟 𝑠𝑞𝑢𝑎𝑟𝑒 1+ 𝑐𝑜𝑟𝑛𝑒𝑟 𝑠𝑞𝑢𝑎𝑟𝑒 2+ 𝑐𝑜𝑟𝑛𝑒𝑟 𝑠𝑞𝑢𝑎𝑟𝑒 3+ 𝑐𝑜𝑟𝑛𝑒𝑟 𝑠𝑞𝑢𝑎𝑟𝑒 4)

4×

𝐷𝑖𝑙𝑢𝑡𝑖𝑜𝑛 𝐹𝑎𝑐𝑡𝑜𝑟 • = 𝑥 × 104 𝑐𝑒𝑙𝑙𝑠/𝑚𝐿

2. Calculate the number of cells/ mL needed and the dilution:

• 𝐷𝑖𝑙𝑢𝑡𝑖𝑜𝑛 𝑓𝑎𝑐𝑡𝑜𝑟 =𝑥 ×104𝑐𝑒𝑙𝑙𝑠/𝑚𝐿(𝑓𝑟𝑜𝑚 𝑆𝑡𝑒𝑝 1)

𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑐𝑒𝑙𝑙𝑠 𝑛𝑒𝑒𝑑𝑒𝑑/𝑚𝐿

3. Calculate the amount of cell suspension to add to media:

• 𝑅𝑒𝑞𝑢𝑖𝑟𝑒𝑑 𝑣𝑜𝑙𝑢𝑚𝑒 (𝑚𝐿)

𝑑𝑖𝑙𝑢𝑡𝑖𝑜𝑛 𝑓𝑎𝑐𝑡𝑜𝑟 (𝑐𝑎𝑙𝑐𝑢𝑙𝑎𝑡𝑒𝑑 𝑖𝑛 𝑠𝑡𝑒𝑝 2)= 𝑣𝑜𝑙𝑢𝑚𝑒 𝑜𝑓 𝑐𝑒𝑙𝑙 𝑠𝑢𝑠𝑝𝑒𝑛𝑠𝑖𝑜𝑛 𝑛𝑒𝑒𝑑𝑒𝑑

• 𝑅𝑒𝑞𝑢𝑖𝑟𝑒𝑑 𝑣𝑜𝑙𝑢𝑚𝑒 (𝑚𝐿) − 𝑣𝑜𝑙𝑢𝑚𝑒 𝑜𝑓 𝑐𝑒𝑙𝑙 𝑠𝑢𝑠𝑝𝑒𝑛𝑠𝑖𝑜𝑛 𝑛𝑒𝑒𝑑𝑒𝑑 =𝑣𝑜𝑙𝑢𝑚𝑒 𝑜𝑓 𝑔𝑟𝑜𝑤𝑡ℎ 𝑚𝑒𝑑𝑖𝑎 𝑛𝑒𝑒𝑑𝑒𝑑

Figure 2.3. Cell count calculation. Each flask was seeded with approximately 1,000,000 U87,

and MDA-MB231, cells for q-PCR and 50,000 for transfection reagent efficiency, and initially

each flask/plate was seeded with approximately 2,000,000 Huh-7 cells then 50,000 for

subsequent experiments.

2.2.6. Transfection reagent efficiency analysis/optimisation

2.2.6.1. Transfection for Microscopy

Cells were transfected with DNA using several transfection reagents including;

Lipofectamine® 3000 and P3000 (In Vitro Technologies), Lipofectamine® 3000,

Lipofectamine® 2000, Lipofectin®, Lipofectamin®, RNAiMAX (ThermoFisher

Scientific), and FuGENE®HD (Promega) to enhance the cellular uptake of

DNAzymes. As per the manufacturers protocol two tubes were prepared (A and B) in

the appropriate volumes (Table 2.3, Figure 2.4) for each transfection reagent. Tubes

A and B were incubated separately to allow for conjugation of transfection reagent

with the DNAzyme. The two tubes were then combined and incubated again at room

59

temperature per the manufacturer’s protocol for either 10, 15 or 30 minutes (Table 2.3,

Figure 2.4). The remainder of the Opti-MEM™ was then added (Table 2.3, Figure

2.4). 500µL transfection mix was then added to each well of the 24-well plate and

incubated for a 24 hour period. Random scrambled sequence (RNV25) alone and

untreated samples were run as controls.

Table 2.3. Reaction mix for each transfection reagent efficiency test.

Transfection Reagent

AO/DNAzyme name

Mol weight (g/mol)

Stock (nM)

Transfection Reagent (nM)

Vol (µL)/well

no. of wells

ug

L3KP3K RNV25 7913.3 100000 200 500 1 0.79133

L3K and IMAX RNV25 7913.3 100000 200 500 1 0.79133

L2K, Lipofectin and Fugene

RNV25 7913.3 100000 200 500 1 0.79133

AO/DNAzyme alone

RNV25 7913.3 100000 200 500 1 0.79133

Optimem (µL)

Volume of Reagent (µL)

AO/DNAzyme (µL)

P3000 Optimem (µL)

Optimem (µL)

Incubation time (Min)

48.5 1.5 1 1.58 47.4 400 10

48.5

1.5 1 0 49 400 10

48.417 1.583 1 0 49 400 10, 30, and 15

0 1.5 1 0 49 400 0

60

Figure 2.4. Illustration of workflow for transfection of cells.

2.2.6.2. Transfection of U87MG and Huh-7 cells

Transfections were performed in 24-well plate seeded with approximately 50,000

cells/well. The cells were seeded 24 hours prior to transfecting with DNAzymes

complexed with Lipofectamine 3000® and P3000 transfection reagent per the

manufacturers protocol (Figure 2.4). Media was aspirated from the cells in the plate,

transfection mixes for each concentration was added to each corresponding well. The

cells and transfection mix were incubated for 24 hours, at 37°C in an incubator

supplying 5% CO2/air.

61

2.2.7. Fluorescent Microscopy

2.2.7.1. Cell Preparation and Hoechst staining

To stain the nucleus of the cells, approximately 1µL of Hoechst solution (1µg/mL)

(Sigma-Aldrich) was added to the plated cells and incubated for 10 minutes at 37°C.

Media was removed (aspirated) and approximately 500µL of 1X PBS was used to

wash the wells, wells were washed a total of two times, cells were observed under the

microscope after each wash, to ensure cells remained attached to the wells surface.

PBS was then removed (aspirated) and 300µL colourless Opti-MEM™

(ThermoFisher Scientific) was added. Fluorescent microscopy was conducted using

the Eclipse TS100 microscope (Nikon Australia) and accompanying NIS Elements

AR 4.13.05 program.

2.2.8. Transfection

2.2.8.1. Transfection for RNA extraction

Cells were transfected with DNA using Liopofectamine 3000® and P3000 to enhance

the cellular uptake of the DNAzyme. Transfection mixes were prepared following

protocol described in 2.2.6.1.

Two 1.5mL tubes were labelled A and B. Optimem was added to each tube A and B.

DNA and P3000 was added to tube B, tube A was then transferred to tube B for each

transfection mix, and incubated at room temperature for 15 minutes inside the fume

hood. The remainder of the optimem was then added. Transfection mix was then added

to plated cells (Figure 2.4). The cells and transfection mix were incubated for 24

hours, at 37°C in an incubator supplying 5% CO2/air.

62

2.2.8.2. Transfection of U87MG, MDA-MB231, and Huh-7 cells with Lipofectamine

3000® P3000 reagent

Transfections were performed in T25cm2 Flasks seeded with approximately 1,000,000

cells/flask for U87, and MDA-MB231 cells and in 10cm2 plates were seeded with

approximately 2,000,000 cells/flask for Huh-7 cells. The cells were seeded 24 hours

prior to transfecting with DNAzymes complexed with Lipofectamine 3000®

transfection reagent per the manufacturers protocol. Media was aspirated from the

cells in the flask/plate, transfection mixes for each concentration was added to each

flask/well (Figure 2.4). The cells and transfection mix were incubated for 24 hours, at

37°C in an incubator supplying 5% CO2/air.

2.2.9. RNA extraction

2.2.9.1. General

Class II biological safety cabinet (fume hood) was sprayed with RNAaseZap and 70%

ethanol to sterilise the area. A bench pad was used to conduct the extraction. Thermos

block was pre-heated to 95°C.

2.2.9.2. Cell Collection for RNA extraction

As described in 2.2.4.2. once the cell pellet was obtained, it was stored in an esky filled

with ice and transferred to pre-PCR laboratory for RNA extraction.

2.2.9.3. RNA extraction

Following transfection, miRNA was isolated using mirVana™ PARIS™ mirVana™

Protein and RNA isolation System kit (Invitrogen) per the manufacturers protocol. A

10µL aliquot was taken of each sample, 2µL was used to conduct nanodrop. Nanodrop

was conducted to determine purity and quantity of RNA extracted. Once adequate

63

yield was confirmed cDNAs were then synthesized and amplified using one-step RT-

PCR, as indicated below.

2.2.10. RT-PCR and q-PCR

2.2.10.1. RT-PCR

RT-PCR was carried out on RNA samples from cells treated with miR-494 and miR-

21 targeting DNAzymes, using TaqMan™ MicroRNA Reverse Transcription Kit

(Applied Biosystems) with Multiscribe Reverse Transcriptase (RT) (Applied

Biosystems). Each reaction consisted of 3µl of Multiscribe RT, 6µL RT custom primer

pool, 0.19µL RNAase inhibitor, 100nM dNTPs, 10X RT buffer, 100ng RNA, and

dH2O up to a final volume of 12µL per sample. Samples were loaded into C1000™

Thermal cycler and cycling conditions were set as follow: initially at 4°C for 5min,

followed by 16°C for 30min, 42°C for 30min, 80°C for 5 min, then finally 4°C till

samples were removed.

2.2.10.2. q-PCR

q-PCR was carried out on cDNA samples produced in RT-PCR. A master mix

consisted of 5µL of TaqMan Master Mix and 20X TaqMan Assays (RNU44, RNU6B,

RNU48, miR-21 and miR-494) were prepared. cDNAs were diluted into 90µL dH2O

to make up to 1:7 dilution. 15µL of master mix and 4.5µL of diluted RNA were added

into each well of a 96-well plate and covered with optimal film. The 96-well plate was

centrifuged at 1000 rcf for 1min. q-PCR was conducted in C1000™ Thermal cycler,

CFX96™ real-time system, and programmed initially at 95°C for 10min, 95°C for

15sec, then 60°C for 1 min, q-PCR is repeated for a total of 40 cycles.

64

2.2.11. Data analysis

2.2.11.1. q-PCR Raw Data Analysis

Raw data of miRNA expression obtained from q-PCR were analysed using delta delta

CT (ΔΔCT) statistical analysis via Bio-Rad CFX Manager™ Software. The analysed

data was then exported to excel (Microsoft) and presented in graphs as normalised

miRNA expression.

65

3. Results

3.1. Initial DNAzyme Construct screening

As proof-of-concept that knockdown of overexpressed oncogenic microRNAs is

inducible and can alter expression of targeted miRNAs using a synthetic catalytic

oligonucleotide (DNAzyme) is possible, six DNAzymes complementary to miR-494

and four DNAzyme constructs targeting miR-21 were tested by in vitro cleavage

(Table 3.1).

Table 3.1. Sequences and targets of DNAzyme constructs.

Table 3.2. Sequences of template strands.

Target Sequence

Construct name

Sequence (5’-3’)

miR-494-3p (Temp-7) RNV533 TTCCCGTGGGCTAGCTACAACGAATGTTTC

miR-494-3p (Temp-7) RNV534 AGGTTTCCCGGGCTAGCTACAACGACTATGTTTCA

miR-494-3p (Temp-7) RNV535 GAGGTTTCCCGTGGGCTAGCTACAACGAATGTTTCA

miR-494-3p (Temp-7) RNV536 CGTGTAGGCTAGCTACAACGAGTTTCA

miR-494-3p (Temp-7) RNV537 TTCCCGTGTAGGCTAGCTACAACGAGTTTCA

miR-494-3p (Temp-7) RNV538 GAGGTTTCCCGTGTAGGCTAGCTACAACGAGTTTCA

miR-21-5p (Temp-8) RNV539 TCAACATGAGTCTGAGGCTAGCTACAACGAAAGCTA

miR-21-5p (Temp-8) RNV540 ATGAGTCTGAGGCTAGCTACAACGAAAGCTA

miR-21-5p (Temp-8) RNV541 TCAACAGGCTAGCTACAACGACAGTCTGATAAGCTA

miR-21-5p (Temp-8) RNV542 TCAACAGGCTAGCTACAACGACAGTCTGATA

Scrambled (RNV174)

GACCTCATCGTTGTAGCTAGCCTGCAGATG

Template Name Sequence (5’-3’)

miR-494-3p (Temp-7) UGAAACAUACACGGGAAACCUC

miR-21-5p (Temp-8) UAGCUUAUCAGCUGAUGUUGA

66

3.1.1. miR-494 Targeting constructs (RNV533-RNV538)

Initially miR-494 targeting DNAzymes (RNV533, 534, 535, 536, 537, 538) were

tested at 20µM concentration (1:1 ratio with template) at time points 0, 60 and 120

minutes. Four of the six constructs tested showed no cleavage of temp-7(Figure 3.1A).

Figure 3.1A. In vitro cleavage assay of RNV533, 534, 535, and 536 targeting miR-494-3p.

Two constructs showed cleavage of miR-494 (Temp-7) at time points 60 and 120

minutes, these included RNV537 and RNV538 (Figure 3.1B).

Figure 3.1B. In vitro cleavage assay of RNV537 and 538 targeting miR-494-3p.

Densitometry revealed a positive correlation between incubation time (Time points)

and cleavage for RNV537 and RNV538, as time increased the cleavage also increased,

for constructs RNV533 to RNV536 there was no change to band intensity. RNV538

showed slightly lower cleavage efficiency at 60 and 120 minutes than RNV537

(Figure 3.1C).

67

Figure 3.1C. Densitometry analysis of gels (In vitro cleavage assay) of RNV537 and RNV538.

68

3.1.2. miR-21 Targeting Constructs (RNV539, RNV540, RNV541, and RNV542)

#1

In vitro Cleavage analysis was conducted on miR-21 (Temp-8) targeting DNAzyme

constructs (RNV539, 540, 541, 542). These four constructs were tested at 100µM

concentration at a 1:1 ratio with Temp-8 at time points 5, 10, 30, 60, 120 minutes.

Constructs RNV539, 541 and 542 showed cleavage of Temp-8, RNV541 showed

highest cleavage efficiency followed by RNV542 then RNV539 (Figure 3.2A).

Figure 3.2A. In vitro cleavage assay of RNV539, 540, 541, 542 targeting miR-21.

Densitometry analysis of gels that showed cleavage revealed that there was a positive

correlation between time and percentage cleavage, as time increased the cleavage also

increased. RNV541 showed the highest percentage cleavage compared with RNV539

and RNV542 (Figure 3.2B).

69

Figure 3.2B. Densitometry analysis of gels (In vitro cleavage assay) of RNV539, RNV541,

and RNV542.

70

3.1.3. miR-21 Targeting Constructs (RNV539, RNV540, RNV541, and RNV542)

#2

To confirm the cleavage of RNV537, 538 and 541, we repeated the in vitro cleavage

assay again, with a 20µM DNAzyme concentration at a 1:1 ration with the templates

and an additional time point (180 minutes). RNV541 was the only construct to show

cleavage of the template (Figure 3.3A).

Figure 3.3A. In vitro cleavage assay of RNV539, 540, 541, and 542 targeting miR-21.

Densitometry analysis showed a positive correlation, as time increased the cleavage

also increased, moreover RNV541 showed efficient cleavage from time points 60 to

180 minutes with some cleavage occurring at time point 30 minutes (Figure 3.3B).

Figure 3.3B. Densitometry analysis of gel (In vitro cleavage assay) of RNV541.

71


RNV541) #1

To further confirm cleavage RNV537, 538 and 541 tested at 20µM at a 2:1 ratio with

the templates (Temp-7 and Temp-8) at time points 0, 10, 30, 60, 120 minutes. All three

of the DNAzyme constructs showed cleavage of their respective template strand

(Temp 7 or 8)(Figure 3.4A).

Figure 3.4A. In vitro cleavage assay of RNV537, 538, and 541 targeting miR-494 and miR-

21 respectively.

Densitometry revealed positive correlation between time and cleavage for RNV537,

RNV538 and RNV541 as time increased the cleavage also increased (Figure 3.4B).

72

Figure 3.4B. Densitometry analysis of gel (In vitro cleavage assay) of RNV537, RNV538, and

RNV541.

73


RNV541) #2

RNV537, 538 and 541 were tested again at 10µM concentration at a 10:1 ratio with

templates, time points 0 to 180 minutes. No cleavage was observed in any of the

constructs at this concentration (Figure 3.5).

Figure 3.5. In vitro cleavage assay of RNV537, 538, and 541 targeting miR-494 and miR-21.

74

3.2. In Cell Transfection Reagent Efficiency Test

3.2.1. Transfection Reagent efficiency in U87MG cell line

From visual observations Lipofectamine® 3000 and P3000 (L3KP3K) appear to have

shown the highest levels of cellular uptake compared with the other transfection

reagents, there also appeared to be little to no observable cell death (Figure 3.6).

FuGENE® (fugene) and Lipofectin® both appeared to show high levels of cellular

uptake on par with L3KP3K, however low amounts of cell death were observed

(Figure 3.6). RNAiMAX® (iMAX), Lipofectamine® 2000 (L2K), and

Lipofectamine® 3000 (L3K) both appeared to show little to no cellular uptake and

relatively high amount of cell death. RNV25 alone appeared to show a moderate

amount of cellular uptake and cell death. In Untreated (UT) there was little to no

cellular observable uptake of DNAzyme, however the FAM image shows high auto

fluorescence in the cells (Figure 3.6).

75

Figure 3.6. Transfection reagent efficiency test U87MG cell line. Images taken at 10X

microscope magnification. Results representative of n=2, other images showed the same

results (A) Experiment one U87 cells (B) Experiment two, conducted with all transfection

reagent and same experimental conditions, only Lipfectamine® 2000 and UT are shown.

76

3.2.2. Transfection reagent efficiency test Huh-7 cell line

From visual observations Lipofectamine 3000® and P3000, and Fugene® appeared to

show the highest amount of cellular uptake. Lipofectamine® appeared to show a

slightly higher level of uptake. No observable cell death was observed for either

Lipofectamine 3000® and P3000 or Fugene® (Figure 3.7). IMAX® and Lipofectin®

appeared to show relatively good (moderate) cellular uptake, there was no observable

cell death for either transfection reagent. L2K and L3K appeared to show relatively

low to moderate cellular uptake, L2K appeared to show a low amount of cell death.

RNV25 alone and UT appeared to show high levels of auto fluorescence, there is a

small amount of DNAzyme entering the cells for RNV25 (Figure 3.7).

77

Figure 3.7. Transfection reagent efficiency test Huh-7 cell line. Images taken at 10X

microscope magnification. Results are representative of n=3, other images showed the same

results.

78

3.3. In Cell Cleavage Analysis

Following initial screening in vitro, we wanted to determine if the DNAzyme

constructs have the ability to target and cleave microRNAs in cell, as well as wanting

to determine the effectiveness of cleavage of target sequences. In order to analyse the

efficiency, DNAzymes were transfected into cell lines at different concentrations

(50nM-400nM), and miRNA expression levels were measured by q-PCR. First, we

tested miR-494 targeting DNAzymes, RNV537 and RNV538 in U87 and Huh-7 cells,

an optimised qPCR array for miR-494 was readily available from a collaborating

laboratory, for Huh-7 cells.

79

3.3.1. Treatment of Huh-7 cells with RNV537 targeting miR-494

In order to validate the catalytic activity of RNV537 against miR-494 in cell, the

DNAzyme was transfected into Huh-7 cell line. 50nM showed relatively large

decrease in expression. Expression was decreased by 55%. 100nM showed increase

of miR-494 expression of 42%, similarly 200nM also showed a large increase in

expression at 61%. 300nM showed a decrease in expression of 25%. 400nM showed

increase in expression of 15%. Scrambled sequence (RNV174) showed a 40% increase

in expression of miR-494.

Figure 3.8. q-PCR analysis of normalized miR-494 expression in Huh-7 cells following

treatment with RNV537. RNV537 DNAzymes treatment at 50nM, 100nM, 200nM, 300nM,

400nM. Data points are obtained from one independent experiment performed in triplicate

(n=1). Results were normalised to UT samples.

0%

20%

40%

60%

80%

100%

120%

140%

160%

180%

RNV53750nM

RNV537100nM

RNV537200nM

RNV537300nM

RNV537400nM

ScrambledSequence

No

rmal

ised

miR

-49

4 E

xpre

ssio

n

miR-494 Expression

80

3.3.2. Treatment of U87MG cells with RNV537 targeting miR-494

All results showed an increase in miR-494 expression following treatment with

RNV537. 50nM concentration showed the smallest increase in expression at 1-2%.

100nM and 400nM concentrations showed similar increase in expression of 41% and

45% respectively. Scrambled sequence (RNV174) showed the largest increase,

expression was elevated by 79%.

Figure 3.9. q-PCR analysis of normalized miR-494 expression in U87MG cells following

treatment with RNV537. RNV537 DNAzyme treatment at 50nM, 100nM and 400nM

concentrations. Data points are obtained from one independent experiment performed in

triplicates (n=1). Results were normalised to UT samples.

0%

20%

40%

60%

80%

100%

120%

140%

160%

180%

200%

RNV537 50nM RNV537 100nM RNV537 400nM ScrambledSequence

No

rmal

ised

miR

-49

4 E

xpre

ssio

n

miR-494 Expression

81

3.3.3. Treatment of Huh-7 cells with RNV538 targeting miR-494

Similarly, to 3.3.1 we wanted to validate the catalytic activity of RNV538 in cell, so

we conducted transfection and q-PCR in huh-7 cell line. All DNAzyme concentration

showed decrease in miR-494 expression. 50nM showed the largest decrease at 50%.

100nM showed a decrease of 30%. 200nM showed the smallest decrease in expression

of any concentration of 15%. 400nM decreased expression by 25%. Scrambled

sequence (RNV174) showed an increase in miR-494 expression levels of 15%. There

was no observed dose dependent response and no obvious correlation between

concentration and cleavage efficiency.

Figure 3.10. q-PCR analysis of normalized miR-494 expression in Huh-7 cells following

treatment with RNV538. RNV538 DNAzymes treatment at 50nM, 100nM, 200nM, and 400nM.

Data points are obtained from one independent experiment performed in triplicate (n=1).

Results were normalised to UT samples.

0%

20%

40%

60%

80%

100%

120%

RNV538 50nM RNV538 100nMRNV538 200nMRNV538 400nM ScrambledSequence

No

rmal

ised

miR

-49

4 E

xpre

ssio

n

miR-494 Expression

82

3.3.4. Treatment of U87MG cells with RNV541 targeting miR-21

As the screening of DNAzymes targeting miR-494 in both U87 and Huh-7 cells did

not show any dose-dependent inhibition, we then explored the potential of miR-21

targeting DNAzyme (RNV541) in U87 glioblastoma cells.

The 100nM concentration showed 70% reduction in miR-21 expression. 200nM

showed a reduced expression of miR-21 by 90%. There is a strong positive correlation

between DNAzyme concentration and miR-21 expression level, as concentration

increased the level of expression reduction also increased. Scrambled sequence

(RNV174) showed a reduction in expression.

Figure 3.11. q-PCR analysis of normalized miR-21 expression in U87MG cells following

treatment with RNV541. RNV541 DNAzyme treatment at 100nM and 200nM concentrations.

Data points are the mean ± standard deviation, from two independent experiments performed

in triplicates (n=2). Results were normalised to UT samples.

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

RNV541 100nM RNV541 200nM Scrambled Sequence

No

rmal

ised

miR

-21

Exp

ress

ion

miR-21 Expression

83

3.3.5. Treatment of MDA-MB231 cells with RNV541 targeting miR-21

In order to validate the catalytic activity of RNV541 in cell, transfection and q-PCR

was conducted in MDA-MB231 cells. All DNAzyme concentrations showed

reduction in miR-21 expression. There was a positive correlation, as concentration

increased, miR-21 expression reduction also increased. There was a dose dependent

response. 100nM showed a knockdown of 18%, followed by 200nM at 22%, and lastly

400nM at 50% knockdown. Scrambled sequence (RNV174) showed an increase in

miR-21 expression.

Figure 3.12. q-PCR analysis of normalised miR-21 expression in MDA-MB231 cells following

treatment with RNV541. RNV541 DNAzyme treatment at 100nM, 200nM, and 400nM

concentrations. Data points are obtained from one independent experiment (n=1). Results

were normalised to UT.

0%

20%

40%

60%

80%

100%

120%

140%

160%

RNV541 100nM RNV541 200nM RNV541 400nM ScrambledSequence

No

rmal

ised

miR

-21

Exp

ress

ion

miR-21 Expression

84

4. Discussion

4.1. Principal findings

Initial screening showed that cleavage of miRNA templates could readily be achieved

by half of the DNAzyme tested (n=10), however cleavage efficiency seems to be

limited for some of the constructs. Two constructs (RNV539, RNV542) only showed

cleavage at 100µM concentration in vitro (Figure 3.2), cleavage was not observed

(bands disappeared) once concentration was reduced to 20µM (Figure 3.3). We

believe this variable efficiency is due to the length, similarity of arm regions for target

sequence and the nucleotides at which cleavage occurs for each DNAzyme, another

possible explanation is the incorrect formation of the RNA secondary structure,

particularly in the conserved catalytic core, base pairing with flanking miRNA bases

will alter the ability of the enzymatic core to cleave the target sequence.

Overall, the experimental results suggest that DNAzyme constructs RNV541,

RNV537 and RNV538 could induce efficient knockdown of their respective miRNA

targets miR-21 and miR-494 respectively, both in vitro and in cell. Five DNAzymes

tested (n=10) showed cleavage of their target sequence. Two (RNV539 and RNV542)

of which only showed cleavage at 100µM concentration in vitro (Figure 3.2 and 3.3)

indicating lack of efficiency or cleavage or binding to target sequence.

Treatment with RNV541 showed a dose dependent response in U87 and MDA-

MB231 cell lines (Figure 3.11 and 3.12), as expected there was generally a positive

correlation between concentration and cleavage, increasing DNAzyme concentration

resulted in larger decreases in miR-21 expression. RNV537 showed consistency in

85

levels of miR-494 knockdown in both U87 and Huh-7 cell lines, with RNV538

showing similar results to RNV537 in Huh-7 cells (Figure 3.8, 3.9, and 3.10).

Unexpectedly lower concentrations of DNAzymes in some cases showed higher

knockdown than high concentrations (Figure 3.8, 3.9, 3.10) , a possible explanation

for this could be that the DNAzymes are completely saturated at low concentrations

(e.g. 50nM) and thus resulting in no statistically significant reduction in expression at

increased concentrations, another explanation may be the formation of DNAzyme

self-dimers, this explanation is consistent with our results, as concentrations of

DNAzymes increase, we expect the occurrence of self-dimerization will also increase

and hence reduce the binding to the target miRNA sequence.

Interestingly, both miR-21 and miR-494 experiments scrambled sequence (RNV174)

showed either a minimal knockdown of target (Figure 3.11), or an increase in miRNA

expression (Figure 3.8, 3.9, 3.10, 3.12) compared with UT. We expected to see no

change in the miRNA expression of samples treated with RNV174, this was because

the sequence is not complementary to the target miRNAs, and was selected as a

negative control. Although unlikely this may be attributed to similarity between

RNV174 and target miRNA, causing primers to bind to RNV174 and causing a

misleading increase in miRNA expression. The most plausible explanation is the small

technical errors during the plating, cell collection, and RNA extraction resulting in

variability of miRNA expression from sample to sample.

4.2. Selection of Transfection Reagent

U87 cell lines were not previously used in this group thus it was essential to select a

transfection reagent that would (1) have high efficiency of moving DNAzymes

intracellularly, and (2) that caused little to no observable cell death. It was also

86

assumed that transfection reagent selection would differ from one cell line to the next,

thus it was essential that transfection reagent efficiency test was optimised prior to

commencing the in cell experiments. In both U87 and Huh-7 cell lines several

transfection reagents were tested including; Lipofectamine® 3000 with and without

P3000, liopofectamine® 2000, Lipofectin®, Lipofectamine® RNAiMAX, and

FuGENE® HD.

4.2.1. U87MG

Three of the seven transfection reagents tested showed high rate of DNAzymes

cellular uptake, these included FuGENE, L3KP3K, and Lipofectin (Figure 3.6). The

other transfection reagents showed low, to no observable DNAzyme uptake.

Observing the cells transfected with each of the reagents that showed cellular uptake

we determined, that despite the high efficiency of FuGENE there was a moderate

amount of cell death, not observed for L3KP3K or Lipofectin. L3KP3K was selected

over lipofectin due to the small difference in cellular uptake in favour of L3KP3K.

4.2.2. Huh-7

Once again several transfection reagents showed high cellular uptake of DNAzymes

including; FuGENE, RNAiMAX, L3KP3K, and Lipofectin. The remaining

transfection reagents showed relatively little observable uptake (Figure 3.7). From

visual observation, it appears that Fugene showed the highest uptake followed by

L3KP3K then Lipofectin. L3KP3K was selected because it effectively delivered

DNAzyme into the cell, is relatively non-toxic, and lastly to maintain consistency

between experiments in multiple cell lines.

Ultimately the choice of transfection reagent depends on a number of factors,

including; cell lines being transfected, target gene transcripts, and DNAzyme

87

sequence. In U87 there was strong auto fluorescence in the UT sample, while for Huh-

7 strong auto fluorescence was observed for RNV25 alone and UT, occurring to some

degree in all other samples except for Lipofectamine® 2000 (Figure 3.7). Huh-7 cells

naturally auto fluoresce to a higher degree than U87 cells. This auto fluorescence is a

naturally occurring phenomenon in the cells, variation is observed from one cell line

to the next (294). Transfection reagent efficiency was not conducted in MDA-MB231

cell line, because these cells were used in our lab and it was previously determined

that L3KP3K showed adequate transfection efficiency and low cell death.

4.3. DNAzyme Concentration and Chemistry

4.3.1. DNAzyme chemistry

DNAzymes, with 10-23 catalytic motif (arm-loop) were designed to target the mature

miR-21-5p and miR-494-3p sequences (Table 3.2). The DNAzymes require

Guanine/Cytosine or Uracil (G(C/U)) and Adenosine/Cytosine or Uracil (A(C/U))

dinucleotides for cleavage to occur, with the highest cleavage efficiency at A/U and

G/U (293). The sequences of the catalytic region were pre-fixed according to previous

reports (293). The catalytic loop structure was 15 nucleotides in length, designed to

target A/U or A/C junctions. The catalytic loop was flanked by sequence specific arm

regions, of varying lengths, and designed to form 6 to 15 Watson-Crick pairs with

target miRNA (Figure 4.1).

88

A.

89

B.

Figure 4.1. Schematic illustration of the 10-23 catalytic motif DNAzymes binding target

mature miRNA sequence. The catalytic motifs are shown in red, the arm regions are in black.

The cleavage site is marked by an arrow and dotted line. A) miR-494-3p targeting DNAzymes.

B) miR-21-5p targeting DNAzymes. Figure adapted from Chakravarthy et al. 2017 (285).

4.3.1.1. miR-494 targeting DNAzymes

Constructs were designed to target the mature strand of miR-494-3p. The catalytic

region as mentioned above was a 10-23 (arm-loop) conserved region for all the

90

constructs targeting miR-494-3p. Initial screening of constructs revealed variable

cleavage efficiencies, despite the high level of similarity between the sequences.

Surprisingly only two (n=6) constructs showed cleavage (Figure 3.1), RNV537 and

RNV538. We can confidently say that the catalytic loop sequence played no role in

cleavage efficiency due to the fact that this region was conserved from one construct

to the next.

The sequences of RNV537 and RNV538 are identical apart from 5 additional

nucleotides in the 5’ arm region of RNV538. Both constructs bind miR-494-3p with

perfect complementarity and cleave at A/U residues (Figure 4.1). Observations show

that the cleavage efficiency of RNV537 may be slightly higher than RNV538 (Figure

3.4), Sequence and length of individual binding arms should be considered for the

optimal design of 10-23 deoxyribozyme to accommodate for the differences in

stability of the arm regions respective substrate complexes. Experiments with different

binding arms have shown that in some instances the rate of DNAzyme-catalyzed

cleavage can be enhanced by asymmetric arm length truncation (295), the

heteroduplex stability of each individual binding domain substrate-complex most

likely influences this effect. The reaction rate may be inhibited by the rigidity of the

enzyme-substrate complex when the RNA substrate is bound with exceptionally high

stability by the full-length DNAzyme, resulting in slow product release and reduction

of multiple turnovers.

RNV533, RNV534, RNV535, and RNV536 showed no cleavage of miR-494-3p at

20µM concentration (Figure 3.1) despite the high sequence complementarity to target

miRNA. These constructs were designed to be similar to each other but show differing

cleavage efficiencies, RNV536 despite having almost identical arm regions to

RNV537 and RNV538 apart from a 4 and 9 base pair (bp) truncation in the 5’ arm for

91

RNV537 and RNV538 respectively, and cleaving at A/U junction, showed no

cleavage (Figure 3.1). An explanation for the lack of cleavage observed may be due

to the lowering of heteroduplex stability and increase in hybridisation free energy

caused by the reduction in arm length and resulting in a decreased reaction rate,

compared with RNV537 and RNV538. The difference in arm length of RNV536 may

have cause formation of DNAzyme secondary structure that may have interfered with

the catalytic activity of the DNAzyme.

RNV533 and RNV535 all showed no cleavage of miR-494-3p (Figure 3.1), despite

high sequence complementarity. This high complementarity may be caused by

increased heteroduplex stability resulting in reaction rate inhibition. Due to the

differing arm length of RNV533-RNV535, cleavage occurs at A/C residues , which

allows for cleavage albeit at a lower efficiency than A/U or G/U dinucleotide junction

(293).

The optimal arm length may vary for different DNAzymes and there is no evidence

on whether the arms should be asymmetrical or symmetrical for optimal catalytic

activity. In addition, the G/C content may also have an effect on the catalytic efficiency

(295-298), but how it is effected is unclear (299).


The constructs were designed to target the mature strand of miR-21. The catalytic

region as mentioned above was a 10-23 (arm-loop) conserved region for all the

constructs targeting miR-21-5p. Initial screening of constructs revealed variable

cleavage efficiencies. Despite the high level of similarity between them, RNV541

showed the strongest cleavage, with some cleavage occurring for RNV539 and

RNV542 (Figure 3.2A) albeit at a reduced efficiency (Figure 3.2B). There was no

92

observable cleavage for RNV540. The low cleavage efficiency of RNV539 and

RNV542 was confirmed in the following experiment where reducing the DNAzyme

concentration to 20µM from 100µM resulted in a disappearance of cleaved bands for

RNV539 and RNV540 (Figure 3.3). All miR-21 targeting constructs tested cleaved at

the A/U junction, thus this factor could be eliminated as influencing cleavage

efficiency. RNV541 had relatively high sequence complementarity, and increased

heteroduplex stability, while all other constructs had a low sequence complementarity

and high level of bp mismatching. This low complementarity would have decrease

heteroduplex stability and thus ultimately reducing the cleavage efficiency of the

constructs. As stated above G/C content may have also influence the cleavage

efficiency.

4.3.2. DNAzyme concentration and cellular environment

Overall results show that miR-21-5p and miR-494-3p can be effectively targeted and

cleaved by RNV541, RNV537, and RNV538 at 20µM and 100µM concentrations

(Figures 3.1-3.4). RNV539 and RNV542 also show cleavage although only at 20µM

concentrations. There was no observable cleavage at 10µM concentration (Figure 3.5)

for any of the constructs, this however may have been due to low sensitivity of

polyacrylamide gel electrophoresis, not being able to detect the template (1µM

concentration) and may not be representative of true DNAzyme function.


To determine if the constructs could target and cleave miRNA at cellular conditions,

RNV537 was transfected into U87 and Huh-7 cell lines at varying concentrations. It

was expected that RNV537 would cleave miR-494-3p effectively and that as

concentration was increased, the DNAzyme binding would also increase, thus

93

increasing the overall cleavage of miR-494. Surprisingly in U87MG cells miR-494

expression was elevated for all concentrations compared with untreated samples

(Figure 3.9). A possible explanation for the observations is untreated sample

contamination, since the experiment was conducted only once in Huh-7 cells, we are

unable to determine whether this expression pattern is representative of RNV537

function. In Huh-7 cells similar results were observed, 50nM and 300nM showed

efficient cleavage, however expression was increased for all other concentrations

tested (Figure 3.8). Due to the cleavage at two concentrations, we suspect that the

increase in miR-494 expression is due to natural variation that occurs within cells and

inaccuracies that occur during plating, transfection, and RNA extraction. Once again

we cannot determine if RNV537 is causing the increase in expression due to the lack

of additional experiments.

In Huh-7 cells, RNV538 showed cleavage at all concentrations tested (Figure 3.10),

there was no observed dose dependent response. 50nM showed the highest cleavage,

followed by 400nM. A possible explanation for a 50% reduction at 50nM but only a

30% and 15% reduction at 100nM and 200nM respectively, is that the DNAzyme

binding sites are saturated and maximum cleavage efficiency has been achieved,

however we would expect to see similar reduction of miR-494 for 50nM. This is

further disproven by an increased knockdown of miR-494 by 25% at 400nM

concentration (Figure 3.10). The variable expression patterns may be due to

variability in the cellular environment and cleavage from one sample to the next.

Expression seemed to generally increase with increasing concentration of DNAzyme,

this may be attributed to self-dimerization, as concentration of the DNAzyme was

increased, the rate of self-dimerization would also increase, however this explanation

94

does not account for the decrease in expression at 400nM, which showed higher

knockdown than 100nM and 200nM concentrations.


To determine if the constructs could target and cleave miRNA at cellular conditions,

RNV541 was transfected into U87, and MDA-MB231 cell line at varying

concentrations. We expected to see a dose dependent response. Results consistently

show relatively efficient reduction of miR-21-5p levels in cell. There is a positive

correlation, as concentration increased generally we saw an increase in the reduction

of miR-21 (Figure 3.11, 3.12). RNV541 was tested in U87 cells targeting miR-21 in

five separate experiments, although high variability in cleavage efficiencies were

observed from one experiment to the next, these differences are relatively small, and

are most likely due to natural variability in the efficiency of DNAzyme from one

sample to the next. In MDA-MB231 cell, as expected there was a dose dependent

response, increasing concentration was positively correlated with increasing cleavage

(Figure 3.12). The results obtained from the in cell cleavage assay (Figure 3.11) show

consistent cleavage pattern as in vitro cleavage assays (Figure 3.1B, 3.2, 3.3).

4.4. Limitations

Beside the limitations of a small number of DNAzymes tested for each miRNA

targeted, and a lack of variability in DNAzyme characteristics, a major limitation

encountered in this project was the low amount of experimental replicates when

quantifying the miRNA expression following treatment with DNAzyme. This resulted

in high variability in the efficacy of DNAzymes from one concentration to the next

and the apparent increase in expression of target miRNA (Figure 3.8 and 3.9). Due to

95

the lack of experimental replicates, it is not possible to determine whether the increase

in miR-494 expression in U87 and huh-7 cells was due to the effects of RNV541.

Running experimental replicates, then averaging the results, would reduce a large

portion of the variability, and would allow us to elucidate the true activity of the

DNAzymes.

Transfection reagent was used at a fixed volume of 1.5µL for all samples, instead 1-

5µL per sample as indicated in the manufacturer’s protocol. This may have affected

the transfection efficiency of each reagent, however we suspect that the only difference

in outcome occurred when quantifying the levels of target miRNAs, high transfection

reagent volume will result in relatively high levels of miRNA compared with levels

detected in low transfection reagent volume experiments, however expression pattern

should remain the same.

4.5. Future directions and implications

Data from this pilot study on miRNA knockdown by synthetic catalytic

oligonucleotides has provided evidence that miRNA can be successfully targeted and

effectively cleaved by DNAzymes in vitro and in cell. The data will provide the basis

for an in-depth exploration of the technique that could result in the development and

novel application of DNAzymes as a strategy to downregulate the expression of genes

associated with solid cancers and other diseases.

4.5.1. Cell viability assay

Initially cited as an aim of the project, cell viability was not conducted due to time

constraints. Analysis of the effects of target miRNA knockdown in cell, would be an

important next step, because a significant decrease in miRNA (miR-21) could result

96

in a significant effect on cell growth, proliferation, and viability. Therefore, the next

step is to examine the effect of DNAzyme mediated miR-21 and miR-494 knockdown

on cell viability.

4.5.2. Experimental modifications

As stated above 1.5µL transfection reagent was used as a fixed volume for the

experiments conducted, however ThermoFisher Scientific recommends the use of

between 1-5µL per sample. We do not expect to see the overall trend of miRNA

downregulation to change, but the raw data will indicated that there is an overall

increase in downregulation across all samples relative to the change in transfection

reagent volume.

Additionally, initially cited as an aim, U251 GBM cells were not used to test in vitro

activity of DNAzymes due to time constrains. Future experiments may include the

addition of U251 cell line to confirm the effect of DNAzymes targeting miR-21 in

glioblastoma.

4.5.3. Mouse models

Following analysis of the effect of miRNA knockdown on cell viability, validation of

the function of DNAzymes in mouse models with the Telethons Kids Institute would

be a logical progression. Determining the toxicity, pharmacodynamics and possible

offtarget effects of these synthetic oligonucleotides is essential for the development of

the technique as a therapeutic option.

4.5.4. Implications

Reducing the expression level of overexpressed miRNAs (miR-21 and miR-494) with

DNAzymes, as shown to be possible in a number of cell lines in this project, may

97

ultimately be developed as a novel therapeutic strategy if sufficient impact on cell

viability, growth, proliferation and a dose dependent response can be achieved.

Decreasing levels of mature miR-21 and miR-494 have been shown to have a

therapeutic effect as discussed above, thus represent highly desirable targets to tackle

highly malignant cancers where conventional therapies remain ineffective. Moreover,

DNAzymes can be used as a tool for the study the function of miRNAs and other

molecules.

98

5. Conclusion

In summary, we have developed and tested unique DNAzymes such as RNV541

targeting miR-21, RNV537 and RNV538 targeting miR-494. The results show that

DNAzyme mediated miRNA knockdown in vitro and in U87 and MDA-MB231 cells

is both inducible and effective. It is postulated that reduction in overexpressed miRNA

levels can inhibit and even reverse the malignant phenotype of some cancers, however

the effect of miRNA knockdown on cell viability was not measured, so it is not

possible to conclude if knockdown of target miRNAs by DNAzyme induced growth

or proliferation suppression. Overall, this project is a preliminary study demonstrating

the ability of DNAzymes to target and cleave miRNAs in cell. A larger scale study

with more DNAzymes with multiple chemistries would be required to accurately

determine the functional efficiency of the DNAzymes, and analysis of the effects of

miRNA knockdown by DNAzymes on cell viability and survival.

99

6. References

1. National Cancer Institute (NIH). Cancer Statistics 2018 [Available from: https://www.cancer.gov/about-cancer/understanding/statistics. 2. American Association for Neurological Surgeons. Glioblastoma multiforme 2018 [Available from: http://www.aans.org/Patients/Neurosurgical-Conditions-and-Treatments/Glioblastoma-Multiforme. 3. Adamson DC, Rasheed BA, McLendon RE, Bigner DD. Central nervous system. Cancer Biomark. 2010;9(1-6):193-210. 4. Furnari FB, Fenton T, Bachoo RM, Mukasa A, Stommel JM, Stegh A, et al. Malignant astrocytic glioma: genetics, biology, and paths to treatment. Genes & development. 2007;21(21):2683-710. 5. American Brain Tumor Association. Glioblastoma (GBM) 2018 [Available from: https://www.abta.org/tumor_types/glioblastoma-gbm/. 6. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. cell. 2011;144(5):646-74. 7. Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, et al. The nuclear RNase III Drosha initiates microRNA processing. Nature. 2003;425(6956):415-9. 8. Winter J, Jung S, Keller S, Gregory RI, Diederichs S. Many roads to maturity: microRNA biogenesis pathways and their regulation. Nature cell biology. 2009;11(3):228-34. 9. Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, et al. MicroRNA genes are transcribed by RNA polymerase II. The EMBO journal. 2004;23(20):4051-60. 10. Borchert GM, Lanier W, Davidson BL. RNA polymerase III transcribes human microRNAs. Nature structural & molecular biology. 2006;13(12):1097-101. 11. Han J, Lee Y, Yeom K-H, Nam J-W, Heo I, Rhee J-K, et al. Molecular basis for the recognition of primary microRNAs by the Drosha-DGCR8 complex. cell. 2006;125(5):887-901. 12. Denli AM, Tops BB, Plasterk RH, Ketting RF, Hannon GJ. Processing of primary microRNAs by the Microprocessor complex. Nature. 2004;432(7014):231-5. 13. Gregory RI, Yan K-p, Amuthan G, Chendrimada T, Doratotaj B, Cooch N, et al. The Microprocessor complex mediates the genesis of microRNAs. Nature. 2004;432(7014):235-40. 14. Han J, Lee Y, Yeom K-H, Kim Y-K, Jin H, Kim VN. The Drosha-DGCR8 complex in primary microRNA processing. Genes & development. 2004;18(24):3016-27. 15. Lee Y, Jeon K, Lee JT, Kim S, Kim VN. MicroRNA maturation: stepwise processing and subcellular localization. The EMBO journal. 2002;21(17):4663-70. 16. Yi R, Qin Y, Macara IG, Cullen BR. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes & development. 2003;17(24):3011-6. 17. Bohnsack MT, Czaplinski K, GÖRLICH D. Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. Rna. 2004;10(2):185-91. 18. Lund E, Dahlberg J, editors. Substrate selectivity of exportin 5 and Dicer in the biogenesis of microRNAs. Cold Spring Harbor symposia on quantitative biology; 2006: Cold Spring Harbor Laboratory Press. 19. Okada C, Yamashita E, Lee SJ, Shibata S, Katahira J, Nakagawa A, et al. A high-resolution structure of the pre-microRNA nuclear export machinery. Science. 2009;326(5957):1275-9. 20. Zeng Y, Cullen BR. Structural requirements for pre-microRNA binding and nuclear export by Exportin 5. Nucleic acids research. 2004;32(16):4776-85.

https://www.cancer.gov/about-cancer/understanding/statistics

http://www.aans.org/Patients/Neurosurgical-Conditions-and-Treatments/Glioblastoma-Multiforme

http://www.aans.org/Patients/Neurosurgical-Conditions-and-Treatments/Glioblastoma-Multiforme

https://www.abta.org/tumor_types/glioblastoma-gbm/

100

21. Lee HY, Zhou K, Smith AM, Noland CL, Doudna JA. Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Nucleic acids research. 2013;41(13):6568-76. 22. Kawamata T, Yoda M, Tomari Y. Multilayer checkpoints for microRNA authenticity during RISC assembly. EMBO reports. 2011;12(9):944-9. 23. Vella MC, Choi E-Y, Lin S-Y, Reinert K, Slack FJ. The C. elegans microRNA let-7 binds to imperfect let-7 complementary sites from the lin-41 3′ UTR. Genes & development. 2004;18(2):132-7. 24. Wightman B, Ha I, Ruvkun G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 1993;75(5):855-62. 25. Brennecke J, Stark A, Russell RB, Cohen SM. Principles of microRNA–target recognition. PLoS biology. 2005;3(3):e85. 26. Doench JG, Sharp PA. Specificity of microRNA target selection in translational repression. Genes & development. 2004;18(5):504-11. 27. Krek A, Grün D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, et al. Combinatorial microRNA target predictions. Nature genetics. 2005;37(5):495-500. 28. Lewis BP, Shih I-h, Jones-Rhoades MW, Bartel DP, Burge CB. Prediction of mammalian microRNA targets. Cell. 2003;115(7):787-98. 29. Jeffries CD, Fried HM, Perkins DO. Nuclear and cytoplasmic localization of neural stem cell microRNAs. Rna. 2011;17(4):675-86. 30. Valencia-Sanchez MA, Liu J, Hannon GJ, Parker R. Control of translation and mRNA degradation by miRNAs and siRNAs. Genes & development. 2006;20(5):515-24. 31. Mallory AC, Reinhart BJ, Jones‐Rhoades MW, Tang G, Zamore PD, Barton MK, et al. MicroRNA control of PHABULOSA in leaf development: importance of pairing to the microRNA 5′ region. The EMBO journal. 2004;23(16):3356-64. 32. Mallory AC, Vaucheret H. MicroRNAs: something important between the genes. Current opinion in plant biology. 2004;7(2):120-5. 33. Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, Tuschl T. Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Molecular cell. 2004;15(2):185-97. 34. Yekta S, Shih I-h, Bartel DP. MicroRNA-directed cleavage of HOXB8 mRNA. Science. 2004;304(5670):594-6. 35. Liu J, Carmell MA, Rivas FV, Marsden CG, Thomson JM, Song J-J, et al. Argonaute2 is the catalytic engine of mammalian RNAi. Science. 2004;305(5689):1437-41. 36. Parker R, Song H. The enzymes and control of eukaryotic mRNA turnover. Nature structural & molecular biology. 2004;11(2):121-7. 37. Coller J, Parker R. Eukaryotic mRNA decapping. Annual review of biochemistry. 2004;73(1):861-90. 38. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. cell. 2004;116(2):281-97. 39. Pillai RS. MicroRNA function: multiple mechanisms for a tiny RNA? Rna. 2005;11(12):1753-61. 40. Pillai RS, Bhattacharyya SN, Artus CG, Zoller T, Cougot N, Basyuk E, et al. Inhibition of translational initiation by Let-7 MicroRNA in human cells. Science. 2005;309(5740):1573-6. 41. Kong YW, Cannell IG, de Moor CH, Hill K, Garside PG, Hamilton TL, et al. The mechanism of micro-RNA-mediated translation repression is determined by the promoter of the target gene. Proceedings of the National Academy of Sciences. 2008;105(26):8866-71.

101

42. Brengues M, Teixeira D, Parker R. Movement of eukaryotic mRNAs between polysomes and cytoplasmic processing bodies. Science. 2005;310(5747):486-9. 43. Liu J, Valencia-Sanchez MA, Hannon GJ, Parker R. MicroRNA-dependent localization of targeted mRNAs to mammalian P-bodies. Nature cell biology. 2005;7(7):719-23. 44. Liu J, Rivas FV, Wohlschlegel J, Yates JR, Parker R, Hannon GJ. A role for the P-body component GW182 in microRNA function. Nature cell biology. 2005;7(12):1261-6. 45. Kedersha N, Stoecklin G, Ayodele M, Yacono P, Lykke-Andersen J, Fritzler MJ, et al. Stress granules and processing bodies are dynamically linked sites of mRNP remodeling. J Cell Biol. 2005;169(6):871-84. 46. ANDREI MA, INGELFINGER D, HEINTZMANN R, ACHSEL T, RIVERA-POMAR R, LÜHRMANN R. A role for eIF4E and eIF4E-transporter in targeting mRNPs to mammalian processing bodies. Rna. 2005;11(5):717-27. 47. Anderson P, Kedersha N. RNA granules. J Cell Biol. 2006;172(6):803-8. 48. TEIXEIRA D, SHETH U, VALENCIA-SANCHEZ MA, BRENGUES M, PARKER R. Processing bodies require RNA for assembly and contain nontranslating mRNAs. Rna. 2005;11(4):371-82. 49. Wu L, Fan J, Belasco JG. MicroRNAs direct rapid deadenylation of mRNA. Proceedings of the National Academy of Sciences of the United States of America. 2006;103(11):4034-9. 50. Bagga S, Bracht J, Hunter S, Massirer K, Holtz J, Eachus R, et al. Regulation by let-7 and lin-4 miRNAs results in target mRNA degradation. Cell. 2005;122(4):553-63. 51. Fischer N, Weis K. The DEAD box protein Dhh1 stimulates the decapping enzyme Dcp1. The EMBO Journal. 2002;21(11):2788-97. 52. COLLER JM, TUCKER M, SHETH U, VALENCIA-SANCHEZ MA, PARKER R. The DEAD box helicase, Dhh1p, functions in mRNA decapping and interacts with both the decapping and deadenylase complexes. Rna. 2001;7(12):1717-27. 53. Malzkorn B, Wolter M, Liesenberg F, Grzendowski M, Stühler K, Meyer HE, et al. Identification and functional characterization of microRNAs involved in the malignant progression of gliomas. Brain pathology. 2010;20(3):539-50. 54. Braoudaki M, Lambrou G, Giannikou K, Papadodima S, Lykoudi A, Stefanaki K, et al. miR-15a and miR-24-1 as putative prognostic microRNA signatures for pediatric pilocytic astrocytomas and ependymomas. Tumor Biology. 2016;37(7):9887-97. 55. Xia H, Qi Y, Ng SS, Chen X, Chen S, Fang M, et al. MicroRNA-15b regulates cell cycle progression by targeting cyclins in glioma cells. Biochemical and biophysical research communications. 2009;380(2):205-10. 56. Wang J, Liu H, Tian L, Wang F, Han L, Zhang W, et al. miR-15b inhibits the progression of glioblastoma cells through targeting insulin-like growth factor receptor 1. Hormones and Cancer. 2017;8(1):49-57. 57. Sun G, Shi L, Yan S, Wan Z, Jiang N, Fu L, et al. MiR-15b targets cyclin D1 to regulate proliferation and apoptosis in glioma cells. BioMed research international. 2014;2014. 58. Sun G, Yan S, Shi L, Wan Z, Jiang N, Li M, et al. Decreased expression of miR-15b in human gliomas is associated with poor prognosis. Cancer Biotherapy and Radiopharmaceuticals. 2015;30(4):169-73. 59. Zheng X, Chopp M, Lu Y, Buller B, Jiang F. MiR-15b and miR-152 reduce glioma cell invasion and angiogenesis via NRP-2 and MMP-3. Cancer letters. 2013;329(2):146-54. 60. Yang TQ, Lu XJ, Wu TF, Ding DD, Zhao ZH, Chen GL, et al. MicroRNA‐16 inhibits glioma cell growth and invasion through suppression of BCL2 and the nuclear factor‐κB1/MMP9 signaling pathway. Cancer science. 2014;105(3):265-71. 61. Li X, Ling N, Bai Y, Dong W, Hui GZ, Liu D, et al. MiR‐16‐1 plays a role in reducing migration and invasion of glioma cells. The Anatomical Record. 2013;296(3):427-32.

102

62. Chen F, Chen L, He H, Huang W, Zhang R, Li P, et al. Up-regulation of microRNA-16 in glioblastoma inhibits the function of endothelial cells and tumor angiogenesis by targeting Bmi-1. Anti-Cancer Agents in Medicinal Chemistry (Formerly Current Medicinal Chemistry-Anti-Cancer Agents). 2016;16(5):609-20. 63. Kefas B, Godlewski J, Comeau L, Li Y, Abounader R, Hawkinson M, et al. microRNA-7 inhibits the epidermal growth factor receptor and the Akt pathway and is down-regulated in glioblastoma. Cancer research. 2008;68(10):3566-72. 64. Zhao J, Tao Y, Zhou Y, Qin N, Chen C, Tian D, et al. MicroRNA-7: a promising new target in cancer therapy. Cancer cell international. 2015;15(1):103. 65. Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, et al. RAS is regulated by the let-7 microRNA family. Cell. 2005;120(5):635-47. 66. Lee YS, Dutta A. The tumor suppressor microRNA let-7 represses the HMGA2 oncogene. Genes & development. 2007;21(9):1025-30. 67. Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Yi M, et al. Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer cell. 2006;9(3):189-98. 68. Felli N, Fontana L, Pelosi E, Botta R, Bonci D, Facchiano F, et al. MicroRNAs 221 and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit receptor down-modulation. Proceedings of the National Academy of Sciences of the United States of America. 2005;102(50):18081-6. 69. Cortez MA, Nicoloso MS, Shimizu M, Rossi S, Gopisetty G, Molina JR, et al. miR‐29b and miR‐125a regulate podoplanin and suppress invasion in glioblastoma. Genes, Chromosomes and Cancer. 2010;49(11):981-90. 70. Aldaz B, Sagardoy A, Nogueira L, Guruceaga E, Grande L, Huse JT, et al. Involvement of miRNAs in the differentiation of human glioblastoma multiforme stem-like cells. PloS one. 2013;8(10):e77098. 71. Costa FF, Bischof JM, Vanin EF, Lulla RR, Sredni ST, Rajaram V, et al. Identification of differentially expressed microRNAs and other non-coding RNAs in ependymomas. AACR; 2012. 72. Werner TV, Hart M, Nickels R, Kim Y-J, Menger MD, Bohle RM, et al. MiR-34a-3p alters proliferation and apoptosis of meningioma cells in vitro and is directly targeting SMAD4, FRAT1 and BCL2. Aging (Albany NY). 2017;9(3):932. 73. El-Gewely MR, Andreassen M, Walquist M, Ursvik A, Knutsen E, Nystad M, et al. Differentially expressed MicroRNAs in meningiomas grades I and II suggest shared biomarkers with malignant tumors. Cancers. 2016;8(3):31. 74. Iorio MV, Ferracin M, Liu C-G, Veronese A, Spizzo R, Sabbioni S, et al. MicroRNA gene expression deregulation in human breast cancer. Cancer research. 2005;65(16):7065-70. 75. Lee HK, Bier A, Cazacu S, Finniss S, Xiang C, Twito H, et al. MicroRNA-145 is downregulated in glial tumors and regulates glioma cell migration by targeting connective tissue growth factor. PloS one. 2013;8(2):e54652. 76. Shi L, Wang Z, Sun G, Wan Y, Guo J, Fu X. miR-145 inhibits migration and invasion of glioma stem cells by targeting ABCG2. Neuromolecular medicine. 2014;16(2):517-28. 77. Koo S, Martin GS, Schulz KJ, Ronck M, Toussaint LG. Serial selection for invasiveness increases expression of miR-143/miR-145 in glioblastoma cell lines. BMC cancer. 2012;12(1):143. 78. Srinivasan S, Patric IRP, Somasundaram K. A ten-microRNA expression signature predicts survival in glioblastoma. PloS one. 2011;6(3):e17438. 79. Lakomy R, Sana J, Hankeova S, Fadrus P, Kren L, Lzicarova E, et al. MiR‐195, miR‐196b, miR‐181c, miR‐21 expression levels and O‐6‐methylguanine‐DNA methyltransferase

103

methylation status are associated with clinical outcome in glioblastoma patients. Cancer science. 2011;102(12):2186-90. 80. le Sage C, Nagel R, Egan DA, Schrier M, Mesman E, Mangiola A, et al. Regulation of the p27 Kip1 tumor suppressor by miR‐221 and miR‐222 promotes cancer cell proliferation. The EMBO journal. 2007;26(15):3699-708. 81. Fornari F, Gramantieri L, Ferracin M, Veronese A, Sabbioni S, Calin G, et al. MiR-221 controls CDKN1C/p57 and CDKN1B/p27 expression in human hepatocellular carcinoma. Oncogene. 2008;27(43):5651-61. 82. Garofalo M, Di Leva G, Romano G, Nuovo G, Suh S-S, Ngankeu A, et al. miR-221&222 regulate TRAIL resistance and enhance tumorigenicity through PTEN and TIMP3 downregulation. Cancer cell. 2009;16(6):498-509. 83. Conti A, Aguennouz MH, La Torre D, Tomasello C, Cardali S, Angileri FF, et al. miR-21 and 221 upregulation and miR-181b downregulation in human grade II–IV astrocytic tumors. Journal of neuro-oncology. 2009;93(3):325-32. 84. Garofalo M, Quintavalle C, Romano G, M Croce C, Condorelli G. miR221/222 in cancer: their role in tumor progression and response to therapy. Current molecular medicine. 2012;12(1):27-33. 85. Gillies JK, Lorimer IA. Regulation of p27Kip1 by miRNA 221/222 in glioblastoma. Cell Cycle. 2007;6(16):2005-9. 86. Ciafre S, Galardi S, Mangiola A, Ferracin M, Liu C-G, Sabatino G, et al. Extensive modulation of a set of microRNAs in primary glioblastoma. Biochemical and biophysical research communications. 2005;334(4):1351-8. 87. Zhang C, Zhang J, Zhang A, Wang Y, Han L, You Y, et al. PUMA is a novel target of miR-221/222 in human epithelial cancers. International journal of oncology. 2010;37(6):1621-6. 88. Fu X, Wang Q, Chen J, Huang X, Chen X, Cao L, et al. Clinical significance of miR-221 and its inverse correlation with p27Kip1 in hepatocellular carcinoma. Molecular biology reports. 2011;38(5):3029-35. 89. Quintavalle C, Garofalo M, Zanca C, Romano G, Iaboni M, De Caro MdB, et al. miR-221/222 overexpession in human glioblastoma increases invasiveness by targeting the protein phosphate PTPμ. Oncogene. 2012;31(7):858. 90. Di Leva G, Gasparini P, Piovan C, Ngankeu A, Garofalo M, Taccioli C, et al. MicroRNA cluster 221-222 and estrogen receptor α interactions in breast cancer. JNCI: Journal of the National Cancer Institute. 2010;102(10):706-21. 91. Pineau P, Volinia S, McJunkin K, Marchio A, Battiston C, Terris B, et al. miR-221 overexpression contributes to liver tumorigenesis. Proceedings of the National Academy of Sciences. 2010;107(1):264-9. 92. Wang X, Han L, Zhang A, Wang G, Jia Z, Yang Y, et al. Adenovirus-mediated shRNAs for co-repression of miR-221 and miR-222 expression and function in glioblastoma cells. Oncology reports. 2011;25(1):97-105. 93. Xie Q, Yan Y, Huang Z, Zhong X, Huang L. MicroRNA‐221 targeting PI3‐K/Akt signaling axis induces cell proliferation and BCNU resistance in human glioblastoma. Neuropathology. 2014;34(5):455-64. 94. Zhang C-Z, Zhang J-X, Zhang A-L, Shi Z-D, Han L, Jia Z-F, et al. MiR-221 and miR-222 target PUMA to induce cell survival in glioblastoma. Molecular cancer. 2010;9(1):229. 95. Li W, Guo F, Wang P, Hong S, Zhang C. miR-221/222 confers radioresistance in glioblastoma cells through activating Akt independent of PTEN status. Current molecular medicine. 2014;14(1):185-95. 96. Cai G, Qiao S, Chen K. Suppression of miR-221 inhibits glioma cells proliferation and invasion via targeting SEMA3B. Biological research. 2015;48(1):37.

104

97. Zhang C, Zhang J, Hao J, Shi Z, Wang Y, Han L, et al. High level of miR-221/222 confers increased cell invasion and poor prognosis in glioma. Journal of translational medicine. 2012;10(1):119. 98. Hao J, Zhang C, Zhang A, Wang K, Jia Z, Wang G, et al. miR-221/222 is the regulator of Cx43 expression in human glioblastoma cells. Oncology reports. 2012;27(5):1504-10. 99. Visani M, De Biase D, Marucci G, Cerasoli S, Nigrisoli E, Bacchi Reggiani ML, et al. Expression of 19 microRNAs in glioblastoma and comparison with other brain neoplasia of grades I–III. Molecular oncology. 2014;8(2):417-30. 100. Sredni ST, de Fátima Bonaldo M, Costa FF, Huang C-C, Hamm CA, Rajaram V, et al. Upregulation of mir-221 and mir-222 in atypical teratoid/rhabdoid tumors: potential therapeutic targets. Child's Nervous System. 2010;26(3):279-83. 101. Torres-Martin M, Lassaletta L, de Campos JM, Isla A, Gavilan J, Pinto GR, et al. Global profiling in vestibular schwannomas shows critical deregulation of microRNAs and upregulation in those included in chromosomal region 14q32. PloS one. 2013;8(6):e65868. 102. Liu Q, Zou R, Zhou R, Gong C, Wang Z, Cai T, et al. miR‐155 Regulates glioma cells invasion and chemosensitivity by p38 Isforms in vitro. Journal of cellular biochemistry. 2015;116(7):1213-21. 103. Ling N, Gu J, Lei Z, Li M, Zhao J, Zhang H-T, et al. microRNA-155 regulates cell proliferation and invasion by targeting FOXO3a in glioma. Oncology reports. 2013;30(5):2111-8. 104. Zhou J, Wang W, Gao Z, Peng X, Chen X, Chen W, et al. MicroRNA-155 promotes glioma cell proliferation via the regulation of MXI1. PloS one. 2013;8(12):e83055. 105. Sun J, Shi H, Lai N, Liao K, Zhang S, Lu X. Overexpression of microRNA-155 predicts poor prognosis in glioma patients. Medical Oncology. 2014;31(4):911. 106. Meng W, Jiang L, Lu L, Hu H, Yu H, Ding D, et al. Anti‐miR‐155 oligonucleotide enhances chemosensitivity of U251 cell to taxol by inducing apoptosis. Cell biology international. 2012;36(7):653-9. 107. D'Urso PI, D'Urso OF, Storelli C, Mallardo M, Gianfreda CD, Montinaro A, et al. miR-155 is up-regulated in primary and secondary glioblastoma and promotes tumour growth by inhibiting GABA receptors. International journal of oncology. 2012;41(1):228-34. 108. Qiu S, Lin S, Hu D, Feng Y, Tan Y, Peng Y. Interactions of miR-323/miR-326/miR-329 and miR-130a/miR-155/miR-210 as prognostic indicators for clinical outcome of glioblastoma patients. Journal of translational medicine. 2013;11(1):10. 109. Osaka E, Kelly AD, Spentzos D, Choy E, Yang X, Shen JK, et al. MicroRNA-155 expression is independently predictive of outcome in chordoma. Oncotarget. 2015;6(11):9125. 110. Butz H, Liko I, Czirjak S, Igaz P, Khan MM, Zivkovic V, et al. Down-regulation of Wee1 kinase by a specific subset of microRNA in human sporadic pituitary adenomas. The Journal of Clinical Endocrinology & Metabolism. 2010;95(10):E181-E91. 111. Van Roosbroeck K, Fanini F, Setoyama T, Ivan C, Rodriguez-Aguayo C, Fuentes-Mattei E, et al. Combining anti-miR-155 with chemotherapy for the treatment of lung cancers. Clinical Cancer Research. 2017;23(11):2891-904. 112. Volinia S, Calin GA, Liu C-G, Ambs S, Cimmino A, Petrocca F, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proceedings of the National academy of Sciences of the United States of America. 2006;103(7):2257-61. 113. Mendell JT. miRiad roles for the miR-17-92 cluster in development and disease. Cell. 2008;133(2):217-22. 114. Ernst A, Campos B, Meier J, Devens F, Liesenberg F, Wolter M, et al. De-repression of CTGF via the miR-17-92 cluster upon differentiation of human glioblastoma spheroid cultures. Oncogene. 2010;29(23):3411-22.

105

115. Li Q, Shen K, Zhao Y, Ma C, Liu J, Ma J. MiR-92b inhibitor promoted glioma cell apoptosis via targeting DKK3 and blocking the Wnt/beta-catenin signaling pathway. Journal of translational medicine. 2013;11(1):302. 116. Wang K, Wang X, Zou J, Zhang A, Wan Y, Pu P, et al. miR-92b controls glioma proliferation and invasion through regulating Wnt/beta-catenin signaling via Nemo-like kinase. Neuro-oncology. 2013;15(5):578-88. 117. Meng F, Henson R, Wehbe–Janek H, Ghoshal K, Jacob ST, Patel T. MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology. 2007;133(2):647-58. 118. Chan JA, Krichevsky AM, Kosik KS. MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells. Cancer research. 2005;65(14):6029-33. 119. Frankel LB, Christoffersen NR, Jacobsen A, Lindow M, Krogh A, Lund AH. Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. Journal of Biological Chemistry. 2008;283(2):1026-33. 120. Zhu S, Si M-L, Wu H, Mo Y-Y. MicroRNA-21 targets the tumor suppressor gene tropomyosin 1 (TPM1). Journal of Biological Chemistry. 2007;282(19):14328-36. 121. Katar S, Baran O, Evran S, Cevik S, Akkaya E, Baran G, et al. Expression of miRNA-21, miRNA-107, miRNA-137 and miRNA-29b in meningioma. Clinical neurology and neurosurgery. 2017;156:66-70. 122. Cioffi JA, Yue WY, Mendolia-Loffredo S, Hansen KR, Wackym PA, Hansen MR. MicroRNA-21 over-expression contributes to vestibular schwannoma cell proliferation and survival. Otology & neurotology: official publication of the American Otological Society, American Neurotology Society [and] European Academy of Otology and Neurotology. 2010;31(9):1455. 123. Floyd DH, Zhang Y, Dey BK, Kefas B, Breit H, Marks K, et al. Novel anti-apoptotic microRNAs 582-5p and 363 promote human glioblastoma stem cell survival via direct inhibition of caspase 3, caspase 9, and Bim. PLoS One. 2014;9(5):e96239. 124. Chen X, Hao B, Liu Y, Dai D, Han G, Li Y, et al. miR‐372 regulates glioma cell proliferation and invasion by directly targeting PHLPP2. Journal of cellular biochemistry. 2015;116(2):225-32. 125. Tang H, Wang Z, Liu Q, Liu X, Wu M, Li G. Disturbing miR-182 and-381 inhibits BRD7 transcription and glioma growth by directly targeting LRRC4. PloS one. 2014;9(1):e84146. 126. Tang H, Liu X, Wang Z, She X, Zeng X, Deng M, et al. Interaction of hsa-miR-381 and glioma suppressor LRRC4 is involved in glioma growth. Brain research. 2011;1390:21-32. 127. Tezcan G, Tunca B, Bekar A, Preusser M, Berghoff AS, Egeli U, et al. microRNA expression pattern modulates temozolomide response in GBM tumors with cancer stem cells. Cellular and molecular neurobiology. 2014;34(5):679-92. 128. Ujifuku K, Mitsutake N, Takakura S, Matsuse M, Saenko V, Suzuki K, et al. MiR-195, miR-455-3p and miR-10a∗ are implicated in acquired temozolomide resistance in glioblastoma multiforme cells. Cancer letters. 2010;296(2):241-8. 129. Kushwaha D, Ramakrishnan V, Ng K, Steed T, Nguyen T, Futalan D, et al. A genome-wide miRNA screen revealed miR-603 as a MGMT-regulating miRNA in glioblastomas. Oncotarget. 2014;5(12):4026. 130. Guo M, Zhang X, Wang G, Sun J, Jiang Z, Khadarian K, et al. miR-603 promotes glioma cell growth via Wnt/β-catenin pathway by inhibiting WIF1 and CTNNBIP1. Cancer letters. 2015;360(1):76-86. 131. Zhang Z, Song X, Feng X, Miao Y, Wang H, Li Y, et al. Norcantharidin modulates miR-655-regulated SENP6 protein translation to suppresses invasion of glioblastoma cells. Tumor Biology. 2016;37(12):15635-41.

106

132. Yue X, Cao D, Lan F, Pan Q, Xia T, Yu H. MiR-301a is activated by the Wnt/β-catenin pathway and promotes glioma cell invasion by suppressing SEPT7. Neuro-oncology. 2016;18(9):1288-96. 133. Chai Z, Fan H, Li Y, Song L, Jin X, Yu J, et al. miR-1908 as a novel prognosis marker of glioma via promoting malignant phenotype and modulating SPRY4/RAF1 axis. Oncology Reports. 2017;38(5):2717-26. 134. Shou J, Gu S, Gu W. Identification of dysregulated miRNAs and their regulatory signature in glioma patients using the partial least squares method. Experimental and therapeutic medicine. 2015;9(1):167-71. 135. Kim HR, Shin CH, Lee H, Choi KH, Nam D-H, Ohn T, et al. MicroRNA-1908-5p contributes to the oncogenic function of the splicing factor SRSF3. Oncotarget. 2017;8(5):8342. 136. Xia X, Li Y, Wang W, Tang F, Tan J, Sun L, et al. MicroRNA-1908 functions as a glioblastoma oncogene by suppressing PTEN tumor suppressor pathway. Molecular cancer. 2015;14(1):154. 137. Agrawal R, Pandey P, Jha P, Dwivedi V, Sarkar C, Kulshreshtha R. Hypoxic signature of microRNAs in glioblastoma: insights from small RNA deep sequencing. BMC genomics. 2014;15(1):686. 138. Liu K, Liu S, Zhang W, Jia B, Tan L, Jin Z, et al. miR-494 promotes cell proliferation, migration and invasion, and increased sorafenib resistance in hepatocellular carcinoma by targeting PTEN. Oncology reports. 2015;34(2):1003-10. 139. Song L, Liu D, Wang B, He J, Zhang S, Dai Z, et al. miR-494 suppresses the progression of breast cancer in vitro by targeting CXCR4 through the Wnt/β-catenin signaling pathway. Oncology reports. 2015;34(1):525-31. 140. Lim L, Balakrishnan A, Huskey N, Jones KD, Jodari M, Ng R, et al. MicroRNA‐494 within an oncogenic microRNA megacluster regulates G1/S transition in liver tumorigenesis through suppression of mutated in colorectal cancer. Hepatology. 2014;59(1):202-15. 141. Zhan M-N, Yu X-T, Tang J, Zhou C-X, Wang C-L, Yin Q-Q, et al. MicroRNA-494 inhibits breast cancer progression by directly targeting PAK1. Cell death & disease. 2017;8(1):e2529. 142. Liao C, Chen W, Fan X, Jiang X, Qiu L, Chen C, et al. MicroRNA-200c inhibits apoptosis in pituitary adenoma cells by targeting the PTEN/Akt signaling pathway. Oncology Research Featuring Preclinical and Clinical Cancer Therapeutics. 2014;21(3):129-36. 143. Li M, Fu W, Wo L, Shu X, Liu F, Li C. miR-128 and its target genes in tumorigenesis and metastasis. Experimental cell research. 2013;319(20):3059-64. 144. Godlewski J, Nowicki MO, Bronisz A, Williams S, Otsuki A, Nuovo G, et al. Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer research. 2008;68(22):9125-30. 145. Papagiannakopoulos T, Friedmann-Morvinski D, Neveu P, Dugas J, Gill R, Huillard E, et al. Pro-neural miR-128 is a glioma tumor suppressor that targets mitogenic kinases. Oncogene. 2012;31(15):1884-95. 146. Palumbo T, Faucz FR, Azevedo M, Xekouki P, Iliopoulos D, Stratakis CA. Functional screen analysis reveals miR-26b and miR-128 as central regulators of pituitary somatomammotrophic tumor growth through activation the PTEN-AKT pathway. Oncogene. 2013;32(13):1651. 147. Shi Z-m, Wang J, Yan Z, You Y-p, Li C-y, Qian X, et al. MiR-128 inhibits tumor growth and angiogenesis by targeting p70S6K1. PloS one. 2012;7(3):e32709. 148. Zhang Y, Chao T, Li R, Liu W, Chen Y, Yan X, et al. MicroRNA-128 inhibits glioma cells proliferation by targeting transcription factor E2F3a. Journal of molecular medicine. 2009;87(1):43-51.

107

149. Venkataraman S, Alimova I, Fan R, Harris P, Foreman N, Vibhakar R. MicroRNA 128a increases intracellular ROS level by targeting Bmi-1 and inhibits medulloblastoma cancer cell growth by promoting senescence. PloS one. 2010;5(6):e10748. 150. Zhi F, Shao N, Li B, Xue L, Deng D, Xu Y, et al. A serum 6-miRNA panel as a novel non-invasive biomarker for meningioma. Scientific reports. 2016;6. 151. Tominaga N, Kosaka N, Ono M, Katsuda T, Yoshioka Y, Tamura K, et al. Brain metastatic cancer cells release microRNA-181c-containing extracellular vesicles capable of destructing blood–brain barrier. Nature communications. 2015;6. 152. Shi L, Cheng Z, Zhang J, Li R, Zhao P, Fu Z, et al. hsa-mir-181a and hsa-mir-181b function as tumor suppressors in human glioma cells. Brain research. 2008;1236:185-93. 153. Jiang L, Mao P, Song L, Wu J, Huang J, Lin C, et al. miR-182 as a prognostic marker for glioma progression and patient survival. The American journal of pathology. 2010;177(1):29-38. 154. Kouri FM, Hurley LA, Daniel WL, Day ES, Hua Y, Hao L, et al. miR-182 integrates apoptosis, growth, and differentiation programs in glioblastoma. Genes & development. 2015;29(7):732-45. 155. Song L, Liu L, Wu Z, Li Y, Ying Z, Lin C, et al. TGF-β induces miR-182 to sustain NF-κB activation in glioma subsets. The Journal of clinical investigation. 2012;122(10):3563. 156. Shi L, Zhang J, Pan T, Zhou J, Gong W, Liu N, et al. MiR-125b is critical for the suppression of human U251 glioma stem cell proliferation. Brain research. 2010;1312:120-6. 157. Shi L, Wan Y, Sun G, Gu X, Qian C, Yan W, et al. Functional differences of miR-125b on the invasion of primary glioblastoma CD133-negative cells and CD133-positive cells. Neuromolecular medicine. 2012;14(4):303-16. 158. Wu N, Xiao L, Zhao X, Zhao J, Wang J, Wang F, et al. miR‐125b regulates the proliferation of glioblastoma stem cells by targeting E2F2. FEBS letters. 2012;586(21):3831-9. 159. Chen J, Fu X, Wan Y, Wang Z, Jiang D, Shi L. miR-125b inhibitor enhance the chemosensitivity of glioblastoma stem cells to temozolomide by targeting Bak1. Tumor Biology. 2014;35(7):6293-302. 160. Wu N, Lin X, Zhao X, Zheng L, Xiao L, Liu J, et al. MiR-125b acts as an oncogene in glioblastoma cells and inhibits cell apoptosis through p53 and p38MAPK-independent pathways. British journal of cancer. 2013;109(11):2853. 161. Xia H-F, He T-Z, Liu C-M, Cui Y, Song P-P, Jin X-H, et al. MiR-125b expression affects the proliferation and apoptosis of human glioma cells by targeting Bmf. Cellular Physiology and Biochemistry. 2009;23(4-6):347-58. 162. Wan Y, Fei X-F, Wang Z-M, Jiang D-Y, Chen H-C, Yang J, et al. Expression of miR-125b in the new, highly invasive glioma stem cell and progenitor cell line SU3. Chinese journal of cancer. 2012;31(4):207. 163. Luo Y, Wang X, Niu W, Wang H, Wen Q, Fan S, et al. Elevated microRNA-125b levels predict a worse prognosis in HER2-positive breast cancer patients. Oncology Letters. 2017;13(2):867-74. 164. Smits M, Wurdinger T, van het Hof B, Drexhage JA, Geerts D, Wesseling P, et al. Myc-associated zinc finger protein (MAZ) is regulated by miR-125b and mediates VEGF-induced angiogenesis in glioblastoma. The FASEB Journal. 2012;26(6):2639-47. 165. Shi L, Zhang S, Feng K, Wu F, Wan Y, Wang Z, et al. MicroRNA-125b-2 confers human glioblastoma stem cells resistance to temozolomide through the mitochondrial pathway of apoptosis. International journal of oncology. 2012;40(1):119-29. 166. Wan Y, Sun G, Wang Z, Guo J, Shi L. miR-125b promotes cell proliferation by directly targeting Lin28 in glioblastoma stem cells with low expression levels of miR-125b. Neuroreport. 2014;25(5):289-96.

108

167. Lang M-F, Yang S, Zhao C, Sun G, Murai K, Wu X, et al. Genome-wide profiling identified a set of miRNAs that are differentially expressed in glioblastoma stem cells and normal neural stem cells. PloS one. 2012;7(4):e36248. 168. Sasayama T, Nishihara M, Kondoh T, Hosoda K, Kohmura E. MicroRNA‐10b is overexpressed in malignant glioma and associated with tumor invasive factors, uPAR and RhoC. International journal of cancer. 2009;125(6):1407-13. 169. Guessous F, Alvarado-Velez M, Marcinkiewicz L, Zhang Y, Kim J, Heister S, et al. Oncogenic effects of miR-10b in glioblastoma stem cells. Journal of neuro-oncology. 2013;112(2):153-63. 170. Gabriely G, Yi M, Narayan RS, Niers JM, Wurdinger T, Imitola J, et al. Human glioma growth is controlled by microRNA-10b. Cancer research. 2011;71(10):3563-72. 171. Sun L, Yan W, Wang Y, Sun G, Luo H, Zhang J, et al. MicroRNA-10b induces glioma cell invasion by modulating MMP-14 and uPAR expression via HOXD10. Brain research. 2011;1389:9-18. 172. Dong CG, Wu WK, Feng SY, Wang XJ, Shao JF, Qiao J. Co-inhibition of microRNA-10b and microRNA-21 exerts synergistic inhibition on the proliferation and invasion of human glioma cells. International journal of oncology. 2012;41(3):1005-12. 173. Skalsky RL, Cullen BR. Reduced expression of brain-enriched microRNAs in glioblastomas permits targeted regulation of a cell death gene. PloS one. 2011;6(9):e24248. 174. Teplyuk NM, Uhlmann EJ, Wong AH-K, Karmali P, Basu M, Gabriely G, et al. MicroRNA-10b inhibition reduces E2F1-mediated transcription and miR-15/16 activity in glioblastoma. Oncotarget. 2015;6(6):3770. 175. Ahmad A, Sethi S, Chen W, Ali-Fehmi R, Mittal S, Sarkar FH. Up-regulation of microRNA-10b is associated with the development of breast cancer brain metastasis. American journal of translational research. 2014;6(4):384. 176. Karsy M, Arslan E, Moy F. Current progress on understanding microRNAs in glioblastoma multiforme. Genes & cancer. 2012;3(1):3-15. 177. Yang HW, Xing H, Johnson MD. A major role for microRNAs in glioblastoma cancer stem-like cells. Archives of pharmacal research. 2015;38(3):423-34. 178. Yan Y, Wang Q, Yan X-L, Zhang Y, Li W, Tang F, et al. miR‐10a controls glioma migration and invasion through regulating epithelial–mesenchymal transition via EphA8. FEBS letters. 2015;589(6):756-65. 179. Pan X, Wang R, Wang Z-X. The potential role of miR-451 in cancer diagnosis, prognosis, and therapy. Molecular cancer therapeutics. 2013;12(7):1153-62. 180. Tian Y, Nan Y, Han L, Zhang A, Wang G, Jia Z, et al. MicroRNA miR-451 downregulates the PI3K/AKT pathway through CAB39 in human glioma. International journal of oncology. 2012;40(4):1105-12. 181. Gal H, Pandi G, Kanner AA, Ram Z, Lithwick-Yanai G, Amariglio N, et al. MIR-451 and Imatinib mesylate inhibit tumor growth of Glioblastoma stem cells. Biochemical and biophysical research communications. 2008;376(1):86-90. 182. Guo R, Gu J, Zhang Z, Wang Y, Gu C. MiR-451 Promotes Cell Proliferation and Metastasis in Pancreatic Cancer through Targeting CAB39. BioMed research international. 2017;2017. 183. Godlewski J, Nowicki MO, Bronisz A, Nuovo G, Palatini J, De Lay M, et al. MicroRNA-451 regulates LKB1/AMPK signaling and allows adaptation to metabolic stress in glioma cells. Molecular cell. 2010;37(5):620-32. 184. Schraivogel D, Weinmann L, Beier D, Tabatabai G, Eichner A, Zhu JY, et al. CAMTA1 is a novel tumour suppressor regulated by miR‐9/9* in glioblastoma stem cells. The EMBO journal. 2011;30(20):4309-22. 185. Lu S, Wang S, Geng S, Ma S, Liang Z, Jiao B. Increased expression of microRNA-17 predicts poor prognosis in human glioma. BioMed Research International. 2012;2012.

109

186. Li H, Yang BB. Stress response of glioblastoma cells mediated by miR-17-5p targeting PTEN and the passenger strand miR-17-3p targeting MDM2. Oncotarget. 2012;3(12):1653. 187. Feng Z, Zhang L, Zhou J, Zhou S. mir-218-2 promotes glioblastomas growth, invasion and drug resistance by targeting CDC27. Oncotarget. 2017;8(4):6304. 188. Fang L, Deng Z, Shatseva T, Yang J, Peng C, Du W, et al. MicroRNA miR-93 promotes tumor growth and angiogenesis by targeting integrin-β8. Oncogene. 2011;30(7):806-21. 189. Jiang L, Wang C, Lei F, Zhang L, Zhang X, Liu A, et al. miR-93 promotes cell proliferation in gliomas through activation of PI3K/Akt signaling pathway. Oncotarget. 2015;6(10):8286. 190. Huse JT, Brennan C, Hambardzumyan D, Wee B, Pena J, Rouhanifard SH, et al. The PTEN-regulating microRNA miR-26a is amplified in high-grade glioma and facilitates gliomagenesis in vivo. Genes & development. 2009;23(11):1327-37. 191. Rao SA, Santosh V, Somasundaram K. Genome-wide expression profiling identifies deregulated miRNAs in malignant astrocytoma. Modern Pathology. 2010;23(10):1404-17. 192. Dong H, Siu H, Luo L, Fang X, Jin L, Xiong M. Investigation gene and microRNA expression in glioblastoma. BMC genomics. 2010;11(Suppl 3):S16. 193. Lavon I, Zrihan D, Granit A, Einstein O, Fainstein N, Cohen MA, et al. Gliomas display a microRNA expression profile reminiscent of neural precursor cells. Neuro-oncology. 2010;12(5):422-33. 194. Gokhale A, Kunder R, Goel A, Sarin R, Moiyadi A, Shenoy A, et al. Distinctive microRNA signature of medulloblastomas associated with the WNT signaling pathway. Journal of cancer research and therapeutics. 2010;6(4):521. 195. Zhang Z, Li S, Cheng SY. The miR-183∼ 96∼ 182 cluster promotes tumorigenesis in a mouse model of medulloblastoma. Journal of biomedical research. 2013;27(6):486. 196. Weeraratne SD, Amani V, Teider N, Pierre-Francois J, Winter D, Kye MJ, et al. Pleiotropic effects of miR-183~ 96~ 182 converge to regulate cell survival, proliferation and migration in medulloblastoma. Acta neuropathologica. 2012;123(4):539-52. 197. Wang M, Deng X, Ying Q, Jin T, Li M, Liang C. MicroRNA-224 targets ERG2 and contributes to malignant progressions of meningioma. Biochemical and biophysical research communications. 2015;460(2):354-61. 198. Silber J, Lim DA, Petritsch C, Persson AI, Maunakea AK, Yu M, et al. miR-124 and miR-137 inhibit proliferation of glioblastoma multiforme cells and induce differentiation of brain tumor stem cells. BMC medicine. 2008;6(1):14. 199. Jiang L, Lin C, Song L, Wu J, Chen B, Ying Z, et al. MicroRNA-30e* promotes human glioma cell invasiveness in an orthotopic xenotransplantation model by disrupting the NF-κB/IκBα negative feedback loop. The Journal of clinical investigation. 2012;122(1):33. 200. Che S, Sun T, Wang J, Jiao Y, Wang C, Meng Q, et al. miR-30 overexpression promotes glioma stem cells by regulating Jak/STAT3 signaling pathway. Tumor Biology. 2015;36(9):6805-11. 201. Wang K, Jia Z, Zou J, Zhang A, Wang G, Hao J, et al. Analysis of hsa-miR-30a-5p expression in human gliomas. Pathology & Oncology Research. 2013;19(3):405-11. 202. Jia Z, Wang K, Wang G, Zhang A, Pu P. MiR-30a-5p antisense oligonucleotide suppresses glioma cell growth by targeting SEPT7. PloS one. 2013;8(1):e55008. 203. Li G, Zhang Z, Tu Y, Jin T, Liang H, Cui G, et al. Correlation of microRNA-372 upregulation with poor prognosis in human glioma. Diagnostic pathology. 2013;8(1):1. 204. Wu Z, Wang L, Li G, Liu H, Fan F, Li Z, et al. Increased expression of microRNA-9 predicts an unfavorable prognosis in human glioma. Molecular and cellular biochemistry. 2013;384(1-2):263-8.

110

205. Thesleff I, Kantomaa T, Mackie E, Chiquet-Ehrismann R. Immunohistochemical localization of the matrix glycoprotein tenascin in the skull of the growing rat. Archives of oral biology. 1988;33(6):383-90. 206. Turchi L, Debruyne DN, Almairac F, Virolle V, Fareh M, Neirijnck Y, et al. Tumorigenic potential of miR‐18A* in glioma initiating cells requires NOTCH‐1 signaling. Stem Cells. 2013;31(7):1252-65. 207. Fox JL, Dews M, Minn AJ, Thomas-Tikhonenko A. Targeting of TGFβ signature and its essential component CTGF by miR-18 correlates with improved survival in glioblastoma. Rna. 2013;19(2):177-90. 208. Jia Z, Wang K, Zhang A, Wang G, Kang C, Han L, et al. miR-19a and miR-19b overexpression in gliomas. Pathology & Oncology Research. 2013;19(4):847-53. 209. Lian H-W, Zhou Y, Jian Z-H, Liu R-Z. MiR-323-5p acts as a tumor suppressor by targeting the insulin-like growth factor 1 receptor in human glioma cells. Asian Pac J Cancer Prev. 2014;15(23):10181-5. 210. Delic S, Lottmann N, Stelzl A, Liesenberg F, Wolter M, Götze S, et al. MiR-328 promotes glioma cell invasion via SFRP1-dependent Wnt-signaling activation. Neuro-oncology. 2013;16(2):179-90. 211. Xiao B, Tan L, He B, Liu Z, Xu R. MiRNA-329 targeting E2F1 inhibits cell proliferation in glioma cells. Journal of translational medicine. 2013;11(1):172. 212. Yao Y, Xue Y, Ma J, Shang C, Wang P, Liu L, et al. MiR-330-mediated regulation of SH3GL2 expression enhances malignant behaviors of glioblastoma stem cells by activating ERK and PI3K/AKT signaling pathways. PloS one. 2014;9(4):e95060. 213. Qu S, Yao Y, Shang C, Xue Y, Ma J, Li Z, et al. MicroRNA-330 is an oncogenic factor in glioblastoma cells by regulating SH3GL2 gene. PloS one. 2012;7(9):e46010. 214. Tavazoie SF, Alarcón C, Oskarsson T, Padua D, Wang Q, Bos PD, et al. Endogenous human microRNAs that suppress breast cancer metastasis. nature. 2008;451(7175):147. 215. Shu M, Zheng X, Wu S, Lu H, Leng T, Zhu W, et al. Targeting oncogenic miR-335 inhibits growth and invasion of malignant astrocytoma cells. Molecular cancer. 2011;10(1):59. 216. Cheng Q, Cao H, Chen Z, Ma Z, Wan X, Peng R, et al. PAX6, a novel target of miR-335, inhibits cell proliferation and invasion in glioma cells. Molecular medicine reports. 2014;10(1):399-404. 217. Jiang J, Sun X, Wang W, Jin X, Bo X, Li Z, et al. Tumor microRNA-335 expression is associated with poor prognosis in human glioma. Medical oncology. 2012;29(5):3472-7. 218. Shu M, Zhou Y, Zhu W, Zhang H, Wu S, Chen J, et al. MicroRNA 335 is required for differentiation of malignant glioma cells induced by activation of cAMP/protein kinase A pathway. Molecular pharmacology. 2012;81(3):292-8. 219. Shi L, Jiang D, Sun G, Wan Y, Zhang S, Zeng Y, et al. miR-335 promotes cell proliferation by directly targeting Rb1 in meningiomas. Journal of neuro-oncology. 2012;110(2):155-62. 220. Liu X, Wang S, Yuan A, Yuan X, Liu B. MicroRNA-140 represses glioma growth and metastasis by directly targeting ADAM9. Oncology reports. 2016;36(4):2329-38. 221. Bray I, Tivnan A, Bryan K, Foley NH, Watters KM, Tracey L, et al. MicroRNA-542-5p as a novel tumor suppressor in neuroblastoma. Cancer letters. 2011;303(1):56-64. 222. Volinia S, Galasso M, Sana ME, Wise TF, Palatini J, Huebner K, et al. Breast cancer signatures for invasiveness and prognosis defined by deep sequencing of microRNA. Proceedings of the National Academy of Sciences. 2012;109(8):3024-9. 223. Wang Z, Wang B, Shi Y, Xu C, Xiao H, Ma L, et al. Oncogenic miR-20a and miR-106a enhance the invasiveness of human glioma stem cells by directly targeting TIMP-2. Oncogene. 2015;34(11).

111

224. Chen L, Zhang A, Li Y, Zhang K, Han L, Du W, et al. MiR-24 regulates the proliferation and invasion of glioma by ST7L via β-catenin/Tcf-4 signaling. Cancer letters. 2013;329(2):174-80. 225. Suh S-S, Yoo JY, Nuovo GJ, Jeon Y-J, Kim S, Lee TJ, et al. MicroRNAs/TP53 feedback circuitry in glioblastoma multiforme. Proceedings of the National Academy of Sciences. 2012;109(14):5316-21. 226. Zhang J, Gong X, Tian K, Chen D, Sun J, Wang G, et al. miR-25 promotes glioma cell proliferation by targeting CDKN1C. Biomedicine & Pharmacotherapy. 2015;71:7-14. 227. Peng G, Yuan X, Yuan J, Liu Q, Dai M, Shen C, et al. miR-25 promotes glioblastoma cell proliferation and invasion by directly targeting NEFL. Molecular and cellular biochemistry. 2015;409(1-2):103-11. 228. Rivera-Díaz M, Miranda-Román MA, Soto D, Quintero-Aguilo M, Ortiz-Zuazaga H, Marcos-Martinez MJ, et al. MicroRNA-27a distinguishes glioblastoma multiforme from diffuse and anaplastic astrocytomas and has prognostic value. American journal of cancer research. 2015;5(1):201. 229. Ge Y-F, Sun J, Jin C-J, Cao B-Q, Jiang Z-F, Shao J-F. AntagomiR-27a targets FOXO3a in glioblastoma and suppresses U87 cell growth in vitro and in vivo. Asian Pacific journal of cancer prevention. 2013;14(2):963-8. 230. Chen L, Li H, Han L, Zhang K, Wang G, Wang Y, et al. Expression and function of miR-27b in human glioma. Oncology reports. 2011;26(6):1617-21. 231. Alrfaei BM, Vemuganti R, Kuo JS. microRNA-100 targets SMRT/NCOR2, reduces proliferation, and improves survival in glioblastoma animal models. PLoS One. 2013;8(11):e80865. 232. Ng WL, Yan D, Zhang X, Mo Y-Y, Wang Y. Over-expression of miR-100 is responsible for the low-expression of ATM in the human glioma cell line: M059J. DNA repair. 2010;9(11):1170-5. 233. Pezuk JA, Brassesco MS, de Oliveira RS, Machado HR, Neder L, Scrideli CA, et al. PLK1-associated microRNAs are correlated with pediatric medulloblastoma prognosis. Child's Nervous System. 2017;33(4):609-15. 234. Dai D-W, Lu Q, Wang L-X, Zhao W-Y, Cao Y-Q, Li Y-N, et al. Decreased miR-106a inhibits glioma cell glucose uptake and proliferation by targeting SLC2A3 in GBM. BMC cancer. 2013;13(1):478. 235. Li KKW, Xia T, Ma FMT, Zhang R, Mao Y, Wang Y, et al. miR‐106b is overexpressed in medulloblastomas and interacts directly with PTEN. Neuropathology and applied neurobiology. 2015;41(2):145-64. 236. Zakrzewska M, Fendler W, Zakrzewski K, Sikorska B, Grajkowska W, Dembowska-Bagińska B, et al. Altered MicroRNA Expression Is Associated with Tumor Grade, Molecular Background and Outcome in Childhood Infratentorial Ependymoma. PloS one. 2016;11(7):e0158464. 237. Zhu G, Wang Y, Mijiti M, Wang Z, Wu P-F, Jiafu D. Upregulation of miR-130b enhances stem cell-like phenotype in glioblastoma by inactivating the Hippo signaling pathway. Biochemical and biophysical research communications. 2015;465(2):194-9. 238. Parker NR, Correia N, Crossley B, Buckland ME, Howell VM, Wheeler HR. Correlation of MicroRNA 132 Up-regulation with an unfavorable clinical outcome in patients with primary glioblastoma multiforme treated with radiotherapy plus concomitant and adjuvant temozolomide chemotherapy. Translational oncology. 2013;6(6):742IN34-8. 239. Liu Q, Liao F, Wu H, Cai T, Yang L, Wang Z-f, et al. Upregulation of miR-132 expression in glioma and its clinical significance. Tumor Biology. 2014;35(12):12299-304. 240. Bayrak OF, Gulluoglu S, Aydemir E, Ture U, Acar H, Atalay B, et al. MicroRNA expression profiling reveals the potential function of microRNA-31 in chordomas. Journal of neuro-oncology. 2013;115(2):143-51.

112

241. Zou M-X, Huang W, Wang X-B, Lv G-H, Li J, Deng Y-W. Identification of miR-140-3p as a marker associated with poor prognosis in spinal chordoma. International journal of clinical and experimental pathology. 2014;7(8):4877. 242. Zhang Y, Schiff D, Park D, Abounader R. MicroRNA-608 and microRNA-34a regulate chordoma malignancy by targeting EGFR, Bcl-xL and MET. PloS one. 2014;9(3):e91546. 243. Zhao S, Liu H, Liu Y, Wu J, Wang C, Hou X, et al. miR-143 inhibits glycolysis and depletes stemness of glioblastoma stem-like cells. Cancer letters. 2013;333(2):253-60. 244. Liu X, Yu H, Cai H, Wang Y. The expression and clinical significance of miR-132 in gastric cancer patients. Diagnostic pathology. 2014;9(1):57. 245. Mei J, Bachoo R, Zhang C-L. MicroRNA-146a inhibits glioma development by targeting Notch1. Molecular and cellular biology. 2011;31(17):3584-92. 246. Li Y, Wang Y, Yu L, Sun C, Cheng D, Yu S, et al. miR-146b-5p inhibits glioma migration and invasion by targeting MMP16. Cancer letters. 2013;339(2):260-9. 247. Vo DT, Qiao M, Smith AD, Burns SC, Brenner AJ, Penalva LO. The oncogenic RNA-binding protein Musashi1 is regulated by tumor suppressor miRNAs. RNA biology. 2011;8(5):817-28. 248. Zhong Q, Wang T, Lu P, Zhang R, Zou J, Yuan S. miR‐193b promotes cell proliferation by targeting Smad3 in human glioma. Journal of neuroscience research. 2014;92(5):619-26. 249. Guan Y, Chen L, Bao Y, Qiu B, Pang C, Cui R, et al. High miR-196a and low miR-367 cooperatively correlate with unfavorable prognosis of high-grade glioma. International journal of clinical and experimental pathology. 2015;8(6):6576. 250. Yang G, Han D, Chen X, Zhang D, Wang L, Shi C, et al. MiR-196a exerts its oncogenic effect in glioblastoma multiforme by inhibition of IκBα both in vitro and in vivo. Neuro-oncology. 2014;16(5):652-61. 251. Ma R, Yan W, Zhang G, Lv H, Liu Z, Fang F, et al. Upregulation of miR-196b confers a poor prognosis in glioblastoma patients via inducing a proliferative phenotype. PLoS One. 2012;7(6):e38096. 252. Ayers D, Mestdagh P, Van Maerken T, Vandesompele J. Identification of miRNAs contributing to neuroblastoma chemoresistance. Computational and structural biotechnology journal. 2015;13:307-19. 253. Zhou X, Ren Y, Moore L, Mei M, You Y, Xu P, et al. Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status. Laboratory investigation. 2010;90(2):144-55. 254. Papagiannakopoulos T, Shapiro A, Kosik KS. MicroRNA-21 targets a network of key tumor-suppressive pathways in glioblastoma cells. Cancer research. 2008;68(19):8164-72. 255. Shang C, Guo Y, Hong Y, Liu Y-h, Xue Y-x. MiR-21 up-regulation mediates glioblastoma cancer stem cells apoptosis and proliferation by targeting FASLG. Molecular biology reports. 2015;42(3):721-7. 256. Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder H, Hagan JP, et al. MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis. Jama. 2007;297(17):1901-8. 257. Garzon R, Volinia S, Liu C-G, Fernandez-Cymering C, Palumbo T, Pichiorri F, et al. MicroRNA signatures associated with cytogenetics and prognosis in acute myeloid leukemia. Blood. 2008;111(6):3183-9. 258. Wang W, Li J, Zhu W, Gao C, Jiang R, Li W, et al. MicroRNA-21 and the clinical outcomes of various carcinomas: a systematic review and meta-analysis. BMC cancer. 2014;14(1):819. 259. Yang CH, Yue J, Pfeffer SR, Fan M, Paulus E, Hosni-Ahmed A, et al. MicroRNA-21 promotes glioblastoma tumorigenesis by down-regulating insulin-like growth factor-binding protein-3 (IGFBP3). Journal of Biological Chemistry. 2014;289(36):25079-87.

113

260. Yang CH, Pfeffer SR, Sims M, Yue J, Wang Y, Linga VG, et al. The oncogenic microRNA-21 inhibits the tumor suppressive activity of FBXO11 to promote tumorigenesis. Journal of Biological Chemistry. 2015;290(10):6037-46. 261. Schetter AJ, Leung SY, Sohn JJ, Zanetti KA, Bowman ED, Yanaihara N, et al. MicroRNA expression profiles associated with prognosis and therapeutic outcome in colon adenocarcinoma. Jama. 2008;299(4):425-36. 262. Yan L-X, Huang X-F, Shao Q, Huang M-Y, Deng L, Wu Q-L, et al. MicroRNA miR-21 overexpression in human breast cancer is associated with advanced clinical stage, lymph node metastasis and patient poor prognosis. Rna. 2008;14(11):2348-60. 263. Gaur AB, Holbeck SL, Colburn NH, Israel MA. Downregulation of Pdcd4 by mir-21 facilitates glioblastoma proliferation in vivo. Neuro-oncology. 2011;13(6):580-90. 264. Costa PM, Cardoso AL, Nóbrega C, Pereira de Almeida LF, Bruce JN, Canoll P, et al. MicroRNA-21 silencing enhances the cytotoxic effect of the antiangiogenic drug sunitinib in glioblastoma. Human molecular genetics. 2012;22(5):904-18. 265. Costa PM, Cardoso AL, Custódia C, Cunha P, de Almeida LP, de Lima MCP. MiRNA-21 silencing mediated by tumor-targeted nanoparticles combined with sunitinib: a new multimodal gene therapy approach for glioblastoma. Journal of Controlled Release. 2015;207:31-9. 266. Li Y, Li W, Yang Y, Lu Y, He C, Hu G, et al. MicroRNA-21 targets LRRFIP1 and contributes to VM-26 resistance in glioblastoma multiforme. Brain research. 2009;1286:13-8. 267. Schramedei K, Mörbt N, Pfeifer G, Läuter J, Rosolowski M, Tomm J, et al. MicroRNA-21 targets tumor suppressor genes ANP32A and SMARCA4. Oncogene. 2011;30(26):2975-85. 268. Lu Z, Liu M, Stribinskis V, Klinge C, Ramos K, Colburn N, et al. MicroRNA-21 promotes cell transformation by targeting the programmed cell death 4 gene. Oncogene. 2008;27(31):4373-9. 269. Gabriely G, Wurdinger T, Kesari S, Esau CC, Burchard J, Linsley PS, et al. MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Molecular and cellular biology. 2008;28(17):5369-80. 270. Zhi X, Wu K, Yu D, Wang Y, Yu Y, Yan P, et al. MicroRNA-494 inhibits proliferation and metastasis of osteosarcoma through repressing insulin receptor substrate-1. American journal of translational research. 2016;8(8):3439. 271. Li X-t, Wang H-z, Wu Z-w, Yang T-q, Zhao Z-h, Chen G-l, et al. miR-494-3p regulates cellular proliferation, invasion, migration, and apoptosis by PTEN/AKT signaling in human glioblastoma cells. Cellular and molecular neurobiology. 2015;35(5):679-87. 272. He L, Thomson JM, Hemann MT, Hernando-Monge E, Mu D, Goodson S, et al. A microRNA polycistron as a potential human oncogene. nature. 2005;435(7043):828. 273. Sun HB, Chen X, Ji H, Wu T, Lu HW, Zhang Y, et al. miR‑494 is an independent prognostic factor and promotes cell migration and invasion in colorectal cancer by directly targeting PTEN. International journal of oncology. 2014;45(6):2486-94. 274. Li N, Zhao X, Wang L, Zhang S, Cui M, He J. miR-494 suppresses tumor growth of epithelial ovarian carcinoma by targeting IGF1R. Tumor Biology. 2016;37(6):7767-76. 275. He W, Li Y, Chen X, Lu L, Tang B, Wang Z, et al. miR‐494 acts as an anti‐oncogene in gastric carcinoma by targeting c‐myc. Journal of gastroenterology and hepatology. 2014;29(7):1427-34. 276. Wang J, Chen H, Liao Y, Chen N, Liu T, Zhang H, et al. Expression and clinical evidence of miR-494 and PTEN in non-small cell lung cancer. Tumor Biology. 2015;36(9):6965-72.

114

277. Liu Y, Li X, Zhu S, Zhang J, Yang M, Qin Q, et al. Ectopic expression of miR-494 inhibited the proliferation, invasion and chemoresistance of pancreatic cancer by regulating SIRT1 and c-Myc. Gene therapy. 2015;22(9):729-38. 278. Liu L, Jiang Y, Zhang H, Greenlee AR, Han Z. Overexpressed miR-494 down-regulates PTEN gene expression in cells transformed by anti-benzo (a) pyrene-trans-7, 8-dihydrodiol-9, 10-epoxide. Life sciences. 2010;86(5):192-8. 279. Kim WK, Park M, Kim Y-K, Tae YK, Yang H-K, Lee JM, et al. MicroRNA-494 downregulates KIT and inhibits gastrointestinal stromal tumor cell proliferation. Clinical Cancer Research. 2011;17(24):7584-94. 280. Zhou R-P, Chen G, Shen Z-L, Pan L-Q. Cinobufacin suppresses cell proliferation via miR-494 in BGC-823 gastric cancer cells. Asian Pac J Cancer Prev. 2014;15(3):1241-5. 281. Bai Y, Sun Y, Peng J, Liao H, Gao H, Guo Y, et al. Overexpression of secretagogin inhibits cell apoptosis and induces chemoresistance in small cell lung cancer under the regulation of miR-494. Oncotarget. 2014;5(17):7760. 282. Zhang R, Chen X, Zhang S, Zhang X, Li T, Liu Z, et al. Upregulation of miR-494 inhibits cell growth and invasion and induces cell apoptosis by targeting cleft Lip and palate transmembrane 1-like in esophageal squamous cell carcinoma. Digestive diseases and sciences. 2015;60(5):1247-55. 283. Romano G, Acunzo M, Garofalo M, Di Leva G, Cascione L, Zanca C, et al. MiR-494 is regulated by ERK1/2 and modulates TRAIL-induced apoptosis in non–small-cell lung cancer through BIM down-regulation. Proceedings of the National Academy of Sciences. 2012;109(41):16570-5. 284. Yamanaka S, Campbell NR, An F, Kuo SC, Potter JJ, Mezey E, et al. Coordinated effects of microRNA-494 induce G₂/M arrest in human cholangiocarcinoma. Cell cycle. 2012;11(14):2729-38. 285. Chakravarthy M, Aung-Htut MT, Le BT, Veedu RN. Novel Chemically-modified DNAzyme targeting Integrin alpha-4 RNA transcript as a potential molecule to reduce inflammation in multiple sclerosis. Scientific Reports. 2017;7(1):1613. 286. Ji W, Sun B, Su C. Targeting microRNAs in cancer gene therapy. Genes. 2017;8(1):21. 287. Bennett CF, Swayze EE. RNA targeting therapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic platform. Annual review of pharmacology and toxicology. 2010;50:259-93. 288. Kole R, Krainer AR, Altman S. RNA therapeutics: beyond RNA interference and antisense oligonucleotides. Nature reviews Drug discovery. 2012;11(2):125. 289. Hannon GJ. RNA interference. Nature. 2002;418:244. 290. Jonas S, Izaurralde E. Towards a molecular understanding of microRNA-mediated gene silencing. Nature Reviews Genetics. 2015;16(7):421. 291. He L, Hannon GJ. MicroRNAs: small RNAs with a big role in gene regulation. Nature Reviews Genetics. 2004;5(7):522. 292. Esposito CL, Catuogno S, de Franciscis V. Aptamer-miRNA conjugates for cancer cell-targeted delivery. SiRNA Delivery Methods: Springer; 2016. p. 197-208. 293. Santoro SW, Joyce GF. A general purpose RNA-cleaving DNA enzyme. Proceedings of the National Academy of Sciences. 1997;94(9):4262-6. 294. Monici M. Cells and tissue autofluorescence research and diagnostic applications. Biotechnology Annual Review. 2005;11:227-56. 295. CAIRNS MJ, HOPKINS TM, WITHERINGTON C, SUN L-Q. The influence of arm length asymmetry and base substitution on the activity of the 10-23 DNA enzyme. Antisense and Nucleic Acid Drug Development. 2000;10(5):323-32. 296. Ackermann JM, Kanugula S, Pegg AE. DNAzyme-mediated silencing of ornithine decarboxylase. Biochemistry. 2005;44(6):2143-52.

115

297. Santoro SW, Joyce GF. Mechanism and utility of an RNA-cleaving DNA enzyme. Biochemistry. 1998;37(38):13330-42. 298. Kurreck J, Bieber B, Jahnel R, Erdmann VA. Comparative study of DNA enzymes and ribozymes against the same full-length messenger RNA of the vanilloid receptor subtype I. Journal of Biological Chemistry. 2002;277(9):7099-107. 299. Schubert S, GuÈl DC, Grunert HP, Zeichhardt H, Erdmann VA, Kurreck J. RNA cleaving ‘10‐23’DNAzymes with enhanced stability and activity. Nucleic acids research. 2003;31(20):5982-92.

116

7. Appendices

Appendix I. Full gene name used in thesis.

Official gene symbol Official gene name

PACT Protein Activator of Interferon Induced Protein

Kinase

TRBP Trans-Activation Response RNA-Binding Protein

CCNE1 Cyclin E1

NRP-2 Neuropilin 2

MMP2 Matrix Metallopeptidase 2




Wt1 Wilms Tumor 1

Rab9B Ras-Associate Protein Rab 9B

AKT AKT Serine/Threonine Kinase

AKT1 AKT Serine/Threonine Kinase 1

AKT2 AKT Serine/Threonine Kinase 2

RAS RAT Sarcoma protein

HMGA2 High Mobility Group AT-Hook 2

PDPN Podoplanin

MCL1 Myeloid Cell Leukaemia Sequence 1

SMAD2 SMAD Family Member 2



117

FRAT1 Frequently Rearranged in Advanced T-cell

lymphomas 1

BCL2 B-Cell CLL/Lymphoma 2

ERG ERG, ETS Transcription Factor

ERG2 ETS Related Gene

CTGF Connective Tissue Growth Factor

ABCG2 ATP Binding Cassette Subfamily G Member 2

PTEN Phosphatase and Tensin Homology

TIMP2 Tissue Inhibitor of Metalloproteinases 2

PTPμ Protein Tyrosine Phosphatase mu

CDKN1B/p27Kip Cyclin Dependent Kinase Inhibitor 1B

CDKN1C Cyclin Dependent Kinase Inhibitor 1C

MGMT O-6-Methylguanine-DNA Methyltransferase

SEMA3B Semaphorin

GABRA1 Gamma-Aminobutyric Acid type A Receptor

Alpha 1 subunit

MAPK13 Mitogen-Activated Protein Kinase 13

MAPK14 Mitogen-Activated Protein Kinase 13

FOXO3a Forkhead Box O3

MXI1 MAX Interactor 1, Dimerization Protein

Wee1 Wee1 G2 Checkpoint Kinase

E2F1 E2F Transcription Factor 1

NLK Nemo Like Kinase

CASP3 Caspase 3

CASP9 Caspase 4

118

PHLPP2 PH Domain and Leucine Rich Repeat Protein

Phosphatase 2

LLRC4 Leucine Rich repeat superfamily C4

WIF1 WNT Inhibitory Factor 1

CTNNBIP1 Catenin Beta Interacting Protein 1

SENP6 SUMO1/Sentrin Specific Peptidase 6

SEPT7 Septin 7

SPRY4 Sprouty RTK Signaling Antagonist 4

RAF1 Raf-1 Proto-Oncogene, Serine/Threonine Kinase

HIF3A Hypoxia Inducible Factor 3 Alpha Subunit

HIF2A Hypoxia Inducible Factor 2 Alpha Subunit

CXCR4 C-X-C Motif Chemokine Receptor 4

PAK1 P21 (RAC1) Activated Kinase 1

RTK Receptor Tyrosine Kinase

PDGFRa Platelet Derived Growth Factor Receptor Alpha

P70S6K1 Ribosomal Protein S6 Kinase Beta-1

E2F3a E2F Transcription Factor 3

Bmi-1 BMI1 Proto-Oncogene, Polycomb Ring Finger

PDPK1 3-Phosphoinositide Dependent Protein Kinase 1

BCL2L12 BCL2 Like 12

BMI/BCL2L11 BCL2 Like 11

MET MET Proto-Oncogene, Receptor Tyrosine Kinase

CYLD CYLD Lysine 63 Deubiquitinase

LRRC4 Leucine Rich Repeat Containing 4

ADAM9 ADAM Metallopeptidase Domain 9

119

CD6K Cyclin Dependent Kinase 6

CDC25A Cell Division Cycle 25A

CDC27 Cell Division Cycle 27

E2F2 E2F Transcription Factor 2

BMF BCL2 Modifying Factor

MAZ MYC Associated Zinc Finger Protein

LIN28 Lin-28 Homolog

HOXD10d Homeobox D10

Rhoc Ras Homolog Family Member C

uPAR Urokinase receptor

BCL3L11 BCL3 Like 11

TFAP2C/ AP-2γ Transcription Factor AP-2 Gamma

CDKN1A/p21 Cyclin Dependent Kinase Inhibitor 1A

CDKN2A/p16 Cyclin Dependent Kinase Inhibitor 2A

P21WAF/1/Cip1 Cyclin Dependent Kinase Inhibitor 1A

CSMD1 CUB And Sushi Multiple Domains 1

CAB39 Calcium Binding Protein 39

LKB1 Liver Kinase B1

CAMTA1 Calmodulin Binding Transcription Activator 1

MDM2 MDM2 Proto-Oncogene

ITGB3 Integrin Subunit Beta 3

Daam1 Dishevelled Associated Activator of

Morphogenesis 1

Rb1 Retinoblastoma 1

Shh signalling pathway Sonic Hedgehog Signalling Pathway

120

IκBα Nuclear Factor of Kappa Light Polypeptide Gene

enhancer in B-cells Inhibitor Alpha

SOCS3 Suppressor of Cytokine Signalling 3

DLL3 Delta Like Canoica Notch Ligand 3

IGFR1 Insulin Like Growth Factor 1 Receptor

SFRP1 Secreted Frizzled Related Protein 1

SH3GL2 SH3 Domain Containing GRB2 Like 2,

Endophilin A1

SOX4 SRY-Box 4

ST7L Suppression of Tumorigenicity 7 Like

TSC1 TSC Complex Subunit 1

NEFL Neurofilament Light

SMRT/NCOR2 Nuclear Receptor Corepressor 2

ATM ATM Serine/Threonine Kinase

SLC2A3 Solute Carrier Family 2 Member 3

MCM7 Minichromosome Maintenance Complex

Component 7

EZH2 Enhancer of Zeste 2 Polycomb Repressive

Complex 2 Subunit

MST1 Macrophage Stimulating 1

SAV1 Salvador Family WW Domain Containing Protein

1

NOTCH1 Translocation-Associated Notch Protein TAN-1

FIH1 Factor Inhibiting Hypoxia Inducible Factor 1

NFKBIA NFKB Inhibitor Alpha

121

Appendix II. Cell freeze down protocol

Subculture of cells was followed as described in 2.2.4.2. to obtain a cell pellet. Cells

were resuspended and counted using a hemocytometer as described in 2.2.5.2.

Following cell count and ensuring the correct number of cells were present, the cell

suspension was then diluted into the amount needed. 1mL of cell suspension was

frozen down per vial, the appropriate amount of media was added (e.g. for 10 vials of

cells, a further 9ml media is added to the 1mL cell suspension, or 10mL media to the

cell pellet). 5% DMSO was added to cells as per ATCC. Samples were then mixed by

inversion and aliquoted into prelabelled cryovials (culture number, name of operator,

date, passage number, and cell type). The cryovials were moved to a defrosted

Mr.Frosty™ Freezing Container (ThermoFisher Scientific) and stored in -80°C

freezer, which was then transferred to liquid nitrogen.

Documents

Development of Novel Oligonucleotide Therapeutic Molecules ...researchrepository.murdoch.edu.au/id/eprint/42397/1/Larcher2018.pdfdevelop the use of synthetic catalytic oligonucleotides