Research ArticleDevelopment of Isothermal RecombinasePolymerase Amplification Assay for Rapid Detection ofPorcine Circovirus Type 2

Yang Yang Xiaodong Qin Yingjun Sun Guozheng Cong Yanmin Li and Zhidong Zhang

State Key Laboratory of Veterinary Etiological Biology Lanzhou Veterinary Research InstituteChinese Academy of Agricultural Sciences Xujiaping 1 Lanzhou Gansu 730046 China

Correspondence should be addressed to Zhidong Zhang zhangzhidongcaascn

Received 6 December 2016 Accepted 13 March 2017 Published 23 March 2017

Academic Editor Cristina Domingo

Copyright copy 2017 Yang Yang et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Porcine circovirus virus type II (PCV2) is the etiology of postweaning multisystemic wasting syndrome (PMWS) porcinedermatitis nephropathy syndrome (PDNS) and necrotizing pneumonia Rapid diagnosis tool for detection of PCV2 plays animportant role in the disease control and eradication program Recombinase polymerase amplification (RPA) assays using a real-time fluorescent detection (PCV2 real-time RPA assay) and RPA combined with lateral flow dipstick (PCV2 RPA LFD assay)were developed targeting the PCV2 ORF2 gene The results showed that the sensitivity of the PCV2 real-time RPA assay was102 copies per reaction within 20min at 37∘C and the PCV2 RPA LFD assay had a detection limit of 102 copies per reaction inless than 20min at 37∘C Both assays were highly specific for PCV2 with no cross-reactions with porcine circovirus virus type 1foot-and-mouth disease virus pseudorabies virus porcine parvovirus porcine reproductive and respiratory syndrome virus andclassical swine fever virus Therefore the RPA assays provide a novel alternative for simple sensitive and specific identification ofPCV2

1 Introduction

Porcine circovirus virus (PCV) is a small nonenvelopedDNA virus with diameter of 17 nm which is divided intotwo distinct genotypes (PCV1 and PCV2) [1] PCV2 is amajor causative agent of postweaning multisystemic wastingsyndrome (PMWS) which is characterized by progressiveweight loss respiratory impairment nephropathy syndromeand congenital tremor and it can affect nursery and fatteningpigs all around the world [2ndash5] Furthermore as PCV2 is animmunosuppressive virus it makes the pig more vulnerableto other viruses and bacteria Investigations show that PCV2commonly exists in pig populations [6]

Polymerase chain reaction- (PCR-) based assays includ-ing conventional PCR and real-time PCR assays weredeveloped and widely used in the laboratory for detec-tion of PCV2 DNA [7ndash12] These PCR-based assays haveplayed a crucial role in monitoring and controlling PCV2However these assays require sophisticated equipment and

well-trained technician which limit the application of PCR-based methods in field and poorly equipped technicians

An isothermal detection method recombinase poly-merase amplification (RPA) has been developed as analternative to PCR assay which can amplify nucleic acidsat 37∘Cndash39∘C within 20min RPA has been developed forveterinary importance viruses detection including porcineparvovirus virus [13] avian influenza virus [14] bovine viraldiarrhea virus [15] canine parvovirus type 2 [16] foot-and-mouth disease virus [17] and Orf virus [18 19] In this studywe developed fluorescent probe-based real-time RPA assay(PCV2 real-time RPA assay) and RPA assay united with LFD(PCV2 RPA LFD assay) to detect PCV2

2 Materials and Methods

21 Virus and Clinical Specimens All viruses used in thisstudy are listed in Table 2 Sixty-five clinical samples (spleen

HindawiBioMed Research InternationalVolume 2017 Article ID 8403642 8 pageshttpsdoiorg10115520178403642

2 BioMed Research International

Table 1 RPA primers and probes designed in this research

Name Sequence (51015840ndash31015840) Genome location (DQ231511)PCV2 RPA Fe1 ATACCATAACCCAGCCCTTCTCCTACCACTCCCGC 443ndash477PCV2 RPA Fe2 ATAACCCAGCCCTTCTCCTACCACTCCCGCTACTT 448ndash482PCV2 RPA Fe3 AAACCTGTCCTAGATTCCACTATTGATTACTTCCA 490ndash524PCV2 RPA Re1 TTGTATTCCTGGTCGTATATACTGTTTTCGAACGC 601ndash635PCV2 RPA Re2 ATATTGTATTCCTGGTCGTATATACTGTTTTCGAA 604ndash638PCV2 RPA Re3 TTACACGGATATTGTATTCCTGGTCGTATATACTG 612ndash646PCV2 RPA Pe ATTACTTCCAACCAAACAACAAAAGAAATCAGCTG 515ndash569

(FAM-dT)G(THF)C(BHQ1-dT)GAGACTACAAACTGC-C3 spacePCV2 RPA Fn1 ATACCATAACCCAGCCCTTCTCCTACCACTCCCGC 443ndash477PCV2 RPA Fn2 ATAACCCAGCCCTTCTCCTACCACTCCCGCTACTT 448ndash482PCV2 RPA Fn3 AAACCTGTCCTAGATTCCACTATTGATTACTTCCA 490ndash524PCV2 RPA Rn1 biotin-TTGTATTCCTGGTCGTATATACTGTTTTCGAACGC 601ndash635PCV2 RPA Rn2 biotin-ATATTGTATTCCTGGTCGTATATACTGTTTTCGAA 604ndash638PCV2 RPA Rn3 biotin-TTACACGGATATTGTATTCCTGGTCGTATATACTG 612ndash646PCV2 RPA Pn FAM-TACTTCCAACCAAACAACAAAAGAAATCAGCTGTG 517ndash567

-THF-CTGAGACTACAAACT-C3 space

Table 2 Evaluation of the specificity of PCV2 real-time RPA assay and PCV2 RPA LFD assay

Virus family Virus species Virus strain Real-time RPA RPA LFD Real-time qPCR

CircoviridaePCV2 NX strain 6min + 15 (CT)PCV2 CQ strain 56min + 14 (CT)PCV1 JL strain minus minus minus

Arteriviridae PRRSV CH-1R minus minus minus

Herpesviridae PRV Fa minus minus minus

Flaviviridae CSF C-strain minus minus minus

Parvoviridae PPV AV30 minus minus minus

Picornaviridae FMDV FMDVOCHA minus minus minus+Positive minusnegative

inguinal lymph node tonsil lung and serum) were collectedfrom suspected PCV2 infection pigs from eight pig farmsin Shandong Province (China) thirty-seven clinical samples(inguinal lymph node tonsil lung and serum)were collectedfromGansu Province (China) and ten PCV1 positive sampleswere conserved in our laboratory confirmed by real-timeqPCR [20] and Sanger dideoxy sequencing

22 Generation of DNA Standard and DNA Extraction ThePCV2 ORF2 gene segments (320 bp ranging from 359 bp to678 bp of DQ231511) named pPCV2RPAwere synthesized byGenewiz (Suzhou China) asDNA standard Viral RNADNAwas isolated by a TaKaRa Viral Mini kit (TaKaRa China)according to the manufacturerrsquos instructions and eluted ina volume of 50120583L In order to use the RPA assay in thefield DNA extraction was also performed by innuPREP MPbasic kit A (Jena Analytik Jena Germany) combined withmagnetic bead separation rack following the manufacturerrsquosinstructions

23 Design of the Primers and Probe of RPA After aligningthe ORF2 gene consensus sequence of KR5597251

KR5596951 KM4559751 KP7684811 JN1819051JN1819021 KF8504611 KC6205151 KF0350591 KF9515671KF9515701 KM6240311 and JQ0026721 we designedPCV2-specific RPA primers and probes in accordancewith TwistDx RPA kits guidelines (Cambridge UnitedKingdom) The sequences of designed probe and primerswere summarized in Table 1

24 Real-Time qPCR Assay Real-time qPCR assay for detec-tion of PCV2 DNA and PCV1 DNA were both performed onAgilent Mx3005P thermocycler machine (Life TechnologiesUSA) as previously described [20 21] The primers PCV2F (51015840-ATGGCGGGAGGAGTAGTTT-31015840) and PCV2 R (51015840-CCCTTTGAATACTACAGCG-31015840) were used to amplify a171 bp fragment within ORF2 region of the PCV2 genomeThe detection limit was 80 copies per reaction and it wasspecific for the PCV2 The primers for PCV1 DNA wereas follows PCV1 F (51015840-GTCAGTGAAAATGCCAAGCAA-31015840) and PCV1 R (51015840-CCAAACCTTCCTCTCCGCA-31015840) Thelength of amplified products was 152 bp The detectionlimit was 100 copies per reaction and it was specific forPCV1

BioMed Research International 3

25 Recombinase Polymerase Amplification Probe-basedPCV2 real-time RPA assay was performed with TwistAmpexo kit (TwistDx Cambridge United Kingdom) on Agi-lent Technologies Mx3005P thermocycler (Life technologiesUSA) The PCV2 real-time RPA assay was carried out asdescribed below 4x rehydration buffer 120 nM real-timeRPA probe 420 nM real-time RPA primes 2 120583L DNA tem-plate and 14mM magnesium acetate Fluorescence intensityof FAM was measured once every 20 seconds PCV2 RPALFD assay was performed with TwistAmp nfo kit (TwistDxCambridge United Kingdom) combined with lateral flowdipstick (Milenia Biotec GmbH Germany) in a water bath at37∘C After 20min incubation 2 120583L of amplification productwas diluted in 198 120583L of the assay buffer

26 Sensitivity and Specificity of PCV2 Real-Time RPA andRPA LFD Assays A dilution range from 106 to 101 copiesper reaction of the recombinant plasmid pPCV2RPA DNAwas used to evaluate the dynamic range of PCV2 real-timeRPA assay in eight replicates The detection limit of PCV2RPA LFD assay was tested by a dilution series of pPCV2RPADNA and the amplicons were also evaluated by agarose gelelectrophoresis In evaluating specificity of the developedPCV2 real-time RPA assay and RPA LFD assay the reac-tions were evaluated with PCV2NX PCV2CQ PCV1JLPRRSVCH-1R CSFVc-strain PRVFa PPVAV30 andFMDVOCHA in three replicates

3 Results

31 Sensitivity and Specificity of PCV2 Real-Time RPA AssayAfter running the PCV2 real-time RPA assay with differ-ent primer and probe combinations PCV2 RPA F3PCV2RPA R1 combines with PCV2 RPA Pe which were used asthey yielded the highest amplification efficiency (Table 1Figure 1) The PCV2 real-time RPA assay was sufficientlysensitive for detecting 102 copies per reaction within 20minat 37∘C (Figures 2(a) and 2(b)) The limit of PCV2 real-time RPA assay detection in 95 was 102 copies perreaction of pPCV2RPA (Figure 2(c)) In evaluating thespecificity of PCV2 real-time RPA assay no cross-reactionswere observedwith PCV1JL PRRSVCH-1R CSFVc-strainPRVFa PPVAV30 and FMDVOCHA and positive signalwas only observed with PCV2NX and PCV2CQ strain(Table 2)

32 Sensitivity and Specificity of PCV2 RPA LFD AssayThe sensitivity results showed that the detection limit ofPCV2 RPA LFD assay was 102 copies per reaction of therecombinant plasmid pPCV2RPA DNA (Figure 4(a)) andthe amplicon in the PCV2 RPA LFD assay (146 bp) wasalso tested by subsequent visualization with 3 agarose gelelectrophoresis (Figure 4(b)) In evaluating the specificityof PCV2 RPA LFD assay no cross-reactions were observedwith other important viruses of pigs as described above(Figure 5(a)) which were also confirmed by the agarose gelelectrophoresis (Figure 5(b))

Fe1Re2

Fe3Re1 Fe3Re3 Fe2Re3

Fe3Re2

Fe2Re1

Fe1Re3

Fe2Re2

Fe1Re1 NC

5 7 9 11 13 15 17 193Time (min)

minus2500

7500

17500

27500

37500

47500

Fluo

resc

ence

(dR)

Figure 1 Optimal primers and probe combinations of PCV2real-time RPA assay The amplification results of nine differentcombinations of primers with the probe PCV2 RPA Pe are shown

33 Performance of PCV2 Real-Time RPA Assay and PCV2RPA LFD Assay on Clinical Samples The practicality ofboth PCV2 real-time RPA assay and PCV2 RPA LFD assaywas evaluated with clinical tissue samples (119899 = 102) Theresults were then comparedwith PCV2 real-time qPCR assayAmong these clinical samples 31 samples were tested aspositive by PCV2 real-time qPCR assay (CT value rangingfrom 19 to 30) All of these 31 samples were determined to bepositive by both PCV2 real-time RPA assay (threshold timeranging from 56 to 93) and PCV2 RPA LFD assay Based ontotal samples examined the sensitivity and the specificity ofboth PCV2 real-time RPA assay and PCV2 RPA LFD assayfor identification of PCV2 were 100 and 100 respectivelywhen compared to PCV2 real-time qPCR (Table 3) ThePCV2 real-time RPA assay and PCV2 RPA LFD assay werealso evaluated with PCV1 positive samples (119899 = 10) and theresults showed that all the samples were PCV2 negative Theextraction effects of innuPREP MP basic kit were tested withthese PCV2 positive tissue samples and results showed thiskit performed well (Table 4) This DNARNA extraction kitcombining with RPA assay could be used in the field or innot well-equipped laboratories

4 Discussion

In this study RPA assays were developed for rapid andspecific detection of PCV2 The most optimal detectionconditions of PCV2 RPA LFD assay were explored withdifferent reaction temperature and time The results showedthat it amplified well from 30∘C to 45∘C The amplificationproducts could be detected when the reaction time was morethan 10min (Figures 3(a) and 3(b)) Therefore the PCV2RPA LFD assay performed in a simple water bath at 37∘Cfor 20min arbitrarily A visible band on the LFD strip gives

4 BioMed Research International

NC0

10000

20000

30000

40000Fl

uore

scen

ce (d

R)

5 7 9 11 133Time (min)

101

102

10310

410510

6

(a)

7

R2= 09075

Y = minus0796X + 1201

0

3

6

9

12

0 1 2 3 4 5 6

Tim

e (m

in)

log10

(copy number of standard)(b)

101

102

103

104

105

106

107

100

Lim

it of

det

ectio

n (

)

0

20

40

60

80

100

Molecules detected(c)

Figure 2The sensitivity of PCV2 real-time RPA assay (a) Fluorescence performance via real-time test using a dilution range of pPCV2RPA(b) Reproducibility of the PCV2 real-time RPA assay according to eight test runs (c) Probit regression analysis was done on data from theeight runs of PCV2 real-time RPA assay

15 20 25 30 35 37 40 45 50

Control

Test

Reaction temperature (∘C)

(a)

Control

Test

0 1 5 10 15 20 25

Reaction time (min)

(b)

Figure 3 Optimal detection conditions of PCV2 RPA LFD assay (a)The assay works in a broad range of temperatures (b) After 10min ofamplification the test line is visible on the lateral flow dipstick

a clear positivenegative result which can be easily read bythe naked eyes without any training In the developed PCV2real-time RPA assay a real-time PCR machine is availablein our laboratory A simple ESEQuant TS2 device (QiagenGermany) is also available in PCV2 real-time RPA assay [1417]This device is simpler and cheaper than the real-time PCR

machine and it could be used conveniently in field as it couldbe charged by battery Additionally a commercially magneticbead-based DNARNA extraction kit could combine withRPA assay without any instrumentThese features made PRAmore applicable for onsite testing or rapid diagnosis in notwell-equipped laboratories

BioMed Research International 5

NC101

102

103

104

105

106

Control

Test

(a)

Amplification line

NC101

102

103

104

105

106

100 bp

200 bp

(b)

Figure 4 Evaluation of the sensitivity of PCV2 RPA LFD assay (a) In the lateral flow format (PCV2 RPA LFD) the sensitivity was 102 copiesof the standard DNA (b) Positive PCV2 RPA LFD reaction products (146 bp) could be detected on a stained agarose gel (3)

Control

Test

PCV2

NX

PCV2

CQ

PCV1

JL

PRRS

VC

H-1

R

PRV

Fa

PPV

AV30

CSF

C str

ain

FMD

VO

CH

A

NC

(a)

Amplification line

100 bp

200 bp

Mar

ker

PCV2

NX

PCV2

CQ

PCV1

JL

PRRS

VC

H-1

R

PRV

Fa

PPV

AV30

CSF

C str

ain

FMD

VO

CH

A

NC

(b)

Figure 5 (a) Specificity test results of PCV2 RPA LFD assay using total DNA extracted from PCV2 virus and other virus (b) Positive PCV2RPA LFD reaction products (146 bp) could be detected on a stained agarose gel (3)

Different isothermal molecule amplification assays havebeen developed as a rapid simple and cost-effective alterna-tive to PCR-based molecule assay since 1990s which includeloop-mediated isothermal amplification assay (LAMP) [22]helicase-dependent amplification assay [23] rolling cir-cle amplification assay [24] nucleic acid sequence-basedamplification assay [25] transcription-mediated amplifica-tion assay [26] signal-mediated amplification assay [27]self-sustained sequence replication assay [28] ramificationamplification assay [29] and RPA assay [30] Among theseassays RPA has several clear advantages including no initialheating for DNA denaturation the availability of a sim-ple battery-charged ESEQuant TS2 instrument and muchmore easiness in implementing test conditions (37∘C within20min)

In comparison with LAMP assay for detection of PCV2[31ndash34] which requires longer time (60min) and highertemperature (62ndash65∘C) RPA assay takes over less than 20minat 37∘C to complete which makes RPA much simpler andeasier to use The potential defect of PCV2 RPA LFDassay is that it may carryover contamination in the fieldas it needs to open the tube after amplification Thereforeprecautions should be taken such as careful opening andclosing of reaction tubes frequent changing the gloves andseparating the progress of pre- and post-RPA amplificationFurthermore replacement of dTTP with dUTP may helpprevent such carryover contamination as demonstrated inPCR and LAMP assays [35 36] Our results showed that thedeveloped RPA assay could tolerate base mismatch in some

degree as the primes could not completelymatchwith the twoPCV2 strains used in our work based on sequence alignmentand it may detect PCV-2 strains in some degree of variabilityWang et al developed a basic RPA assay for PCV2 detectionrecently [37] The sensitivity and specificity were almost thesame as our research but the results were analyzed usingagarose gel electrophoresis and staining limiting the use ofit in the field

5 Conclusions

In summary the PCV2 real-time RPA assay and PCV2 RPALFD assay described are sensitive and specific for rapiddetecting of PCV2 within less than 20min The developedRPA assay has the advantage of providing a potential diag-nostic tool suitable for routine diagnostic use in a laboratorywithout complex equipment or in the field which wouldgreatly assist in epidemiological investigation of PCV2

Conflicts of Interest

All the authors declare no conflicts of interest

Authorsrsquo Contributions

Yang Yang and Zhidong Zhang conceived and designedthe project Yang Yang performed the study and wrote the

6 BioMed Research International

Table 3 Comparison of PCV2 real-time RPA assay and PCV2 RPA LFD assay with real-time qPCR assay on clinical samples

Clinical sample Real-time RPA RPA LFD Real-time qPCRPositive Negative Positive Negative Positive Negative

Spleen 4 12 4 12 4 12Inguinal lymph node 6 19 6 19 6 19Tonsil 9 17 9 17 9 17Lung 7 12 7 12 7 12Serum 5 11 5 11 5 11Total 31 71 31 71 31 71

Table 4 The performance of innuPREP MP basic kit on PCV2 positive samples (119899 = 31) was tested by real-time RPA assay RPA LFD assayand real-time qPCR assay respectively

Sample name Real-time qPCR (CT) Real-time RPA (min) RPA LFDSpleen 1 25 7 +Spleen 2 27 7 +Spleen 3 29 73 +Spleen 4 30 76 +Inguinal lymph node 1 28 7 +Inguinal lymph node 2 32 83 +Inguinal lymph node 3 31 8 +Inguinal lymph node 4 29 76 +Inguinal lymph node 5 26 63 +Inguinal lymph node 6 26 66 +Tonsil 1 30 8 +Tonsil 2 31 83 +Tonsil 3 25 63 +Tonsil 4 25 66 +Tonsil 5 26 66 +Tonsil 6 27 73 +Tonsil 7 27 76 +Tonsil 8 28 73 +Tonsil 9 24 6 +Lung 1 24 63 +Lung 2 24 66 +Lung 3 29 7 +Lung 4 22 63 +Lung 5 22 66 +Lung 6 30 83 +Lung 7 30 86 +Serum 1 32 9 +Serum 2 32 93 +Serum 3 27 76 +Serum 4 29 76 +Serum 5 25 73 +

manuscript Guozheng Cong and Yingjun Sun participatedin preparation of virus and samples Xiaodong Qin YanminLi and Zhidong Zhang revised the manuscript

Acknowledgments

The research was supported by National Research andDevelopment Program of China (2016YFD0500907) and

Innovation Fund of Chinese Academy of Agricultural Sci-ences (CAAS) China

References

[1] G M Allan and J A Ellis ldquoPorcine circoviruses a reviewrdquoJournal of Veterinary Diagnostic Investigation vol 12 no 1 pp3ndash14 2000

BioMed Research International 7

[2] J Kim and C Chae ldquoMultiplex nested PCR compared with insitu hybridization for the differentiation of porcine circovirusesand porcine parvovirus from pigs with postweaning multi-systemic wasting syndromerdquo Canadian Journal of VeterinaryResearch vol 67 no 2 pp 133ndash137 2003

[3] LWen X Guo andH Yang ldquoGenotyping of porcine circovirustype 2 from a variety of clinical conditions in ChinardquoVeterinaryMicrobiology vol 110 no 1-2 pp 141ndash146 2005

[4] J Segales and M Domingo ldquoPostweaning multisystemic wast-ing syndrome (PMWS) in pigs A reviewrdquoVeterinary Quarterlyvol 24 no 3 pp 110ndash124 2002

[5] A-S Ladekjaeligr-Mikkelsen J Nielsen T Stadejek et al ldquoRepro-duction of postweaning multisystemic wasting syndrome(PMWS) in immunostimulated and non-immunostimulated3-week-old piglets experimentally infected with porcine cir-covirus type 2 (PCV2)rdquoVeterinaryMicrobiology vol 89 no 2-3pp 97ndash114 2002

[6] L J Guo Y H Lu Y W Wei L P Huang and C M LiuldquoPorcine circovirus type 2 (PCV2) genetic variation and newlyemerging genotypes in Chinardquo Virology Journal vol 7 article273 2010

[7] W-B Chung W-H Chan H-C Chaung Y Lien C-C Wuand Y-L Huang ldquoReal-time PCR for quantitation of porcinereproductive and respiratory syndrome virus and porcinecircovirus type 2 in naturally-infected and challenged pigsrdquoJournal of Virological Methods vol 124 no 1-2 pp 11ndash19 2005

[8] A Olvera M Sibila M Calsamiglia J Segales and MDomingo ldquoComparison of porcine circovirus type 2 load inserum quantified by a real time PCR in postweaning multisys-temic wasting syndrome and porcine dermatitis and nephropa-thy syndrome naturally affected pigsrdquo Journal of VirologicalMethods vol 117 no 1 pp 75ndash80 2004

[9] Q Liu L Wang P Willson and L A Babiuk ldquoQuantitativecompetitive PCR analysis of porcine circovirus DNA in serumfrom pigs with postweaning multisystemic wasting syndromerdquoJournal of Clinical Microbiology vol 38 no 9 pp 3474ndash34772000

[10] A L Hamel L L Lin C Sachvie E Grudeski and G PNayar ldquoPCR detection and characterization of type-2 porcinecircovirusrdquoCanadian Journal of Veterinary Research vol 64 no1 pp 44ndash52 2000

[11] C Huang J-J Hung C-Y Wu and M-S Chien ldquoMultiplexPCR for rapid detection of pseudorabies virus porcine par-vovirus and porcine circovirusesrdquo Veterinary Microbiology vol101 no 3 pp 209ndash214 2004

[12] R Larochelle M Antaya M Morin and R Magar ldquoTypingof porcine circovirus in clinical specimens by multiplex PCRrdquoJournal of Virological Methods vol 80 no 1 pp 69ndash75 1999

[13] Y Yang X Qin W Zhang Y Li and Z Zhang ldquoRapidand specific detection of porcine parvovirus by isothermalrecombinase polymerase amplification assaysrdquo Molecular andCellular Probes vol 30 no 5 pp 300ndash305 2016

[14] N Yehia A-S Arafa A Abd El Wahed A A El-SanousiM Weidmann and M A Shalaby ldquoDevelopment of reversetranscription recombinase polymerase amplification assay foravian influenza H5N1 HA gene detectionrdquo Journal of VirologicalMethods vol 223 pp 45ndash49 2015

[15] A Aebischer K Wernike B Hoffmann and M Beer ldquoRapidgenome detection of Schmallenberg virus and bovine viraldiarrhea virus by use of isothermal amplification methods andhigh-speed real-time reverse transcriptase PCRrdquo Journal ofClinical Microbiology vol 52 no 6 pp 1883ndash1892 2014

[16] J Wang L Liu R Li J Wang Q Fu and W Yuan ldquoRapid andsensitive detection of canine parvovirus type 2 by recombinasepolymerase amplificationrdquo Archives of Virology vol 161 no 4pp 1015ndash1018 2016

[17] A Abd El Wahed A El-Deeb M El-Tholoth et al ldquoA portablereverse transcription recombinase polymerase amplificationassay for rapid detection of foot-and-mouth disease virusrdquoPLoSONE vol 8 no 8 Article ID e71642 2013

[18] Y Yang X Qin G Wang Y Zhang Y Shang and Z ZhangldquoDevelopment of a fluorescent probe-based recombinase poly-merase amplification assay for rapid detection of Orf virusVeterinary DNA virusesrdquo Virology Journal vol 12 no 1 article206 2015

[19] Y Yang X Qin G Wang J Jin Y Shang and Z ZhangldquoDevelopment of an isothermoal amplification-based assay forrapid visual detection of an Orf virusrdquo Virology Journal vol 13no 1 article 46 2016

[20] B-C Yang F-X Wang S-Q Zhang et al ldquoComparative eval-uation of conventional polymerase chain reaction (PCR) withloop-mediated isothermal amplification and SYBR green I-based real-time PCR for the quantitation of porcine circovirus-1 DNA in contaminated samples destined for vaccine produc-tionrdquo Journal of Virological Methods vol 191 no 1 pp 1ndash8 2013

[21] L-L Zheng Y-BWangM-F Li et al ldquoSimultaneous detectionof porcine parvovirus and porcine circovirus type 2 by duplexreal-time PCR and ampliconmelting curve analysis using SYBRGreenrdquo Journal of Virological Methods vol 187 no 1 pp 15ndash192013

[22] T Notomi H Okayama H Masubuchi et al ldquoLoop-mediatedisothermal amplification of DNArdquo Nucleic acids research vol28 no 12 p E63 2000

[23] M Vincent Y Xu and H Kong ldquoHelicase-dependent isother-mal DNA amplificationrdquo EMBO Reports vol 5 no 8 pp 795ndash800 2004

[24] A Fire and S-Q Xu ldquoRolling replication of short DNA circlesrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 92 no 10 pp 4641ndash4645 1995

[25] J Compton ldquoNucleic acid sequence-based amplificationrdquoNature vol 350 no 6313 pp 91ndash92 1991

[26] P Gill and A Ghaemi ldquoNucleic acid isothermal amplificationtechnologies a reviewrdquo Nucleosides Nucleotides amp NucleicAcids vol 27 no 3 pp 224ndash243 2008

[27] S D Wharam P Marsh J S Lloyd et al ldquoSpecific detectionof DNA and RNA targets using a novel isothermal nucleicacid amplification assay based on the formation of a three-wayjunction structurerdquoNucleic Acids Research vol 29 no 11 articlee54 2001

[28] J C Guatelli K MWhitfield D Y Kwoh K J Barringer D DRichman andT RGingeras ldquoIsothermal in vitro amplificationof nucleic acids by a multienzyme reaction modeled afterretroviral replicationrdquo Proceedings of the National Academy ofSciences of the United States of America vol 87 no 19 article7797 1990

[29] D Yong Zhang M Brandwein T Chun Hung Hsuih and HLi ldquoAmplification of target-specific ligation-dependent circularproberdquo Gene vol 211 no 2 pp 277ndash285 1998

[30] O Piepenburg C HWilliams D L Stemple and N A ArmesldquoDNA detection using recombination proteinsrdquo PLoS Biologyvol 4 no 7 article e204 2006

[31] S Zhou S Han J Shi et al ldquoLoop-mediated isothermal ampli-fication for detection of porcine circovirus type 2rdquo VirologyJournal vol 8 article 497 2011

8 BioMed Research International

[32] K Zhao W Shi F Han et al ldquoSpecific simple and rapiddetection of porcine circovirus type 2 using the loop-mediatedisothermal amplification methodrdquo Virology Journal vol 8article 126 2011

[33] H-T Chen J Zhang D-H Sun et al ldquoRapid detection ofporcine circovirus type 2 by loop-mediated isothermal ampli-ficationrdquo Journal of Virological Methods vol 149 no 2 pp 264ndash268 2008

[34] C Wang V F E Pang F Lee et al ldquoDevelopment andevaluation of a loop-mediated isothermal amplificationmethodfor rapid detection and differentiation of two genotypes ofporcine circovirus type 2rdquo Journal ofMicrobiology Immunologyand Infection vol 47 no 5 pp 363ndash370 2014

[35] M C Longo M S Berninger and J L Hartley ldquoUse ofuracil DNA glycosylase to control carry-over contamination inpolymerase chain reactionsrdquo Gene vol 93 no 1 pp 125ndash1281990

[36] E-J Kil S Kim Y-J Lee et al ldquoAdvanced loop-mediatedisothermal amplification method for sensitive and specificdetection of Tomato chlorosis virus using a uracil DNAglycosy-lase to control carry-over contaminationrdquo Journal of VirologicalMethods vol 213 pp 68ndash74 2015

[37] J Wang L Liu R Li andW Yuan ldquoRapid detection of Porcinecircovirus 2 by recombinase polymerase amplificationrdquo Journalof VeterinaryDiagnostic Investigation vol 28 no 5 pp 574ndash5782016

Submit your manuscripts athttpswwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 3

25 Recombinase Polymerase Amplification Probe-basedPCV2 real-time RPA assay was performed with TwistAmpexo kit (TwistDx Cambridge United Kingdom) on Agi-lent Technologies Mx3005P thermocycler (Life technologiesUSA) The PCV2 real-time RPA assay was carried out asdescribed below 4x rehydration buffer 120 nM real-timeRPA probe 420 nM real-time RPA primes 2 120583L DNA tem-plate and 14mM magnesium acetate Fluorescence intensityof FAM was measured once every 20 seconds PCV2 RPALFD assay was performed with TwistAmp nfo kit (TwistDxCambridge United Kingdom) combined with lateral flowdipstick (Milenia Biotec GmbH Germany) in a water bath at37∘C After 20min incubation 2 120583L of amplification productwas diluted in 198 120583L of the assay buffer

26 Sensitivity and Specificity of PCV2 Real-Time RPA andRPA LFD Assays A dilution range from 106 to 101 copiesper reaction of the recombinant plasmid pPCV2RPA DNAwas used to evaluate the dynamic range of PCV2 real-timeRPA assay in eight replicates The detection limit of PCV2RPA LFD assay was tested by a dilution series of pPCV2RPADNA and the amplicons were also evaluated by agarose gelelectrophoresis In evaluating specificity of the developedPCV2 real-time RPA assay and RPA LFD assay the reac-tions were evaluated with PCV2NX PCV2CQ PCV1JLPRRSVCH-1R CSFVc-strain PRVFa PPVAV30 andFMDVOCHA in three replicates

3 Results

31 Sensitivity and Specificity of PCV2 Real-Time RPA AssayAfter running the PCV2 real-time RPA assay with differ-ent primer and probe combinations PCV2 RPA F3PCV2RPA R1 combines with PCV2 RPA Pe which were used asthey yielded the highest amplification efficiency (Table 1Figure 1) The PCV2 real-time RPA assay was sufficientlysensitive for detecting 102 copies per reaction within 20minat 37∘C (Figures 2(a) and 2(b)) The limit of PCV2 real-time RPA assay detection in 95 was 102 copies perreaction of pPCV2RPA (Figure 2(c)) In evaluating thespecificity of PCV2 real-time RPA assay no cross-reactionswere observedwith PCV1JL PRRSVCH-1R CSFVc-strainPRVFa PPVAV30 and FMDVOCHA and positive signalwas only observed with PCV2NX and PCV2CQ strain(Table 2)

32 Sensitivity and Specificity of PCV2 RPA LFD AssayThe sensitivity results showed that the detection limit ofPCV2 RPA LFD assay was 102 copies per reaction of therecombinant plasmid pPCV2RPA DNA (Figure 4(a)) andthe amplicon in the PCV2 RPA LFD assay (146 bp) wasalso tested by subsequent visualization with 3 agarose gelelectrophoresis (Figure 4(b)) In evaluating the specificityof PCV2 RPA LFD assay no cross-reactions were observedwith other important viruses of pigs as described above(Figure 5(a)) which were also confirmed by the agarose gelelectrophoresis (Figure 5(b))

Fe1Re2

Fe3Re1 Fe3Re3 Fe2Re3

Fe3Re2

Fe2Re1

Fe1Re3

Fe2Re2

Fe1Re1 NC

5 7 9 11 13 15 17 193Time (min)

minus2500

7500

17500

27500

37500

47500

Fluo

resc

ence

(dR)

Figure 1 Optimal primers and probe combinations of PCV2real-time RPA assay The amplification results of nine differentcombinations of primers with the probe PCV2 RPA Pe are shown

33 Performance of PCV2 Real-Time RPA Assay and PCV2RPA LFD Assay on Clinical Samples The practicality ofboth PCV2 real-time RPA assay and PCV2 RPA LFD assaywas evaluated with clinical tissue samples (119899 = 102) Theresults were then comparedwith PCV2 real-time qPCR assayAmong these clinical samples 31 samples were tested aspositive by PCV2 real-time qPCR assay (CT value rangingfrom 19 to 30) All of these 31 samples were determined to bepositive by both PCV2 real-time RPA assay (threshold timeranging from 56 to 93) and PCV2 RPA LFD assay Based ontotal samples examined the sensitivity and the specificity ofboth PCV2 real-time RPA assay and PCV2 RPA LFD assayfor identification of PCV2 were 100 and 100 respectivelywhen compared to PCV2 real-time qPCR (Table 3) ThePCV2 real-time RPA assay and PCV2 RPA LFD assay werealso evaluated with PCV1 positive samples (119899 = 10) and theresults showed that all the samples were PCV2 negative Theextraction effects of innuPREP MP basic kit were tested withthese PCV2 positive tissue samples and results showed thiskit performed well (Table 4) This DNARNA extraction kitcombining with RPA assay could be used in the field or innot well-equipped laboratories

4 Discussion

In this study RPA assays were developed for rapid andspecific detection of PCV2 The most optimal detectionconditions of PCV2 RPA LFD assay were explored withdifferent reaction temperature and time The results showedthat it amplified well from 30∘C to 45∘C The amplificationproducts could be detected when the reaction time was morethan 10min (Figures 3(a) and 3(b)) Therefore the PCV2RPA LFD assay performed in a simple water bath at 37∘Cfor 20min arbitrarily A visible band on the LFD strip gives

4 BioMed Research International

NC0

10000

20000

30000

40000Fl

uore

scen

ce (d

R)

5 7 9 11 133Time (min)

101

102

10310

410510

6

(a)

7

R2= 09075

Y = minus0796X + 1201

0

3

6

9

12

0 1 2 3 4 5 6

Tim

e (m

in)

log10

(copy number of standard)(b)

101

102

103

104

105

106

107

100

Lim

it of

det

ectio

n (

)

0

20

40

60

80

100

Molecules detected(c)

Figure 2The sensitivity of PCV2 real-time RPA assay (a) Fluorescence performance via real-time test using a dilution range of pPCV2RPA(b) Reproducibility of the PCV2 real-time RPA assay according to eight test runs (c) Probit regression analysis was done on data from theeight runs of PCV2 real-time RPA assay

15 20 25 30 35 37 40 45 50

Control

Test

Reaction temperature (∘C)

(a)

Control

Test

0 1 5 10 15 20 25

Reaction time (min)

(b)

Figure 3 Optimal detection conditions of PCV2 RPA LFD assay (a)The assay works in a broad range of temperatures (b) After 10min ofamplification the test line is visible on the lateral flow dipstick

a clear positivenegative result which can be easily read bythe naked eyes without any training In the developed PCV2real-time RPA assay a real-time PCR machine is availablein our laboratory A simple ESEQuant TS2 device (QiagenGermany) is also available in PCV2 real-time RPA assay [1417]This device is simpler and cheaper than the real-time PCR

machine and it could be used conveniently in field as it couldbe charged by battery Additionally a commercially magneticbead-based DNARNA extraction kit could combine withRPA assay without any instrumentThese features made PRAmore applicable for onsite testing or rapid diagnosis in notwell-equipped laboratories

BioMed Research International 5

NC101

102

103

104

105

106

Control

Test

(a)

Amplification line

NC101

102

103

104

105

106

100 bp

200 bp

(b)

Figure 4 Evaluation of the sensitivity of PCV2 RPA LFD assay (a) In the lateral flow format (PCV2 RPA LFD) the sensitivity was 102 copiesof the standard DNA (b) Positive PCV2 RPA LFD reaction products (146 bp) could be detected on a stained agarose gel (3)

Control

Test

PCV2

NX

PCV2

CQ

PCV1

JL

PRRS

VC

H-1

R

PRV

Fa

PPV

AV30

CSF

C str

ain

FMD

VO

CH

A

NC

(a)

Amplification line

100 bp

200 bp

Mar

ker

PCV2

NX

PCV2

CQ

PCV1

JL

PRRS

VC

H-1

R

PRV

Fa

PPV

AV30

CSF

C str

ain

FMD

VO

CH

A

NC

(b)

Figure 5 (a) Specificity test results of PCV2 RPA LFD assay using total DNA extracted from PCV2 virus and other virus (b) Positive PCV2RPA LFD reaction products (146 bp) could be detected on a stained agarose gel (3)

Different isothermal molecule amplification assays havebeen developed as a rapid simple and cost-effective alterna-tive to PCR-based molecule assay since 1990s which includeloop-mediated isothermal amplification assay (LAMP) [22]helicase-dependent amplification assay [23] rolling cir-cle amplification assay [24] nucleic acid sequence-basedamplification assay [25] transcription-mediated amplifica-tion assay [26] signal-mediated amplification assay [27]self-sustained sequence replication assay [28] ramificationamplification assay [29] and RPA assay [30] Among theseassays RPA has several clear advantages including no initialheating for DNA denaturation the availability of a sim-ple battery-charged ESEQuant TS2 instrument and muchmore easiness in implementing test conditions (37∘C within20min)

In comparison with LAMP assay for detection of PCV2[31ndash34] which requires longer time (60min) and highertemperature (62ndash65∘C) RPA assay takes over less than 20minat 37∘C to complete which makes RPA much simpler andeasier to use The potential defect of PCV2 RPA LFDassay is that it may carryover contamination in the fieldas it needs to open the tube after amplification Thereforeprecautions should be taken such as careful opening andclosing of reaction tubes frequent changing the gloves andseparating the progress of pre- and post-RPA amplificationFurthermore replacement of dTTP with dUTP may helpprevent such carryover contamination as demonstrated inPCR and LAMP assays [35 36] Our results showed that thedeveloped RPA assay could tolerate base mismatch in some

degree as the primes could not completelymatchwith the twoPCV2 strains used in our work based on sequence alignmentand it may detect PCV-2 strains in some degree of variabilityWang et al developed a basic RPA assay for PCV2 detectionrecently [37] The sensitivity and specificity were almost thesame as our research but the results were analyzed usingagarose gel electrophoresis and staining limiting the use ofit in the field

5 Conclusions

In summary the PCV2 real-time RPA assay and PCV2 RPALFD assay described are sensitive and specific for rapiddetecting of PCV2 within less than 20min The developedRPA assay has the advantage of providing a potential diag-nostic tool suitable for routine diagnostic use in a laboratorywithout complex equipment or in the field which wouldgreatly assist in epidemiological investigation of PCV2

Conflicts of Interest

All the authors declare no conflicts of interest

Authorsrsquo Contributions

Yang Yang and Zhidong Zhang conceived and designedthe project Yang Yang performed the study and wrote the

6 BioMed Research International

Table 3 Comparison of PCV2 real-time RPA assay and PCV2 RPA LFD assay with real-time qPCR assay on clinical samples

Clinical sample Real-time RPA RPA LFD Real-time qPCRPositive Negative Positive Negative Positive Negative

Spleen 4 12 4 12 4 12Inguinal lymph node 6 19 6 19 6 19Tonsil 9 17 9 17 9 17Lung 7 12 7 12 7 12Serum 5 11 5 11 5 11Total 31 71 31 71 31 71

Table 4 The performance of innuPREP MP basic kit on PCV2 positive samples (119899 = 31) was tested by real-time RPA assay RPA LFD assayand real-time qPCR assay respectively

Sample name Real-time qPCR (CT) Real-time RPA (min) RPA LFDSpleen 1 25 7 +Spleen 2 27 7 +Spleen 3 29 73 +Spleen 4 30 76 +Inguinal lymph node 1 28 7 +Inguinal lymph node 2 32 83 +Inguinal lymph node 3 31 8 +Inguinal lymph node 4 29 76 +Inguinal lymph node 5 26 63 +Inguinal lymph node 6 26 66 +Tonsil 1 30 8 +Tonsil 2 31 83 +Tonsil 3 25 63 +Tonsil 4 25 66 +Tonsil 5 26 66 +Tonsil 6 27 73 +Tonsil 7 27 76 +Tonsil 8 28 73 +Tonsil 9 24 6 +Lung 1 24 63 +Lung 2 24 66 +Lung 3 29 7 +Lung 4 22 63 +Lung 5 22 66 +Lung 6 30 83 +Lung 7 30 86 +Serum 1 32 9 +Serum 2 32 93 +Serum 3 27 76 +Serum 4 29 76 +Serum 5 25 73 +

manuscript Guozheng Cong and Yingjun Sun participatedin preparation of virus and samples Xiaodong Qin YanminLi and Zhidong Zhang revised the manuscript

Acknowledgments

The research was supported by National Research andDevelopment Program of China (2016YFD0500907) and

Innovation Fund of Chinese Academy of Agricultural Sci-ences (CAAS) China

References

[1] G M Allan and J A Ellis ldquoPorcine circoviruses a reviewrdquoJournal of Veterinary Diagnostic Investigation vol 12 no 1 pp3ndash14 2000

BioMed Research International 7

[2] J Kim and C Chae ldquoMultiplex nested PCR compared with insitu hybridization for the differentiation of porcine circovirusesand porcine parvovirus from pigs with postweaning multi-systemic wasting syndromerdquo Canadian Journal of VeterinaryResearch vol 67 no 2 pp 133ndash137 2003

[3] LWen X Guo andH Yang ldquoGenotyping of porcine circovirustype 2 from a variety of clinical conditions in ChinardquoVeterinaryMicrobiology vol 110 no 1-2 pp 141ndash146 2005

[4] J Segales and M Domingo ldquoPostweaning multisystemic wast-ing syndrome (PMWS) in pigs A reviewrdquoVeterinary Quarterlyvol 24 no 3 pp 110ndash124 2002

[5] A-S Ladekjaeligr-Mikkelsen J Nielsen T Stadejek et al ldquoRepro-duction of postweaning multisystemic wasting syndrome(PMWS) in immunostimulated and non-immunostimulated3-week-old piglets experimentally infected with porcine cir-covirus type 2 (PCV2)rdquoVeterinaryMicrobiology vol 89 no 2-3pp 97ndash114 2002

[6] L J Guo Y H Lu Y W Wei L P Huang and C M LiuldquoPorcine circovirus type 2 (PCV2) genetic variation and newlyemerging genotypes in Chinardquo Virology Journal vol 7 article273 2010

[7] W-B Chung W-H Chan H-C Chaung Y Lien C-C Wuand Y-L Huang ldquoReal-time PCR for quantitation of porcinereproductive and respiratory syndrome virus and porcinecircovirus type 2 in naturally-infected and challenged pigsrdquoJournal of Virological Methods vol 124 no 1-2 pp 11ndash19 2005

[8] A Olvera M Sibila M Calsamiglia J Segales and MDomingo ldquoComparison of porcine circovirus type 2 load inserum quantified by a real time PCR in postweaning multisys-temic wasting syndrome and porcine dermatitis and nephropa-thy syndrome naturally affected pigsrdquo Journal of VirologicalMethods vol 117 no 1 pp 75ndash80 2004

[9] Q Liu L Wang P Willson and L A Babiuk ldquoQuantitativecompetitive PCR analysis of porcine circovirus DNA in serumfrom pigs with postweaning multisystemic wasting syndromerdquoJournal of Clinical Microbiology vol 38 no 9 pp 3474ndash34772000

[10] A L Hamel L L Lin C Sachvie E Grudeski and G PNayar ldquoPCR detection and characterization of type-2 porcinecircovirusrdquoCanadian Journal of Veterinary Research vol 64 no1 pp 44ndash52 2000

[11] C Huang J-J Hung C-Y Wu and M-S Chien ldquoMultiplexPCR for rapid detection of pseudorabies virus porcine par-vovirus and porcine circovirusesrdquo Veterinary Microbiology vol101 no 3 pp 209ndash214 2004

[12] R Larochelle M Antaya M Morin and R Magar ldquoTypingof porcine circovirus in clinical specimens by multiplex PCRrdquoJournal of Virological Methods vol 80 no 1 pp 69ndash75 1999

[13] Y Yang X Qin W Zhang Y Li and Z Zhang ldquoRapidand specific detection of porcine parvovirus by isothermalrecombinase polymerase amplification assaysrdquo Molecular andCellular Probes vol 30 no 5 pp 300ndash305 2016

[14] N Yehia A-S Arafa A Abd El Wahed A A El-SanousiM Weidmann and M A Shalaby ldquoDevelopment of reversetranscription recombinase polymerase amplification assay foravian influenza H5N1 HA gene detectionrdquo Journal of VirologicalMethods vol 223 pp 45ndash49 2015

[15] A Aebischer K Wernike B Hoffmann and M Beer ldquoRapidgenome detection of Schmallenberg virus and bovine viraldiarrhea virus by use of isothermal amplification methods andhigh-speed real-time reverse transcriptase PCRrdquo Journal ofClinical Microbiology vol 52 no 6 pp 1883ndash1892 2014

[16] J Wang L Liu R Li J Wang Q Fu and W Yuan ldquoRapid andsensitive detection of canine parvovirus type 2 by recombinasepolymerase amplificationrdquo Archives of Virology vol 161 no 4pp 1015ndash1018 2016

[17] A Abd El Wahed A El-Deeb M El-Tholoth et al ldquoA portablereverse transcription recombinase polymerase amplificationassay for rapid detection of foot-and-mouth disease virusrdquoPLoSONE vol 8 no 8 Article ID e71642 2013

[18] Y Yang X Qin G Wang Y Zhang Y Shang and Z ZhangldquoDevelopment of a fluorescent probe-based recombinase poly-merase amplification assay for rapid detection of Orf virusVeterinary DNA virusesrdquo Virology Journal vol 12 no 1 article206 2015

[19] Y Yang X Qin G Wang J Jin Y Shang and Z ZhangldquoDevelopment of an isothermoal amplification-based assay forrapid visual detection of an Orf virusrdquo Virology Journal vol 13no 1 article 46 2016

[20] B-C Yang F-X Wang S-Q Zhang et al ldquoComparative eval-uation of conventional polymerase chain reaction (PCR) withloop-mediated isothermal amplification and SYBR green I-based real-time PCR for the quantitation of porcine circovirus-1 DNA in contaminated samples destined for vaccine produc-tionrdquo Journal of Virological Methods vol 191 no 1 pp 1ndash8 2013

[21] L-L Zheng Y-BWangM-F Li et al ldquoSimultaneous detectionof porcine parvovirus and porcine circovirus type 2 by duplexreal-time PCR and ampliconmelting curve analysis using SYBRGreenrdquo Journal of Virological Methods vol 187 no 1 pp 15ndash192013

[22] T Notomi H Okayama H Masubuchi et al ldquoLoop-mediatedisothermal amplification of DNArdquo Nucleic acids research vol28 no 12 p E63 2000

[23] M Vincent Y Xu and H Kong ldquoHelicase-dependent isother-mal DNA amplificationrdquo EMBO Reports vol 5 no 8 pp 795ndash800 2004

[24] A Fire and S-Q Xu ldquoRolling replication of short DNA circlesrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 92 no 10 pp 4641ndash4645 1995

[25] J Compton ldquoNucleic acid sequence-based amplificationrdquoNature vol 350 no 6313 pp 91ndash92 1991

[26] P Gill and A Ghaemi ldquoNucleic acid isothermal amplificationtechnologies a reviewrdquo Nucleosides Nucleotides amp NucleicAcids vol 27 no 3 pp 224ndash243 2008

[27] S D Wharam P Marsh J S Lloyd et al ldquoSpecific detectionof DNA and RNA targets using a novel isothermal nucleicacid amplification assay based on the formation of a three-wayjunction structurerdquoNucleic Acids Research vol 29 no 11 articlee54 2001

[28] J C Guatelli K MWhitfield D Y Kwoh K J Barringer D DRichman andT RGingeras ldquoIsothermal in vitro amplificationof nucleic acids by a multienzyme reaction modeled afterretroviral replicationrdquo Proceedings of the National Academy ofSciences of the United States of America vol 87 no 19 article7797 1990

[29] D Yong Zhang M Brandwein T Chun Hung Hsuih and HLi ldquoAmplification of target-specific ligation-dependent circularproberdquo Gene vol 211 no 2 pp 277ndash285 1998

[30] O Piepenburg C HWilliams D L Stemple and N A ArmesldquoDNA detection using recombination proteinsrdquo PLoS Biologyvol 4 no 7 article e204 2006

[31] S Zhou S Han J Shi et al ldquoLoop-mediated isothermal ampli-fication for detection of porcine circovirus type 2rdquo VirologyJournal vol 8 article 497 2011

8 BioMed Research International

[32] K Zhao W Shi F Han et al ldquoSpecific simple and rapiddetection of porcine circovirus type 2 using the loop-mediatedisothermal amplification methodrdquo Virology Journal vol 8article 126 2011

[33] H-T Chen J Zhang D-H Sun et al ldquoRapid detection ofporcine circovirus type 2 by loop-mediated isothermal ampli-ficationrdquo Journal of Virological Methods vol 149 no 2 pp 264ndash268 2008

[34] C Wang V F E Pang F Lee et al ldquoDevelopment andevaluation of a loop-mediated isothermal amplificationmethodfor rapid detection and differentiation of two genotypes ofporcine circovirus type 2rdquo Journal ofMicrobiology Immunologyand Infection vol 47 no 5 pp 363ndash370 2014

[35] M C Longo M S Berninger and J L Hartley ldquoUse ofuracil DNA glycosylase to control carry-over contamination inpolymerase chain reactionsrdquo Gene vol 93 no 1 pp 125ndash1281990

[36] E-J Kil S Kim Y-J Lee et al ldquoAdvanced loop-mediatedisothermal amplification method for sensitive and specificdetection of Tomato chlorosis virus using a uracil DNAglycosy-lase to control carry-over contaminationrdquo Journal of VirologicalMethods vol 213 pp 68ndash74 2015

[37] J Wang L Liu R Li andW Yuan ldquoRapid detection of Porcinecircovirus 2 by recombinase polymerase amplificationrdquo Journalof VeterinaryDiagnostic Investigation vol 28 no 5 pp 574ndash5782016

Submit your manuscripts athttpswwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

4 BioMed Research International

NC0

10000

20000

30000

40000Fl

uore

scen

ce (d

R)

5 7 9 11 133Time (min)

101

102

10310

410510

6

(a)

7

R2= 09075

Y = minus0796X + 1201

0

3

6

9

12

0 1 2 3 4 5 6

Tim

e (m

in)

log10

(copy number of standard)(b)

101

102

103

104

105

106

107

100

Lim

it of

det

ectio

n (

)

0

20

40

60

80

100

Molecules detected(c)

Figure 2The sensitivity of PCV2 real-time RPA assay (a) Fluorescence performance via real-time test using a dilution range of pPCV2RPA(b) Reproducibility of the PCV2 real-time RPA assay according to eight test runs (c) Probit regression analysis was done on data from theeight runs of PCV2 real-time RPA assay

15 20 25 30 35 37 40 45 50

Control

Test

Reaction temperature (∘C)

(a)

Control

Test

0 1 5 10 15 20 25

Reaction time (min)

(b)

Figure 3 Optimal detection conditions of PCV2 RPA LFD assay (a)The assay works in a broad range of temperatures (b) After 10min ofamplification the test line is visible on the lateral flow dipstick

a clear positivenegative result which can be easily read bythe naked eyes without any training In the developed PCV2real-time RPA assay a real-time PCR machine is availablein our laboratory A simple ESEQuant TS2 device (QiagenGermany) is also available in PCV2 real-time RPA assay [1417]This device is simpler and cheaper than the real-time PCR

machine and it could be used conveniently in field as it couldbe charged by battery Additionally a commercially magneticbead-based DNARNA extraction kit could combine withRPA assay without any instrumentThese features made PRAmore applicable for onsite testing or rapid diagnosis in notwell-equipped laboratories

BioMed Research International 5

NC101

102

103

104

105

106

Control

Test

(a)

Amplification line

NC101

102

103

104

105

106

100 bp

200 bp

(b)

Figure 4 Evaluation of the sensitivity of PCV2 RPA LFD assay (a) In the lateral flow format (PCV2 RPA LFD) the sensitivity was 102 copiesof the standard DNA (b) Positive PCV2 RPA LFD reaction products (146 bp) could be detected on a stained agarose gel (3)

Control

Test

PCV2

NX

PCV2

CQ

PCV1

JL

PRRS

VC

H-1

R

PRV

Fa

PPV

AV30

CSF

C str

ain

FMD

VO

CH

A

NC

(a)

Amplification line

100 bp

200 bp

Mar

ker

PCV2

NX

PCV2

CQ

PCV1

JL

PRRS

VC

H-1

R

PRV

Fa

PPV

AV30

CSF

C str

ain

FMD

VO

CH

A

NC

(b)

Figure 5 (a) Specificity test results of PCV2 RPA LFD assay using total DNA extracted from PCV2 virus and other virus (b) Positive PCV2RPA LFD reaction products (146 bp) could be detected on a stained agarose gel (3)

Different isothermal molecule amplification assays havebeen developed as a rapid simple and cost-effective alterna-tive to PCR-based molecule assay since 1990s which includeloop-mediated isothermal amplification assay (LAMP) [22]helicase-dependent amplification assay [23] rolling cir-cle amplification assay [24] nucleic acid sequence-basedamplification assay [25] transcription-mediated amplifica-tion assay [26] signal-mediated amplification assay [27]self-sustained sequence replication assay [28] ramificationamplification assay [29] and RPA assay [30] Among theseassays RPA has several clear advantages including no initialheating for DNA denaturation the availability of a sim-ple battery-charged ESEQuant TS2 instrument and muchmore easiness in implementing test conditions (37∘C within20min)

In comparison with LAMP assay for detection of PCV2[31ndash34] which requires longer time (60min) and highertemperature (62ndash65∘C) RPA assay takes over less than 20minat 37∘C to complete which makes RPA much simpler andeasier to use The potential defect of PCV2 RPA LFDassay is that it may carryover contamination in the fieldas it needs to open the tube after amplification Thereforeprecautions should be taken such as careful opening andclosing of reaction tubes frequent changing the gloves andseparating the progress of pre- and post-RPA amplificationFurthermore replacement of dTTP with dUTP may helpprevent such carryover contamination as demonstrated inPCR and LAMP assays [35 36] Our results showed that thedeveloped RPA assay could tolerate base mismatch in some

degree as the primes could not completelymatchwith the twoPCV2 strains used in our work based on sequence alignmentand it may detect PCV-2 strains in some degree of variabilityWang et al developed a basic RPA assay for PCV2 detectionrecently [37] The sensitivity and specificity were almost thesame as our research but the results were analyzed usingagarose gel electrophoresis and staining limiting the use ofit in the field

5 Conclusions

In summary the PCV2 real-time RPA assay and PCV2 RPALFD assay described are sensitive and specific for rapiddetecting of PCV2 within less than 20min The developedRPA assay has the advantage of providing a potential diag-nostic tool suitable for routine diagnostic use in a laboratorywithout complex equipment or in the field which wouldgreatly assist in epidemiological investigation of PCV2

Conflicts of Interest

All the authors declare no conflicts of interest

Authorsrsquo Contributions

Yang Yang and Zhidong Zhang conceived and designedthe project Yang Yang performed the study and wrote the

6 BioMed Research International

Table 3 Comparison of PCV2 real-time RPA assay and PCV2 RPA LFD assay with real-time qPCR assay on clinical samples

Clinical sample Real-time RPA RPA LFD Real-time qPCRPositive Negative Positive Negative Positive Negative

Spleen 4 12 4 12 4 12Inguinal lymph node 6 19 6 19 6 19Tonsil 9 17 9 17 9 17Lung 7 12 7 12 7 12Serum 5 11 5 11 5 11Total 31 71 31 71 31 71

Table 4 The performance of innuPREP MP basic kit on PCV2 positive samples (119899 = 31) was tested by real-time RPA assay RPA LFD assayand real-time qPCR assay respectively

Sample name Real-time qPCR (CT) Real-time RPA (min) RPA LFDSpleen 1 25 7 +Spleen 2 27 7 +Spleen 3 29 73 +Spleen 4 30 76 +Inguinal lymph node 1 28 7 +Inguinal lymph node 2 32 83 +Inguinal lymph node 3 31 8 +Inguinal lymph node 4 29 76 +Inguinal lymph node 5 26 63 +Inguinal lymph node 6 26 66 +Tonsil 1 30 8 +Tonsil 2 31 83 +Tonsil 3 25 63 +Tonsil 4 25 66 +Tonsil 5 26 66 +Tonsil 6 27 73 +Tonsil 7 27 76 +Tonsil 8 28 73 +Tonsil 9 24 6 +Lung 1 24 63 +Lung 2 24 66 +Lung 3 29 7 +Lung 4 22 63 +Lung 5 22 66 +Lung 6 30 83 +Lung 7 30 86 +Serum 1 32 9 +Serum 2 32 93 +Serum 3 27 76 +Serum 4 29 76 +Serum 5 25 73 +

manuscript Guozheng Cong and Yingjun Sun participatedin preparation of virus and samples Xiaodong Qin YanminLi and Zhidong Zhang revised the manuscript

Acknowledgments

The research was supported by National Research andDevelopment Program of China (2016YFD0500907) and

Innovation Fund of Chinese Academy of Agricultural Sci-ences (CAAS) China

References

[1] G M Allan and J A Ellis ldquoPorcine circoviruses a reviewrdquoJournal of Veterinary Diagnostic Investigation vol 12 no 1 pp3ndash14 2000

BioMed Research International 7

[2] J Kim and C Chae ldquoMultiplex nested PCR compared with insitu hybridization for the differentiation of porcine circovirusesand porcine parvovirus from pigs with postweaning multi-systemic wasting syndromerdquo Canadian Journal of VeterinaryResearch vol 67 no 2 pp 133ndash137 2003

[3] LWen X Guo andH Yang ldquoGenotyping of porcine circovirustype 2 from a variety of clinical conditions in ChinardquoVeterinaryMicrobiology vol 110 no 1-2 pp 141ndash146 2005

[4] J Segales and M Domingo ldquoPostweaning multisystemic wast-ing syndrome (PMWS) in pigs A reviewrdquoVeterinary Quarterlyvol 24 no 3 pp 110ndash124 2002

[5] A-S Ladekjaeligr-Mikkelsen J Nielsen T Stadejek et al ldquoRepro-duction of postweaning multisystemic wasting syndrome(PMWS) in immunostimulated and non-immunostimulated3-week-old piglets experimentally infected with porcine cir-covirus type 2 (PCV2)rdquoVeterinaryMicrobiology vol 89 no 2-3pp 97ndash114 2002

[6] L J Guo Y H Lu Y W Wei L P Huang and C M LiuldquoPorcine circovirus type 2 (PCV2) genetic variation and newlyemerging genotypes in Chinardquo Virology Journal vol 7 article273 2010

[7] W-B Chung W-H Chan H-C Chaung Y Lien C-C Wuand Y-L Huang ldquoReal-time PCR for quantitation of porcinereproductive and respiratory syndrome virus and porcinecircovirus type 2 in naturally-infected and challenged pigsrdquoJournal of Virological Methods vol 124 no 1-2 pp 11ndash19 2005

[8] A Olvera M Sibila M Calsamiglia J Segales and MDomingo ldquoComparison of porcine circovirus type 2 load inserum quantified by a real time PCR in postweaning multisys-temic wasting syndrome and porcine dermatitis and nephropa-thy syndrome naturally affected pigsrdquo Journal of VirologicalMethods vol 117 no 1 pp 75ndash80 2004

[9] Q Liu L Wang P Willson and L A Babiuk ldquoQuantitativecompetitive PCR analysis of porcine circovirus DNA in serumfrom pigs with postweaning multisystemic wasting syndromerdquoJournal of Clinical Microbiology vol 38 no 9 pp 3474ndash34772000

[10] A L Hamel L L Lin C Sachvie E Grudeski and G PNayar ldquoPCR detection and characterization of type-2 porcinecircovirusrdquoCanadian Journal of Veterinary Research vol 64 no1 pp 44ndash52 2000

[11] C Huang J-J Hung C-Y Wu and M-S Chien ldquoMultiplexPCR for rapid detection of pseudorabies virus porcine par-vovirus and porcine circovirusesrdquo Veterinary Microbiology vol101 no 3 pp 209ndash214 2004

[12] R Larochelle M Antaya M Morin and R Magar ldquoTypingof porcine circovirus in clinical specimens by multiplex PCRrdquoJournal of Virological Methods vol 80 no 1 pp 69ndash75 1999

[13] Y Yang X Qin W Zhang Y Li and Z Zhang ldquoRapidand specific detection of porcine parvovirus by isothermalrecombinase polymerase amplification assaysrdquo Molecular andCellular Probes vol 30 no 5 pp 300ndash305 2016

[14] N Yehia A-S Arafa A Abd El Wahed A A El-SanousiM Weidmann and M A Shalaby ldquoDevelopment of reversetranscription recombinase polymerase amplification assay foravian influenza H5N1 HA gene detectionrdquo Journal of VirologicalMethods vol 223 pp 45ndash49 2015

[15] A Aebischer K Wernike B Hoffmann and M Beer ldquoRapidgenome detection of Schmallenberg virus and bovine viraldiarrhea virus by use of isothermal amplification methods andhigh-speed real-time reverse transcriptase PCRrdquo Journal ofClinical Microbiology vol 52 no 6 pp 1883ndash1892 2014

[16] J Wang L Liu R Li J Wang Q Fu and W Yuan ldquoRapid andsensitive detection of canine parvovirus type 2 by recombinasepolymerase amplificationrdquo Archives of Virology vol 161 no 4pp 1015ndash1018 2016

[17] A Abd El Wahed A El-Deeb M El-Tholoth et al ldquoA portablereverse transcription recombinase polymerase amplificationassay for rapid detection of foot-and-mouth disease virusrdquoPLoSONE vol 8 no 8 Article ID e71642 2013

[18] Y Yang X Qin G Wang Y Zhang Y Shang and Z ZhangldquoDevelopment of a fluorescent probe-based recombinase poly-merase amplification assay for rapid detection of Orf virusVeterinary DNA virusesrdquo Virology Journal vol 12 no 1 article206 2015

[19] Y Yang X Qin G Wang J Jin Y Shang and Z ZhangldquoDevelopment of an isothermoal amplification-based assay forrapid visual detection of an Orf virusrdquo Virology Journal vol 13no 1 article 46 2016

[20] B-C Yang F-X Wang S-Q Zhang et al ldquoComparative eval-uation of conventional polymerase chain reaction (PCR) withloop-mediated isothermal amplification and SYBR green I-based real-time PCR for the quantitation of porcine circovirus-1 DNA in contaminated samples destined for vaccine produc-tionrdquo Journal of Virological Methods vol 191 no 1 pp 1ndash8 2013

[21] L-L Zheng Y-BWangM-F Li et al ldquoSimultaneous detectionof porcine parvovirus and porcine circovirus type 2 by duplexreal-time PCR and ampliconmelting curve analysis using SYBRGreenrdquo Journal of Virological Methods vol 187 no 1 pp 15ndash192013

[22] T Notomi H Okayama H Masubuchi et al ldquoLoop-mediatedisothermal amplification of DNArdquo Nucleic acids research vol28 no 12 p E63 2000

[23] M Vincent Y Xu and H Kong ldquoHelicase-dependent isother-mal DNA amplificationrdquo EMBO Reports vol 5 no 8 pp 795ndash800 2004

[24] A Fire and S-Q Xu ldquoRolling replication of short DNA circlesrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 92 no 10 pp 4641ndash4645 1995

[25] J Compton ldquoNucleic acid sequence-based amplificationrdquoNature vol 350 no 6313 pp 91ndash92 1991

[26] P Gill and A Ghaemi ldquoNucleic acid isothermal amplificationtechnologies a reviewrdquo Nucleosides Nucleotides amp NucleicAcids vol 27 no 3 pp 224ndash243 2008

[27] S D Wharam P Marsh J S Lloyd et al ldquoSpecific detectionof DNA and RNA targets using a novel isothermal nucleicacid amplification assay based on the formation of a three-wayjunction structurerdquoNucleic Acids Research vol 29 no 11 articlee54 2001

[28] J C Guatelli K MWhitfield D Y Kwoh K J Barringer D DRichman andT RGingeras ldquoIsothermal in vitro amplificationof nucleic acids by a multienzyme reaction modeled afterretroviral replicationrdquo Proceedings of the National Academy ofSciences of the United States of America vol 87 no 19 article7797 1990

[29] D Yong Zhang M Brandwein T Chun Hung Hsuih and HLi ldquoAmplification of target-specific ligation-dependent circularproberdquo Gene vol 211 no 2 pp 277ndash285 1998

[30] O Piepenburg C HWilliams D L Stemple and N A ArmesldquoDNA detection using recombination proteinsrdquo PLoS Biologyvol 4 no 7 article e204 2006

[31] S Zhou S Han J Shi et al ldquoLoop-mediated isothermal ampli-fication for detection of porcine circovirus type 2rdquo VirologyJournal vol 8 article 497 2011

8 BioMed Research International

[32] K Zhao W Shi F Han et al ldquoSpecific simple and rapiddetection of porcine circovirus type 2 using the loop-mediatedisothermal amplification methodrdquo Virology Journal vol 8article 126 2011

[33] H-T Chen J Zhang D-H Sun et al ldquoRapid detection ofporcine circovirus type 2 by loop-mediated isothermal ampli-ficationrdquo Journal of Virological Methods vol 149 no 2 pp 264ndash268 2008

[34] C Wang V F E Pang F Lee et al ldquoDevelopment andevaluation of a loop-mediated isothermal amplificationmethodfor rapid detection and differentiation of two genotypes ofporcine circovirus type 2rdquo Journal ofMicrobiology Immunologyand Infection vol 47 no 5 pp 363ndash370 2014

[35] M C Longo M S Berninger and J L Hartley ldquoUse ofuracil DNA glycosylase to control carry-over contamination inpolymerase chain reactionsrdquo Gene vol 93 no 1 pp 125ndash1281990

[36] E-J Kil S Kim Y-J Lee et al ldquoAdvanced loop-mediatedisothermal amplification method for sensitive and specificdetection of Tomato chlorosis virus using a uracil DNAglycosy-lase to control carry-over contaminationrdquo Journal of VirologicalMethods vol 213 pp 68ndash74 2015

[37] J Wang L Liu R Li andW Yuan ldquoRapid detection of Porcinecircovirus 2 by recombinase polymerase amplificationrdquo Journalof VeterinaryDiagnostic Investigation vol 28 no 5 pp 574ndash5782016

Submit your manuscripts athttpswwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 5

NC101

102

103

104

105

106

Control

Test

(a)

Amplification line

NC101

102

103

104

105

106

100 bp

200 bp

(b)

Figure 4 Evaluation of the sensitivity of PCV2 RPA LFD assay (a) In the lateral flow format (PCV2 RPA LFD) the sensitivity was 102 copiesof the standard DNA (b) Positive PCV2 RPA LFD reaction products (146 bp) could be detected on a stained agarose gel (3)

Control

Test

PCV2

NX

PCV2

CQ

PCV1

JL

PRRS

VC

H-1

R

PRV

Fa

PPV

AV30

CSF

C str

ain

FMD

VO

CH

A

NC

(a)

Amplification line

100 bp

200 bp

Mar

ker

PCV2

NX

PCV2

CQ

PCV1

JL

PRRS

VC

H-1

R

PRV

Fa

PPV

AV30

CSF

C str

ain

FMD

VO

CH

A

NC

(b)

Figure 5 (a) Specificity test results of PCV2 RPA LFD assay using total DNA extracted from PCV2 virus and other virus (b) Positive PCV2RPA LFD reaction products (146 bp) could be detected on a stained agarose gel (3)

Different isothermal molecule amplification assays havebeen developed as a rapid simple and cost-effective alterna-tive to PCR-based molecule assay since 1990s which includeloop-mediated isothermal amplification assay (LAMP) [22]helicase-dependent amplification assay [23] rolling cir-cle amplification assay [24] nucleic acid sequence-basedamplification assay [25] transcription-mediated amplifica-tion assay [26] signal-mediated amplification assay [27]self-sustained sequence replication assay [28] ramificationamplification assay [29] and RPA assay [30] Among theseassays RPA has several clear advantages including no initialheating for DNA denaturation the availability of a sim-ple battery-charged ESEQuant TS2 instrument and muchmore easiness in implementing test conditions (37∘C within20min)

In comparison with LAMP assay for detection of PCV2[31ndash34] which requires longer time (60min) and highertemperature (62ndash65∘C) RPA assay takes over less than 20minat 37∘C to complete which makes RPA much simpler andeasier to use The potential defect of PCV2 RPA LFDassay is that it may carryover contamination in the fieldas it needs to open the tube after amplification Thereforeprecautions should be taken such as careful opening andclosing of reaction tubes frequent changing the gloves andseparating the progress of pre- and post-RPA amplificationFurthermore replacement of dTTP with dUTP may helpprevent such carryover contamination as demonstrated inPCR and LAMP assays [35 36] Our results showed that thedeveloped RPA assay could tolerate base mismatch in some

degree as the primes could not completelymatchwith the twoPCV2 strains used in our work based on sequence alignmentand it may detect PCV-2 strains in some degree of variabilityWang et al developed a basic RPA assay for PCV2 detectionrecently [37] The sensitivity and specificity were almost thesame as our research but the results were analyzed usingagarose gel electrophoresis and staining limiting the use ofit in the field

5 Conclusions

In summary the PCV2 real-time RPA assay and PCV2 RPALFD assay described are sensitive and specific for rapiddetecting of PCV2 within less than 20min The developedRPA assay has the advantage of providing a potential diag-nostic tool suitable for routine diagnostic use in a laboratorywithout complex equipment or in the field which wouldgreatly assist in epidemiological investigation of PCV2

Conflicts of Interest

All the authors declare no conflicts of interest

Authorsrsquo Contributions

Yang Yang and Zhidong Zhang conceived and designedthe project Yang Yang performed the study and wrote the

6 BioMed Research International

Table 3 Comparison of PCV2 real-time RPA assay and PCV2 RPA LFD assay with real-time qPCR assay on clinical samples

Clinical sample Real-time RPA RPA LFD Real-time qPCRPositive Negative Positive Negative Positive Negative

Spleen 4 12 4 12 4 12Inguinal lymph node 6 19 6 19 6 19Tonsil 9 17 9 17 9 17Lung 7 12 7 12 7 12Serum 5 11 5 11 5 11Total 31 71 31 71 31 71

Table 4 The performance of innuPREP MP basic kit on PCV2 positive samples (119899 = 31) was tested by real-time RPA assay RPA LFD assayand real-time qPCR assay respectively

Sample name Real-time qPCR (CT) Real-time RPA (min) RPA LFDSpleen 1 25 7 +Spleen 2 27 7 +Spleen 3 29 73 +Spleen 4 30 76 +Inguinal lymph node 1 28 7 +Inguinal lymph node 2 32 83 +Inguinal lymph node 3 31 8 +Inguinal lymph node 4 29 76 +Inguinal lymph node 5 26 63 +Inguinal lymph node 6 26 66 +Tonsil 1 30 8 +Tonsil 2 31 83 +Tonsil 3 25 63 +Tonsil 4 25 66 +Tonsil 5 26 66 +Tonsil 6 27 73 +Tonsil 7 27 76 +Tonsil 8 28 73 +Tonsil 9 24 6 +Lung 1 24 63 +Lung 2 24 66 +Lung 3 29 7 +Lung 4 22 63 +Lung 5 22 66 +Lung 6 30 83 +Lung 7 30 86 +Serum 1 32 9 +Serum 2 32 93 +Serum 3 27 76 +Serum 4 29 76 +Serum 5 25 73 +

manuscript Guozheng Cong and Yingjun Sun participatedin preparation of virus and samples Xiaodong Qin YanminLi and Zhidong Zhang revised the manuscript

Acknowledgments

The research was supported by National Research andDevelopment Program of China (2016YFD0500907) and

Innovation Fund of Chinese Academy of Agricultural Sci-ences (CAAS) China

References

[1] G M Allan and J A Ellis ldquoPorcine circoviruses a reviewrdquoJournal of Veterinary Diagnostic Investigation vol 12 no 1 pp3ndash14 2000

BioMed Research International 7

[2] J Kim and C Chae ldquoMultiplex nested PCR compared with insitu hybridization for the differentiation of porcine circovirusesand porcine parvovirus from pigs with postweaning multi-systemic wasting syndromerdquo Canadian Journal of VeterinaryResearch vol 67 no 2 pp 133ndash137 2003

[3] LWen X Guo andH Yang ldquoGenotyping of porcine circovirustype 2 from a variety of clinical conditions in ChinardquoVeterinaryMicrobiology vol 110 no 1-2 pp 141ndash146 2005

[4] J Segales and M Domingo ldquoPostweaning multisystemic wast-ing syndrome (PMWS) in pigs A reviewrdquoVeterinary Quarterlyvol 24 no 3 pp 110ndash124 2002

[5] A-S Ladekjaeligr-Mikkelsen J Nielsen T Stadejek et al ldquoRepro-duction of postweaning multisystemic wasting syndrome(PMWS) in immunostimulated and non-immunostimulated3-week-old piglets experimentally infected with porcine cir-covirus type 2 (PCV2)rdquoVeterinaryMicrobiology vol 89 no 2-3pp 97ndash114 2002

[6] L J Guo Y H Lu Y W Wei L P Huang and C M LiuldquoPorcine circovirus type 2 (PCV2) genetic variation and newlyemerging genotypes in Chinardquo Virology Journal vol 7 article273 2010

[7] W-B Chung W-H Chan H-C Chaung Y Lien C-C Wuand Y-L Huang ldquoReal-time PCR for quantitation of porcinereproductive and respiratory syndrome virus and porcinecircovirus type 2 in naturally-infected and challenged pigsrdquoJournal of Virological Methods vol 124 no 1-2 pp 11ndash19 2005

[8] A Olvera M Sibila M Calsamiglia J Segales and MDomingo ldquoComparison of porcine circovirus type 2 load inserum quantified by a real time PCR in postweaning multisys-temic wasting syndrome and porcine dermatitis and nephropa-thy syndrome naturally affected pigsrdquo Journal of VirologicalMethods vol 117 no 1 pp 75ndash80 2004

[9] Q Liu L Wang P Willson and L A Babiuk ldquoQuantitativecompetitive PCR analysis of porcine circovirus DNA in serumfrom pigs with postweaning multisystemic wasting syndromerdquoJournal of Clinical Microbiology vol 38 no 9 pp 3474ndash34772000

[10] A L Hamel L L Lin C Sachvie E Grudeski and G PNayar ldquoPCR detection and characterization of type-2 porcinecircovirusrdquoCanadian Journal of Veterinary Research vol 64 no1 pp 44ndash52 2000

[11] C Huang J-J Hung C-Y Wu and M-S Chien ldquoMultiplexPCR for rapid detection of pseudorabies virus porcine par-vovirus and porcine circovirusesrdquo Veterinary Microbiology vol101 no 3 pp 209ndash214 2004

[12] R Larochelle M Antaya M Morin and R Magar ldquoTypingof porcine circovirus in clinical specimens by multiplex PCRrdquoJournal of Virological Methods vol 80 no 1 pp 69ndash75 1999

[13] Y Yang X Qin W Zhang Y Li and Z Zhang ldquoRapidand specific detection of porcine parvovirus by isothermalrecombinase polymerase amplification assaysrdquo Molecular andCellular Probes vol 30 no 5 pp 300ndash305 2016

[14] N Yehia A-S Arafa A Abd El Wahed A A El-SanousiM Weidmann and M A Shalaby ldquoDevelopment of reversetranscription recombinase polymerase amplification assay foravian influenza H5N1 HA gene detectionrdquo Journal of VirologicalMethods vol 223 pp 45ndash49 2015

[15] A Aebischer K Wernike B Hoffmann and M Beer ldquoRapidgenome detection of Schmallenberg virus and bovine viraldiarrhea virus by use of isothermal amplification methods andhigh-speed real-time reverse transcriptase PCRrdquo Journal ofClinical Microbiology vol 52 no 6 pp 1883ndash1892 2014

[16] J Wang L Liu R Li J Wang Q Fu and W Yuan ldquoRapid andsensitive detection of canine parvovirus type 2 by recombinasepolymerase amplificationrdquo Archives of Virology vol 161 no 4pp 1015ndash1018 2016

[17] A Abd El Wahed A El-Deeb M El-Tholoth et al ldquoA portablereverse transcription recombinase polymerase amplificationassay for rapid detection of foot-and-mouth disease virusrdquoPLoSONE vol 8 no 8 Article ID e71642 2013

[18] Y Yang X Qin G Wang Y Zhang Y Shang and Z ZhangldquoDevelopment of a fluorescent probe-based recombinase poly-merase amplification assay for rapid detection of Orf virusVeterinary DNA virusesrdquo Virology Journal vol 12 no 1 article206 2015

[19] Y Yang X Qin G Wang J Jin Y Shang and Z ZhangldquoDevelopment of an isothermoal amplification-based assay forrapid visual detection of an Orf virusrdquo Virology Journal vol 13no 1 article 46 2016

[20] B-C Yang F-X Wang S-Q Zhang et al ldquoComparative eval-uation of conventional polymerase chain reaction (PCR) withloop-mediated isothermal amplification and SYBR green I-based real-time PCR for the quantitation of porcine circovirus-1 DNA in contaminated samples destined for vaccine produc-tionrdquo Journal of Virological Methods vol 191 no 1 pp 1ndash8 2013

[21] L-L Zheng Y-BWangM-F Li et al ldquoSimultaneous detectionof porcine parvovirus and porcine circovirus type 2 by duplexreal-time PCR and ampliconmelting curve analysis using SYBRGreenrdquo Journal of Virological Methods vol 187 no 1 pp 15ndash192013

[22] T Notomi H Okayama H Masubuchi et al ldquoLoop-mediatedisothermal amplification of DNArdquo Nucleic acids research vol28 no 12 p E63 2000

[23] M Vincent Y Xu and H Kong ldquoHelicase-dependent isother-mal DNA amplificationrdquo EMBO Reports vol 5 no 8 pp 795ndash800 2004

[24] A Fire and S-Q Xu ldquoRolling replication of short DNA circlesrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 92 no 10 pp 4641ndash4645 1995

[25] J Compton ldquoNucleic acid sequence-based amplificationrdquoNature vol 350 no 6313 pp 91ndash92 1991

[26] P Gill and A Ghaemi ldquoNucleic acid isothermal amplificationtechnologies a reviewrdquo Nucleosides Nucleotides amp NucleicAcids vol 27 no 3 pp 224ndash243 2008

[27] S D Wharam P Marsh J S Lloyd et al ldquoSpecific detectionof DNA and RNA targets using a novel isothermal nucleicacid amplification assay based on the formation of a three-wayjunction structurerdquoNucleic Acids Research vol 29 no 11 articlee54 2001

[28] J C Guatelli K MWhitfield D Y Kwoh K J Barringer D DRichman andT RGingeras ldquoIsothermal in vitro amplificationof nucleic acids by a multienzyme reaction modeled afterretroviral replicationrdquo Proceedings of the National Academy ofSciences of the United States of America vol 87 no 19 article7797 1990

[29] D Yong Zhang M Brandwein T Chun Hung Hsuih and HLi ldquoAmplification of target-specific ligation-dependent circularproberdquo Gene vol 211 no 2 pp 277ndash285 1998

[30] O Piepenburg C HWilliams D L Stemple and N A ArmesldquoDNA detection using recombination proteinsrdquo PLoS Biologyvol 4 no 7 article e204 2006

[31] S Zhou S Han J Shi et al ldquoLoop-mediated isothermal ampli-fication for detection of porcine circovirus type 2rdquo VirologyJournal vol 8 article 497 2011

8 BioMed Research International

[32] K Zhao W Shi F Han et al ldquoSpecific simple and rapiddetection of porcine circovirus type 2 using the loop-mediatedisothermal amplification methodrdquo Virology Journal vol 8article 126 2011

[33] H-T Chen J Zhang D-H Sun et al ldquoRapid detection ofporcine circovirus type 2 by loop-mediated isothermal ampli-ficationrdquo Journal of Virological Methods vol 149 no 2 pp 264ndash268 2008

[34] C Wang V F E Pang F Lee et al ldquoDevelopment andevaluation of a loop-mediated isothermal amplificationmethodfor rapid detection and differentiation of two genotypes ofporcine circovirus type 2rdquo Journal ofMicrobiology Immunologyand Infection vol 47 no 5 pp 363ndash370 2014

[35] M C Longo M S Berninger and J L Hartley ldquoUse ofuracil DNA glycosylase to control carry-over contamination inpolymerase chain reactionsrdquo Gene vol 93 no 1 pp 125ndash1281990

[36] E-J Kil S Kim Y-J Lee et al ldquoAdvanced loop-mediatedisothermal amplification method for sensitive and specificdetection of Tomato chlorosis virus using a uracil DNAglycosy-lase to control carry-over contaminationrdquo Journal of VirologicalMethods vol 213 pp 68ndash74 2015

[37] J Wang L Liu R Li andW Yuan ldquoRapid detection of Porcinecircovirus 2 by recombinase polymerase amplificationrdquo Journalof VeterinaryDiagnostic Investigation vol 28 no 5 pp 574ndash5782016

Submit your manuscripts athttpswwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

6 BioMed Research International

Table 3 Comparison of PCV2 real-time RPA assay and PCV2 RPA LFD assay with real-time qPCR assay on clinical samples

Clinical sample Real-time RPA RPA LFD Real-time qPCRPositive Negative Positive Negative Positive Negative

Spleen 4 12 4 12 4 12Inguinal lymph node 6 19 6 19 6 19Tonsil 9 17 9 17 9 17Lung 7 12 7 12 7 12Serum 5 11 5 11 5 11Total 31 71 31 71 31 71

Table 4 The performance of innuPREP MP basic kit on PCV2 positive samples (119899 = 31) was tested by real-time RPA assay RPA LFD assayand real-time qPCR assay respectively

Sample name Real-time qPCR (CT) Real-time RPA (min) RPA LFDSpleen 1 25 7 +Spleen 2 27 7 +Spleen 3 29 73 +Spleen 4 30 76 +Inguinal lymph node 1 28 7 +Inguinal lymph node 2 32 83 +Inguinal lymph node 3 31 8 +Inguinal lymph node 4 29 76 +Inguinal lymph node 5 26 63 +Inguinal lymph node 6 26 66 +Tonsil 1 30 8 +Tonsil 2 31 83 +Tonsil 3 25 63 +Tonsil 4 25 66 +Tonsil 5 26 66 +Tonsil 6 27 73 +Tonsil 7 27 76 +Tonsil 8 28 73 +Tonsil 9 24 6 +Lung 1 24 63 +Lung 2 24 66 +Lung 3 29 7 +Lung 4 22 63 +Lung 5 22 66 +Lung 6 30 83 +Lung 7 30 86 +Serum 1 32 9 +Serum 2 32 93 +Serum 3 27 76 +Serum 4 29 76 +Serum 5 25 73 +

manuscript Guozheng Cong and Yingjun Sun participatedin preparation of virus and samples Xiaodong Qin YanminLi and Zhidong Zhang revised the manuscript

Acknowledgments

The research was supported by National Research andDevelopment Program of China (2016YFD0500907) and

Innovation Fund of Chinese Academy of Agricultural Sci-ences (CAAS) China

References

[1] G M Allan and J A Ellis ldquoPorcine circoviruses a reviewrdquoJournal of Veterinary Diagnostic Investigation vol 12 no 1 pp3ndash14 2000

BioMed Research International 7

[2] J Kim and C Chae ldquoMultiplex nested PCR compared with insitu hybridization for the differentiation of porcine circovirusesand porcine parvovirus from pigs with postweaning multi-systemic wasting syndromerdquo Canadian Journal of VeterinaryResearch vol 67 no 2 pp 133ndash137 2003

[3] LWen X Guo andH Yang ldquoGenotyping of porcine circovirustype 2 from a variety of clinical conditions in ChinardquoVeterinaryMicrobiology vol 110 no 1-2 pp 141ndash146 2005

[4] J Segales and M Domingo ldquoPostweaning multisystemic wast-ing syndrome (PMWS) in pigs A reviewrdquoVeterinary Quarterlyvol 24 no 3 pp 110ndash124 2002

[5] A-S Ladekjaeligr-Mikkelsen J Nielsen T Stadejek et al ldquoRepro-duction of postweaning multisystemic wasting syndrome(PMWS) in immunostimulated and non-immunostimulated3-week-old piglets experimentally infected with porcine cir-covirus type 2 (PCV2)rdquoVeterinaryMicrobiology vol 89 no 2-3pp 97ndash114 2002

[6] L J Guo Y H Lu Y W Wei L P Huang and C M LiuldquoPorcine circovirus type 2 (PCV2) genetic variation and newlyemerging genotypes in Chinardquo Virology Journal vol 7 article273 2010

[7] W-B Chung W-H Chan H-C Chaung Y Lien C-C Wuand Y-L Huang ldquoReal-time PCR for quantitation of porcinereproductive and respiratory syndrome virus and porcinecircovirus type 2 in naturally-infected and challenged pigsrdquoJournal of Virological Methods vol 124 no 1-2 pp 11ndash19 2005

[8] A Olvera M Sibila M Calsamiglia J Segales and MDomingo ldquoComparison of porcine circovirus type 2 load inserum quantified by a real time PCR in postweaning multisys-temic wasting syndrome and porcine dermatitis and nephropa-thy syndrome naturally affected pigsrdquo Journal of VirologicalMethods vol 117 no 1 pp 75ndash80 2004

[9] Q Liu L Wang P Willson and L A Babiuk ldquoQuantitativecompetitive PCR analysis of porcine circovirus DNA in serumfrom pigs with postweaning multisystemic wasting syndromerdquoJournal of Clinical Microbiology vol 38 no 9 pp 3474ndash34772000

[10] A L Hamel L L Lin C Sachvie E Grudeski and G PNayar ldquoPCR detection and characterization of type-2 porcinecircovirusrdquoCanadian Journal of Veterinary Research vol 64 no1 pp 44ndash52 2000

[11] C Huang J-J Hung C-Y Wu and M-S Chien ldquoMultiplexPCR for rapid detection of pseudorabies virus porcine par-vovirus and porcine circovirusesrdquo Veterinary Microbiology vol101 no 3 pp 209ndash214 2004

[12] R Larochelle M Antaya M Morin and R Magar ldquoTypingof porcine circovirus in clinical specimens by multiplex PCRrdquoJournal of Virological Methods vol 80 no 1 pp 69ndash75 1999

[13] Y Yang X Qin W Zhang Y Li and Z Zhang ldquoRapidand specific detection of porcine parvovirus by isothermalrecombinase polymerase amplification assaysrdquo Molecular andCellular Probes vol 30 no 5 pp 300ndash305 2016

[14] N Yehia A-S Arafa A Abd El Wahed A A El-SanousiM Weidmann and M A Shalaby ldquoDevelopment of reversetranscription recombinase polymerase amplification assay foravian influenza H5N1 HA gene detectionrdquo Journal of VirologicalMethods vol 223 pp 45ndash49 2015

[15] A Aebischer K Wernike B Hoffmann and M Beer ldquoRapidgenome detection of Schmallenberg virus and bovine viraldiarrhea virus by use of isothermal amplification methods andhigh-speed real-time reverse transcriptase PCRrdquo Journal ofClinical Microbiology vol 52 no 6 pp 1883ndash1892 2014

[16] J Wang L Liu R Li J Wang Q Fu and W Yuan ldquoRapid andsensitive detection of canine parvovirus type 2 by recombinasepolymerase amplificationrdquo Archives of Virology vol 161 no 4pp 1015ndash1018 2016

[17] A Abd El Wahed A El-Deeb M El-Tholoth et al ldquoA portablereverse transcription recombinase polymerase amplificationassay for rapid detection of foot-and-mouth disease virusrdquoPLoSONE vol 8 no 8 Article ID e71642 2013

[18] Y Yang X Qin G Wang Y Zhang Y Shang and Z ZhangldquoDevelopment of a fluorescent probe-based recombinase poly-merase amplification assay for rapid detection of Orf virusVeterinary DNA virusesrdquo Virology Journal vol 12 no 1 article206 2015

[19] Y Yang X Qin G Wang J Jin Y Shang and Z ZhangldquoDevelopment of an isothermoal amplification-based assay forrapid visual detection of an Orf virusrdquo Virology Journal vol 13no 1 article 46 2016

[20] B-C Yang F-X Wang S-Q Zhang et al ldquoComparative eval-uation of conventional polymerase chain reaction (PCR) withloop-mediated isothermal amplification and SYBR green I-based real-time PCR for the quantitation of porcine circovirus-1 DNA in contaminated samples destined for vaccine produc-tionrdquo Journal of Virological Methods vol 191 no 1 pp 1ndash8 2013

[21] L-L Zheng Y-BWangM-F Li et al ldquoSimultaneous detectionof porcine parvovirus and porcine circovirus type 2 by duplexreal-time PCR and ampliconmelting curve analysis using SYBRGreenrdquo Journal of Virological Methods vol 187 no 1 pp 15ndash192013

[22] T Notomi H Okayama H Masubuchi et al ldquoLoop-mediatedisothermal amplification of DNArdquo Nucleic acids research vol28 no 12 p E63 2000

[23] M Vincent Y Xu and H Kong ldquoHelicase-dependent isother-mal DNA amplificationrdquo EMBO Reports vol 5 no 8 pp 795ndash800 2004

[24] A Fire and S-Q Xu ldquoRolling replication of short DNA circlesrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 92 no 10 pp 4641ndash4645 1995

[25] J Compton ldquoNucleic acid sequence-based amplificationrdquoNature vol 350 no 6313 pp 91ndash92 1991

[26] P Gill and A Ghaemi ldquoNucleic acid isothermal amplificationtechnologies a reviewrdquo Nucleosides Nucleotides amp NucleicAcids vol 27 no 3 pp 224ndash243 2008

[27] S D Wharam P Marsh J S Lloyd et al ldquoSpecific detectionof DNA and RNA targets using a novel isothermal nucleicacid amplification assay based on the formation of a three-wayjunction structurerdquoNucleic Acids Research vol 29 no 11 articlee54 2001

[28] J C Guatelli K MWhitfield D Y Kwoh K J Barringer D DRichman andT RGingeras ldquoIsothermal in vitro amplificationof nucleic acids by a multienzyme reaction modeled afterretroviral replicationrdquo Proceedings of the National Academy ofSciences of the United States of America vol 87 no 19 article7797 1990

[29] D Yong Zhang M Brandwein T Chun Hung Hsuih and HLi ldquoAmplification of target-specific ligation-dependent circularproberdquo Gene vol 211 no 2 pp 277ndash285 1998

[30] O Piepenburg C HWilliams D L Stemple and N A ArmesldquoDNA detection using recombination proteinsrdquo PLoS Biologyvol 4 no 7 article e204 2006

[31] S Zhou S Han J Shi et al ldquoLoop-mediated isothermal ampli-fication for detection of porcine circovirus type 2rdquo VirologyJournal vol 8 article 497 2011

8 BioMed Research International

[32] K Zhao W Shi F Han et al ldquoSpecific simple and rapiddetection of porcine circovirus type 2 using the loop-mediatedisothermal amplification methodrdquo Virology Journal vol 8article 126 2011

[33] H-T Chen J Zhang D-H Sun et al ldquoRapid detection ofporcine circovirus type 2 by loop-mediated isothermal ampli-ficationrdquo Journal of Virological Methods vol 149 no 2 pp 264ndash268 2008

[34] C Wang V F E Pang F Lee et al ldquoDevelopment andevaluation of a loop-mediated isothermal amplificationmethodfor rapid detection and differentiation of two genotypes ofporcine circovirus type 2rdquo Journal ofMicrobiology Immunologyand Infection vol 47 no 5 pp 363ndash370 2014

[35] M C Longo M S Berninger and J L Hartley ldquoUse ofuracil DNA glycosylase to control carry-over contamination inpolymerase chain reactionsrdquo Gene vol 93 no 1 pp 125ndash1281990

[36] E-J Kil S Kim Y-J Lee et al ldquoAdvanced loop-mediatedisothermal amplification method for sensitive and specificdetection of Tomato chlorosis virus using a uracil DNAglycosy-lase to control carry-over contaminationrdquo Journal of VirologicalMethods vol 213 pp 68ndash74 2015

[37] J Wang L Liu R Li andW Yuan ldquoRapid detection of Porcinecircovirus 2 by recombinase polymerase amplificationrdquo Journalof VeterinaryDiagnostic Investigation vol 28 no 5 pp 574ndash5782016

Submit your manuscripts athttpswwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 7

[2] J Kim and C Chae ldquoMultiplex nested PCR compared with insitu hybridization for the differentiation of porcine circovirusesand porcine parvovirus from pigs with postweaning multi-systemic wasting syndromerdquo Canadian Journal of VeterinaryResearch vol 67 no 2 pp 133ndash137 2003

[3] LWen X Guo andH Yang ldquoGenotyping of porcine circovirustype 2 from a variety of clinical conditions in ChinardquoVeterinaryMicrobiology vol 110 no 1-2 pp 141ndash146 2005

[4] J Segales and M Domingo ldquoPostweaning multisystemic wast-ing syndrome (PMWS) in pigs A reviewrdquoVeterinary Quarterlyvol 24 no 3 pp 110ndash124 2002

[5] A-S Ladekjaeligr-Mikkelsen J Nielsen T Stadejek et al ldquoRepro-duction of postweaning multisystemic wasting syndrome(PMWS) in immunostimulated and non-immunostimulated3-week-old piglets experimentally infected with porcine cir-covirus type 2 (PCV2)rdquoVeterinaryMicrobiology vol 89 no 2-3pp 97ndash114 2002

[6] L J Guo Y H Lu Y W Wei L P Huang and C M LiuldquoPorcine circovirus type 2 (PCV2) genetic variation and newlyemerging genotypes in Chinardquo Virology Journal vol 7 article273 2010

[7] W-B Chung W-H Chan H-C Chaung Y Lien C-C Wuand Y-L Huang ldquoReal-time PCR for quantitation of porcinereproductive and respiratory syndrome virus and porcinecircovirus type 2 in naturally-infected and challenged pigsrdquoJournal of Virological Methods vol 124 no 1-2 pp 11ndash19 2005

[8] A Olvera M Sibila M Calsamiglia J Segales and MDomingo ldquoComparison of porcine circovirus type 2 load inserum quantified by a real time PCR in postweaning multisys-temic wasting syndrome and porcine dermatitis and nephropa-thy syndrome naturally affected pigsrdquo Journal of VirologicalMethods vol 117 no 1 pp 75ndash80 2004

[9] Q Liu L Wang P Willson and L A Babiuk ldquoQuantitativecompetitive PCR analysis of porcine circovirus DNA in serumfrom pigs with postweaning multisystemic wasting syndromerdquoJournal of Clinical Microbiology vol 38 no 9 pp 3474ndash34772000

[10] A L Hamel L L Lin C Sachvie E Grudeski and G PNayar ldquoPCR detection and characterization of type-2 porcinecircovirusrdquoCanadian Journal of Veterinary Research vol 64 no1 pp 44ndash52 2000

[11] C Huang J-J Hung C-Y Wu and M-S Chien ldquoMultiplexPCR for rapid detection of pseudorabies virus porcine par-vovirus and porcine circovirusesrdquo Veterinary Microbiology vol101 no 3 pp 209ndash214 2004

[12] R Larochelle M Antaya M Morin and R Magar ldquoTypingof porcine circovirus in clinical specimens by multiplex PCRrdquoJournal of Virological Methods vol 80 no 1 pp 69ndash75 1999

[13] Y Yang X Qin W Zhang Y Li and Z Zhang ldquoRapidand specific detection of porcine parvovirus by isothermalrecombinase polymerase amplification assaysrdquo Molecular andCellular Probes vol 30 no 5 pp 300ndash305 2016

[14] N Yehia A-S Arafa A Abd El Wahed A A El-SanousiM Weidmann and M A Shalaby ldquoDevelopment of reversetranscription recombinase polymerase amplification assay foravian influenza H5N1 HA gene detectionrdquo Journal of VirologicalMethods vol 223 pp 45ndash49 2015

[15] A Aebischer K Wernike B Hoffmann and M Beer ldquoRapidgenome detection of Schmallenberg virus and bovine viraldiarrhea virus by use of isothermal amplification methods andhigh-speed real-time reverse transcriptase PCRrdquo Journal ofClinical Microbiology vol 52 no 6 pp 1883ndash1892 2014

[16] J Wang L Liu R Li J Wang Q Fu and W Yuan ldquoRapid andsensitive detection of canine parvovirus type 2 by recombinasepolymerase amplificationrdquo Archives of Virology vol 161 no 4pp 1015ndash1018 2016

[17] A Abd El Wahed A El-Deeb M El-Tholoth et al ldquoA portablereverse transcription recombinase polymerase amplificationassay for rapid detection of foot-and-mouth disease virusrdquoPLoSONE vol 8 no 8 Article ID e71642 2013

[18] Y Yang X Qin G Wang Y Zhang Y Shang and Z ZhangldquoDevelopment of a fluorescent probe-based recombinase poly-merase amplification assay for rapid detection of Orf virusVeterinary DNA virusesrdquo Virology Journal vol 12 no 1 article206 2015

[19] Y Yang X Qin G Wang J Jin Y Shang and Z ZhangldquoDevelopment of an isothermoal amplification-based assay forrapid visual detection of an Orf virusrdquo Virology Journal vol 13no 1 article 46 2016

[20] B-C Yang F-X Wang S-Q Zhang et al ldquoComparative eval-uation of conventional polymerase chain reaction (PCR) withloop-mediated isothermal amplification and SYBR green I-based real-time PCR for the quantitation of porcine circovirus-1 DNA in contaminated samples destined for vaccine produc-tionrdquo Journal of Virological Methods vol 191 no 1 pp 1ndash8 2013

[21] L-L Zheng Y-BWangM-F Li et al ldquoSimultaneous detectionof porcine parvovirus and porcine circovirus type 2 by duplexreal-time PCR and ampliconmelting curve analysis using SYBRGreenrdquo Journal of Virological Methods vol 187 no 1 pp 15ndash192013

[22] T Notomi H Okayama H Masubuchi et al ldquoLoop-mediatedisothermal amplification of DNArdquo Nucleic acids research vol28 no 12 p E63 2000

[23] M Vincent Y Xu and H Kong ldquoHelicase-dependent isother-mal DNA amplificationrdquo EMBO Reports vol 5 no 8 pp 795ndash800 2004

[24] A Fire and S-Q Xu ldquoRolling replication of short DNA circlesrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 92 no 10 pp 4641ndash4645 1995

[25] J Compton ldquoNucleic acid sequence-based amplificationrdquoNature vol 350 no 6313 pp 91ndash92 1991

[26] P Gill and A Ghaemi ldquoNucleic acid isothermal amplificationtechnologies a reviewrdquo Nucleosides Nucleotides amp NucleicAcids vol 27 no 3 pp 224ndash243 2008

[27] S D Wharam P Marsh J S Lloyd et al ldquoSpecific detectionof DNA and RNA targets using a novel isothermal nucleicacid amplification assay based on the formation of a three-wayjunction structurerdquoNucleic Acids Research vol 29 no 11 articlee54 2001

[28] J C Guatelli K MWhitfield D Y Kwoh K J Barringer D DRichman andT RGingeras ldquoIsothermal in vitro amplificationof nucleic acids by a multienzyme reaction modeled afterretroviral replicationrdquo Proceedings of the National Academy ofSciences of the United States of America vol 87 no 19 article7797 1990

[29] D Yong Zhang M Brandwein T Chun Hung Hsuih and HLi ldquoAmplification of target-specific ligation-dependent circularproberdquo Gene vol 211 no 2 pp 277ndash285 1998

[30] O Piepenburg C HWilliams D L Stemple and N A ArmesldquoDNA detection using recombination proteinsrdquo PLoS Biologyvol 4 no 7 article e204 2006

[31] S Zhou S Han J Shi et al ldquoLoop-mediated isothermal ampli-fication for detection of porcine circovirus type 2rdquo VirologyJournal vol 8 article 497 2011

8 BioMed Research International

[32] K Zhao W Shi F Han et al ldquoSpecific simple and rapiddetection of porcine circovirus type 2 using the loop-mediatedisothermal amplification methodrdquo Virology Journal vol 8article 126 2011

[33] H-T Chen J Zhang D-H Sun et al ldquoRapid detection ofporcine circovirus type 2 by loop-mediated isothermal ampli-ficationrdquo Journal of Virological Methods vol 149 no 2 pp 264ndash268 2008

[34] C Wang V F E Pang F Lee et al ldquoDevelopment andevaluation of a loop-mediated isothermal amplificationmethodfor rapid detection and differentiation of two genotypes ofporcine circovirus type 2rdquo Journal ofMicrobiology Immunologyand Infection vol 47 no 5 pp 363ndash370 2014

[35] M C Longo M S Berninger and J L Hartley ldquoUse ofuracil DNA glycosylase to control carry-over contamination inpolymerase chain reactionsrdquo Gene vol 93 no 1 pp 125ndash1281990

[36] E-J Kil S Kim Y-J Lee et al ldquoAdvanced loop-mediatedisothermal amplification method for sensitive and specificdetection of Tomato chlorosis virus using a uracil DNAglycosy-lase to control carry-over contaminationrdquo Journal of VirologicalMethods vol 213 pp 68ndash74 2015

[37] J Wang L Liu R Li andW Yuan ldquoRapid detection of Porcinecircovirus 2 by recombinase polymerase amplificationrdquo Journalof VeterinaryDiagnostic Investigation vol 28 no 5 pp 574ndash5782016

Submit your manuscripts athttpswwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

8 BioMed Research International

[32] K Zhao W Shi F Han et al ldquoSpecific simple and rapiddetection of porcine circovirus type 2 using the loop-mediatedisothermal amplification methodrdquo Virology Journal vol 8article 126 2011

[33] H-T Chen J Zhang D-H Sun et al ldquoRapid detection ofporcine circovirus type 2 by loop-mediated isothermal ampli-ficationrdquo Journal of Virological Methods vol 149 no 2 pp 264ndash268 2008

[34] C Wang V F E Pang F Lee et al ldquoDevelopment andevaluation of a loop-mediated isothermal amplificationmethodfor rapid detection and differentiation of two genotypes ofporcine circovirus type 2rdquo Journal ofMicrobiology Immunologyand Infection vol 47 no 5 pp 363ndash370 2014

[35] M C Longo M S Berninger and J L Hartley ldquoUse ofuracil DNA glycosylase to control carry-over contamination inpolymerase chain reactionsrdquo Gene vol 93 no 1 pp 125ndash1281990

[36] E-J Kil S Kim Y-J Lee et al ldquoAdvanced loop-mediatedisothermal amplification method for sensitive and specificdetection of Tomato chlorosis virus using a uracil DNAglycosy-lase to control carry-over contaminationrdquo Journal of VirologicalMethods vol 213 pp 68ndash74 2015

[37] J Wang L Liu R Li andW Yuan ldquoRapid detection of Porcinecircovirus 2 by recombinase polymerase amplificationrdquo Journalof VeterinaryDiagnostic Investigation vol 28 no 5 pp 574ndash5782016

Submit your manuscripts athttpswwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

Submit your manuscripts athttpswwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology