Development of a New Molecular Marker for the Resistance ...downloads.hindawi.com › journals › bmri › 2018 › 8120281.pdf · in tomato (Solanum lycopersicumL.) yield worldwide

Research ArticleDevelopment of a New Molecular Marker for the Resistance toTomato Yellow Leaf Curl Virus

Adedze YawoMawunyo Nevame 1 Lu Xia1 Chofong Gilbert Nchongboh2

MuhammadMahmudul Hasan 34 Md Amirul Alam 5 Li Yongbo1 ZhangWenting1

He Yafei6 Reza Mohammad Emon3 Mohd Razi Ismail 4 Andrew Efisue7 Sun Gang1

Li Wenhu1 and Si Longting 1

1Molecular Biology Laboratory of Jiangsu Green Port Modern Agriculture Development CompanyNancai Township Road No 1 Suqian City Jiangsu Province 223800 China2Catholic University Institute of Buea PO Box 563 Buea Cameroon3Bangladesh Institute of Nuclear Agriculture BAU Campus Mymensingh 2202 Bangladesh4Institute of Tropical Agriculture and Food Security Universiti Putra Malaysia (UPM) 43400 SerdangSelangor Malaysia5Faculty of Sustainable Agriculture Horticulture and Landscaping Program Universiti Malaysia SabahSandakan Campus 90509 Sandakan Sabah Malaysia6College of Life Science Nanjing Agricultural University Nanjing 210095 China7Departments of Crop and Soil Science University of Port Harcourt Port Harcourt Nigeria

Correspondence should be addressed to Adedze Yawo Mawunyo Nevame amennevame07yahoofrand Si Longting 1831136541qqcom

Received 9 April 2018 Accepted 21 June 2018 Published 17 July 2018

Academic Editor Atanas Atanassov

Copyright copy 2018 Adedze Yawo Mawunyo Nevame et al This is an open access article distributed under the Creative CommonsAttribution License which permits unrestricted use distribution and reproduction in any medium provided the original work isproperly cited

Tomato yellow leaf curl virus (TYLCV) responsible for tomato yellow leaf curl disease (TYLCD) causes a substantial decreasein tomato (Solanum lycopersicum L) yield worldwide The use of resistant variety as a sustainable management strategy hasbeen advocated Tremendous progress has been made in genetically characterizing the resistance genes (R gene) in tomatoBreeding tomato for TYLCV resistance has been based mostly on Ty-3 as a race-specific resistance gene by introgressionoriginating from wild tomato species relatives Improvement or development of a cultivar is achievable through the use ofmarker-assisted selection (MAS) Therefore precise and easy use of gene-targeted markers would be of significant importancefor selection in breeding programs The present study was undertaken to develop a new marker based on Ty-3 gene sequencethat can be used for MAS in TYLCV resistant tomato breeding program The new developed marker was named ACY Thereliability and accuracy of ACY were evaluated against those of Ty-3 linked marker P6-25 through screening of commercialresistant and susceptible tomato hybrids and genetic segregation using F2 population derived from a commercial resistanthybrid AG208 With the use of bioinformatics and DNA sequencing analysis tools deletion of 10 nucleotides was observed inTy-3 gene sequence for susceptible tomato variety ACY is a co-dominant indel-based marker that produced clear and strongpolymorphic band patterns for resistant plant distinguishing it from its susceptible counterpart The obtained result correlateswith 31 segregation ratio of single resistant dominant gene inheritance which depicted ACY as gene-tag functional markerThis marker is currently in use for screening 968 hybrids varieties and one thousand breeding lines of tomato varieties stockedin Jiangsu Green Port Modern Agriculture Development Company (Green Port) So far ACY has been used to identify 56hybrids and 51 breeding lines These newly detected breeding lines were regarded as potential source of resistance for tomatobreeding This work exploited the sequence of Ty-3 and subsequently contributed to the development of molecular marker ACYto aid phenotypic selection We thus recommend this marker to breeders which is suitable for marker-assisted selection intomato

HindawiBioMed Research InternationalVolume 2018 Article ID 8120281 10 pageshttpsdoiorg10115520188120281

2 BioMed Research International

1 Introduction

Tomato yellow leaf curl disease (TYLCD) inflicted bywhitefly-transmitted species of Begomovirus genus (Gemi-niviridae) is one of the most devastating tomato disease (Slycopersicum) worldwide The potential of TYLCV to wreakhavoc on tomato was initially reported in Israel in the late1930s and 1960s with a severe outbreak on tomato plantsrecorded in the Mediterranean basin [1] The biotype Bvector B tabaci accounts for the dramatic spread of TYLCVthrough Africa Europe Asia the Caribbean and NorthAmerica [2] TYLCV is an economically important plantpathogen with yield losses in tomato reaching 100 [1 3ndash5]Tomato yellow leaf curl disease survey followed by sequenceanalysis across six tomato growing regions in China showedsequence identity of up to 98 among TYLCV isolates [6]These isolates shared more than 97 sequence identity withTYLCVIL [ILReo] (X15656) an Israel isolate [6] TYLCVwith nucleotide sequence homology of more than 90 couldbe regarded as strains of the same virus [7]Themanagementof TYLCD is dependent on the intensive use of insecticidesto control vector (B tabaci) populations [8] This chemicalcontrol measure is partially effective against insect vectorsNevertheless it is expensive and labor intensive and oftenresults in chemical residue buildup subsequently leading tothe development of pesticide resistance insect populations[8ndash11] In addition intensive and inaccurate application ofinsecticides could generate environmental pollutants andpesticide poisoning via toxin retention in tomato fruit [12]One of the efficient ways to alleviate or manage TYLCDis introgression of virus resistance into cultivated plantsPrevious research works have focused on the determinationof natural sources of virus resistance and have been identifiedin tomato wild relatives including S pimpinellifolium S peru-vianum S chilense S habrochaites and S cheesmaniae [3 1314] Genetic mapping analysis has led to the identification ofdifferent TYLCD resistanttolerances loci being exploited intomato breeding from S habrochaites (Ty-2) S peruvianum(ty-5) and S chilense (Ty-1 Ty-3 and Ty-4) [15ndash20] Amongthese S chilense has been used extensively as resistancedonor parent [21] with Ty-1 recognized as promising sourceof TYLCV resistance [22] The gene Ty-1 was identified asallelic to the group of genes Ty-3 Ty-3a and Ty-3b [16 23]whereas three ORFs were predicted as candidate gene of Ty-1 Ty-3 [22] Conventional tomato breeding solely dependson phenotypic traits selection for resistant cultivar How-ever the impacts of environmental conditions on phenotypegreatly affect its selection efficiency Field screening is acomplex and time consuming process which requires specificgrowing conditions [24 25] With the advent of marker-assisted selection (MAS) as a modern molecular biologytechnique the rapidity and efficiency of resistant cultivardevelopment have been greatly enhanced Progressive effortsmade in the development ofTy-1Ty-3 resistant genes-derivedmolecular markers for MAS in tomato cleaved amplifiedpolymorphic sequence (CAPS) and sequence-characterizedamplified region (SCAR) markers are significant [26 27]However concerns have been raised regarding their physicalposition relative to the resistance gene in the genome

arguing the possibility of false negative or false positiveresults during breeding programs [4 26] To circumventthe aforementioned problem gene-specificmarker techniquewas introduced aimed at developing molecular markerswith gene specificity [28 29] This led to the developmentof gene-targeted markers (GTMs) and functional markers(FMs) resistance gene based markers (RGMs) and RNA-based markers (RBMs) [30ndash32] According to Andersenand Lubberstedt [33] functional markers are polymorphicDNA sequences that are likely to be involved in phenotypictrait variation while gene-targeted markers are gene specificand capable of tagging untranslated regions [34 35] RGMcan allow tracking the resistant gene in new germplasmssegregating population for promoting gene pyramiding inplant Based on recently reported research findings intronlength polymorphism seems to be a convenient and reliablesource of information with high interspecies transferability[36] We speculated that marker developed by exploitingsuch information might contribute to the compensating ofthe discrepancy observations often encountered betweengenotypes and phenotypes during breeding programs Infor-mation regarding intron polymorphism based molecularmaker for TYLCV resistance marker-assisted selection intomato breeding is lacking

Here we developed and reported a new marker namedACY in the basis of indel-10 nucleotides for Ty-3Ty-1 geneSolyc06g051170 between cultivated tomato (S lycopersicum)and wild type tomato (S pennellii) This marker can be usedas a powerful tool in segregating resistant from susceptibletomato plants PCR amplification amplicon revealed 132bpand 123bp DNA fragment from TYLCV resistant varieties(R) and susceptible varieties respectively Screening of com-mercial F

1hybrids and segregating F

2population showed

reliability and accuracy with ACY marker

2 Materials and Methods

21 Plant Materials Thirty-six (36) commercial varietiesone thousand (1000) breeding lines and nine hundred andsixty-eight (968) hybrid varieties of tomato were used Thecommercial hybrids were purchased from different seedcompanies The hybrids and breeding lines constituted thecandidate of tomato varieties stock of Jiangsu Green PortModern Agriculture Development Company (abbreviated asGreen Port) Seeding transplanting and plants managementwere handled following the standard practice of Green PortTo conduct the phenotypically selection assay tomato plantswere transplanted in greenhouse to meet the critical periodof whiteflies invasion

22 Tomato Yellow Leaf Curl Disease Evaluation A diseaserating scales of 0 to 4 were adopted and used as describedby Hutton and Scott [37] On the rating scale 0 1 2 3 and4 signified no symptoms slight symptoms visible upon closeinspection clear symptoms evident on a portion of the plantheavy symptoms on entire plant and severe symptoms andstunting of the entire plant respectively The plants that wererated on the scale of 0 1 and 2 were considered resistantwhile those of 3 and 4 were susceptible

BioMed Research International 3

Table 1 The primer sequences used in amplifying targeted fragments

Marker name Forward primer sequence (51015840-31015840) Reverse primer sequence (31015840-51015840)ACYlowast CCTTATGATGTCTCGTGAAAGG GAAGCACAGATTGAAGAAAACCSeq ATACTTTTCTCGTGCCTTCTC AGCTTATTTTGCTGGCTCATATYLCV390 GATGGCCGCGCCTTTTCCTTTTATGTGG GCTGCTGTATGGGCTGTCGAAGTTCAGP6-25 GGTAGTGGAAATGATGCTGCTC GCTCTGCCTATTGTCCCATATATAACCSCAR1 CAATTTATAGGTGTTTTTGGGACATC GTTCAACACTTGGCCAATGCTTACGSCAR2 TGGCTCATCCTGAAGCTGATAGCGC AGTGTACATCCTTGCCATTGACTlowast Primer sequence of the newly developed ACY marker

23 DNA Extraction and Polymerase Chain Reaction DNAwas extracted from the fresh leaves of 30- and 60-day-old tomato plants using NuClear Plant Genomic DNA Kit(CWO531M) protocol (CWBiotech Beijing China) DNAobtained from 30-day-old plants was used for resistancegene detection while that from 60-day-old plants was usedfor viral DNA detection The obtained DNA was adjustedto a final concentration of 10ng120583l For PCR products tobe analyzed by agarose gel 25120583l of PCR reactions mixcontaining 125120583l 2xTaq MasterMix (CWBiotech BeijingChina) 1120583l of each forward and reverse primer at 10120583M 1120583lof DNA extract and 95120583l of sterilized water were used Inthe case of polyacrylamide gel analysis 10120583l PCR reactionsmix containing 1 120583l of DNA extract 1120583l 1 mM dNTPs 1120583l10xbuffer (-MgCl2) 1120583l 25 mM MgCl2 03120583l (5 units) TaqDNApolymerase (CWBiotech Beijing China) 08 120583l of eachforward and reverse primer at 10120583M and 41120583l of sterilizedwater were composed in a PCR tube Amplification reactionconditions were as follows initial denaturation of 94∘ for 2min 35 cycles of denaturation at 94∘ for 30 sec annealing at55∘ for 30 sec and extension at 72∘ for 30 seconds followedby 72∘ for 2 min The PCR products generated from 25120583lreaction mix were separated on 15 agarose gel in 05x TAEbuffer stained with ethidium bromide while those obtainedfrom 10 120583l reaction mix were analyzed on 8 polyacrylamidegel stained with silver Visualization was done under UV andwhite light respectively

24 Primers Designing and Molecular Screening Thenucleotide sequence of Ty-3 candidate gene Solyc06g051170was downloaded from ITAG24 release genomic annotationsdatabase (httpssolgenomicsnet) The sequence ofpredicted resistant allele was attributed to wild typetomato S pennellii (accession HG975518) while susceptibleallele was associated with cultivated tomato S lycopersicum(accession HG975445) Alignment was performed betweenthese two sequences using Basic Local Alignment SearchTool of NCBI database (httpwwwncbinlmnihgov) Twoindel sequences (9bp and 10bp indels) were observed andexploited for primers designing Two primer pairs weredesigned to target these indels sequence However only the10bp indel-based primer showed distingue polymorphicand clear genetic band patterns The 10bp indel-basedprimer pair annotated as ACY was used to amplify 132bpDNA fragment from the resistant varieties and 123bp fromsusceptible varieties ATy-3 linked marker P6-25 was used

conjointly for commercial hybrid screening to demonstratethe gene-specific character of ACY Molecular screening wasdone following the methods of Yao et al [38] and Hansonet al [27] with minor modifications PCR was performedon three individuals from each plantrsquos varieties using ACYderived primer pair The entries that showed either 132bpor 123bp length product were considered as homozygoteresistant or susceptible plant respectively while those thatcarried both fragments simultaneously were regarded asheterozygote resistant TYLCV infection was promoted bygrowing these varieties in an opened door greenhouse underhigher pressure of viruliferous whiteflies through July toSeptember 2017

25 Cloning and Sequencing of DNA Fragment A nestedPCR product of ACY-based marker with fragment lengthof 630bp was obtained using Seq-F and Seq-R primer pair(Table 1) located before ACY-F and after ACY-R primersequences respectively The TYLCV390 primers [3] wereused to amplify 390bp DNA fragment from TYLCV inresistant and susceptible plants samples Cloningwas done byligating these amplicons onto pMD19-T Simple Vector afterpurification Constructs (pMD19-T ACY-based marker andpMD19-T-TYLCV fragments) were commercially sequencedby Huada Gene Company Wuhan Alignments of obtainedsequences were performed using DNAMAN software

26 Genetic Analysis of ACY in Segregation of F2 PopulationA total of 111 F

2generations derived from AG208 (commer-

cial resistant tomato hybrid variety) were grown and usedfor phenotypic traits evaluation and genotyping with ACYmaker F

2populationwas analyzed according toYao et al [38]

using Chi-square test with 31 segregation ratio (1205942005

1=384as threshold)

3 Results

31 Characterization of Tomato Yellow Leaf Curl DiseasePhenotypic characterization of commercial tomato plantsagainst TYLCV showed consistency in phenotype betweengreenhouse screening evaluation result and that provided bythe respective seed supplier companies In fact twenty-five(25) hybrid varieties were categorized as resistant to TYLCVand eleven (11) as susceptible to TYLCV infection followingtheir field performance (Suppl Table S1 and Figures 1(a)-1(d)) PCR-based diagnostic performed using a primer pair


M 500bp

M 500bp

M 500bp 1 2 3 4 5 6 7

8 9 10 11 12 13 14 15 16 17

18 19 20 21 22 23 24 25 26 27

390bp

M 0 DSL

M

150bp

M

150bp

1 DSL 2 DSL

M 3 DSL 4 DSL

123bp132bp

123bp132bp

123bp132bp

150bp

(k)(h)(f) (g) (i) (j)

(p)(o)(l)

(r)

(q)

(d)(c)

(b)(a)

(e)

(m) (n)

Figure 1 Disease characterization in commercial hybrid varieties and in F2 population derived from commercial resistant AG208 F1hybrid

(a) Five-week-old asymptomatic resistant tomato seedling of AG208 hybrid (b) Susceptible symptomatic tomato seedling of Hi-tech1 (c)Flowering stage of resistant tomato plants (d) Susceptible tomato plants (e) PCR-based diagnostic performed using TYLCY390 primer pairon DNA from tomato plants at flowering stage (f) Resistant F1 plants form AG208 (g) Upper leaves of resistant F1 plants form AG208 (h-i)Plant upper leaves of F2 individual with 0 DSL (j-k) Plant upper leaves of F2 individual with 1 DSL (l-m) Plant upper leaves of F2 individualwith 2 DSL (n-o) Plant upper leaves of F2 individual with 3 DSL (p-q) Plant upper leaves of F2 individual with 4 DSL (r) Segregation of ACYmarker in F2 population DSL disease symptom level 0 no symptoms 1 slight symptoms visible upon close inspection 2 clear symptomsevident on a portion of the plant 3 heavy symptoms on entire plant and 4 severe symptoms and stunting of entire plantThe plants belongingto scales 0 1 and 2 were considered resistant while 3 and 4 were susceptible Resistance fragment = 132bp and susceptible fragment = 123bp


derived from TYLCV DNA sequence (TYLCV390 primer)as described by Kil et al [3] yielded DNA fragment of390bp from all the infected plants (Figure 1(e)) The obtainedsequences from the cloned 360bp amplicon in alignmentwith that of different TYLCV isolate from Israel and Japanrevealed 98 sequence homology especially with TYLCV-Israel strain [IRBoj28-2] (Figure S1) This is in conformitywith previously reported Chinese TYLCV isolates sharingmore than 97 nucleotide sequence identity with TYLCVIL[ILReo] (X15656) [6]

32 Segregation Analysis with ACYMarker TheACYmarkerwas validated for segregating F

2population derived from

AG208 one of the control commercial hybrids carrying Ty-3gene Phenotypic evaluation of 111 genotypes of F

2population

based on disease symptom showed 75 resistant and 36susceptible plants This is equivalent to the 31 segregationratio revealed by Chi-square test (1205942=326 lt 384 of 1205942

005

with df = 1) (Table S2) Sixty plants were found with nosymptoms ten with slight symptoms expression and five (5)with visible symptoms twenty-five showed severe symptomson entire plant and eleven (11) showed severe symptoms andstunting The first three groups suit the rating scales of 0 1and 2 respectively and were considered resistant while thetwo last groups were considered susceptible (belonging torating scales of 3 and 4) (Figures 1(f)-1(q)) These match theresults obtained when ACY marker was used for genotyping(Figure 1(r))These results support the assumption that resis-tance character is actually under control of a single dominantresistant gene

33 Validation and Accuracy of ACY Marker The devel-oped ACY marker has potentials in differentiating resistantand susceptible tomato varieties to TYLCD Thirty-six (36)tomato hybrids were screened using ACY for commercialresistant and susceptible hybrid varieties in order to checkthe markerrsquos accuracy and reliability Molecular assay usingACYmarker revealed twenty-four commercial resistant vari-eties with heterozygote allele (123bp132bp) one resistanthybrid with homozygote resistant allele (132bp) and eleven(11) susceptible varieties with homozygous susceptible allele(123bp) (Figure 2(a)) This result is in agreement with thefield performance data of the commercial hybrids In orderto confirm ACY for being a resistance gene-specific markerwhich is located within the Ty-3 gene itself a linked makerP6-25 commonly used for marker-assisted selection for Ty-3 gene was later involved in genotyping commercial tomatohybrids Genotype of the thirty-six (36) commercial varietiesusing P6-25 revealed fourteen with homozygote susceptibleallele (320bp) and twenty-two with heterozygote resistantallele (320bp630bp) (Figure 2(b)) It is worthwhile to notethat 320bp amplicon for P6-25 marker is tagged to sus-ceptibility while the amplicons 540bp (Ty-3) 630bp (Ty-3a) or 660bp (Ty-3b) were for resistivity suggesting thatthe resistance commercial hybrid might harbor Ty-3a geneIn this regard all the commercial hybrids might carry Ty-3a gene Genotypic differences were recorded with AG115NongboFenba 1510 and Dongfeng 601 hybrids differing fromthe phenotypic observation Although genotypic screening

with P6-25 revealed that these three hybrids possess themarker locus at the homozygous susceptible state theirphenotypic expression was quiet different Their physicalappearance showed resistance against TYLCV while molec-ular analysis data showed susceptibility bringing about dis-crepancy between phenotypic and molecular analysis Thisdifference might be a result of crossing-over between the P6-25 marker and Ty-3 locus thus the three hybrids can beconsidered as recombinant varieties Prediction using Blasttools in Gramene database (httpwwwgrameneorg) haslocated P6-25 to approximately 620kb from the Ty-3 genelocus while ACY was found in fourth intron of the Ty-3gene Solyc06g051170 (Figures 2(c)-2(d)) The developed ACYmarker is an efficient tool that can help in correcting the dif-ferences between genotype and phenotype analysis of tomatoplants Functional characteristic and efficiency evaluation ofACY marker through sequence analysis using Seq primersshowed 10bp insertion in wild type gene possessed by resis-tant varieties not found in susceptible varieties (Figure 2(e))Graphical representations of ACY and Seq primer amplifiedbands are highlighted in Figure 2(f) The sequencing resulthas confirmed 10 nucleotides deletion in susceptible varietiesas compared to resistant varieties (Figure 2(g))

34 Selection of the Candidate Hybrid Varieties and BreedingLines of Green Port Company for Ty-3 Resistance Gene Phe-notypic traits evaluation and molecular screening test usingACY marker together with P6-25 were performed on onethousand breeding lines and 968 hybrids stocked in GreenPort Company (Suppl Figure S1 a b Table S3 and Table S4)Among the breeding lines 51 showed 132bp of PCR ampliconwhich revealed the presence of Ty-3 resistance gene usingACY In order to investigate whether there is introgressionof three different alleles (Ty-3 Ty-3a and Ty-3b) of Ty-3resistance gene as well as Ty-1 in these breeding lines P6-25and SCAR1were respectively used for screening the resistantbreeding lines Twenty-five out of 51 resistant breeding lineswere detected with Ty-3a 24 lines with Ty-3 and two withTy-1 (Suppl Table S3 and Suppl Figure S1c-d) No line wasdetected to harborTy-3b alleleMeanwhilemolecular screen-ing was done using SCAR2 (Ty-2) to determine whether ornot there is another source of resistance gene in these lines(Suppl Figure S1e) It was found that breeding lines Y-172and Y-49 possess Ty-2 (Suppl Table S3) Another thirty-fivelines also expressed disease resistance in the field HoweverTy-1 Ty-3 and Ty-2 resistance genes could not be detected Itcould be proposed that there might be an alternative sourceof resistance against TYLCD for these varieties In case ofthe 968 candidate hybrids molecular screening 56 carry Ty-3resistance gene as revealed by molecular markers ACY Thisresult is further confirmed using the Ty-3 linked marker P6-25 for screening According to the result obtained fromP6-25we speculate that all the selected 56 candidate hybrids carryTy-3a resistance gene (Suppl Table S4)

4 Discussion

Numerous molecular markers associated with importantgenes for plants of agricultural and horticultural interests


(c)

Solyc06g051170

SL250ch0634372978hellip34361137bp

RSTTATTGGAAACCG- - - - - - - - - - TCGCTCGGAG

(d)

(e)

TTATTGGAAACCAAAAGAAATCATCGCTCGGAG

Chr6

ATGTGA

M 1 2 43 5 6 7 8 9 10 1211750bp

750bpM 13 14 1615 17 18 19 20 21 22 2423

M 25 26 2827 29 30 31 32 33 34 3635750bp 630bp

320bp

630bp

630bp

320bp

320bp

lowastlowastlowastlowast

(g)

Seq-F ACY-F ACY-R Seq-RXChr6(f)

CCCTTTTGATGTCTCGTGAAAGGGTGTGATTGCTTTATTGGAAACCAAAAGAAATCATCGCTCTGGAGACCCTTTTGATGTCTCGTGAAAGGGTGTGATTGCTTTATTGGAAACCAAAAGAAATCATCGCTCTGGAGA

CCCTTATGATGTCTCGTGAAAGGGTGTGATTGCTTTATTGGAAACCG - - - - - - - - - -CCCTTATGATGTCTCGTGAAAGGGTGTGATTGCTTTATTGGAAACCG - - - - - - - - - -

CCCTTTTGATGTCTCGTGAAAGGGTGTGATTGCTTTATTGGAAACCAAAAGAAATCATCGCTCTGGAGA

ATCTATCAAATCAAGCTCTAGGGGATTACTTCAGTCCATACAAGGTTTTCTTCAATCTGTGCTTCAAAAGATCTATCAAATCAAGCTCTAGGGGATTACTTCAGTCCATACAAGGTTTTCTTCAATCTGTGCTTCAAAAG

ATCTATCAAATCAAGCTCTAGGGGATTACTTCAGTCCATACAAGGTTTTCTTCAATCTGTGCTTCAAAAG



FengMan No 7

Hi-techo1Hi-techo2 Reference seq

FengMan No 4

FengMan No 7


FengMan No 4

Forward primer sequence

Reverse primer sequence

10 bp deletion

TCGCTCTGGAGATCGCTCTGGAGA

lowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowast lowastlowastlowastlowastlowastlowastlowastlowastlowastlowast

lowastlowastlowastlowastlowastlowastlowastlowast lowastlowast lowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowast lowastlowastlowastlowastlowastlowastlowastlowastlowastlowast

(b)

21 3 4 5 256 7 98 10 11 13 14 15 16 17 18 19 20 21 2212 26 27 28 29 30 31 32 33 34 35 36M

132bp123bp

23 24lowastlowastlowast(a)

(b)

Figure 2 Genetic characterization of ACY marker (a) Polyacrylamide gel and (b) agarose gel electrophoresis of 36 commercial tomatohybrids using a newly developed ACY marker and Ty-3 linked marker P6-25 respectively (c) Predicted position of ACY on tomatochromosome 6 (d) Structure of Ty-3 gene with 12 exons and 11 introns (e) 10bp indel predicted between S pennellii and S lycopersicumATG and TGA represent start codon and stop codon respectively R indicates S pennellii allele and S indicates S lycopersicum (f) Graphicalrepresentation of fragment size and primers position forACYmarker and those ofDNA sequencing X and vertical line indicate indel positiondashed line with double arrows indicates ACY amplified products (132bp and 123 bp) and double arrows line shows amplified DNA fragmentfor sequencing (630bp) (g) DNA sequencing results confirming 10bp insertion in resistant genotype and 10bp deletion in susceptible onenucleotides in Italic are forward and reverse primers sequence from ACY M in (a) and (b) were 500bp and 2000bp DNA Ladder Markerrespectively 1 Pinkebabe 2 Qianxi 3 Huangrong 4 Jiaxina (74-112) 5 Manxina (73-47) Messina 6 Futesi 72-152 7 Mantian 2025 8Hi-tech1 9 Hi-tech2 10 YuyiliangJingjing 11 Aomei No 1 12 Oudun 13 AG112 14 AG115 15 AG158 16 AG1330 17 Fengman No 7 18FengmanNo 4 19 Dongfeng 601 20 NongboFenba No 1510 21 ZhonghuaLvbao 22 Jinfan102 23 Duoxi13-1 24 Nongqing 12-7 25 Jinpeng703 26 Tianbao 326 27 Yabao 28 Luola 29 Beiying 30 Qidali 31 Fenshou (74-560) RZ F1 32 AG208 33 Mantian 2218 34 Mantian 219935 Jingfan 502 (Ty1 Ty3a) 36 Hongshuang Xi (4224 Asterisk (lowast) represents the recombinants varieties


have been developed [36] Introgression of resistance geneinto cultivated variety has been the principal route of breed-ing against tomato yellow leaf disease (TYLCD) this processrequires development of molecular marker for resistancegene tracking Nowadays resistance gene based techniqueshave the advantage of creating molecular markers linkedto potential functional genes with the ability of providinginformation of the targeted gene [39] The major TYLCDassociated markers generated so far include a tightly linkedmolecular marker SCAR1 for screening of Ty-1 [40] P6-25and FLUW25 for screening of Ty-3 Ty-3a and Ty-3b [13 23]SCAR2 and P1-16 for Ty-2 identification [13 26] Most ofthese markers are recognized as arbitrarily amplified DNA(AAD) fragment markers [36]There is little or limited infor-mation about the genetic distance between thesemarkers andresistance genes locus In most cases a simple recombinationevent is sufficient to negate their utility thus limiting theiruse in MAS [41] As an example genomic location of P6-25could cause recombination event between marker and geneof interest as demonstrated in this study Nowadays gene-targeted and functionalmarker technologies have constituteda breakthrough in marker-assisted selection In this studywe developed a new marker named ldquoACYrdquo for use in MASbased on intron polymorphism of Ty-3 resistance gene intomato Insertion-deletions (indels) of introns are becomingimportant genetic markers for many plant taxa [42] HereACY marker type could be attributed to gene-targeted andfunctional markers group (GTMs and FMs) [36] especiallythe intron-targeting polymorphism (ITP)marker as classifiedby Weining and Langridge [43] Interestingly recombinationevent is rare or impossible between ACY and Ty-3

The Ty-3 is one of the most promising resistant genescommonly used against the occurrence of TYLCD in ChinaUpon the fine mapping experimental research three ORFsSolyc06g051170 Solyc06g051180 and Solyc06g051190 werepredicted as candidate genes [22] Much indel informationhas been recorded from the alignment of Ty-3DNA sequenceof different cultivated and wild type tomato varieties Severalindel markers have been designed for polymorphism assayusing resistant and susceptible varieties The ACY is co-dominant marker that could efficiently distinguish TYLCVresistant allele from susceptible counterpart based on 10nucleotides difference It was observed in this experiment thatACY marker is located in the vicinity of the exon close to thebiggest intron section of Solyc06g051170 locus It is accuratelyvalidated in major resistant commercial hybrids used in thisexperiment with most of them carrying Ty-3 resistant geneSimilarly its segregation ratiowas observed inAG208 derivedF2population which completely matched a single resistant

gene Virus strain diagnostic test from these commercialhybrids (including the resistant and susceptible hybrids)showed more than 98 sequence homology with previouslyreported TYLCV isolates from China Israel TYLCV-IL andJapan TYLCV-Tosa this corroborated the findings of Wu etal [44] and Zhang et al [6] Therefore it could be inferredthat all or most of the plants could be infected naturally thusmaking the field phenotypic observation reliable Thus ACYmarker could be recommended to breeders for detectingand tracking of Ty-3 in tomato resistance breeding program

against TYLCV and will significantly improve tomatoesproduction It may not be advisable to depend solely on asingle type of molecular marker for MAS because it maynot always generate accurate band pattern under differentexperimental conditions A diversity of molecular markerscould be effective for sustainability and validation of MASprocesses

This ACY marker is being used for screening tomatovarieties comprised of 968 hybrid varieties and one thousandbreeding lines stocked in Green Port Company for breedingprogram Actually we have selected 56 hybrids varieties withTy-3a and 51 breeding lines that carry different alleles ofTy-3 gene including Ty-3 Ty-3a and Ty-1 based on P6-25 and SCAR1 markers respectively Diagnostic PCR usingACY has shown 123bp132bp or 132bp amplicons from allthe selected varieties indicating that they incorporate Ty-3resistance geneHerewe speculate thatACYmarkermay havea broad-spectrum application with ability to simultaneouslydetect the presence of Ty-3 Ty-3a and Ty-1 resistant allelesHowever additional research with ACY marker amplifyingTy-3 resistant gene form the genotypes carrying Ty-3 Ty-3aand Ty-1 allele would be required in future for confirmationThe breeding lines that manifest disease resistance withoutcarryingTy-3 are considered having other source of resistancegenes (Ty-4 Ty-5 and Ty-6) These lines can be subjectedto further molecular screening study using the availablemolecular markers for those resistance genes The newlyselected hybrid varieties could have resistance potentialand implication in tomatoes production and in agriculturalextension work in ChinaThe newly identified breeding linesconstitute promising breedingmaterials which could be usedin resistance breeding as new sources of Ty-3 resistancefor tomatoes breeding program We believe that the newlydeveloped marker could serve as an alternative breedingtool to immensely assist the breeders to tract Ty-3 allele intomato plants for breeding programMost of theTy resistancegenes have been reported to be derived from different wildtomato species such as Solanum chilense Solanum peru-vianum Solanum hirsutum Solanum pimpinellifolium andSolanum cheesmanii however little TYLCV resistance breed-ing research work involving Solanum pennellii has been done[13 16 45] Here ACY specific marker is developed basedon the predicted genomic sequence of Ty-3 from S pennelliiindicating that this wild species may also contain TYLCDresistance gene Up to date Ty-3 is commonly known to bederived from S chilense and this is the first report suspectingS pennellii to harbor Ty-3 Besides the development of newmarker for the promotion of breeding efficiency this studytends also to bring closer two tomato wild species in terms ofresistance to TYLCD This information provides evidence ofusing S pennellii in resistant tomato breeding program

Data Availability

1 The primers sequence and molecular screening data usedto support the findings of this study are included within thearticle 2 The patent of the newly developed ACY markeris under submission however the primer sequence data isavailable here for the scientific community 3 Previously


reported markers data and the sequence of their corre-sponding primers used to support this study are availablein this article (Table 1) The related prior studies are cited inReferences The field screening of the breeding lines and allthe hybrids varieties (Our own developed hybrid varietiesand the purchased commercial hybrid varieties) as well astheir respective molecular screening data used to support thefindings of this study are included within the SupplementaryMaterials 5 The tomato breeding lines used to supportthe findings of this study were supplied by Professor SiLongtingManager of Green Port Company Research Centerand then they are under license and cannot be made freelyavailable Requests for access to these materials should bemade to the Manager of Research Center of Green PortCompany Professor Si Longting mobile phone 0086 1880060 2136 e-mail 2582259972qqcom or to Dr AdedzeYMNevame Senior Scientist inGreen Port Company e-mailamennevame07yahoofr 6 All the tomato hybrid varietiesused to support the findings of this study are currently undercommercialization Requests for them will need 12 monthsafter publication of this article

Conflicts of Interest

The authors declare that they have no conflicts of interest

Acknowledgments

The authors are thankful to the Chinese leaders for estab-lishing and promoting talents projects in Jiangsu provinceand Suqian city This work is supported by funding from twotalent projects 2017 Jiangsu Province Entrepreneurial Inno-vation Talent Program and 2017 Suqian City EntrepreneurialInnovation Leading Talent Program The authors are alsothankful to the Institute of Tropical Agriculture and FoodSecurity Universiti Putra Malaysia for technical support topublish this manuscript

Supplementary Materials

Table S1 phenotypic and molecular screening results basedon 36 F1 generation seeds of commercial tomato hybridvarieties Table S2 evaluation of F2 generation of hybridstock for resistance for tomato yellow leaf curl virusTable S3 tomato breeding lines phenotypic and geno-typic selection assay for two consecutive periods TableS4 hybrid varieties selected during the period of twoconsecutive phenotypic observation and molecular analysisassays Figure S1 comparison of the 390bp DNA sequencesbetween six different strains of TYLCV Ty-IS=TYLCV-Israel strain [IRBoj28-2] Ty-Mld=TYLCV-Isolate MldTy-Gs=TYLCV-Isolate Goseong Ty-MMN=TYLCV-IsolateMu Mu5-N Ty-JT= TYLCV-Israel[JapanTosa2005] Ty-GP= TYLCV-Green Port Figure S2 molecular screeningresults of the hybrid varieties and breeding lines (a) molec-ular screening of breeding lines (R-lines=resistant lines andS-lines= susceptible lines) and hybrid varieties using ACYwhere 132bp indicates the presence of resistance genes either

Ty-1 Ty-3 or Ty-3a and 123bp indicates the presence ofsusceptible gene ty-1 ty-3 or ty-3 (b) molecular screeningof hybrid varieties using P6-25 where 630bp indicates thepresence of resistance gene Ty-3a and 320bp the presenceof susceptible gene ty-3 (c) molecular screening of breedinglines using P6-25 where 630bp indicates the presence ofresistance gene Ty-3a 450bp the presence of resistance geneTy-3 and 320bp the presence of susceptible gene ty-3 (d)molecular screening of breeding lines using SCAR1 where530bp indicates presence of resistance gene Ty-1 and 610bpthe presence of susceptible gene ty-1 (e) molecular screeningof breeding lines using SCAR2 where 900bp indicates thepresence of resistance gene Ty-2 and 800bp the presence ofsusceptible one ty-2 M=marker (Supplementary Materials)

References

[1] F Perefarres M Thierry N Becker et al ldquoBiological invasionsof geminiviruses case study of TYLCV and bemisia tabaci inreunion islandrdquo Viruses vol 4 no 12 pp 3665ndash3688 2012

[2] Y Fang X Jiao W Xie et al ldquoTomato yellow leaf curl virusalters the host preferences of its vector bemisia tabacirdquo ScientificReports vol 3 Article ID 2876 2013

[3] E-J Kil S Kim Y-J Lee et al ldquoTomato yellow leaf curl virus(TYLCV-IL) a seed-transmissible geminivirus in tomatoesrdquoScientific Reports vol 6 Article ID 19013 2016

[4] Y Antignus ldquoThe management of tomato yellow leaf curl virusin greenhouses and the open field a strategy of manipulationrdquoTomato Yellow Leaf Curl Virus Disease Management MolecularBiology Breeding for Resistance pp 263ndash278 2007

[5] H Delatte D P Martin F Naze et al ldquoDifferential diseasephenotype of begomoviruses associated with tobacco leaf curldisease in ComorosrdquoArchives of Virology vol 86 pp 1553-15422005

[6] H Zhang H Gong and X Zhou ldquoMolecular characterizationand pathogenicity of tomato yellow leaf curl virus in ChinardquoVirus Genes vol 39 no 2 pp 249ndash255 2009

[7] X Yang W Guo X Ma Q An and X Zhou ldquoMolecularcharacterization of Tomato leaf curl China virus infectingtomato plants in China and functional analyses of its associatedbetasatelliterdquo Applied and Environmental Microbiology vol 77no 9 pp 3092ndash3101 2011

[8] L A McCauley W K Anger M Keifer R Langley MG Robson and D Rohlman ldquoStudying health outcomes infarmworker populations exposed to pesticidesrdquo EnvironmentalHealth Perspectives vol 114 no 6 pp 953ndash960 2006

[9] T Chareonviriyaphap M J Bangs W Suwonkerd M Kong-mee V Corbel and R Ngoen-Klan ldquoReview of insecticideresistance and behavioral avoidance of vectors of human dis-eases in Thailandrdquo Parasites amp Vectors vol 6 no 1 article no280 2013

[10] F Zhu L Lavine S OrsquoNeal M Lavine C Foss and D WalshldquoInsecticide resistance and management strategies in urbanecosystemsrdquo Insects vol 7 no 1 2016

[11] A Elbert and R Nauen ldquoResistance of Bemisia tabaci(Homoptera Aleyrodidae) to insecticides in southern Spainwith special reference to neonicotinoidsrdquo Pest ManagementScience vol 56 no 1 pp 60ndash64 2000

[12] M A Z Chowdhury S Bhattacharjee A N M FakhruddinM N Islam andM K Alam ldquoDetermination of cypermethrin


chlorpyrifos and diazinon residues in tomato and reduction ofcypermethrin residues in tomato using rice branrdquoWorld Journalof Agricultural Research vol 2 pp 30ndash35 2013

[13] Y Ji D J Schuster and J W Scott ldquoTy-3 a begomovirusresistance locus near theTomato yellow leaf curl virus resistancelocus Ty-1 on chromosome 6 of tomatordquo Molecular Breedingvol 20 no 3 pp 271ndash284 2007

[14] J W Scott ldquoBreeding for resistance to viral pathogensrdquo inGenetic improvement of solanaceous crops M K Razdan and AK Mattoo Eds Science Publisher Inc Enfield NH USA 2007

[15] M Caro M G Verlaan O Julian et al ldquoAssessing the geneticvariation of Ty-1 andTy-3 alleles conferring resistance to tomatoyellow leaf curl virus in a broad tomato germplasmrdquoMolecularBreeding vol 35 no 6 2015

[16] M G Verlaan D Szinay S F Hutton et al ldquoChromosomalrearrangements between tomato and Solanum chilense hampermapping and breeding of the TYLCV resistance gene Ty-1rdquoThePlant Journal vol 68 no 6 pp 1093ndash1103 2011

[17] H Chen R Fu and X Li ldquoTomato yellow leaf virus (TYLCV)the structure ecotypes and the resistance germplasm resourcesin tomatordquo African Journal of Biotechnology vol 10 no 62 pp13361ndash13367 2011

[18] S Tabein S A A Behjatnia L Laviano et al ldquoPyramidingTy-1Ty-3 and Ty-2 in tomato hybrids dramatically inhibitssymptom expression and accumulation of tomato yellow leafcurl disease inducing virusesrdquo Archives of Phytopathology andPlant Protection vol 50 no 5-6 pp 213ndash227 2017

[19] M Pilowsky and S Cohen ldquoScreening additional wild tomatoesfor resistance to the whitefly-borne tomato yellow leaf curlvirusrdquo Acta Physiologiae Plantarum vol 22 no 3 pp 351ndash3532000

[20] A P De Castro M J Dıez and F Nuez ldquoInheritance ofTomato yellow leaf curl virus resistance derived from Solanumpimpinellifolium UPV16991rdquo Plant Disease vol 91 no 7 pp879ndash885 2007

[21] G Nombela and M Muniz ldquoHost plant resistance for the man-agement of bemisia tabaci a multi-crop survey with emphasison tomatordquo Bemisia Bionomics and Management of a GlobalPest pp 357ndash383 2010

[22] M G Verlaan S F Hutton R M Ibrahem et al ldquoThetomato yellow leaf curl virus resistance genes Ty-1 and Ty-3are allelic and code for DFDGD-class RNA-dependent RNApolymerasesrdquo PLoS Genetics vol 9 no 3 Article ID e10033992013

[23] Y Ji M S Salus B van Betteray et al ldquoCo-dominant SCARmarkers for detection of the Ty-3 and Ty-3a loci from Solanumchilense at 25 cM of chromosome 6 of tomatordquo Tomato GeneticsCooperative vol 57 pp 25ndash28 2007

[24] A Junker MMMuraya KWeigelt-Fischer et al ldquoOptimizingexperimental procedures for quantitative evaluation of cropplant performance in high throughput phenotyping systemsrdquoFrontiers in Plant Science vol 5 pp 1ndash21 2015

[25] E Moriones S Garcıa-Andres and J Navas-Castillo ldquoRecom-bination in the TYLCV complex a mechanism to increasegenetic diversity Implications for plant resistance develop-mentrdquo in Tomato Yellow Leaf Curl Virus Disease SpringerDordrecht 2007

[26] X Yang M Caro S F Hutton et al ldquoFine mapping of thetomato yellow leaf curl virus resistance gene Ty-2 on chromo-some 11 of tomatordquo Molecular Breeding vol 34 no 2 pp 749ndash760 2014

[27] P Hanson S-F Lu J-F Wang et al ldquoConventional and molec-ular marker-assisted selection and pyramiding of genes formultiple disease resistance in tomatordquo Scientia Horticulturaevol 201 pp 346ndash354 2016

[28] G Ramkumar A K P Sivaranjani M K Pandey et alldquoDevelopment of a PCR-based SNP marker system for effectiveselection of kernel length and kernel elongation in ricerdquoMolecular Breeding vol 26 no 4 pp 735ndash740 2010

[29] G Ramkumar K Srinivasarao K M Mohan et al ldquoDevelop-ment and validation of functional marker targeting an InDelin the major rice blast disease resistance gene Pi54 (Pikh)rdquoMolecular Breeding vol 27 no 1 pp 129ndash135 2011

[30] V A Sorri K N Watanabe and J P Valkonen ldquoPredictedkinase-3a motif of a resistance gene analogue as a uniquemarker for virus resistancerdquo Theoretical and Applied Geneticsvol 99 no 1-2 pp 164ndash170 1999

[31] K Kasai YMorikawaVA Sorri J P TValkonen CGebhardtand K N Watanabe ldquoDevelopment of SCAR markers to thePVY resistance gene RY(adg) based on a common feature ofplant disease resistance genesrdquo Genome vol 43 no 1 pp 1ndash82000

[32] J P T Valkonen K Wiegmann J H Hamalainen W Mar-czewski and K N Watanabe ldquoEvidence for utility of the samePCR-basedmarkers for selection of extreme resistance to Potatovirus Y controlled by Rysto of Solanum stoloniferum derivedfrom different sourcesrdquo Annals of Applied Biology vol 152 no1 pp 121ndash130 2008

[33] J R Andersen and T Lubberstedt ldquoFunctional markers inplantsrdquo Trends in Plant Science vol 8 no 11 pp 554ndash560 2003

[34] B Arnholdt-Schmitt ldquoFunctional markers and a rsquosystemicstrategyrsquo convergency between plant breeding plant nutritionand molecular biologyrdquo Plant Physiology and Biochemistry vol43 no 9 pp 817ndash820 2005

[35] R K Varshney T Mahendar R K Aggarwal and A BornerldquoGenic molecular markers in plants development and applica-tionsrdquo Genomics-Assisted Crop Improvement vol 1 pp 13ndash292007

[36] P Poczai I Varga M Laos et al ldquoAdvances in plant gene-targeted and functional markers a reviewrdquo Plant Methods vol9 no 1 2013

[37] S F Hutton and J W Scott ldquoTy-6 a major begomovirusresistance gene located on chromosome 10rdquo Report of theTomato Genetics Cooperative TGC Report vol 64 2014

[38] Z P Yao Q J Ye R Q Wang et al ldquoMolecular mapping andidentifying PCR-based markers conferring Ty-3a a resistantgene to tomato yellow leaf curl virusrdquoMolecular Plant Breedingvol 3 pp 595ndash600 2015

[39] B Brugmans D Wouters H Van Os et al ldquoGenetic mappingand transcription analyses of resistance gene loci in potato usingNBS profilingrdquo Theoretical and Applied Genetics vol 117 no 8pp 1379ndash1388 2008

[40] W Fu X R Xin Y Jin and H X Wang ldquoIdentification oftomato Ty-1 Ty-2 and Ty-3 genes by multiplex PCRrdquo Chinesejournal of Horticultural no Fourth 2013 (Chinese)

[41] J A Rafalski and S V Tingey ldquoGenetic diagnostics in plantbreeding RAPDs microsatellites and machinesrdquo Trends inGenetics vol 9 no 8 pp 275ndash280 1993

[42] U Vali M Brandstrom M Johansson and H EllegrenldquoInsertion-deletion polymorphisms (indels) as genetic markersin natural populationsrdquo BMC Genetics vol 9 p 8 2008


[43] S Weining and P Langridge ldquoIdentification and mappingof polymorphisms in cereals based on the polymerase chainreactionrdquo Theoretical and Applied Genetics vol 82 no 2 pp209ndash216 1991

[44] J BWu FMDai andX P Zhou ldquoFirst report of tomato yellowleaf curl virusin Chinardquo Plant Disease vol 90 no 10 pp 1359-1359 2006

[45] Q J Ye Y J Yang R Q Wang et al ldquoProgress in researchon TYLCD-resistant breeding of tomatordquo Scientia AgriculturaSinica vol 42 pp 1230ndash1242 2009 (Chinese)

Hindawiwwwhindawicom

International Journal of

Volume 2018

Zoology

Hindawiwwwhindawicom Volume 2018

Anatomy Research International

PeptidesInternational Journal of



Journal of Parasitology Research

GenomicsInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom Volume 2013Hindawiwwwhindawicom

The Scientific World Journal

Volume 2018


BioinformaticsAdvances in

Marine BiologyJournal of



Neuroscience Journal


BioMed Research International

Cell BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawiwwwhindawicom Volume 2018


Genetics Research International


Advances in

Virolog y Stem Cells International



Enzyme Research



MicrobiologyHindawiwwwhindawicom

Nucleic AcidsJournal of

Volume 2018

Submit your manuscripts atwwwhindawicom


1 Introduction

Tomato yellow leaf curl disease (TYLCD) inflicted bywhitefly-transmitted species of Begomovirus genus (Gemi-niviridae) is one of the most devastating tomato disease (Slycopersicum) worldwide The potential of TYLCV to wreakhavoc on tomato was initially reported in Israel in the late1930s and 1960s with a severe outbreak on tomato plantsrecorded in the Mediterranean basin [1] The biotype Bvector B tabaci accounts for the dramatic spread of TYLCVthrough Africa Europe Asia the Caribbean and NorthAmerica [2] TYLCV is an economically important plantpathogen with yield losses in tomato reaching 100 [1 3ndash5]Tomato yellow leaf curl disease survey followed by sequenceanalysis across six tomato growing regions in China showedsequence identity of up to 98 among TYLCV isolates [6]These isolates shared more than 97 sequence identity withTYLCVIL [ILReo] (X15656) an Israel isolate [6] TYLCVwith nucleotide sequence homology of more than 90 couldbe regarded as strains of the same virus [7]Themanagementof TYLCD is dependent on the intensive use of insecticidesto control vector (B tabaci) populations [8] This chemicalcontrol measure is partially effective against insect vectorsNevertheless it is expensive and labor intensive and oftenresults in chemical residue buildup subsequently leading tothe development of pesticide resistance insect populations[8ndash11] In addition intensive and inaccurate application ofinsecticides could generate environmental pollutants andpesticide poisoning via toxin retention in tomato fruit [12]One of the efficient ways to alleviate or manage TYLCDis introgression of virus resistance into cultivated plantsPrevious research works have focused on the determinationof natural sources of virus resistance and have been identifiedin tomato wild relatives including S pimpinellifolium S peru-vianum S chilense S habrochaites and S cheesmaniae [3 1314] Genetic mapping analysis has led to the identification ofdifferent TYLCD resistanttolerances loci being exploited intomato breeding from S habrochaites (Ty-2) S peruvianum(ty-5) and S chilense (Ty-1 Ty-3 and Ty-4) [15ndash20] Amongthese S chilense has been used extensively as resistancedonor parent [21] with Ty-1 recognized as promising sourceof TYLCV resistance [22] The gene Ty-1 was identified asallelic to the group of genes Ty-3 Ty-3a and Ty-3b [16 23]whereas three ORFs were predicted as candidate gene of Ty-1 Ty-3 [22] Conventional tomato breeding solely dependson phenotypic traits selection for resistant cultivar How-ever the impacts of environmental conditions on phenotypegreatly affect its selection efficiency Field screening is acomplex and time consuming process which requires specificgrowing conditions [24 25] With the advent of marker-assisted selection (MAS) as a modern molecular biologytechnique the rapidity and efficiency of resistant cultivardevelopment have been greatly enhanced Progressive effortsmade in the development ofTy-1Ty-3 resistant genes-derivedmolecular markers for MAS in tomato cleaved amplifiedpolymorphic sequence (CAPS) and sequence-characterizedamplified region (SCAR) markers are significant [26 27]However concerns have been raised regarding their physicalposition relative to the resistance gene in the genome

arguing the possibility of false negative or false positiveresults during breeding programs [4 26] To circumventthe aforementioned problem gene-specificmarker techniquewas introduced aimed at developing molecular markerswith gene specificity [28 29] This led to the developmentof gene-targeted markers (GTMs) and functional markers(FMs) resistance gene based markers (RGMs) and RNA-based markers (RBMs) [30ndash32] According to Andersenand Lubberstedt [33] functional markers are polymorphicDNA sequences that are likely to be involved in phenotypictrait variation while gene-targeted markers are gene specificand capable of tagging untranslated regions [34 35] RGMcan allow tracking the resistant gene in new germplasmssegregating population for promoting gene pyramiding inplant Based on recently reported research findings intronlength polymorphism seems to be a convenient and reliablesource of information with high interspecies transferability[36] We speculated that marker developed by exploitingsuch information might contribute to the compensating ofthe discrepancy observations often encountered betweengenotypes and phenotypes during breeding programs Infor-mation regarding intron polymorphism based molecularmaker for TYLCV resistance marker-assisted selection intomato breeding is lacking

Here we developed and reported a new marker namedACY in the basis of indel-10 nucleotides for Ty-3Ty-1 geneSolyc06g051170 between cultivated tomato (S lycopersicum)and wild type tomato (S pennellii) This marker can be usedas a powerful tool in segregating resistant from susceptibletomato plants PCR amplification amplicon revealed 132bpand 123bp DNA fragment from TYLCV resistant varieties(R) and susceptible varieties respectively Screening of com-mercial F

1hybrids and segregating F

2population showed

reliability and accuracy with ACY marker

2 Materials and Methods

21 Plant Materials Thirty-six (36) commercial varietiesone thousand (1000) breeding lines and nine hundred andsixty-eight (968) hybrid varieties of tomato were used Thecommercial hybrids were purchased from different seedcompanies The hybrids and breeding lines constituted thecandidate of tomato varieties stock of Jiangsu Green PortModern Agriculture Development Company (abbreviated asGreen Port) Seeding transplanting and plants managementwere handled following the standard practice of Green PortTo conduct the phenotypically selection assay tomato plantswere transplanted in greenhouse to meet the critical periodof whiteflies invasion

22 Tomato Yellow Leaf Curl Disease Evaluation A diseaserating scales of 0 to 4 were adopted and used as describedby Hutton and Scott [37] On the rating scale 0 1 2 3 and4 signified no symptoms slight symptoms visible upon closeinspection clear symptoms evident on a portion of the plantheavy symptoms on entire plant and severe symptoms andstunting of the entire plant respectively The plants that wererated on the scale of 0 1 and 2 were considered resistantwhile those of 3 and 4 were susceptible













1=384as threshold)

3 Results



M 500bp

M 500bp

M 500bp 1 2 3 4 5 6 7

8 9 10 11 12 13 14 15 16 17

18 19 20 21 22 23 24 25 26 27

390bp

M 0 DSL

M

150bp

M

150bp

1 DSL 2 DSL

M 3 DSL 4 DSL

123bp132bp

123bp132bp

123bp132bp

150bp

(k)(h)(f) (g) (i) (j)

(p)(o)(l)

(r)

(q)

(d)(c)

(b)(a)

(e)

(m) (n)








2population


005





4 Discussion



(c)

Solyc06g051170

SL250ch0634372978hellip34361137bp


(d)

(e)


Chr6

ATGTGA

M 1 2 43 5 6 7 8 9 10 1211750bp

750bpM 13 14 1615 17 18 19 20 21 22 2423

M 25 26 2827 29 30 31 32 33 34 3635750bp 630bp

320bp

630bp

630bp

320bp

320bp


(g)









FengMan No 7


FengMan No 4

FengMan No 7


FengMan No 4



10 bp deletion




(b)

21 3 4 5 256 7 98 10 11 13 14 15 16 17 18 19 20 21 2212 26 27 28 29 30 31 32 33 34 35 36M

132bp123bp


(b)








Data Availability






Acknowledgments





References



















































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018














1=384as threshold)

3 Results



M 500bp

M 500bp

M 500bp 1 2 3 4 5 6 7

8 9 10 11 12 13 14 15 16 17

18 19 20 21 22 23 24 25 26 27

390bp

M 0 DSL

M

150bp

M

150bp

1 DSL 2 DSL

M 3 DSL 4 DSL

123bp132bp

123bp132bp

123bp132bp

150bp

(k)(h)(f) (g) (i) (j)

(p)(o)(l)

(r)

(q)

(d)(c)

(b)(a)

(e)

(m) (n)








2population


005





4 Discussion



(c)

Solyc06g051170

SL250ch0634372978hellip34361137bp


(d)

(e)


Chr6

ATGTGA

M 1 2 43 5 6 7 8 9 10 1211750bp

750bpM 13 14 1615 17 18 19 20 21 22 2423

M 25 26 2827 29 30 31 32 33 34 3635750bp 630bp

320bp

630bp

630bp

320bp

320bp


(g)









FengMan No 7


FengMan No 4

FengMan No 7


FengMan No 4



10 bp deletion




(b)

21 3 4 5 256 7 98 10 11 13 14 15 16 17 18 19 20 21 2212 26 27 28 29 30 31 32 33 34 35 36M

132bp123bp


(b)








Data Availability






Acknowledgments





References



















































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018



M 500bp

M 500bp

M 500bp 1 2 3 4 5 6 7

8 9 10 11 12 13 14 15 16 17

18 19 20 21 22 23 24 25 26 27

390bp

M 0 DSL

M

150bp

M

150bp

1 DSL 2 DSL

M 3 DSL 4 DSL

123bp132bp

123bp132bp

123bp132bp

150bp

(k)(h)(f) (g) (i) (j)

(p)(o)(l)

(r)

(q)

(d)(c)

(b)(a)

(e)

(m) (n)








2population


005





4 Discussion



(c)

Solyc06g051170

SL250ch0634372978hellip34361137bp


(d)

(e)


Chr6

ATGTGA

M 1 2 43 5 6 7 8 9 10 1211750bp

750bpM 13 14 1615 17 18 19 20 21 22 2423

M 25 26 2827 29 30 31 32 33 34 3635750bp 630bp

320bp

630bp

630bp

320bp

320bp


(g)









FengMan No 7


FengMan No 4

FengMan No 7


FengMan No 4



10 bp deletion




(b)

21 3 4 5 256 7 98 10 11 13 14 15 16 17 18 19 20 21 2212 26 27 28 29 30 31 32 33 34 35 36M

132bp123bp


(b)








Data Availability






Acknowledgments





References



















































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018







2population


005





4 Discussion



(c)

Solyc06g051170

SL250ch0634372978hellip34361137bp


(d)

(e)


Chr6

ATGTGA

M 1 2 43 5 6 7 8 9 10 1211750bp

750bpM 13 14 1615 17 18 19 20 21 22 2423

M 25 26 2827 29 30 31 32 33 34 3635750bp 630bp

320bp

630bp

630bp

320bp

320bp


(g)









FengMan No 7


FengMan No 4

FengMan No 7


FengMan No 4



10 bp deletion




(b)

21 3 4 5 256 7 98 10 11 13 14 15 16 17 18 19 20 21 2212 26 27 28 29 30 31 32 33 34 35 36M

132bp123bp


(b)








Data Availability






Acknowledgments





References



















































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018



(c)

Solyc06g051170

SL250ch0634372978hellip34361137bp


(d)

(e)


Chr6

ATGTGA

M 1 2 43 5 6 7 8 9 10 1211750bp

750bpM 13 14 1615 17 18 19 20 21 22 2423

M 25 26 2827 29 30 31 32 33 34 3635750bp 630bp

320bp

630bp

630bp

320bp

320bp


(g)









FengMan No 7


FengMan No 4

FengMan No 7


FengMan No 4



10 bp deletion




(b)

21 3 4 5 256 7 98 10 11 13 14 15 16 17 18 19 20 21 2212 26 27 28 29 30 31 32 33 34 35 36M

132bp123bp


(b)








Data Availability






Acknowledgments





References



















































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018








Data Availability






Acknowledgments





References



















































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018






Acknowledgments





References



















































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018








































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018








Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018




Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018


Documents

Development of a New Molecular Marker for the Resistance ...downloads.hindawi.com › journals › bmri › 2018 › 8120281.pdf · in tomato (Solanum lycopersicumL.) yield worldwide