Development 142: doi:10.1242/dev.115774: Supplementary ... · Scale bar: 40 μm. (F) Development of pharyngeal arches, pouches and cartilages in individual efnb2a mutants and wild-type

Development 142: doi:10.1242/dev.115774: Supplementary Material

Supplementary Figures

Figure S1. Eph-ephrin gene expression within the 30-hpf zebrafish head. Fluorescent

in situ hybridization (green) shows expression of efnb2a (A,B), efnb3b (C,D) and ephb4a

(E,F) relative to sox10:GFP+ neural crest-derived mesenchyme (red in A,C,E) and

nkx2.5:GFP+ mesoderm (red in B,D,F). In addition to staining in pouches p3, p4 and p5,

we also observed expression of efnb2a in neural crest-derived cells (arrowheads in A) and

ephb4a expression in ventral arch mesoderm (arrowheads in F) adjacent to more mature

pouches. Scale bar: 20 μm.

Development | Supplementary Material


Figure S2. EphB signaling in pouch, CB cartilage and neural crest development. (A)

An MO was designed against the exon 3 (E3)-intron 3 splice junction of efnb3b. In un-

injected control embryos, normal splicing of exons 3/4 resulted in excision of intron 3

(2498 bp) and loss of PCR amplification of 24-hpf embryonic cDNA by the designated



primers (arrows of PCR I) and amplification of a 162 bp band spanning exons 3/4 (arrows

of PCR II). By contrast, 24-hpf embryos injected with 1 nL of 300 μM efnb3b MO at the

one-cell stage resulted in amplification of a 502 bp band (PCR I) and a 2660 bp band

(PCR II), and loss of the 162 bp band spanning exons 3/4 (PCR II), due to a failure to

splice out intron 3. (B) Alcama immunohistochemistry reveals normal pouches in efnb3b-

MO and ephb4a-/- single mutants, and disrupted pouches in efnb3b-MO; ephb4a-/- and

efnb2a-/-; efnb3b-MO; ephb4a-/- compound mutants. Whereas injection of a translation-

blocking efnb3b morpholino (efnb3b-MOTB) enhanced the defects of efnb2a mutant

pouches, injection of a control morpholino antisense to the splice-blocking morpholino

failed to enhance. Forced expression of a dominant-negative KD-Pak2a transgene in the

nkx2.3+ endoderm (nkx2.3:Gal4VP16; UAS:KD-Pak2a) also resulted in reduced numbers

of dysmorphic pouches. Compared with non-transgenic efnb2a-/- or efnb2a-/-; efnb3b-MO

siblings, the sox10:Efnb2a transgene did not rescue pouches in EphrinB-deficient mutants.

Arrowheads denote malformed pouches. Scale bar: 40 μm. (C) Alcian Blue staining of

cartilage reveals no CB defects in efnb3b-MO and ephb4a-/- single mutants, and lost

and/or fused CBs in efnb3b-MO; ephb4a-/- and efnb2a-/-; efnb3b-MO; ephb4a-/- compound

mutants, as well as in embryos with endoderm-specific Pak2a disruption. Injection of a

translation-blocking but not a control efnb3b-MO into efnb2a mutants enhanced CB

defects of efnb2a mutants. sox10:Efnb2a transgene in either efnb2a single mutants or

efnb2a-/-; efnb3b-MO compound animals failed to rescue losses of CBs and fusions of CH

and CB1. (D) Immunohistochemistry at 18 hpf shows that Efnb2a protein is lost in efnb2a

mutants and restored to migratory neural crest mesenchyme by the sox10:Efnb2a

transgene. her5:mCherryCAAX labels pre-pouch endoderm where Efnb2a expression is

not restored. Confocal projections are shown. Scale bar: 40 μm. (E) Fluorescent in situ

hybridization for dlx2a (green) at 16.5 hpf shows no intermingling of neural crest cells

between the three migrating streams (numbered) in embryos with losses of EphrinB



ligands and EphB receptors. Scale bar: 40 μm. (F) Development of pharyngeal arches,

pouches and cartilages in individual efnb2a mutants and wild-type siblings. In wild types at

34 hpf, labeling of neural crest-derived cells by sox10:GFP (green) shows six arches, and

labeling by her5:mCherryCAAX (red) shows five pouches. Note that arches 2 and 3 are

fully separated by the second pouch (yellow arrow), and by 5 dpf, Alcian Blue staining

reveals that the CH and CB1 cartilages are well separated. In the efnb2a-/- example, the

second pouch does not extend as far ventrally (yellow arrow) and arches 2 and 3 appear

fused ventrally. In this same animal at 5 dpf, CH and CB1 cartilages are also fused

ventrally (arrow). Scale bar: 40 μm. (G) Quantification of pouch and CB defects. Data

represent mean±s.e.m. n.s., not significant.



Figure S3. Requirements of Eph-ephrin signaling in pouch morphology. (A-E) High

magnification confocal sections show pouches p4 and p5 labeled by Alcama

immunohistochemistry at 34 hpf. In contrast to wild-type pouch epithelial cells that form

bilayers with straight lines of apical membranes, pouch epithelial cells from Eph-ephrin

deficient embryos appear disorganized.



Figure S4. Parallel requirements for Pak2a and Alcama in pouch and CB cartilage

development. (A) Double immunohistochemistry of pPAK-S143 (red) with Alcama (green)

during maturation of the fifth pouch in wild types. As pouch development proceeds,

Alcama becomes progressively enriched at sites of cell-cell contact while pPAK-S143

staining increases. Scale bar: 20 μm. (B) Immunohistochemistry shows that Efnb2a

protein (green) is still present in her5:mCherryCAAX+ pouches (red cell membranes) in

wnt4a-/- mutants and wild-type siblings. Efnb2a protein is also unaffected in surrounding



neural-crest-derived cells (not labeled red) of wnt4a-/- mutants. (C) Fluorescent in situ

hybridization shows ephb4a expression (green, arrowheads) in nascent her5:GFP+

pouches (labeled red by anti-GFP immunohistochemistry) in wnt4a mutants and wild-type

siblings. Scale bar: 40 μm.(D) Double immunohistochemistry shows that pPAK-S143

staining (red) is reduced in the posterior pouches labeled by Alcama (green) of embryos

expressing kinase-dead Ephb4a (nkx2.3:Gal4VP16; UAS:KD-Ephb4a) or dominant-

negative Cdc42 (nkx2.3:Gal4VP16; UAS:DN-Cdc42) specifically in the endoderm. (E)

Fluorescent in situ hybridization shows pak2a expression (green, arrowheads) in the

her5:GFP+ pouches (labeled red by anti-GFP immunohistochemistry) in wild types,

efnb2a-/-; efnb3b-MO embryos and nkx2.3:Pak2a; efnb2a-/-; efnb3b-MO embryos. (F)

Immunohistochemistry shows E-cadherin protein (green) within pouches p4 and p5. In

pak2a mutants or embryos expressing dominant-negative Pak2a specifically in the

endoderm (nkx2.3:Gal4VP16; UAS:KD-Pak2a), E-cadherin staining is mildly reduced.

Whereas injection of a low dose of alcama-MO (50 μM) into wild types causes no defects

in E-cadherin localization, injection into pak2a mutants causes a greater reduction of E-

cadherin staining (arrowhead) than seen in pak2a mutants alone. Scale bar: 20 μm. (G)

Alcama immunohistochemistry reveals more severe defects in pouches in pak2a-/-;

alcama-MO (50 μM) compound animals than in single pak2a mutants or alcama-MO

animals. In addition, the nkx2.3:Pak2a transgene fails to rescue the pouch defects of

efnb2a-/-; efnb3b-MO animals. Scale bar: 40 μm. (H) Alcian Blue staining reveals more

severe losses of CB cartilages in pak2a-/-; alcama-MO (50 μM) compound animals

compared with single pak2a mutants or alcama-MO animals. In addition, the nkx2.3:Pak2a

transgene fails to rescue the CB cartilage defects of efnb2a-/-; efnb3b-MO animals. (I)

Quantification of E-cadherin staining reduction. Data represent mean±s.e.m. P-values are

shown. (J) Quantification of pouch and CB defects. Data represent mean±s.e.m. *** shows

P<0.001 compared with pak2a mutants or alcama-MO animals. n.s., not significant.



Figure S5. Requirement of E-cadherin in pouch morphogenesis. (A-D) Forced

expression of a dominant-negative N-terminally-truncated E-cadherin transgene in pouch

endoderm (nkx2.3:Gal4VP16; UAS:∆N-E-cadherin) resulted in reduced numbers of

dysmorphic pouches (B), as well as fusions of CB cartilages (D). Scale bar: 40 μm. (E)

Quantification of pouch and CB defects. Data represent mean±s.e.m. *** shows P<0.001

relative to non-transgenic ‘wild-type’ siblings.



Supplementary Movie

Movie S1. Pouch disintegration phenotypes in embryos defective for Eph-ephrin or

Pak2a signaling. Time-lapse recordings show development of the fourth through sixth

pouches (25 to 35 hpf) in embryos expressing her5:mCherryCAAX (red). Partial

projections of multiple z-stacks are shown to capture cell behaviors across multiple cell

layers. In wild types (A), the fourth to sixth pouches form sequentially from anterior to

posterior. Groups of epithelial cells emerge from the pre-pouch endoderm, collectively

migrate towards lateral positions (down), and then coalesce into mature bilayers that are

much less migratory. In contrast in embryos lacking EphrinBs (efnb2a-/-; efnb3b-MO),

expressing dominant-negative EphB receptor in the endoderm (nkx2.3:Gal4VP16;

UAS:KD-Ephb4a), or mutant for pak2a, pouch epithelial cells initially migrate laterally but

then fail to cease migratory behavior and break into small groups of dissociated cells.


http://www.biologists.com/DEV_Movies/DEV115774/Movie1.mov


Supplementary Materials and Methods

For genotyping of efnb2ahu3393, primers efnb2a-GT-F2 and efnb2a-GT-R were designed to

convert efnb2ahu3393 into a codominant polymorphism, with a wild-type product of 315 bp

and mutant products of 276 and 39 bp after Hpy188III digestion. The ephb4ahu3378

mutation changes nucleotide AGA to TGA and creates a premature stop codon that

deletes the entire cytoplasmic domain of the EphB4a protein. For genotyping, primers

ephb4a(hu3378)-F and ephb4a(hu3378)-R were designed to turn ephb4ahu3378 into a

codominant polymorphism, with a wild-type product of 731 bp and mutant products of 470

and 261 bp after AlwNI digestion. For pME-Efnb2a and pME-Pak2a, the full-length

sequence of efnb2a and pak2a was amplified from multi-stage zebrafish cDNA according

to manufacturer instructions (Phusion, NEB) and cloned into pDONR221. The

Pak2aCAAX fusion protein was generated through fusion PCR (Szewczyk et al., 2006) to

fuse the last 21 amino acids of human H-ras (CAAX box) (Moriyoshi et al., 1996) to the C-

terminus of Pak2a. The Pak2aCAAX cDNA was then cloned into pDONR221 to generate

pME-Pak2aCAAX. A point mutation was induced by fusion PCR to generate EphB4aK662R

(KD-EphB4a) and Pak2aK299R (KD-Pak2a), which have been described as a kinase dead

mutant for EphB receptor (Zisch et al., 1998) and for PAK kinases in general (Sells et al.,

1997; Tang et al., 1997). The KD-EphB4a and KD-Pak2a cDNAs were cloned into

pDONR221 to generate pME-KD-EphB4a and pME-KD-Pak2a. In order to generate a

version of E-cadherin deleted for the extracellular domain, which has been reported to

dominantly block E-cadherin function in other contexts (Nieman et al., 1999), the

sequence of transmembrane and cytoplasmic domains of E-cadherin was directly

amplified from multi-stage zebrafish cDNA and was cloned into pDONR221. After LR

cloning with p3E-pA, p5E-nkx2.3, p5E-sox10, or p5E-UAS, and pDestTol2CG2

(myl7:EGFP) or pDestTol2AB (cryaa:Cerulean), plasmids were injected at 30 ng/μl with 35

ng/μl Tol2 transposase RNA into one-cell stage embryos. Four each of



Tg(nkx2.3:EfnB2a:pA) and Tg(nkx2.3:Pak2aCAAX:pA) and two each of

Tg(sox10:EfnB2a:pA) and Tg(nkx2.3:Pak2a:pA) were isolated based on myl7:EGFP which

produces green fluorescence in the heart. Also, five each of Tg(UAS:KD-EphB4a:pA),

Tg(UAS:KD-Pak2a:pA), and Tg(UAS:∆N-E-cadherin:pA) were isolated based on α-

cryaa:Cerulean which produces blue fluorescence in the lens. We used stable lines

Tg(nkx2.3:Efnb2a:pA; myl7:EGFP)el589, Tg(nkx2.3:Pak2aCAAX:pA; myl7:EGFP)el590,

Tg(nkx2.3:Pak2a:pA)el605, Tg(UAS:KD-EphB4a:pA; cryaa:Cerulean)el225, Tg(UAS:KD-

Pak2a:pA; cryaa:Cerulean)el530 and Tg(UAS:∆N-E-cadherin:pA; cryaa:Cerulean)el321 for

this study.

Genotyping primers

efnb2a-GT-F2: 5’-TTATAAACTCTATATGGTTCCTCTGTA-3’

efnb2a-GT-R: 5’-CCACGACCCACTAAAACA-3’

ephb4a(hu3378)-F: 5’-GACTTCCTACTGCGCAAA-3’

ephb4a(hu3378)-R: 5’-CTACCACCACACTGGAGC-3’

Primers used to create transgenic constructs

Efnb2a_B1F: 5’-

GGGGACAAGTTTGTACAAAAAAGCAGGCTGAAACGGAATTTGACCGT-3’

Efnb2a_B2R: 5’-

GGGGACCACTTTGTACAAGAAAGCTGGGTGCATGTGAGGGGTTAGAGT-3’

Pak2a-CAAX_B1F: 5’-

GGGGACAAGTTTGTACAAAAAAGCAGGCTCCACCATGTCTGACAACGGAGAGC-3’

Pak2a-CAAX_MR: 5’-GGTTCAGCTTACGGTTACTCT-3’

Pak2a-CAAX_MF: 5’-AGAGTAACCGTAAGCTGAACC-3’



Pak2a-CAAX_B2R: 5’-

GGGGACCACTTTGTACAAGAAAGCTGGGTCGTTTCCCGTTGAATATG-3’

Pak2a_B2R: 5’-

GGGGACCACTTTGTACAAGAAAGCTGGGTTTAACGGTTACTCTTCAT-3’

Ephb4a_B1F: 5’-

GGGGACAAGTTTGTACAAAAAAGCAGGCTGGTACAACAAGACCCAGCTG-3’

Ephb4a(K662R)_MR: 5’-TCAGGGTCCTGATGGCC-3’

Ephb4a(K662R)_MF: 5’-GGCCATCAGGACCCTGA-3’

Ephb4a_B2R: 5’-

GGGGACCACTTTGTACAAGAAAGCTGGGTTCAGTACAGCACATTCCCTG-3’

Pak2a_B1F: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGAGCTTTCCATCAGGGTT-

3’

Pak2a(K299R)_MR: 5’-AGGTTAATCTGCCTAATAGCAAC-3’

Pak2a(K299R)_MF: 5’-GTTGCTATTAGGCAGATTAACCT-3’

Pak2a_B2R: 5’-

GGGGACCACTTTGTACAAGAAAGCTGGGTGACTAGAAGGGGCTCTGC-3’

∆N-Ecad_B1F: 5’-

GGGGACAAGTTTGTACAAAAAAGCAGGCTCCACCATGGAGGCATTCCAATGTACTG-

3’

∆N-Ecad_B2R: 5’-

GGGGACCACTTTGTACAAGAAAGCTGGGTGAGCCATCGCAACATATC-3’

Primers used to confirm the efficiency of efnb3b-MO

efnb3b-MO_F: 5’-CTGGAGAGCATGAGAGGA-3’

efnb3b-MO_R: 5’-AAACGGGAAAAGAACGAC-3’

efnb3b-MO_E3_F: 5’- CTACATCAGACGGGACGC-3’

efnb3b-MO_E4_R: 5’- CTGGGTTTGGGTTGTTGA-3’



Primers used to create in situ probes

efnb2a-r-F: 5’-GTGTGGAAGGTGGTTCAA-3’

efnb2a-r-R: 5’-AGTGGGATGATGATGTCG-3’

efnb3b-r-F: 5’-CGTCTGGATCTCATTTGC-3’

efnb3b-r-R: 5’-GGTCAGAGAGGAGAGGGA-3’

ephb4a-r-F: 5’-GAGGATTCCGGGTAAGAA-3’

ephb4a-r-R: 5’-CGGTAATCCTGCTCAATG-3’

pak2a-r-F: 5’-GCAGAGCCCCTTCTAGTC-3’

pak2a-r-R: 5’-CTGATTCCTGTCCCCTCT-3’

Probes were generated by PCR, cloned into pGEM-T Easy Vector Systems (Promega),

and digoxigenin-labeled RNAs or dinitrophenol-labeled RNAs were synthesized using T7

or SP6 RNA polymerase.

Supplementary References

Moriyoshi, K., Richards, L. J., Akazawa, C., O'Leary, D. D. and Nakanishi, S. (1996). Labeling neural cells using adenoviral gene transfer of membrane-targeted GFP. Neuron 16, 255-60. Nieman, M. T., Kim, J. B., Johnson, K. R. and Wheelock, M. J. (1999). Mechanism of extracellular domain-deleted dominant negative cadherins. J. Cell Sci. 112, 1621-32.

Sells, M. A., Knaus, U. G., Bagrodia, S., Ambrose, D. M., Bokoch, G. M. and Chernoff, J. (1997). Human p21-activated kinase (Pak1) regulates actin organization in mammalian cells. Curr Biol 7, 202-10.

Szewczyk, E., Nayak, T., Oakley, C. E., Edgerton, H., Xiong, Y., Taheri-Talesh, N., Osmani, S. A. and Oakley, B. R. (2006). Fusion PCR and gene targeting in Aspergillus nidulans. Nat Protoc 1, 3111-20.

Tang, Y., Chen, Z., Ambrose, D., Liu, J., Gibbs, J. B., Chernoff, J. and Field, J. (1997).

Kinase-deficient Pak1 mutants inhibit Ras transformation of Rat-1 fibroblasts. Mol Cell Biol 17, 4454-64.

Zisch, A. H., Kalo, M. S., Chong, L. D. and Pasquale, E. B. (1998). Complex formation

between EphB2 and Src requires phosphorylation of tyrosine 611 in the EphB2 juxtamembrane region. Oncogene 16, 2657-70.



Table S1. Experimental Numbers

Figure Experimental Numbers

1B Expression of efnb2a in wild-type pouches at 18 hpf. n = 41

1C Expression of efnb2a in wild-type pouches at 24 hpf. n = 38

1D Expression of efnb2a in wild-type pouches at 30 hpf. n = 40

1E Expression of efnb3b in wild-type pouches at 18 hpf. n = 29

1F Expression of efnb3b in wild-type pouches at 24 hpf. n = 42

1G Expression of efnb3b in wild-type pouches at 30 hpf. n = 37

1H Expression of ephb4a in wild-type pouches at 18 hpf. n = 37

1I Expression of ephb4a in wild-type pouches at 24 hpf. n = 31

1J Expression of ephb4a in wild-type pouches at 30 hpf. n = 43

1K Expression of pak2a in wild-type pouches at 18 hpf. n = 49

1L Expression of pak2a in wild-type pouches at 24 hpf. n = 45

1M Expression of pak2a in wild-type pouches at 30 hpf. n = 45

1N,O Expression of Efnb2a in wild-type pouches at 30 hpf. n = 18

2A Alcama immunohistochemistry in wild types at 34 hpf. n = 103

2B Alcama immunohistochemistry in efnb2a mutants at 34 hpf. n = 64

2C Alcama immunohistochemistry in efnb2a-/-; efnb3b-MO embryos at 34 hpf. n = 113

2D Alcama immunohistochemistry in efnb2a-/-; ephb4a-/- double mutants at 34 hpf. n = 30

2E Alcama immunohistochemistry in pak2a mutants at 34 hpf. n = 56

2F Alcama immunohistochemistry in nkx2.3:Gal4VP16; UAS:KD-EphB4a embryos at 34 hpf. n = 96

2G Rescue of efnb2a-/-; efnb3b-MO pouches with nkx2.3:Efnb2a. n = 42

2H Rescue of efnb2a-/-; efnb3b-MO pouches with nkx2.3:Efnb2a-CT. n = 32

2I Alcian blue staining in wild types at 5 dpf. n = 96

2J Alcian blue staining in efnb2a mutants at 5 dpf. n = 95

2K Alcian blue staining in efnb2a-/-; efnb3b-MO embryos at 5 dpf. n = 88

2L Alcian blue staining in efnb2a-/-; ephb4a-/- double mutants at 5 dpf. n = 32

2M Alcian blue staining in pak2a mutants at 5 dpf. n = 48

2N Alcian blue staining in nkx2.3:Gal4VP16; UAS:KD-EphB4a embryos at 5 dpf. n = 92

2O Rescue of efnb2a-/-; efnb3b-MO CBs with nkx2.3:Efnb2a. n = 80

2P Rescue of efnb2a-/-; efnb3b-MO CBs with nkx2.3:Efnb2a-CT. n = 28

2Q Efnb2a immunohistochemistry in wild-type siblings at 30 hpf. 15/15 had Efnb2a staining in arches

2R Efnb2a immunohistochemistry in efnb2a mutant siblings at 30 hpf. 0/4 had Efnb2a staining in arches

2S Rescue of efnb2a mutants with nkx2.3:Efnb2a. 4/6 embryos had selective restoration of Efnb2a to pouches. 2/6 with no Efnb2a staining.



3A-3D (see also

Movie S1A)

Time-lapse imaging for development of her5:mCherryCAAX+ pouches p4-p6 in wild types. 0/3 wild-type embryos showed pouch fragmentation.

3E-3H (see also

Movie S1B)

Time-lapse imaging for development of her5:mCherryCAAX+ pouches p4-p6 in efnb2a-/-; efnb3b-MO embryos. 3/3 efnb2a-/-; efnb3b-MO embryos showed pouch fragmentation.

3I-3L (see also

Movie S1C)

Time-lapse imaging for development of her5:mCherryCAAX+ pouches p4-p6 in nkx2.3:Gal4VP16; UAS:KD-EphB4a embryos. 3/3 nkx2.3:Gal4VP16; UAS:KD-EphB4a embryos showed pouch fragmentation.

3M-3P (see also

Movie S1D)

Time-lapse imaging for development of her5:mCherryCAAX+ pouches p4-p6 in pak2a mutants. 3/4 pak2a mutants showed pouch fragmentation.

3Q Alcama immunohistochemistry in wild types at 34 hpf. 17/17 showed bilayers.

3R Alcama immunohistochemistry in efnb2a-/-; efnb3b-MO embryos at 34 hpf. 9/13 showed disorganized layers of pouches..

3S Alcama immunohistochemistry in nkx2.3:Gal4VP16; UAS:KD-EphB4a embryos at 34 hpf. 16/16 showed disorganized layers of pouches.

3T Alcama immunohistochemistry in pak2a mutants at 34 hpf. 11/14 showed disorganized layers of pouches.

4A Double immunohistochemistry of pPAK-S143 and Alcama in wild types at 34 hpf. n = 106

4B Double immunohistochemistry of pPAK-S143 and Alcama in efnb2a mutants at 34 hpf. 44/65 had reduction of pPAK-S143 in pouches.

4C Double immunohistochemistry of pPAK-S143 and Alcama in wnt4a mutants at 34 hpf. 36/60 had reduction of pPAK-S143 in pouches.

4D Double immunohistochemistry of pPAK-S143 and Alcama in efnb2a-/-; wnt4a-/- double mutants at 34 hpf. 18/18 had reduction of pPAK-S143 in pouches.

4E Double immunohistochemistry of pPAK-S143 and Alcama in efnb2a-/-; efnb3b-MO embryos at 34 hpf. 63/78 had reduction of pPAK-S143 in pouches.

4F Rescue of efnb2a-/-; efnb3b-MO embryos with nkx2.3:Pak2aCAAX. 7/56 had reduction of pPAK-S143 in pouches.

4G Alcian blue staining in wild types at 5 dpf. n = 102

4H Alcian blue staining in efnb2a mutants at 5 dpf. n = 44

4I Alcian blue staining in wnt4a mutants at 5 dpf. n = 71

4J Alcian blue staining in efnb2a-/-; wnt4a-/- double mutants at 5 dpf. n = 16

4K Alcian blue staining in efnb2a-/-; efnb3b-MO embryos at 5 dpf. n = 40

4L Rescue of efnb2a-/-; efnb3b-MO CBs with nkx2.3:Pak2aCAAX. n = 47

4M E-cadherin immunohistochemistry in wild types at 34 hpf. 61/61 showed strong E-cadherin localization along apicolateral membranes.

4N E-cadherin immunohistochemistry in efnb2a mutants at 34 hpf. 19/27 showed reduced E-cadherin localization along apicolateral membranes.

4O E-cadherin immunohistochemistry in wnt4a mutants at 34 hpf. 18/25 showed reduced E-cadherin localization along apicolateral membranes.

4P E-cadherin immunohistochemistry in efnb2a-/-; wnt4a-/- double mutants at 34



hpf. 15/15 showed reduced E-cadherin localization along apicolateral membranes.

4Q E-cadherin immunohistochemistry in efnb2a-/-; efnb3b-MO embryos at 34 hpf. 11/12 showed reduced E-cadherin localization along apicolateral membranes.

4R Rescue of efnb2a-/-; efnb3b-MO embryos with nkx2.3: Pak2aCAAX. 0/25 showed reduced E-cadherin localization along apicolateral membranes.

S1A Expression of efnb2a relative to sox10:GFP+ neural crest at 30 hpf. 15/15 showed expression in neural crest.

S1B Expression of efnb2a relative to nkx2.5:GFP+ mesoderm at 30 hpf. 0/21 showed expression in mesoderm.

S1C Expression of efnb3b relative to sox10:GFP+ neural crest at 30 hpf. 0/18 showed expression in neural crest.

S1D Expression of efnb3b relative to nkx2.5:GFP+ mesoderm at 30 hpf. 0/14 showed expression in mesoderm.

S1E Expression of ephb4a relative to sox10:GFP+ neural crest at 30 hpf. 0/19 showed expression in neural crest.

S1F Expression of ephb4a relative to nkx2.5:GFP+ mesoderm at 30 hpf. 22/22 showed expression in mesoderm.

S2B Alcama immunohistochemistry in wild types at 34 hpf. n = 103

Alcama immunohistochemistry in efnb3b-MO embryos at 34 hpf. n = 120

Alcama immunohistochemistry in ephb4a-/- mutants at 34 hpf. n = 141

Alcama immunohistochemistry in efnb2a-/-; efnb3b-MOTB embryos at 34 hpf. n = 49

Alcama immunohistochemistry in efnb2a-/-; control-MO embryos at 34 hpf. n = 21

Alcama immunohistochemistry in efnb3b-MO; ephb4a-/- embryos at 34 hpf. n = 88

Alcama immunohistochemistry in efnb2a-/-; efnb3b-MO; ephb4a-/- embryos at 34 hpf. n = 36

Alcama immunohistochemistry in nkx2.3:Gal4VP16; UAS:KD-Pak2a embryos at 34 hpf. n = 45

Alcama immunohistochemistry in efnb2a mutants at 34 hpf. n = 35

Lack of rescue of efnb2a-/- pouches with sox10:Efnb2a. n = 48

Alcama immunohistochemistry in efnb2a-/-; efnb3b-MO embryos at 34 hpf. n = 38

Lack of rescue of efnb2a-/-; efnb3b-MO pouches with sox10:Efnb2a. n = 47

S2C Alcian blue staining in wild types at 5 dpf. n = 96

Alcian blue staining in efnb3b-MO embryos at 5 dpf. n = 132

Alcian blue staining in ephb4a-/- mutants at 5 dpf. n = 116

Alcian blue staining in efnb2a-/-; efnb3b-MOTB embryos at 5 dpf. n = 69

Alcian blue staining in efnb2a-/-; control-MO embryos at 5 dpf. n = 24

Alcian blue staining in efnb3b-MO; ephb4a-/- embryos at 5 dpf. n = 75

Alcian blue staining in efnb2a-/-; efnb3b-MO; ephb4a-/- embryos at 5 dpf. n = 35



Alcian blue staining in nkx2.3:Gal4VP16; UAS: KD-Pak2a embryos at 5 dpf. n = 39

Alcian blue staining in efnb2a-/- mutants at 5 dpf. n = 31

Lack of rescue of efnb2a-/- CBs with sox10:Efnb2a. n = 44

Alcian blue staining in efnb2a-/-; efnb3b-MO embryos at 5 dpf. n = 42

Lack of rescue of efnb2a-/-; efnb3b-MO CBs with sox10:Efnb2a. n = 49

S2D Efnb2a immunohistochemistry in efnb2a mutant siblings at 30 hpf. 0/7 had Efnb2a staining in neural crests.

Efnb2a immunohistochemistry in sox10:Efnb2a; efnb2a-/- animals at 30 hpf. 6/9 embryos had selective restoration of Efnb2a to neural crests. 3/9 with no Efnb2a staining.

S2E Expression of dlx2a in wild types at 16.5 hpf. 52/52 showed three distinct streams of neural-crest-derived cells.

Expression of dlx2a in efnb2a mutants at 16.5 hpf. 14/14 showed three distinct streams of neural-crest-derived cells.

Expression of dlx2a in efnb2a-/-; efnb3b-MO embryos at 16.5 hpf. 11/11 showed three distinct streams of neural-crest-derived cells.

Expression of dlx2a in efnb2a-/-; efnb3b-MO; ephb4a-/- embryos at 16.5 hpf. 6/6 showed three distinct streams of neural-crest-derived cells.

S2F Development of pharyngeal arches, pouches, and cartilages in wild types. n = 41

Development of pharyngeal arches, pouches, and cartilages in efnb2a mutants. 4/8 had ventral fusion of the second and third arches with later CB1-CH fusion. 4/8 with normal development of pharyngeal arches, pouches, and cartilages.

S3A Alcama immunohistochemistry in wild types at 34 hpf. 17/17 showed bilayers.

S3B Alcama immunohistochemistry in efn2a mutants at 34 hpf. 6/9 showed disorganized layers of pouches.

S3C Alcama immunohistochemistry in efnb2a-/-; ephb4a-/- double mutants at 34 hpf. 6/6 showed disorganized layers of pouches.

S3D Alcama immunohistochemistry in efnb3b-MO; ephb4a-/- embryos at 34 hpf. 9/11 showed disorganized layers of pouches.

S3E Alcama immunohistochemistry in efnb2a-/-; efnb3b-MO; ephb4a-/- embryos at 34 hpf. 7/7 showed disorganized layers of pouches.

S4A Double immunohistochemistry of pPAK-S143 and Alcama in wild types at 30-34 hpf. n = 21

S4B Efnb2a immunohistochemistry in wild types at 34 hpf. n = 24

Efnb2a immunohistochemistry in wnt4a mutants at 34 hpf. n = 11

S4C Fluorescent in situ hybridization of ephb4a in wild types at 30 hpf. 31/31 showed ephb4a expression in the nascent pouch.

Fluorescent in situ hybridization of ephb4a in wnt4a mutants at 30 hpf. 9/9 showed ephb4a expression in the nascent pouch.

S4D Double immunohistochemistry of pPAK-S143 and Alcama in wild types at 34 hpf. n = 106

Double immunohistochemistry of pPAK-S143 and Alcama in nkx2.3:Gal4VP16; UAS:KD-EphB4a embryos at 34 hpf. 14/14 had reduction



of pPAK-S143 in pouches.

Double immunohistochemistry of pPAK-S143 and Alcama in nkx2.3:Gal4VP16; UAS:DN-Cdc42 embryos at 34 hpf. 35/35 had reduction of pPAK-S143 in pouches.

S4E Fluorescent in situ hybridization of pak2a in wild types at 34 hpf. 21/21 showed pak2a expression in pouches.

Fluorescent in situ hybridization of pak2a in efnb2a-/-; efnb3b-MO embryos at 34 hpf. 13/13 showed pak2a expression in pouches.

Fluorescent in situ hybridization of pak2a in nkx2.3:Pak2a; efnb2a-/-; efnb3b-MO embryos at 34 hpf. 9/9 showed pak2a expression in pouches.

S4F E-cadherin immunohistochemistry in wild types at 34 hpf. 61/61 showed strong E-cadherin localization along apicolateral membranes.

E-cadherin immunohistochemistry in pak2a mutants at 34 hpf. 14/23 showed reduced E-cadherin localization along apicolateral membranes.

E-cadherin immunohistochemistry in nkx2.3:Gal4VP16; UAS:KD-Pak2a embryos at 34 hpf. 39/42 showed reduced E-cadherin localization along apicolateral membranes.

E-cadherin immunohistochemistry in alcama-MO (50 μM) embryos at 34 hpf. 52/52 showed E-cadherin localization along apicolateral membranes.

E-cadherin immunohistochemistry in pak2a-/-; alcama-MO (50 μM) embryos at 34 hpf. 30/51 showed reduced E-cadherin localization along apicolateral membranes.

S4G Alcama immunohistochemistry in wild types at 34 hpf. n = 106

Alcama immunohistochemistry in efnb2a-/-; efnb3b-MO embryos at 34 hpf. n = 29

Lack of rescue of efnb2a-/-; efnb3b-MO pouches with nkx2.3:Pak2a. n = 23

Alcama immunohistochemistry in pak2a mutants at 34 hpf. n = 56

Alcama immunohistochemistry in alcama-MO (50 μM) embryos at 34 hpf. n = 42

Alcama immunohistochemistry in pak2a-/-; alcama-MO (50 μM) embryos at 34 hpf. n = 43

S4H Alcian blue staining in wild types at 5 dpf. n = 102

Alcian blue staining in efnb2a-/-; efnb3b-MO embryos at 5 dpf. n = 58

Lack of rescue of efnb2a-/-; efnb3b-MO CBs with nkx2.3:Pak2a. n = 26

Alcian blue staining in pak2a mutants at 34 hpf. n = 48

Alcian blue staining in alcama-MO (50 μM) embryos at 34 hpf. n = 42

Alcian blue staining in pak2a-/-; alcama-MO (50 μM) embryos at 34 hpf. n = 37

S5A Alcama immunohistochemistry in wild types at 34 hpf. n = 20

S5B Alcama immunohistochemistry in nkx2.3:Gal4VP16; UAS:∆N-E-cadherin embryos at 34 hpf. n = 19

S5C Alcian blue staining in wild types at 5 dpf. n = 25

S5D Alcian blue staining in nkx2.3:Gal4VP16; UAS:∆N-E-cadherin embryos at 5 dpf. n = 22


Documents

Development 142: doi:10.1242/dev.115774: Supplementary ... · Scale bar: 40 μm. (F) Development of pharyngeal arches, pouches and cartilages in individual efnb2a mutants and wild-type