Detection of Tumor Suppressor Genes in Cancer Development by … · Genomics Detection of Tumor Suppressor Genes in Cancer Development by a Novel shRNA-Based Method Johannes von Burstin1,

Genomics

Detection of Tumor Suppressor Genes in CancerDevelopment by a Novel shRNA-Based MethodJohannes von Burstin1, Sandra Diersch1, G€unter Schneider1, Maximilian Reichert1,2,Anil K. Rustgi2, and Roland M. Schmid1

Abstract

Pancreatic cancer is one of the deadliest cancers with poorsurvival rates and limited therapeutic options. To improve theunderstanding of this disease's biology, a prerequisite for thegeneration of novel therapeutics, new platforms for rapid andefficient genetic and therapeutic screening are needed. Therefore,a combined in vitro/in vivo hybrid shRNA assay was developedusing isolated murine primary pancreatic ductal cells (PDCs), inwhich oncogenic KrasG12D could be activated in vitro by genomicrecombination through 4OH-tamoxifen–induced nuclear trans-location of Cre-ERT2 expressed under control of the ROSA26promoter. Further genetic manipulation was achieved throughselective and stable RNAi against the tumor suppressors p16Ink4a

(CDKN2A) or Trp53 (TP53) using lentiviral gene delivery. Treat-ment of PDCswith 4OH-tamoxifen increased phosphorylation of

ERKdownstreamof KRAS, and subsequent lentiviral transductionresulted in sustained target gene repression.Double-mutant PDCswere then reintroduced into the pancreata of NOD-SCID-gamma(NSG) mice and monitored for tumor growth. Orthotopicimplantation of PDCs carrying the activated KrasG12D-allele andshRNA against p16Ink4a or Trp53 resulted in tumor growth, metas-tasis, and reduced survival of NSG mice. In contrast, KrasG12D

alone was not sufficient to induce tumor growth.

Implications: The combinatory in vitro/in vivo approach describedin this study allows for rapid and efficient identification ofgenes involved in carcinogenesis and opens new avenuesfor the development of therapeutic strategies to improve cancertreatment. Mol Cancer Res; 13(5); 1–7. �2015 AACR.

IntroductionPancreatic ductal adenocarcinoma (PDAC) is the fourth lead-

ing cause of cancer-related deaths in the United States. The 5-yearsurvival rate of all patients suffering from PDAC is 6%, andincidence almost equals mortality rate, underscoring the aggres-sive behavior of this tumor (1). Most patients suffering fromPDAC already present with metastasis, causing the majority ofpancreatic cancer–associated deaths (2). Although several broad-based approaches have been undertaken to shed light on thegenetics and biology of pancreatic cancer, only few essential drivermutations have been identified so far (3, 4). One of the mostcommon genetic perturbations in pancreatic cancer is an activat-ingmutation of oncogenic Kras, which can be found inmore than90% of PDAC and is thought to represent an initiating event (5).However, single activation of Kras in mice results in pancreaticintraepithelial neoplasia (PanIN), but shows only infrequentdevelopment of invasive PDAC (6). Thus, additional geneticevents are required for the development of invasive PDAC,including loss of the cell cycle regulator p16Ink4a (part of theCdkn2a locus), and of the tumor suppressor genes Trp53 and/or

Smad4 (7). Identification of additional genes involved in tumor-igenesis will broaden our understanding of pancreatic cancerbiology and eventually lead the way to more effective treatments.

Functional characterization of cancer genes can be cumber-some. Although cell culture assays can be easily performed andare highly reproducible, in vitro models lack the features of thetumor microenvironment and, thus, may not be suitable todetect gene activities linked to cancer initiation or progression.

The standard approach for investigating candidate cancer genesrequires the generation of transgenic and knockout mice thatharbor germline alterations in the gene of interest. Although thesestrains are invaluable tools in the field of cancer research, theirgeneration, maintenance, and analysis can be costly and timeconsuming. Moreover, many data obtained with these modelsrely on manipulation of cancer genes during embryogenesis, andthus, do not reflect somatic mutations occurring during an indi-vidual's life span.

To obviate these obstacles, we developed an approach inwhichwe combined the ease of in vitro genetic manipulation and thepower of in vivo pancreatic cancer studies. In this model, we tookadvantage of the well-established primary pancreatic ductal cellculture (PDC; refs. 8, 9). Isolation of PDCs frommice that harborthe lox-stop-lox-KrasG12D-allele and express Cre-ERT2 under con-trol of the ubiquitous ROSA26 promoter allowed us to inducegenetic recombination and subsequent activation of KrasG12D

in vitro. We hypothesized that additional depletion of the tumorsuppressor genes p16Ink4a or Trp53 in the context of Kras activ-ation in PDCs will lead to accelerated tumor growth and invasivePDAC. Genetic silencing was achieved by lentiviral delivery ofshRNA, and orthotopic implantation of these resulted in tumorgrowth. However, Kras activation on its own was not sufficient

1II. Medizinische Klinik, Technische Universit€at M€unchen, Munich,Germany. 2Division of Gastroenterology, Departments of Medicineand Genetics, Abramson Cancer Center, University of Pennsylvania,Philadelphia, Pennsylvania.

Corresponding Author: J. von Burstin, Technische Universit€at M€unchen, Isma-ningerstr. 22, Munich 81675, Germany. Phone: 49-89-4140-2250; Fax: 49-89-4140-4914; E-mail: [email protected]

doi: 10.1158/1541-7786.MCR-14-0709

�2015 American Association for Cancer Research.

MolecularCancerResearch

www.aacrjournals.org OF1

on July 15, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Published OnlineFirst February 27, 2015; DOI: 10.1158/1541-7786.MCR-14-0709

http://mcr.aacrjournals.org/

to induce tumor growth. The method described in this studywill simplify the identification and validation of new cancergenes with high reliability and without the need for tediousmouse models.

Materials and MethodsIsolation of PDCs

Primary PDCs were isolated from mice carrying the genotypeROSA26Cre-ERT2;Lox-Stop-Lox-KrasG12D (termed Kras-PDCsthereafter) and maintained essentially as described (10). Earlypassage cells were treated with 4OH-tamoxifen 200 nmol/L(Sigma) or vehicle for 10 days.

Western blot analysisPDCs were collected from collagen by digestion with collage-

nase type 2 (Worthington) at a final concentration of 1 mg/mL at37�C for 15minutes.Upon complete digestion, cellswere pelletedby centrifugation and washed with ice-cold PBS. The final pelletwas lysed and protein concentration was normalized using Brad-ford reagent (Biorad). Fifty micrograms were resolved on a 10%SDS-polyacrylamide gel and transferred to polyvinylidenedifluoride (PVDF) membranes. Membranes were blocked in PBScontaining 0.05% Tween and 3% non-fat dry milk for 1 hour atroom temperature and incubated with anti-pERK (Cell Signaling;4370; 1:1,000), anti-P16INK4a (M-156; Santa Cruz; sc-1207;1:200), or anti-TRP53 (NCL-p53-CM5p; Novocastra; LeicaBiosystems; 1:1,000). Membranes were then subsequentlyincubated with anti-ERK (BD Biosciences; 610124; 1:1,000) andanti–b-actin (Sigma Aldrich; Clone AC-74; A5316; 1:5,000).Visualization was performed using IRDye 680 (anti-rabbit) orIRDye 780 (anti-mouse) secondary antibodies on an OdysseyInfrared Imaging System (all LiCor).

RAS activation assayDetection of activated KRAS was performed essentially as

described using a Raf–RBD-pulldown assay (Cytoskeleton;ref. 11). Transfer to PVDF membranes and visualization wasconducted as mentioned above using an antibody against KRAS(Merck-Millipore; 1:1,000).

Quantitative real-time PCRTotal RNA was extracted using the RNeasy Kit (Qiagen). Syn-

thesis of cDNA using random hexamers andMMLV-based reversetranscriptase (Life Technologies) was achieved as previouslydescribed (12). Quantitative analysis was carried out on StepO-NEplus real-time PCR system (Applied Biosystems; Life Technol-ogies), and the amount of target gene was normalized to theendogenous reference Ppia (Cyclophilin A; ref. 13).

Murine primers were designed to be intron spanning. Thefollowing primers were used: p16Ink4a FW: CCCAACGCCCC-GAACT, P16Ink4a RV: GTGAACGTTGCCCATCATCA, Trp53 FW:AGATCCGCGGGCGTAAAC, Trp53 RV: TCTGTAGCATGGG-CATCCTTT, Ppia FW: ATGGTCAACCCCACCGTGT, PpiaRV: TTCTGCTGTCTTTGGAACTTTGTC.

Lentiviral constructs, virus generation, target cell transduction,and selection

Glycerol stocks containing the desired lentiviral constructswere obtained from Open Biosystems (now part of GE Health-care) and grown according to the manufacturer's instructions.

The clone IDs for shRNAp16Ink4a were: TRCN0000077814,target sequence GTGATGATGATGGGCAACGTT, termedshRNAp16Ink4a #1 hereafter, and TRCN0000077813, targetsequence CATCAAGACATCGTGCGATAT, termed shRNA-p16Ink4a #2 hereafter. The clone IDs for shRNATrp53 were:TRCN0000012362, target sequence CTACAAGAAGTCACAGCA-CAT, termed shRNATrp53 #1 hereafter, and TRCN0000054551,target sequence AGAGTATTTCACCCTCAAGAT, termedshRNATrp53 #2 hereafter. pLKO.1 was used for control. Puri-fied plasmids were tested for integrity before transfectionusing the restriction enzymes BamHI and NdeI.

For virus production, 6� 106 293T cells in a 10-cm dish weretransfected with 12 mg lentiviral construct, 4.2 mg pMD2G-VSVG, and 7.8 mg pCMV-dR8.74 using Lipofectamine 2000(Life Technologies). Twenty-four hours after transfection, cul-ture media were changed and virus-containing supernatantwas collected 24 hours later. Culture media were replaced andcollected another 24 hours later. Viral supernatant was stored at–80�C until further use.

Kras-PDCs were transduced with lentiviral constructs asdescribed with only minor modifications (14). Briefly, 4OH-tamoxifen–treated Kras-PDCs were placed in wells of a 6-wellplate at a cell number of 3� 105 cells/well and allowed to adhereon plastic overnight. Next day, cells were transduced with viralsupernatant containing polybrene 4 mg/mL (Sigma). Twenty-fourhours later, PDCs were placed back onto collagen-coated wellsandwere allowed to adhere for another 24 hours. Upon completeattachment, cells were selected in the presence of puromycin(8 mg/mL) for 10 days (termed Kras-shRNA-PDCs hereafter).Successful depletion of target gene mRNA was confirmed byquantitative RT-PCR. Two different shRNAs per target gene weretested to reduce off-target effects.

Orthotopic transplantation and animal proceduresImmunocompromised NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ mice

(NOD scid gamma, NSG) were obtained from The JacksonLaboratory. Eight- to 10-week-old animals were anaesthetizedusing a combination of medetomidine, midazolam, and fen-tanyl. A total of 5 � 105 Kras-shRNA-PDCs in a volume of 20 mLwere injected into the pancreata of NSG mice as described (12).Briefly, a small left abdominal incision was made, and thepancreas was retrieved by gently dislodging the spleen. Tumorcells were injected into the pancreas in an area adjacent to thespleen using a micro liter syringe with a 27-gauge needle.Successful injection was confirmed by an intrapancreatic bleb.The peritoneal layer was sutured with Ethilon 5-0 (Johnson andJohnson), and the cutaneous wound was closed using woundclips. We injected three mice per shRNA. Animals were inves-tigated weekly for tumor growth, development of ascites, andweight loss. Animals were euthanized upon palpable localtumor growth >1 cm, development of ascites, or loss of bodyweight >20%. If none of these occurred, animals were eutha-nized after a period of 26 weeks. All animal procedures were inagreement with the Government of Upper Bavaria (protocol55.2-1-54-2532-117-13).

HistologyMice were euthanized and organs were removed and fixed

overnight in 4% paraformaldehyde. Organs were then embedd-ed in paraffin, sectioned at 2.5 mm, and mounted on glassslides. Following standard dewaxing and hydration procedures,

von Burstin et al.

Mol Cancer Res; 13(5) May 2015 Molecular Cancer ResearchOF2




staining was performed for 30 seconds in hematoxylin, fol-lowed by a 5-minute tap water rinse. Counterstaining was per-formed in Eosin for 30 seconds, and subsequent dehydrationwas conducted according to standard procedures. For immu-nohistochemistry, slides were dewaxed and hydrated as above.Antigen retrieval was performed in citrate solution at pH 6.0for 15 minutes in a microwave at 600 W. The followingantibodies were used: anti-P16INK4a (1:100; Santa Cruz;F-12; sc-1661) and anti-TRP53 (1:300; NCL-p53-CM5p; Novo-castra; Leica Biosystems), followed by secondary biotin-conju-gated antibodies. Peroxidase-conjugated streptavidin wasused with 3,30-diaminobenzidine tetrahydrochloride (DAB;VectorLabs) as a chromogen for detection. Hematoxylin wasused for counterstaining. Pictures were then recorded on anAxioImagerA1 microscope with an AxioCam color camerausing AxioVision 4.3 software (all Carl Zeiss).

Statistical analysisStatisticswereperformedusing graphpadprism. For expression

analysis, the Student t test was used. To analyze survival afterorthotopic implantation ofKras-shRNA-PDCs, log-rank (Mantle–Cox) analysis was applied.

ResultsDevelopment of an in vitro Kras activation method

To obtain a strictly genetically defined model without contam-inating stromal cells, we decided to isolate a purely ductal cellpopulation from the pancreas for further in vitro manipulation.Because Kras is mutated in over 90% of PDAC cases, we chosein vitro activation of LSL-KrasG12D by nuclear translocation ofCre-ERT2 through the application of 4OH-tamoxifen. Genomicrearrangement and activation of KrasG12D were followed byintroduction of a well-defined genetic second hit by the virtueof shRNA against Trp53 or p16Ink4a. These double-mutant PDCswere then reintroduced into the pancreata of NSG mice (Fig. 1).

Indirect and direct assessment of Kras activation by deter-mination of the phosphorylation status of ERK and by usinga Raf–RBD–GST-pulldown assay clearly demonstrated an in-crease of activated Kras in 4OH-tamoxifen–treated Kras-PDCs(Fig. 2A and B).

Stable expression of shRNA leads to long-term gene regulationAs lentiviral transduction results in stable integration of the

lentiviral genome into the host genome, we evaluated for sus-tained gene silencing after lentiviral infection. To that end, wetested target gene expression 10 days after withdrawal of puro-mycin. Indeed, we observed long-term gene silencing of p16Ink4a

and Trp53 in all shRNA constructs used as demonstratedby assessment of target gene expression by qRT-PCR (Fig. 3Aand C). Additional Western blot analysis confirmed significant

Figure 1.Approach to generate double-mutantprimary PDCs. PDCs were harvestedfrom ROSA26CreERT2;KrasG12D

animals and treated with 4OH-tamoxifen to induce recombination. Asecond genetic hit was subsequentlyintroduced by infection with lentiviralparticles containing empty controlvector or shRNAs directed againstp16Ink4a or Trp53. Upon selection forviral integration by puromycin,double-mutant PDCs were injectedorthotopically into recipient mice(n ¼ 3 per lentiviral construct).

Figure 2.Validation of KRAS activation in 4OH-tamoxifen–treated PDCs. A, Westernblot analysis reveals increased levels of pERK in 4OH-tamoxifen–treatedPDCs as compared with control as a functional readout for Kras activation.B, direct evidence for KRAS activation by 4OH-tamoxifen by detection ofactive KRAS using a Raf–RBD assay, followed by Western blot analysis.Note the absence of active endogenous KRAS in nontreated cells andcomparable levels of total KRAS.

An shRNA-Based Method for Detection of Tumor Suppressors

www.aacrjournals.org Mol Cancer Res; 13(5) May 2015 OF3




reduction of protein expression of P16INK4a and TRP53, respec-tively (Fig. 3B and D).

Depletion of p16Ink4a in Kras-PDCs results in tumorigenesisTumor growth did not occur in animals that received

Kras-shRNA-Control-PDCs over a time period of 26 weeks. Inparticular, the histologic examination of control pancreata didnot reveal any PanINs or other atypical or premalignant cellformation. By contrast, stable knockdown of P16Ink4a resultedin rapid local tumor growth in 5 of 6 animals in total. Inter-estingly, implantation of Kras-shRNA-p16Ink4a #1-PDCsresulted in tumor growth in 2 of 3 animals, whereas Kras-shRNA-p16Ink4a #2-PDCs led to development of pancreatictumors in all animals. In addition, the median survival inanimals receiving Kras-shRNA-p16Ink4a #1-PDCs was 160.0 daysand 105.0 days in those receiving Kras-shRNA-p16Ink4a

#2-PDCs. However, gross anatomy as well as histologic findingsdid not differ between the two shRNAs against p16Ink4a. Immu-nohistological staining for P16INK4a did not yield any signal intumors that developed from Kras-shRNA-p16Ink4a-PDCs, indi-cating sustained gene silencing by both shRNAs directed againstp16Ink4a. PanINs from 3-month-old Ptf1a-Cre; LSL-KrasG12D

animals served as positive control (Supplementary Fig. S1A).

Of note, the tumors did not show the classical, desmoplasticarchitecture typical for PDAC but rather displayed a tumorcell–rich growth with only sparse duct formation in vivo andalmost no stromal reaction (Fig. 4A and B). Macroscopic livermetastasis did not occur upon depletion of p16Ink4a. However,micrometastasis could be found in 1 animal of 5 mice thatdeveloped tumors upon depletion of p16Ink4a (SupplementaryFig. S2).

Loss of Trp53 leads to tumor growthTo address the question whether increased tumor growth is

specific to the loss of p16Ink4a in the setting of Kras activation,we asked if depletion of another tumor suppressor, Trp53,would result in tumorigenesis as well. In line with the findingsmentioned above, implantation of Kras-shRNA-Trp53-PDCsresulted in tumor development in 5 of 6 animals in total. Twoof 3 animals receiving Kras-shRNA-Trp53 #1-PDCs and allanimals receiving Kras-shRNA-Trp53 #2-PDCs developed pan-creatic tumors. The median survival was 140 and 111 days,respectively. Loss of TRP53 was demonstrated by the absenceof nuclear staining compared with TRP53-positive PanINs of3-month-old Ptf1a-Cre; LSL-KrasG12D animals (SupplementaryFig. S1B), demonstrating downregulation of TRP53 in these

Figure 3.Transduction with shRNA results inlong-term gene silencing. A,quantitative RT-PCR of p16Ink4a.4OH-tamoxifen–treated PDCs havebeen transduced with lentiviralparticles containing either pLKO.1empty control vector or shRNA againstp16Ink4a. Ten days after 4OH-tamoxifenwithdrawal, PDCs show significantdecrease of target gene mRNA in bothexperimental groups versus control.� , P < 0.05, n ¼ 3. B, Western blotanalysis of P16INK4a expression. 4OH-tamoxifen–treated PDCs have beentransduced with lentiviral particlescontaining either pLKO.1 empty controlvector or shRNA against p16Ink4a. Tendays after 4OH-tamoxifen withdrawal,PDCs show significant decrease ofP16INK4a protein expression in bothexperimental groups versus control.C, quantitative RT-PCR of Trp53. 4OH-tamoxifen–treated PDCs have beentransduced with lentiviral particlescontaining either pLKO.1 empty controlvector or shRNA against Trp53. Tendays after 4OH-tamoxifenwithdrawal, PDCs show significantdecrease of target gene mRNA in bothexperimental groups versus control.� , P < 0.05, n ¼ 3. D, Western blotanalysis of TRP53 expression. 4OH-tamoxifen–treated PDCs have beentransduced with lentiviral particlescontaining either pLKO.1 empty controlvector or shRNA against Trp53. Tendays after 4OH-tamoxifen withdrawal,PDCs show significant decrease ofTRP53 protein expression in bothexperimental groups versus control.

von Burstin et al.





tumors. Interestingly, the macroscopic and histologic findingswere similar to those seen in animals that have been implantedwith Kras-shRNA-p16Ink4a-PDCs, with tumors containingdensely arranged tumor cells but almost no stromal reaction(Fig. 5A and B). Macroscopic liver metastasis occurred in 3 of5 tumor-bearing animals and was confirmed by histology(Supplementary Fig. S2).

shRNA-mediated gene silencing results in decreased survivalIn total, 5 of 6 animals receiving Kras-shRNAp16Ink4a-PDCs

or Kras-shRNATrp53-PDCs developed tumors. These animalsdisplay a significantly shorter survival when compared withanimals that received Kras-shRNA-Control. However, there wasno difference between animals implanted with Kras-shRNA-p16Ink4a-PDCs or Kras-shRNATrp53-PDCs (SupplementaryFig. S3).

DiscussionThe data presented here demonstrate a stepwise manipula-

tion of adult PDCs to model PDAC in vivo. First, we reportisolation of an already well-defined pancreatic cell populationthat can be genetically altered by ex vivo recombination eventsthrough transient nuclear translocation of Cre-ERT2 (15), there-by activating oncogenic Kras. Second, we show sustained long-term gene silencing in Kras-PDCs using selective shRNAsagainst the tumor suppressor genes p16Ink4a or Trp53. Third,we clearly demonstrate that in vitro modeling of genetic path-ways that have been implicated in pancreatic cancer develop-ment and progression leads to malignant pancreatic tumorsin vivo. One main advantage of the system used is the rapidgeneration of the desired cell line carrying the shRNA againstthe gene of interest within a few weeks. In addition, cell lines

can be produced in parallel, and the impact on pancreaticcancer biology of various genes can be studied simultaneously.An overall reduction of time consuming and expensive gener-ation of germline-altered animal models and subsequentbreedings and genotyping, not to mention long-term back-crossing, will emerge as a consequence.

Although the advantage of shRNA has been widely usedin screening assays, many of the studies performed so faruse either cells from animals that have already undergoneembryonic loss of tumor suppressor genes (16, 17), cells withintroduction of more than one genetic lesion before the trans-duction with shRNA (17, 18), or use already established andimmortalized cancer cell lines (19, 20). The use of cells that arederived from embryonic tissue and/or harbor constitutive acti-vation of oncogenes might lead to interaction with variousdevelopmentally activated but otherwise inactive pathways,thus resulting in cell fate decisions and phenotypes that donot occur upon sporadic oncogene activation in somatic cells.This is especially true for pancreatic cancer research as mostanimal models utilize Pdx1- or Ptf1a-driven Cre, which leads tooncogene activation or tumor suppressor deletion in all func-tional compartments of the pancreas due to their early pro-moter activity on days E8.5 and E9.5, respectively (21, 22).Also, sensitizing cells by more than one genetic alteration maylead to over interpretation of a newly identified tumor sup-pressor gene's impact as cells may be "supersensitized" to onlyminor oncogenic events. Third, long-term cultured cancer celllines carry numerous genetic and epigenetic changes and doonly partly reflect the cell of origin. In contrast, our model isdesigned to recapitulate truly somatic oncogene activationas we were able to avoid germline activation of oncogenic Kras.

Figure 5.Loss of Trp53 results in PDAC formation. Animals receiving Kras-shRNA-Control-PDCs did not develop tumors. Animals injected with Kras-shRNATrp53 develop tumors and die due to their tumor burden. A and B,gross anatomy shows tumor growth within the anatomical site of injection,and histology confirms tumor growth (magnification, �50 and �200).

Figure 4.Loss of p16Ink4a results in PDAC formation. Animals receiving Kras-shRNA-Control-PDCs did not develop tumors. Animals injected with Kras-shRNAp16Ink4a-PDCs develop tumors and die due to their tumor burden.A and B, gross anatomy shows tumor growth within the anatomical site ofinjection, and histology confirms tumor growth (magnification, �50 and�200).






In addition, one additional genetic hit was sufficient to inducetumor growth. It is important to realize that pancreatic lossp16Ink4a/p19Arf on its own does not result in PanIN or PDACdevelopment in mice (23). Although Trp53–/– animals areprone to develop malignancies, these are mostly lymphomasand soft tissue tumors. The development of epithelial cancers inthese animals is rare (reviewed in ref. 24), and we do not knowabout any report of development of PDAC upon pancreas-specific Trp53 deletion. Thus, our model more closely resem-bles a truly sequential second-hit carcinogenesis as initiallyproposed by Knudson in 1971 (25).

In contrast to the human disease and most geneticallyengineered mouse models of pancreatic cancer, the tumorsdescribed in this study lack the classical stromal componentand show a more dedifferentiated phenotype. This observationmay be due to various reasons. First, we injected ductal cellsthat have undergone genetic manipulation. However, theinduction of a stromal cell response is known to take placeearly in PDAC development, so that this critical phase might bemissed in our model (26). Second, NOD SCID gamma miceused in this study are depleted for B- and T cells, which are alsobelieved to play an important role during the generation of astromal response (27). Third, injection of a cell suspensionmight not reflect the hypoxic conditions naturally occurring ina solid tumor, thereby reducing levels of secreted factors thatusually foster development of a stromal reaction (28). Intrigu-ingly, tumors described in this study closely resemble thoseseen in mouse models that a priori lack the stromal compart-ment (29, 30). However, we argue that orthotopic implantationis preferred over subcutaneous tumor xenograft models as thelatter completely lack tumor cell interaction with neighboringcells at the naturally occurring site of origin of PDAC. Thismight not only be important in tumor initiation processes butalso during the course of metastasis.

Because p16Ink4a and Trp53 act nonredundantly through eitherthe control of cell cycle regulation orDNAdamage repairmechan-isms (31), we argue that our model will be an expandable andpowerful tool to screen for new tumor suppressor genes and willbroaden our understanding of cancer biology. Moreover, theprinciple of stepwise in vitro acquisition of genetic hits in primaryPDCs may be transferrable to other techniques of gene modula-tion, including genome editing using CRIPSR/Cas9, as it hasalready been described for liver cancer (32).

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: J. von Burstin, A.K. Rustgi, R.M. SchmidDevelopment of methodology: J. von Burstin, S. Diersch, M. ReichertAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): J. von Burstin, S. DierschAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): J. von Burstin, G. Schneider, A.K. RustgiWriting, review, and/or revision of themanuscript: J. von Burstin,M. Reichert,A.K. Rustgi, R.M. SchmidAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): G. SchneiderStudy supervision: R.M. Schmid

Grant SupportThis work was supported by the NIH (NIH R01DK060694, NIH/NIDDK

P30DK050306), American Cancer Society (RP-10-033-01-CCE; to A.K. Rustgi),and Max-Eder-Programm, Deutsche Krebshilfe (#111273; to M. Reichert).

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received December 30, 2014; revised February 18, 2015; accepted February19, 2015; published OnlineFirst March 4, 2015.

References1. Siegel R, NaishadhamD, Jemal A. Cancer statistics, 2013. CA Cancer J Clin

2014;63:11–30.2. Schneider G, Siveke JT, Eckel F, Schmid RM. Pancreatic cancer: basic and

clinical aspects. Gastroenterology 2005;128:1606–25.3. Biankin AV, Waddell N, Kassahn KS, Gingras MC, Muthuswamy LB, Johns

AL, et al. Pancreatic cancer genomes reveal aberrations in axon guidancepathway genes. Nature 2012;491:399–405.

4. Jones S, Zhang X, Parsons DW, Lin JC, Leary RJ, Angenendt P, et al. Coresignaling pathways in human pancreatic cancers revealed by global geno-mic analyses. Science 2008;321:1801–6.

5. Kanda M, Matthaei H, Wu J, Hong SM, Yu J, Borges M, et al. Presence ofsomatic mutations inmost early-stage pancreatic intraepithelial neoplasia.Gastroenterology 2012;142:730–3 e9.

6. Hingorani SR, Petricoin EF, Maitra A, Rajapakse V, King C, Jacobetz MA,et al. Preinvasive and invasive ductal pancreatic cancer and its earlydetection in the mouse. Cancer Cell 2003;4:437–50.

7. Bardeesy N, DePinho RA. Pancreatic cancer biology and genetics. Nat RevCancer 2002;2:897–909.

8. Deramaudt TB, Takaoka M, Upadhyay R, Bowser MJ, Porter J, Lee A, et al.N-cadherin and keratinocyte growth factor receptor mediate the functionalinterplay between Ki-RASG12V and p53V143A in promoting pancreaticcell migration, invasion, and tissue architecture disruption. Mol Cell Biol2006;26:4185–200.

9. von Burstin J, Reichert M, Wescott MP, Rustgi AK. The pancreatic andduodenal homeobox protein PDX-1 regulates the ductal specific keratin 19through the degradation of MEIS1 and DNA binding. PLoS One 2010;5:e12311.

10. Schreiber FS,Deramaudt TB, Brunner TB, BorettiMI, GoochKJ, StoffersDA,et al. Successful growth and characterization of mouse pancreatic ductalcells: functional properties of the Ki-RAS(G12V) oncogene. Gastroenter-ology 2004;127:250–60.

11. Eser S, Reiff N, Messer M, Seidler B, Gottschalk K, Dobler M, et al. Selectiverequirement of PI3K/PDK1 signaling for Kras oncogene-driven pancreaticcell plasticity and cancer. Cancer Cell 2013;23:406–20.

12. von Burstin J, Eser S, Seidler B, Meining A, Bajbouj M, Mages J, et al.Highly sensitive detection of early-stage pancreatic cancer by multi-modal near-infrared molecular imaging in living mice. Int J Cancer2008;123:2138–47.

13. Saur D, Vanderwinden J-M, Seidler B, Schmid RM, De Laet M-H, AllescherH-D. Single-nucleotide promoter polymorphism alters transcription ofneuronal nitric oxide synthase exon 1c in infantile hypertrophic pyloricstenosis. Proc Natl Acad Sci USA 2004;101:1662–7.

14. Reichert M, Takano S, Heeg S, Bakir B, Botta GP, Rustgi AK. Isolation,culture and genetic manipulation of mouse pancreatic ductal cells.Nat Protoc 2013;8:1354–65.

15. Feil R, Wagner J, Metzger D, Chambon P. Regulation of Cre recombinaseactivity by mutated estrogen receptor ligand-binding domains. BiochemBiophys Res Commun 1997;237:752–7.

16. Mills JR, Malina A, Lee T, Di Paola D, Larsson O, Miething C, et al. RNAiscreening uncovers Dhx9 as a modifier of ABT-737 resistance in an Emu-myc/Bcl-2 mouse model. Blood 2013;121:3402–12.

17. Zender L, Xue W, Zuber J, Semighini CP, Krasnitz A, Ma B, et al. Anoncogenomics-based in vivo RNAi screen identifies tumor suppressors inliver cancer. Cell 2008;135:852–64.

von Burstin et al.





18. Iorns E, Ward TM, Dean S, Jegg A, Thomas D, Murugaesu N, et al. Wholegenome in vivo RNAi screening identifies the leukemia inhibitory factorreceptor as a novel breast tumor suppressor. Breast Cancer Res Treat2012;135:79–91.

19. Collins CS, Hong J, Sapinoso L, Zhou Y, Liu Z, Micklash K, et al. A smallinterfering RNA screen for modulators of tumor cell motility identifiesMAP4K4 as a promigratory kinase. Proc Natl Acad Sci USA 2006;103:3775–80.

20. van derMeer R, Yong SongH, Park SH, Abdulkadir SA, RohM. RNAi screenidentifies a synthetic lethal interaction between PIM1 overexpression andPLK1 inhibition. Clin Cancer Res 2014;20:3211–21.

21. Jonsson J, Carlsson L, Edlund T, Edlund H. Insulin-promoter-factor 1 isrequired for pancreas development in mice. Nature 1994;371:606–9.

22. Krapp A, Knofler M, Ledermann B, B€urki K, Berney C, Zoerkler N, et al. ThebHLH protein PTF1-p48 is essential for the formation of the exocrine andthe correct spatial organization of the endocrine pancreas. Genes Dev1998;12:3752–63.

23. Aguirre AJ, Bardeesy N, Sinha M, Lopez L, Tuveson DA, Horner J, et al.Activated Kras and Ink4a/Arf deficiency cooperate to produce metastaticpancreatic ductal adenocarcinoma. Genes Dev 2003;17:3112–26.

24. Donehower LA. The p53-deficient mouse: a model for basic and appliedcancer studies. Semin Cancer Biol 1996;7:269–78.

25. Knudson AG, Jr. Mutation and cancer: statistical study of retinoblastoma.Proc Natl Acad Sci U S A 1971;68:820–3.

26. Thayer SP, di Magliano MP, Heiser PW, Nielsen CM, Roberts DJ, LauwersGY, et al. Hedgehog is an early and late mediator of pancreatic cancertumorigenesis. Nature 2003;425:851–6.

27. Hiraoka N, Onozato K, Kosuge T, Hirohashi S. Prevalence of FOXP3þregulatory T cells increases during the progression of pancreatic ductaladenocarcinoma and its premalignant lesions. Clin Cancer Res 2006;12:5423–34.

28. Tsuzuki Y, Mouta Carreira C, Bockhorn M, Xu L, Jain RK, Fukumura D.Pancreas microenvironment promotes VEGF expression and tumorgrowth: novel window models for pancreatic tumor angiogenesis andmicrocirculation. Lab Invest 2001;81:1439–51.

29. Lee JJ, Perera RM,WangH,WuDC, Liu XS,Han S, et al. Stromal response toHedgehog signaling restrains pancreatic cancer progression. ProcNatl AcadSci U S A 2014;111:E3091–100.

30. Rhim AD, Oberstein PE, Thomas DH, Mirek ET, Palermo CF, Sastra SA,et al. Stromal elements act to restrain, rather than support, pancreatic ductaladenocarcinoma. Cancer Cell 2014;25:735–47.

31. Bardeesy N, Aguirre AJ, ChuGC, Cheng KH, Lopez LV, Hezel AF, et al. Bothp16(Ink4a) and the p19(Arf)-p53 pathway constrain progression of pan-creatic adenocarcinoma in the mouse. Proc Natl Acad Sci USA 2006;103:5947–52.

32. Xue W, Chen S, Yin H, Tammela T, Papagiannakopoulos T, Joshi NS, et al.CRISPR-mediated direct mutation of cancer genes in the mouse liver.Nature 2014;514:380–4.






Published OnlineFirst February 27, 2015.Mol Cancer Res Johannes von Burstin, Sandra Diersch, Günter Schneider, et al. Development by a Novel shRNA-Based MethodDetection of Tumor Suppressor Genes in Cancer

Updated version

10.1158/1541-7786.MCR-14-0709doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2015/02/28/1541-7786.MCR-14-0709.DC1

Access the most recent supplemental material at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://mcr.aacrjournals.org/content/early/2015/04/28/1541-7786.MCR-14-0709To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-14-0709

http://mcr.aacrjournals.org/content/suppl/2015/02/28/1541-7786.MCR-14-0709.DC1

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/early/2015/04/28/1541-7786.MCR-14-0709


Documents

Detection of Tumor Suppressor Genes in Cancer Development by … · Genomics Detection of Tumor Suppressor Genes in Cancer Development by a Novel shRNA-Based Method Johannes von Burstin1,