Molecular Genetics Of Wilms' Tumor:

The Analysis Of The WTI And Hl9 Tumor Suppressor Genes.

Gang Hu

Department of Biochemistry

McGill University, Montreal

August 1996

A Thesis submitted to the Faculty of Graduate

Studies and Research in partial fulfilment of the

requirements of the degree of Masters of Science.

Gang Hu, 1996

IY&lUUllal LIUIW Y ~IUIIUII I W ~ U W r icriiui lai= 1-1 of Canada du Canada

Acquisitions and Acquisitions et Bibliographie Services services bibliographiques

395 Wellington Street 395, nie Wellington Ottawa ON K1A ON4 Ottawa ON K I A ON4 Canada Canada

The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la fome de microfiche/film, de

reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial ' extracts fiom it Ni la thèse ni des extraits substantie1s may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

The pl6/MTS 1 (multiple tumor suppressor l), p 15lMTS2

and Hl9 genes have been recently proposed as candidate

tumor suppressor genes. In this study, we determined the

mutation status of these three genes in 82 Wilms' tumors b y

the polymerase chain reaction and single-strand conformation

polymorphism(PCR-SSCP) analysis. The results suggested tha t

pl6lMTSl and p15IMTS2 genes are not involved in Wilms'

tumor, and that the H l 9 gene may be altered at a low fequency

in Wilms ' tumorigenesis.

We also analyzed the involvement of the WT1-

3'untranslated region(UTR) in the translational regulation of

the WTl gene expression. The data revealed that the WT1-

3'UTR does not affect WTl gene expression at the translational

Ievel in vitro.

These studies contribute to the molecular genetic

understanding of Wilms' tumorigenesis.

Les gènes p l6/MTS 1 (multiple tumor suppressor 1 ), pWMTS2 et Hl9 ont été récemment proposés comme gbnes suppresseur de tumeurs. Dans cette étude, nous avons examiné si ces trois gènes sont mutés dans des tumeurs de Wilms' e t ceci à l'aide des expériences de polymérisation en chaîne (PCR) et de conformation polymorphique de l'ADN simple brin (SSCP). Les résultats de nos travaux portant sur l'étude de 82 cas d e tumeurs de Wilms' suggerant que les gbnes p16/MTS 1 e t pWMTS2 ne sont pas impliqués dans l'étiologie de la t umeur de Wilms', par contre, le gène H l 9 pourrait être altéré, mais a faible fréquence, dans des tumeurs de Wilms'.

Nous avons egalement examiné le rôle de la région 3' non- traduite (3'-UTR) du gène de tumeur de Wilms' (WT1) dans s a propre rkgulation traductionnelle. Nos données ont indiqué q u e la région 3'-UTR du gène WTI n'est pas impliqué dans l e processus de traduction du gène, du moins in vitro.

Les résultats de nos études ont amené une compréhension relativement significative sur la génétique moléculaire de la tumeur de Wilms'.

ACKNOWLEOGEMENTS

First of all, 1 wish to express my appreciation to Dr. Jerry

Pelletier for supporting, directing my studies, and for his

guidance and helpful discussions. Many thanks to Nabeel

Bardeesy, 1 am very grateful to him for his helpful suggestions

and discussions concerning this manuscript. And I also wish to

thank other members in Our lab for their help and friendship.

Finally, with al1 of my heart, 1 thank my husband and m y

family for their encouragement and support during m y

graduate studies.

TABLE OF CONTENTS

ImODUCTION

Wilms' Tumor And Associated Syndromes

WAGR Syndrome

Beckwith-Wiedemann Syndrome(BWS)

Denys-Drash Syndrome(DDS)

Genetics In Wilms' Tumor-Syndromes

WT1-Wilms' Tumor Suppressor Gene

Association Of Other Tumor Suppressor Genes

In Wilms' Tumor

p53 Mutations In Wilms' Tumor

Association Of The Hl9 Gene In Wilms'

Tumor

pl6/MTS1 And p15/MTS2 Genes

Projects

Evaluating The Mutation Status Of MTS

And Hl9 Genes In Wilms' Tumor

Analysis Of The Putative Role Of The

WT1-3'UTR(Untranslated Region)

Translational Regulation

MflTER IClLS flND METHODS

Genomic DNA Of Wilrns' Tumor Source

PCR-SSCP Analysis

Plasmids And Construction

In Vitro Transcription And Translation

RESULTS

Searching Mutation Of MTS And Hl9 Genes

In Wilms' Tumor

Analysis Of The Function Of The WTld'UTR

DISCUSSION

Low Rate Of Mutations Of MTS And Hl9 Genes

In W T

Absence Of The MTS Gene Mutations In

Wilms' Tumor

Low Rate Of Polymorphism Of The Hl9

Gene In Wilms' Tumor

The WT1-3'UTR 1s Not Involved In WT1

Translational Regulation

SUMMfiRY

REFERENCES

LIST OF FIGURES

FI G. 1 Knudson-Strong Two Hit Hypothesis.

Fig. 2 Schematic diagram of genomic organization of the H l 9

gene and oligonucleotide primer paires used to amplify

the exonic regions.

Fig. 3 Effect of human WT1-3'UTR deletion on translation in

vitro.

Fig. 4 Effect of mouse WT1-3'UTR deletion on translation in

vitro.

Fig. 5 PCR-SSCP analysis of H l 9 exon 1 and exon 5 in DNA

sample No.Sth and No.60.

Table 1 Summary of the polymorphism of the H l 9 gene in WT

cases.

LIST OF ABBREUIATIONS

A- adenine

ATP- adenosine triphosphate

AUIRE- AU rich element

AWTA- association of Wilms' tumor-aniridia

bp- base pair(s)

BWS- Beckwith-Wiedemann Syndrome

CDK- cyclin-dependent kinases

CpG- cytosine-guanine dinucleotide

CTP- cytidine triphosphate

DDS- Denys-Drash Syndrome

DNA- deoxyribonucleic acid

EGR gene(s)- Early Growth Response genecs)

G1- the gap 1 period of interphase in a ce11 cycle

GTP- guanosine triphosphate

GU- genitourinary

kbp- kilobase pairs

kDa- kilodaltons

LOH- loss of heterozygosity

mRNA- messenger ribonucleic acid

MTS gene(s)- multiple tumor suppressor genes

PAX gene- a paired box- and homeobox-containing gene

PCR- polymerase chain reaction

S- the synthetic phase of the interphase in a ceIl cycle

SSCP- single strand conformational polymorphism

T- thymine

TNF- a- cachectin-tumor necrosis factor a

U- uracil

UTP- uridine triphosphate

IJTR- untranslated region

WT- Wilms' Tumor

Molecular Genetics Of Wilms' Tumor: The Analysis Of The WT1 And H l 9 Tumor

Suppressor Genes.

Wilms' Tumor And Associated Svndromes

Wilms' tumor or Nephroblastoma û a fairly amimon renal tumor in

childhood. It typically affects about 1 in 1 0,000 children under the age of 1 5

occurring primarily between 3 and 6 years of age (1-4). In most cases,

Wilms' tumors corne to medical attention after abdominal

swelling or an abdominal mass is detected by parents. Some

children may experience fever, abdominal pain or hematuria.

Wilms' tumor is a solid multilobulated tumor mas s,

cornposed of persistent blastema, dysplastic tubules a n d

supporting stroma (5, 6). It develops either from one pole o r

from the central body of the immature kidney, replacing t h e

renal parenchyma and producing a gross appearance of

encapsulation due to compression and scarring of t h e

surrounding tissue.

Most Wilms' tumor cases are sporadic and unilateral,

however 5-10% are bilateral and 1% of the cases are familial.

The age of onset of patients with bilateral tumors is much earl ier

than in unilateral cases. In hereditary cases of WT, t h e

proportion of bilateral cases is higher than in the sporadic form,

and the age of onset of hereditary unilateral tumors is muc h

lower than for sporadic cases (7). These data have been

interpreted by Knudson-Strong's "two step" mutation hypothesis

(8 and see fig.1). This mode1 suggests that two mutational s teps

are required for the development of Wilms' tumor. The bilateral

and hereditary cases are presumed to arise and have an earlier

age of onset, because the first predisposing mutation is

postulated to be present already in the germ-line cell, and only

one additional somatic mutation is required for tumorigenesis. In

sporadic cases, two independent genetic mutations have to

accumulate postzygotically within the same target ce11 for t h e

development of a tumor.

Wilms' tumor occurs either as an isolated cancer or in

association with congenital anomalies comprising at least four

different syndromes: WAGR syndrome; Beckwith-Wiedemann

syndrome (BWS); Denys-Drash syndrome @DS) and Perlman

syndrome. When Wilms' tumor occurs in combination with other

congenital anomalies, the incidence of the bilateral neoplasm i s

greater than cases without congenital anomalies (9).

WAGR Svndrome

WAGR syndrome is a constellation of Wilms' Tumor, Aniridia,

Genitourinary (GU) Anomalies, and Mental Retardation. Aniridia

Hereditary Sporadic

germline

one mutation inherited (germline)

1 2nd somatic mutation

tumor formation

no mutation

germline

1 two somatic mutations

tumor formation

Fig. 1 Knudson-Strong Two Hit Hypothesis. The bilateral and hereditary cases are presumed to arise and have an earlier age of onset, since the first predisposing mutation is postulated to be already present in the germ-line cell, and only one additional somatic mutation is required for tumorigenesis. In sporadic cases, two independent genetic mutations have to accumulate postzygotically within the same target cell. The asterisk (*) denotes a mutation of the WT1 gene.

is defined as congenital absence of part or al1 of the iris.

Generally, this anomaly is bilateral, and the frequency of aniridia

in the general population is between 1150,000 and 111 00 ,000 .

(10, 1 1). The association of Wilms' tumor-aniridia (AWTA) w a s

first reported by Brusa and Torricelli (12). Miller et al. in 1964

(13), noted the frequency of aniridia arnong patients with WT

was 1 in 73, thus establishing that aniridia is much more

frequent in patients with Wilms' tumor than in the general

population. By the same token, Wilms' turnor arises much more

frequently in patients with aniridia than in the general

population, and also, the bilateral neoplasm arises in 20% of t h e

cases, when Wilms' tumor occurs in combination with aniridia

(14).

With more recent clinical investigation, the association of

Wilms' tumor-aniridia was enlarged to include ment a l

retardation and genitourinary (GU) anomalies. The mental

retardation is defined as well as delayed somatic growth a n d

cognitive and motor impairment (4). GU anomalies may invo lve

the kidney, collecting system and external genitalia. In clinical

observation, GU anomalies include renal h ypoplasia, uni1 ateral

renal agenesis, horseshoe kidney s, urethral atresia, bifid ur e ter s ,

hypospadias, cryptorchidism and ambiguous genitalia. The

incidence of GU anomalies in association with sporadic WT is

approximately threefold higher than in the general population.

GU anomalies are more often associated with bilateral WT t han

aniridia (1, 4, 13). The incidence of congenital abnormalities i n

children with bilateral WT is at least ten times higher than that

with unilateral neoplasm (3, 4).

Beckwith-Wiedemann Svndrome (B W SI

In the 196OYs, Beckwith and Wiedemann described a

syndrome consisting of the association of macroglossia,

ornphalocele, h yperplastic visceromegaly, neonatal

hypoglycemia, cytomegaly of the adrenal cortex, renal medull ary

dysplasia and fetal gigantism (15, 16). Since then, the syndrome

has been extensively described and reviewed. The frequency of

occurrence of this syndrome has been estimated about 7 per

100,000 births (17, 18). Individuals with this syndrome are a t

increased risk for the development of neoplasrns. Approximatel y

20% of patients with BWS eventually develop cancers such as

Wilms' tumor, adrenocortical carcinomas and hepatoblas toma

(17, 18, 19).

Most BWS cases are sporadic, but there is a subset of familial

cases. Genetic linkage analysis demonstrated that chromosome

1 lp15 is associated with the familial form of BWS (20, 21).

Denys-Drash Syndrome IDDS)

The observations of Wilms' tumor occurring i n

hermaphroditic children have been reported for many years. 1 n

1967, Denys et al. first described the association of male

pseudohermaphroditism, Wilms' tumor, and renal failure, in a

child with XX/XY mosaicism (22). Three years later, Drash et al.

also noted two unrelated children evaluated for abnormal sexual

differentiation. These two children had negative buccal sme ar,

but one had a 46, XY karyotype on peripheral leucocytes, both

were diagnosed with Wilms' tumor and eventually died from

progressive renal failure (23). Since these original observations,

new case descriptions of the association between male

pseudohermaphroditisrn, Wilms' tumor and nephropathy have

appeared (24, 25) and this syndrome was designated as Denys-

Drash syndrome by Garfunkel in 1985 (26).

The Wilms' tumors in patients with Denys-Drash syndrome

may be bilateral, unilateral or unilateral but multinodular (22,

23, 27-34).

Genetics In W W Tumor-Svndromes

A chromosomal abnormality was long suspected in some

patients with Wilms' tumor. This suspicion was based on the

association of Wilms' tumor with various congenital anomalies.

Consequently, the investigation of chromosome abnormalities i n

Wilms' tumor has been studied extensively.

The chromosome abnormalities such as deletions or O t her

mutational events sometimes involve loss of the homologue of a

chromosomal segment, and DNA polymorphisms di s tri bu ted

along the chromosome can be used to determine the extent of

the loss of heterozygosity (LOH) i n individual tumors. The

analysis of LOH is an indirect method to determine if a mu ta ted

tumor suppressor gene is in the region identified by LOH. Also,

LOH analysis can detect deletions of a small chromosomal region

that cannot be found by cytogenetic studies. Therefore, LûH

analysis has been used to identify chromosomal regions

frequently deleted in tumors, indicating areas which may harbor

tumor suppressor genes. The study of LOH in Wilms' tumor h a s

demonstrated that the most common chromosome structural

abnormalities occur on chromosomes 1 , 7, 1 l p and 16. So far, n o

specific regions of chromosome 1 and 7 have been identified fo r

having conclusive involvement in tumorigenesis. Chromosome

1 l p exhibits LOH in 30-40% of al1 Wilms' tumors (35).

Chromosome bands l l p 1 3 and l lp15 both are associated

with Wilms' tumor in distinct syndromes. Deletions within 1 l p 13

have led to the isolation of the WT suppressor gene, WT1 (36).

Chromosome 1 lp15 is involved in the predisposition to BWS an d

harbors a second Wilms' tumor gene (37). In addition, the long

arm of chromosome 16 is thought to harbor a gene involved i n

progression since 20% of Wilms' tumor specimens of LOH

restricted to this region (38).

In summary, LOH studies, cytogenetic analysis and clinical

investigation consistently indicate that Wilms' tumors involve

multiple genetic alterations to give rise to a fully malignant

phenotype, hence, the discovery of WT1 gene and genetic studies

of other loci is important for our understanding of the genetic

cornplexity for this , pediatric tumor.

WT1-Wilms' Tumor Suppressor Gene

Cytogenetic analysis of Wilms' tumors frequently revealed a

deletion within the short arm of chromosome 11 at band pl3 i n

the WAGR syndrome (36). This constitutional deletion provided

the first clue to the location of a gene involved in t h e

development of Wilms' tumor. It is now known that the WAGR

deletion encompasses a number of contiguous genes, including

the Wilms' tumor suppressor gene WT1 and the aniridia gene

PAX6. Loss of one allele of the PAX6 gene is responsible for

aniridia (39), whereas mutations of one WTI allele are not only

responsible for Wilms' tumor predisposition, but also produce

genitourinary defects (40, 4 1).

The WT1 gene has been isolated by a positional cloning

approach. It maps to chromosome l lp13, and spans

approximately 50 kbp of DNA, composed of 10 exons (42). WT 1

codes for an 3 kb mRNA of containing a coding region of 1.4 kb.

The gene encodes four alternatively spliced transcripts which

yield distinct polypeptides. The transcripts are characterized b y

the presence or absence of exon 5 which encodes for 17 amino

acids, and the selection of a downstream splice donor si te

inserting three codons between exons 9 and 10 (43). The

products are 49-54 kDa nuclear proteins (44, 45) and contain

two known functional domains with homology to transcription

factors. The amino terminus contains a proline and glutamine

rich domain and mediates transcription repression (46, 47). The

carboxy terminus has four cysteine-histidine zinc fingers a n d

mediates DNA binding (48). This region shows significant

homogy to two early growth regulated mammalian polypeptides,

EGRl and EGR2 (49, 50) and can bind to the EGRl DNA

recognition site (S'GCGGGGGCG3') (51). These features suggested

that product of WT1 gene acts as a transcription factor and may

be involved in the growth proliferation response of nephroblasts

during renal development. Recent studies have shown the W T l

encoded products repress expression of insulin like grow th

factor 2 and the A chain of platelet-derived growth factor at t h e

transcription level (52, 53). The ability to suppress t h e

expression of these growth-associated genes may contribute t O

the function of WTI as a tumor suppressor gene. These genes

are expressed at high levels in Wilms' tumor, and it has been

suggested that the overexpression of these genes due to

inactivating mutations in WTI could contribute to tumor

phenotypes.

Mutation studies have demonstrated that WT1 deletions or

mutations occur in 10-158 of Wilms' tumor cases (54-61).

Practically, the constitutional WTI mutations are often found i n

children with an inherited predisposition to Wilms' tumor. Hence

in total, 5-7% of al1 Wilms' tumors are caused by an inherited

mutation in the WTl gene (62). In patients with WAGR-

associated deletions, the second WT1 allele is always mutated

within the tumor (63-65), and mutations in the WT1 gene have

been found in almost 100% of DDS patients (66, 67).

The WTl gene is expressed in specific types of cells (68), and

highly expressed in the developing kidney. During em bry onic

development, WTI is expressed in condensing blastemic cells,

renal vesicles, and glomerular epithelium(69), al1 thought to b e

the sites of origin of Wilms' tumor. WT1 expression peaks

around the time of birth in the murine renal system (68). I n

contrast, the expression of WT1 is at high levels in the

differentiating testis and ovary, and continues at high levels

throughout adult life (70). These observations indicate that the

WT1 gene product is not only involved in development of t h e

renal systern, but also implicates WT1 in genitourinary

development.

WT1 transcripts are also found in the spleen, in specific

regions of the spinal cord, brain and body wall muscles (71), but

the role that the WT1 protein plays in these tissues is unclear. I n

addition, WT1 expression has been detected in hematopoietic ce11

lines such as HL-60 promyelocytes and K562 cells (69, 70, 71).

Recently studies have demonstrated that WT1 is mutated i n

about 15% of leukemias (72).

In most Wilms' tumors, the WTl gene is expressed by t h e

same cellular constituents as during normal nephrogenesis (73),

and primarily occurs in blastema, immature tubular structures

and glomeruloid bodies. The levels of WT1 expression is highly

variable in Wilms' tumor (74-76), which seems to be related to

the quantity of each ce11 type present in each specimen.

Association Of Other Tumor Su~messor Genes In W h s ' Tumor

p53 Mutations In Wilms' Tumor

The p53 gene is a tumor suppressor gene, located on t h e

short arm of chromosome 17. It encodes a 53 kDa nuclear

phosphoprotein which appears to act as a negative regulator of

ce11 proliferation (77, 78). The p53 protein probably acts as a

transcriptional activator that suppresses abnormal ce11

proliferation by acting as a G1 ce11 cycle checkpoint control fo r

DNA damage (79). p53 gene alterations are the most f requen t

genetic events in human cancers, and have been reported i n

almost every type of adult and pediatric sporadic neoplasm (80-

83). Mutation analysis showed that p53 mutations were p resen t

in 8 of 140 Wilms' tumors (84). The small proportion with p 5 3

mutations were found to be the subset of nephroblastomas

known as anaplastic Wilms' tumor, which have a very poor

prognosis (82). The majority of WTs do not harbor p53 gene

mutations. Therefore, alterations of p53 gene can be used as a

molecular marker for anaplastic Wilms' tumor. Recently,

Bardeesy et al. reported that p53 gene mutations are associated

with the clona1 progression of Wilms' tumor cells showing

favorable histology to anaplastic cells, and suggested that tu m o r

cells with p53 mutations show attenuated apoptosis, indicating

that such lesions may provide a selective advantage in vivo b y

decreasing ce11 death ( 85).

Association Of Hl9 Gene In Wilms' Tumor

As previously mentioned, genetic mapping of BWS patients

and LOH studies of Wilms' tumors have dernonstrated that a

second WT gene locus is present at chromosome 1 l p15 .

Interestingly, the LOH for chromosome 1 lp15 markers in WT

always involved loss of the materna1 alleles (86) , raising t h e

possibility that a genomically imprinted gene is involved in BWS

and Wilms' tumor predisposition.

Genomic imprinting is a phenomenon in which some genes

are silenced when transmitted through a particular parent a l

germ line. Genes subject to imprinting are therefore

monoallelically expressed. Several imprinted genes have b e e n

documented in humans, the Hl9 gene is one such irnprinted gene

and maps to chromosome 1 lp15 (87, 88).

The Hl9 gene was originally cloned in screenings aimed a t

isolating imprinted genes. It codes for a spliced a n d

polyadenylated RNA, which is highly expressed in m a n y

developing organs such as fetal kidney, and has reduced b u t

persistent expression in certain human post-natal organs,

including juvenile and adult kidney (89-9 1). Transcription of

H l 9 is highly regulated and remains detectable in differentiated

myoblasts in culture (92). Hl9 RNA is a major transcript i n

expressing tissues, however, the lack of a long or evolutionarily

conserved translational reading frame and the failure t O

identify peptide products have impeded attempts to predict a

biological function. The H l 9 gene shares some characteristic a s

other mRNA: it is transcribed by RNA polymerase II, a n d

processed by RNA splicing and polyadeny lated. T h e s e

observations suggested that the Hl9 gene product may be a n

RNA molecule, in other words, the biologically active product

might be the H l 9 RNA itself (93). In 1991, Brunkow et al.

reported that inappropriate expression of an Hl9 transgene i n

mice caused fetal mortality (94), and later, Hao et al. described

that the expression of an human Hl9 expression construct i n

certain human embryonic tumor ce11 lines such as RD@ cells

derived from an embryonal rhabdomyosarcoma) and G40 1 (G40 1

cells derived from a malignant rhabdoid tumor), had cau sed

growth retardation and morphological changes, and had an t i -

clonogenic and anti-tumourigenic effects (95). Based on t he se

observations, the H l 9 gene was proposed to be a candidate

tumor suppressor gene. According to this hypothesis, Moulton

and CO-workers analyzed H l9 expression, CpG-methylation, a n d

1 l p 15.5 allelic status in 25 primary WTs. They found that H 1 9

RNA expression was reduced at least 20-fold from fetal k idney

levels in 18 of Wilms' tumor cases. Ten of the expression-

negative tumors retained 1 1 p 15.5 heterozygosity. In nine of

these, H l 9 DNA was biallelically hypermethylated and in t w o

cases hypermethylation locally restricted to H l 9 sequences w a s

also present in the non-neoplastic kidney parenchyma (96).

These observations revealed genetic and epigenetic inactivation

of the H l 9 gene in Wilms' tumorigenesis, suggesting that H 19

plays a tumor suppressor role in the pathogenesis of WT. These

finding are suggestive of a possible biological role of the H l 9

gene in tumorigenesis.

pl6/MTSl And ~15 /MTs2 Genes

Recently, two tumor suppressor genes MTS(multip1e t um or

suppressor)l and MTS2 genes have been demonstrated to b e

involved in many tumor types (97). These two genes a r e

tandemly located within 25 kb of each other at chromosome

9p21, where the region showed the high frequency of deletions

in multiple tumor types. The sequence of the two genes was

determined, and they encode proteins that are cy clin-dependent

kinases inhibitors p l6fMTS 1 and pl 5iMTS2. These proteins ac t

as negative ce11 cycle regulators to inactivate specific cyclin-

protein kinase complexes that are required for progression

through the ce11 cycle (98, 99). The p l6 protein inhibits ras -

induced proliferation and cellular transformation (100). The

MTSl and 2 genes have a high degree of structural a n d

functional homology of each other. They are both encoded b y

two exons, and, 44% and 97% of the MTS2 exons, respectively,

are identical to the first and second exon of MTSl (97).

Functionally, pl6 or p15, each can bind to CDK4 and CDK6, a n d

inhibit their kinase activation, causing the blockade of the ce11

cycle between G1 and S, and resulting in suppression of cellular

proliferation (98, 99). The MTSl and 2 genes were analyzed for

deletions in ce11 lines derived frorn 12' different turnor types. The

analysis demonstrated that MTSl is homozygously deleted a t

high frequency in ce11 lines derived from tumors of lung, breast,

brain, bone, skin, bladder, kidney, ovary and lymphocyte, and a t

least 75% melanoma ce11 lines contain mutant MTSl or have lost

the gene from both homologs. In addition, nonsense and splice-

junction mutations in MTSl have been observed in primary

melanomas and bladder tumors (97). According to these

findings, it has been inferred that MTS mutations are involved in

tumor formation in wide range of tissues and the MTSl and 2

genes are designated as candidate tumor suppressor genes.

Evaluatine The Mutation Status Of MT'S And Hl9 Genes In Wilms'

Turnor

Cancer has been commonly linked to aberrant proliferation

and a failure of the transformed cells to differentiate. Cancer-

associated genes generally can be divided into two types: the

activated proto-oncogenes and the inactivated tumor suppre s sor

genes. The inactivation of a tumor suppressor gene could result

from deletions of the gene or from nonsense mutations that

result in truncated, nonfunctional protein. In these cases bot h

alleles are usually altered In some cases, tumor suppressor

genes are mutated on only one allele producing a protein which

acts in a dominant negative manner inhibiting the function of

the other normal allele. Therefore, the frequency of mutation

and LOH provides persuasive evidence that inactivation of

candidate tumor suppressor genes is necessary for a ce11 to

become cancerous.

As mentioned earlier, genetic analysis has revealed the

MTSl and 2 genes as candidate tumor suppressor genes, and t h e

deletions of these two genes occurs frequently in many cancer

ce11 lines and in certain malignant neoplasms (97), although,

Wilms' tumors have not been previously analyzed. Hence, in

order to assess the possible involvement of the MTS gene

alterations in Wilms' tumor, we searched for deletions or somatic

mutations in the genomic DNAs of Wilrns' tumor.

The H l 9 gene has been suggested as a candidate t u m o r

suppressor gene involved in Wilms' tumor, and the locus of t h e

H l 9 gene where is assumed the second WT suppressor gene, i s

associated in the predisposition of BWS and WT. Based on t he se

considerations, we explored the mutational status of the H l 9

gene in DNA samples from Wilms' tumor and BWS patients.

Analvsis Of The Putative Role Of The WT1-3'UTR(Untranslated Re

Translational Replat ion

The regulation of gene expression may occur at many levels,

including transcriptional initiation, elongation, mRNA splicing,

transport and stability, and translational efficiency.

Transcriptional efficiency is regulated by enhancers, inducible

factors and other transcription factors. A number of t h e

components regulating WT1 transcription have been identified

(101). Post-transcriptional regulation of WTI however is not a

well studied mechanism. Translational regulation often involves

the participation of sequences in the untranslated regions of

mRNA (102). The 5'-untranslated region (5'-UTR) strongly

influences the efficiency of translation. Recently, the 3'-UTR h a s

also been reported to function in translational regulation (102,

103), as well as play a role in affecting mRNA stability (103).

Examples of inhibition of translation by interactions with in t h e

3'-UTR include p-interferon in Xenopus oocytes (104) a n d

creatine kinase in U937 cells (105). The 3'-UTR may also

function to increase protein translation. Studies with ornithine

decarboxylase, which is under translational control b y

polyamines (106), have demonstrated coordinated regulation of

translation by both the S'-and 3'-UTRs. Whereas ornithine

decarboxylase translation initiation is inhibited by sequences in

the 5'-UTR of the mRNA, the 3'-UTR functions to augment, and

partially negate, this inhibition of translation (107).

The importance of the 3'-UTR in regulation of gene

expression inspired us to analyze the translational regulation of

the WT1 gene, and determine what function the 3'-UTR of WTI

has in the expression. Work from Our laboratory had previously

demonstrated elements of the WTl-S'UTR which had a strong

effect on translational efficiency (108). Accordingly, we dec ided

to investigate the function of the WT13'UTR in the translational

efficiency of the WTl gene using an in vitro translation assay.

MATERIRLS AND METHODS

Genomic DNA Of Wilmç' Tumor Source

Al1 the genomic DNA of Wilms' Tumors in Our analysis were

supplied from Dr. Benhard Zabel, Department of Pediatrics,

University of Mainz, Germany. All of DNA samples were isolated

from sporadic tumors, there is no any anaplastic tumor case i n

these specimens.

PCR-SSCP Andysis

To detect possible deletions, insertions or point mutations i n

the Hl9 gene and MTS gene in Wilms' tumor, we used

polymerase chain reaction-single strand conformation

polymorphism(PCR-SSCP) assays.

For amplification of the H l 9 gene, 12 oligonucleotide pairs

were designed to enable coverage of the entire Hl9 coding

region. The primers are summarized in the Fig. 2.

In the analysis of exon 1 & 2 of MTSUpl6, the prirners were

designed as follows: For exon 1: 2F. S'GAAGAAAGAGGAG-

GGGCïG3', 1 1 08R. SGCGCTACCTGATTCCAATïC3'; Exon2: 42F.

S'GGAAAnGGAAACTGGAAGC3'' 55 1 R. S'TCTGAGCTlTGGAAGC-

TCT3'. For exon2 of MTS2jp15 gene, the oligonucleotide pair is:

89F. S'TGAGTTTAAACCTGAAGGTGG3', 50R. SGGGTGGGAAATT'G-

GGTAAG3'.

Primer Primer Pair

1

2

3

4

5

6

7

8

9

1 O

11

12

Sequence Annealing Exon Temperature OC Scanned

PCR-product

Generated, bp

Fig. 2 Schematic diagram of genomic organization of the H l 9

gene and oligonucleotide primer pairs used to amplify the

exonic regions. The black boxes represent the 5 exons of the

H l 9 gene and each exon is numbered. Oligonucleotide primer

pairs used to amplify specific regions of H l 9 are represented

by bidirectional arrows under the exon segments. Primer

names, their sequence, annealing temperature, and size of the

PCR product generated are tabulated below the H l 9 gene.

19

Exonic sequences of the Hl9 gene and the MTSl and 2 genes

were amplified from genomic DNA of Wilms' tumor samples b y

the polymerase chah reaction(PCR).

Each PCR was performed in 20pl volumes containing 50ng of

genomic DNA as template, 0.5 pmoles of each oligonucleotide,

0 final concentration dimethyl sulfoxide, 1 OOpM

deoxynucleoside triphosphates, 0.2unit of Taq I polymerase an d

l x PCR buffer [lOmM Tris-HCL(PH8.4), 50mM KCi, 1 SmM MgCl*,

0.01% Gelatin, 0.01% NP-40 and 0.01% Tween-201. One of the

primer pair was radiolabelled with Y - ~ ~ P - A T P and T4

polynucleotide kinase, 50pC of 3 2 ~ was used to label 20 pmoles

of oligo. The amplification reactions were performed for 3 0 - 3 5 ,

cycles.

The PCR products were directly analyzed by the SSCP(sing1e

strand cornformation polymorphism) method. 2p1 of the KR

products were mixed with 8pl of the formamide dye mix (95%

formamide, 20mM EDTA, 0.05 $6 bromophenol blue, 0.05 % x y le n e

cyan01 FF), boiled for 5 minutes, and then placed on ice for 5

minutes. 2pl samples were loaded onto 8% polyacrylamide (50:l

acrylamidelbisacrylamide) gels and the gels were

electrophoresed for 3-5 hours at 30W in the cold room (4 OC).

Before loading the samples, the polyacrylamide gels were pre-

electrophoresed for 30 minutes in 1X TBE (90mM Tris, 90mM

boric acid, 2.5 mM EDTA) at 30W in the cold room. The gels w e re

dried for 30 minutes at 80 OC with filter paper and exposed to

Kodak X-OMAT film at -70 OC for 12-24 hours with or without an

intensifying screen.

Plasmids And Construction

For human WTl cDNA clones: Plasmid WT33 contains a

truncated WT1 fragment (1024bp-3335bp), pBSNiWT1 contains

the WTl coding region but lacks a 3'-UTR (568bp-2080bp).

pSP65/hWT(+3') was generated as follows: WT33 was digested

with NcoI (in WTl) and XbaI (in pKSII vector), pBSN/WT1 w as

digested with NcoI (in WT1) and EcoRI(in pKSII vector), the two

WT1 fragments were ligated at the NcoI site, to obtain the ful l

length WTI from 390bp-3335 bp (EcoRI-Xbai), and this in sert

was introduced into the transcription vector pSP65-38A.( see fig . 3). The 2.9kb fragment of WTl which lacks a 3'-UTR was

obtained by digestion of pBSNlWTl with EcoRI (two EcoRI are in

the pKSII vector), then ligation of this WT1 fragment wit h

pSP65-38A, to generate pSP651hWTl(-3') (see fig. 3).

For mouse WTl cDNA clones: Plasmid pKSIIWT(-I-) contai ns

the entire coding region of the WTl murine cDNA (3200bp)

(Pelletier J. 199 1). To generate truncations of the WT 1 -3'UTR,

pKS8IWT(-I-) was digested with EcoRI in the 5' end of WT1, and

with EcoRI, HincII, BglII, XbaI or Sau3AI at the 3' end of WTI.

These inserts were introduced into the EcoRI-EcoRI, EcoRI-

HincII, EcoRI-BglII, EcoRI-XbaI and EcoRI-Sau3AI sits of pSP65-

38A. The resulting plasmids were referred to as pS P65/WTe,

pSP65/WTh, pSP65/WTb, pSP65IWTx and pSP65/WTs(see fig.

4) -

5'UTR A?G Codina Region 3'UTR Hurnan WT1 cDNA

U l lbp

Fig. 3 Effect of human WTI-3'UTR deletion on translation in

vitro.

A. diagram of deletions generated within the human WT1-

3'UTR. The hatched boxes represent the SP6 RNA polymerase

promoters, the stippled boxes represent the S'UTR, the black

boxes indicate the coding region, and the white boxes represent

the 3'UTR.

B. In vitro translation of human WT1 mRNA constructs.

Lane 1. pSP65/hWT(+3'); Lane 2. pSP6ShWT(-3'); Lane 3. no

input RNA. After in vitro translation reaction, 5p1 translation

products were loaded onto a 10% SDSlpolyacrylamide gel,

following electrophoresis, the gel was treated with ance, ce, dried, and exposed to X-Omat (Kodak) film at -70 OC with an

intensifying screen overnight.

pSP65/hWT(+3') does not. contain the WTI alternative

splice, pSP65/hWT(-3') contains the alternative splice. So, the

bands of the translation products in lane 1 and 2 do not appear

to line up.

SPG U Promoter 180bp

Xba I

1 n

u I l t b p

Fig. 4 Effect of mouse WT1-3'UTR deletion on translation in

vitro.

A. diagram of deletions generated within the WT1-

3'UTR.The hatched boxes represent the SP6 RNA polymerase

promoters, the stippled boxes represent the S'UTR, the black

boxes indicate the coding region, and the white boxes represent

3'UTR.

B. In vitro translation of WT1 mRNA constructs. Lane 1.

pSP6S/mWTe; Lane 2. pSP65/mWTb; Lane 3. pSP65lmWTh;

Lane 4. pSP6S/rnWTx; Lane 5. pSP65fmWTs; Lane 6. no input

RNA. After in vitro translation reaction, 5ul translation

products were loaded onto a 109 SDSlpolyacrylamide gel,

following electrophoresis, the gel was treated with pro an ce, dried, and exposed to X-Omat (Kodak) film at -70 OC with an

intensifying screen overnight.

The plasmid pKS8/WT(-1-) and WT33 were constructed b y

Dr.Jerry Pelletier, pBSNlWT1 was a gift of Dr. Benhard Zabel

(Germany). The transcription vector pSP65-38A was modified a s

described ( Pelletier et al 1991).

The restriction enzymes were purchased frorn New England

Biolabs and were used according to the manufacturer ' s

directions.

Plasmid selection were performed by using the DHl OP

bacteria strain (GibcoBRL). DHlOP was grown in LB media. The

protocol of competent DH10B preparation, transformation w i t h

plasmid, and plasmid isolation, were as described (109).

Zn Vitro Transcri~tion And Translation

For in vitro transcription, the plasmids pSP65/WTe,

pSP65/WTh, pSP65IWTb, pSP65tWTx, pSP6S/WTs,

pSP65/hWT(+3') and pSP65/hWT(-3') were linearized w i t h

HindZII. After digestion, linearized plasmids were extracted b y

phenol-chloroform( 1 : 1 ; v/v), purified by passing over the G-50

spun-dialysis column, and precipitated by ethanol. In 1 0 0 ~ 1

transcription reactions, 500pM m7GpppG and 100prn GTP w a s

added in the reaction mix, in order to synthesize capped mRNA

transcripts. 1mM ATP, CTP and UTP were included in the mix,

10pC 5-'H-CTP was added in the reaction mix as a trace label to

quantify mRNA yields. SP6 polymerase was used in the reaction

for the mRNA synthesis. The incubation tirne was 2hr at 4 2 ' ~ .

After incubating, the samples were extracted b y

phenollchloroform 1 : l v : ) passed over G-50 spun-dialysis

column and ethanol precipitated. 2p1 of the products of t h e

transcription reactions were measured by scintillation counting

to quantify mRNA synthesis yields. 4p1 of the products were

loaded ont0 1% formaldehyde agarose gels for analysis of t h e

integrity of the RNA products.

For translation reactions, 1 pg RNA templates as translated i n

50p1 rabbit reticulocyte lysate(Promega Biotech) reaction mix.

1mM amino acid mixture (minus Methionine) and 16pglml of

[ 3 5 ~ ] Methionine (final concentration) were added in the mix. The

translation control was set by a mix lacking RNA templates. The

translation reactions were performed at 30°c for lhr. After

incubation, 5p1 of translation products were loaded ont0 a 10%

SDS-polyacryamide gel for analysis of protein produc ts.

Following electrophoresis, the gel was treated with ance, ce, dried, and exposed to Fuji x-ray film at -70 OC for 12 hr.

RESULTS

Searching Mu ta tion Of MTS Arad Hl9 Genes In Wilmç' Tumor

To detect possible deletions, insertions or point mutations of

the H l 9 gene and MTS genes in Wilms' tumor, we used the PCR-

SSCP assay. The SSCP assay is based on the property of single

stranded nucleic acid to assume sequence-specific conformations

due to intramolecular hydrogen bonding when analyzed u n der

non-denaturing conditions. A difference of even a single base

pair can cause the single stranded DNA to adopt different

conformations (conformers). The resulting conformers have a

characteristic electrophoretic mobility and the differe n t

conformer displays a mobility shift in the presence of sequence

polymorphisms. In the SSCP assay, radiolabelled DNA fragments

of the gene of interest are generated by PCR. Subsequently the

DNA is denatured, the single strands are elec trophoresed

through a non-denaturing polyacrylamide gel. The mobility of

conformers is detected by autoradiography. The differences i n

migration of polyrnorphic sequences are observed as a "shift" on

the autoradiogram.

The SSCP method is efficient, rapid, and has a high mutation

detection rate (1 10- 1 12), which allows simple and rapid analysis

of a large number of samples. Additionally, the mu tational

detection ability of this method is not interfered with b y

contamination with the normal product (frorn normal DNA) i n

the PCR, hence heterozygous mutations are detectable.

During Our mutational detection for the Hl9 gene and MTS

genes in Wilms' tumor, the fragments of approximately 200bp of

the Hl9 gene and MTS genes were amplified by polymerase

chah reaction (PCR) and the products are analyzed by SSCP. The

PCR-SSCP analysis for each product was performed tw ice

alternating the identity of the radiolabelled oligonucleotides

primer. This is because the sequence context in which a

mutation is located can have striking influences on the shift

detected by SSCP analysis, thus it is optimal to analyze both

strands of the gene of interest when searching for mutations.

For analysis of mutations in the MTS genes, we used

ofigonucleotide pairs designed to enable coverage of the

sequences of exon 1 and 2 of the pl6/MTS1 gene and exon 2 of

the p151MTS2 gene. Exon 1 and 2 of the pl6lMTS1 gene

displayed a high rate of mutation frequency in melanoma ce11

lines (97), eighteen mutations distributed in 14 of 34 melanoma

lines. In our WT specimens, we decided to scan the mutation

frequency of these three exon regions of MTS genes in Wilms

tumors. We analyzed 28 genomic DNA samples isolated f rom

sporadic Wilms' tumors. N65 is a genomic DNA from a normal

individual which was used as a standard for the intact normal

MTS genes in the PCR-SSCP analysis. In these 28 cases, no

fragment showing mobility shifts for the MTS genes was found,

and the data was consistent with the results of Southern blot

analysis for these genes, that did not display any deletions of

these genes in Wilms' tumor (Dr.Jerry Pelletier, unpublished).

For analysis of the Hl9 gene, we designed oligonucleotide

primer pairs which allowed us to amplify the entire Hl9 exonic

region. In total, we scanned genomic DNAs of 54 Wilms' tumors

for the H l 9 gene mutations, of which 47 genomic DNAs w e r e

derived from sporadic Wilms' tumors. Considering whether t h e

Hl9 gene is involved in the predisposition to BWS and Wilms'

tumor, we examined 7 cases of familial BWS DNA samples

(Table.1). We also tested 22 other DNA samples which w e r e

isolated from normal blood cells for cornparison. The PCR-SSCP

analysis showed that two tumor DNA samples had mobility shifts

(see Fig. 5). N0.60 DNA was derived from a sporadic Wilms'

tumor and showed mobility shifts with primer pairs 4A/4B a n d

1 I A/ 1 1 B. No.Sth DNA was derived from a BWS patient, a n d

showed a mobility shift with the primer pairs 4A14B. No o the r

DNA samples showed evidence of H l 9 gene alterations. We d id

not sequence these two SSCP shifts. Since, genetic studies h a v e

revealed that 50% of WTs show LOH restricted to chromosome

1 l p l 5 and thus the Wilms' tumor locus located at 1 l p l 5 i s

expected to be altered at high frequency. Therefore, we expected

the alteration of the H l 9 gene in WT should be at a very high

frequency. During the course of these studies, deletion analysis

of WTs using markers from 1 l p 15 identified specimens w i t h

small deletions 1Mbp centromeric to Hl9 (J, Pelletier,

unpublished data). In Our data, only two DNA samples showed a

mobility shift out of 54 WT specimens. The low rate of t h e

unaffec ted

N0.W

unaffected

' unaffected

No.GO

unaffected

unaffec ted

No.0

unaffected

N0.60

unaffected *

'JoSth

Fig. 5 PCR-SSCP analysis of H l 9 exon 1 and exon 5 in DNA

sample No.Sth and No.60. PCR product from an unaffected

individual were included as an interna1 standard for the

normal allele. Mobility shifts are indicated by arrowheads.

(A). Mutational analysis of exon 1 of the H l 9 gene in turnor

DNA samples No.Sth and No.60. The segments of H l 9 exon 1

were amplified with oligonucleotide primer pair 4A/4B, and .

the PCR products were amplified from these two DNA samples

showing the mobility shift (arrowhead). (a) Oligonucleotide 4A

was radiolabeled and (b) oligonucleotide 4B was radiolabeled

when PCR products were amplified.

(B). Mutational analysis of exon 5 of the H l 9 .gene in tumor

DNA sample No.60. Exon 5 of the Hl9 gene was amplified with

oligonucleotide primer pair 1 1 A/11 B, and the PCR product

display an mobility shift (arrowhead). (a) Oligonucleotide 11A

was radiolabeled, and (b) oligonucleotide 11B was radiolabeled -

for amplifications.

mobility shift was not as significant as we expected, which

prompted us to reconsider the significance of the mutation status

of the Hl9 gene in WT.

Analvsis Of The Function Of The WT13'UTR

To understand what function the 3'-UTR of WT1 has in the

control of translation, we developed a deletion strategy to

investigate the involvment of different elements of WT1-3'UTR

for the efficiency of in vitro translation.

The full length cDNA of human and mouse WTl gene is

3335bp and 3138bp. The length of human and mouse WT1-

3'UTR is 1277bp and 1263bp respectively, and parts of these

regions were deleted in a series of in vitro

transcriptiodtranslation constructs ( see Fig. 3& 4 ) The

constructs contain part of the 5'-UTR, the full length coding

region and different deletions of the WTl-3'UTR.

pSP65/hWT(+3') contains the intact human WT1 coding region

with complete 3'-UTR (the length is 2.9kb), pSP65/hWT(-3')

contains human WTl coding region without the 3'-UTR (the

length is 1630bp) (see Fig.3). pSP65lWTe contains the mouse

WT1 coding region with the entire WT1-3'UTR (total size:

2803bp). pSP651WTh' pSP65/WTb, pSP65TWTx and pSP6WWTs

contains the truncated mouse WTl gene, deleted respectively a t

HincII(2655bp), BglII(2243bp), XbaI(1765bp) and

Sau3AI(1640bp) sites in WTl-3'UTR (see Fig.4). After

construction of these plasmids, they were linearized and used a s

templates in in vitro transcription experiments. mRNA w a s

successfully synthesized and the size of the RNA products w e r e

consistent with the inserts of these plasmids. Equal quantities of

RNA products were translated in the rabbit reticulocyte ly sate

system. The results showed that al1 RNA products were

translated with equal efficiencies (see Fig.3 & 4 ) and thus the

3'-UTR of WT1 does not affect translation in vitro.

DISCUSSION

Low Rate Of Mutations Of MTS And Hl9 Genes h WT

Absence Of The MTS Gene Mutations In Wilms' Tumor.

Since the MTS genes were discovered and were found to b e

mutated in a wide range of ceIl lines, a number of investigators

have evaluated the frequency of the MTS genes alterations in

prirnary human tumor material. The results of examinations of

primary tumors have conflicted in their support for the role of

the MTS genes as tumor suppressors. Studies of the MTS genes,

in particular p l6lMTS 1 have shown high frequencies of

homozygous deletions or point mutations in some tumor types,

suggesting that involvement of the p16fp15 genes is a common

event in certain human primary tumors (97, 1 13-1 18). Studies

of other cancers have demonstrated low mutation rates ( 1 19-

123). Indeed, the frequency of p l6 gene mutation in primary

tumors ranges from 0% in breast cancer (120) to 52% in

esophageal squamous ce11 carcinomas (1 13). During Our studies,

no point mutations or deletions of the MTS genes were observed

in 28 Wilms' tumor cases, either by PCR-SSCP analysis o r

Southern blot analysis. These observations suggest that t h e

mutation or deletion on the MTS genes does not contribute to

Wilms' tumor onset or progression. In addition, reviewing t h e

recent reports of LOH studies in Wilms' tumor, common

chromosome structural abnormalities are found occurring O n

chromosomes 1,7, 11 and 16, excluding chromosome 9 where t h e

MTS genes are located. The MTS genes are thus not commonly

involved in Wilms' tumor carcinogenesis.

Low Rate Of Pol~morphisim Of The H l 9 Gene In Wilms' Tumor

As mentioned earlier, previous functional, imprinting a n d

mapping data have implicated H l 9 as a candidate WT

suppressor gene. Proof of this hypothesis requires evidence f rom

the molecular analysis of primary tumors. We investigated t h e

mutational status of the H l 9 gene in Wilms' tumor cases. In 5 4

Wilms' tumor genomic DNAs, only 2 cases were observed to have

mobility shifts ( table 1). This data suggested the low frequency

of the H l 9 gene alterations in WT. Possible explanations for t h e

low rate of alteration of the Hl9 gene are (i) That a gene o the r

than H l 9 is the Wilms' tumor suppressor gene located a t

chromosome 1 lp15. (ii) Either, the alteration of Hl9 gene m a y

not play a main role in Wilms' tumorigenesis, or (iii) Since H l 9 i s

irnprinted, and therefore can be inactivated by a single genetic

- hit at one locus, the evidence of tumor suppression activity m a y

differ from that obtained for other tumor suppressor genes. 1 n

particular, if genetic inactivation is through mitotic

recombination or to alterations in an "imprinting center'' which is

Table.1 Summary of the polymorphism of the H l 9 gene in WT cases.

Wilms' tumor type DNA sarnple No. Polymorphism Affected Exon Oligo Pair

sporadic WT 1-36 - - -

- 1 and 5

-

W T with BWS Sth 1 1 4M4B

San - - - 1 Sch - - -

SI0 - Bca - ScAL

Newc

adjacent to the gene then the criterion of intragenic mutat ion

which has been useful for identifying classical tumor suppressor

genes may not apply to imprinted genes.

The WTlô'UTR 1s Not Involved In WT1 Translational

Remdation.

WT 1 is a developmentally regulated transcription factor th a t

functions as a tumor suppressor gene, and has a highly t issue-

specific pattern of gene expression, but the regulatory

mechanism of WTl expression is still as a rnystery. In this s tudy,

we demonstrated that WT1-3'UTR does not play a functional role

in the regulation of WT1 expression and translation in vitro (see

fig.3 & 4). As protein product levels in the absence and presence

of the WTl-3'UTR were not significantly different in the rabbi t

reticulocyte translation system. It remains formally possible t ha t

the in vitro translation system does not contain factors necessory

for mimicking the in vitro regulation of WT1 translation. The

factors may thernselves be developmentally regulated and t hu s

absent in reticulocyte which do not normally express WTl.

Motifs found in 3'UTRs are known to influence translational

efficiency in particular AU-rich (usually AUUUA) elements. AU

rich elements (3'AURE) affect the efficiency of translation

include that of the cachectin-tumor necrosis factor a (TNF-a)

chimeric constructs which are inhibited in mouse macrophage-

derived cells grown in the absence of endotoxin but show

increased expression in cells grown in the presence of inducer,

and a differential effect on translation has been attributed to the

3'AURE of the TNF-a transcript (1 24). Both cDNA of human a n d

mouse WT1 contain AU-rich elements. However, according to Our

data, effects of the 3'AURE for WT 1 translation regulation w e r e

not observed in vitro. But it does not eliminate the function of

the 3'AURE of WT1 in vivo. Perhaps, the 3'AURE affects t h e

translational efficiency and or mRNA stability of WTl b y

interacting with certain cellular proteins of the WT1 transcrip ts

i n cellular environment.

In summary, we evaluated the mutationai status of t h e

p16IMTS 1 and p15/MTS2 genes in 28 sporadic Wilms' tumor

cases, no point mutations or deletions were observed, and these

results were consistent with the result of Southern blot analysis

of these genes in Wilms' tumor. Taken together, p l6/MTS1 a n d

p15IMTS2 are not frequently associated in the Wilms'

tumorigenesis. Likewise, only two polymorphisims were found in

54 Wilms' tumor genomic DNAs during the mutation analysis of

the H l 9 gene, suggesting the low alteration frequency of the H l 9

gene in Wilms' tumor cases. We demonstrated the WT 1 -3'UTR

does not function in the translational expression of the WTI gene

in a simple in vitro system. Al1 of these study results contribute

to the molecular genetic understanding of Wilms' tumorigenesis.

REFERENCES

1. Pendergrass, T.M. 1976. Congenital anomalies in children

with Wilms' tumor, a new survey. Cancer 37: 403.

2. Breshow NE, Beckwith SB, Ci01 M, et al. 1988. Age

distribution of Wilms' tumor: Report From the National

Wilms' Tumor Study. Cancer Res 48: 1653.

3. Bond J.V.1975. Bilateral Wilms' tumor. Age at diagnosis,

associated congenital anomalies, and possible pattern of

inheritance. Lancet II: 482

4. Breslow N.E, Beckwith J.B, 1982. Epidemiological features of

Wilms' tumor: Results of the National Wilms' Tumor Study. J.

Natl. Cancer Inst. 68: 429

5. Bove K.E, Koffler H, McAdams A.J. 1969. Nodular renal

blastema. Definition and possible significance. Cancer 24:323.

6. Bennington J.L, BeckwithJB, 1975. Tumors of the kidney,

renal pelvis and ureter. In Atlas of tumor pathology, series

2, fascile 12. Armed Forces Institute of Pathology,

Washington,D.C.

7. Matsunaga E. 1981. Genetics of Wilms' tumor. Hum. Genet.

57: 231.

8. Knudson A G , Jr. and L.C. Strong. 1972. Mutation and cancer:

A mode1 for Wilms' tumor of the kidney. J. Natl. Cancer Inst.

48: 313.

9. Nakagome Y, Ise T, Sakurai M, Nakajo T, Okamoto E, Takano

T, Saito S, et a1.1984. High-resolution studies in patients

with aniridia-Wilms' tumor association, Wilms' tumor or

related congenital abnormalities. Hum. Genet .67: 245.

10. Shaw M.W, Falls H.F, Neel J.V. 1960. Congenital aniridia.

Am. J. Hum. Genet 12: 389.

I l . Francois J, Coucke D, Coppieters R. 1977. Aniridia-Wilms'

tumor syndrome. Ophthalmology 174: 35.

12.Brusa P. Torricelli C. 1953. Nefroblastoma di Wilms' ed

affezioni renale congenite nella casistica dell' IPPAI di

Milano. Minerva Pediatr. vol. 5: 457.

13. Miller,R.W., J.F. Fraumeni, and M.D. Manning. 1964.

Association of Wilms' tumor with aniridia,

hemihypertrophy and other congenital malformations. N.

Eng. J. Med. 270: 922.

14. Fraumeni IF, Glass AG. 1968. Wilms' tumro and congenital

aniridia. J. Am. Med. Assoc. 206: 825,

15. Beckwith J.B. 1963. Extreme cytomegaly of the fetal adrenal

cortex, omphalocoele, hyperplasia of kidneys and pancreas,

and Leydig-ce11 hyperplasia. Another syndrome? Presented

a t the Annual Meeting of Western Society for Pediatric

Research, Los Angeles, California, Nov. I l .

16. Wiedemann H.R. 1964. Complexe malformatif familial avec

hernie ombilicale et macroglossie-Un syndrome nouveau? J.

Genet. Hum. 13: 223.

17. Higurashi M, Ijima K, Sugimoto Y, Ishikawa N, Yoneyarna K.

1980. The birth prevalence of malformatin syndromes in

Tokyo infants. Am. J. Med.Genet. 6:189.

18. Pettenati M.J, Haines J.L, Higgins R.R, Wappner R.S, Palmer

C.G. Weaver D.D. 1986. Wiedemann-Beckwith syndrome:

Presentation of clinical and cytogenetic data on 22 new

cases and review of the literature. Hum. Genet. 74: 143.

19. Sotelo-Avila C, Gonzalez-Crussi F, Fowler J.W. 1980.

Complete and incomplete forrns of Beckwith-Wiedemann

syndrome: Their oncogenic potential. J. Pediatr. 96: 47.

20. Koufos A., Grundy P., Morgan K. 1989. Familial Wiedemann-

Beckwith syndrome and a second Wilms' tumor locus both

map to 1 lp15.5. Am. J. Hum. Genet 44: 71 1.

21. Ping AJ, Reeve AE, Law DJ. 1989. Genetic linkage of

Beckwith-Wiedemann syndrome to 1 lp15. Am. J. Hum.

Genet 44: 720.

22. Denys P, Malvaux P. van den Berghe H, Tanghe W,

Proesmans W. 1967. Association d'un syndrome anatomo-

pathologique de pseudohermaphrodisme masculin, d'une

tumeur de Wilms', d'une nephropathie parenchymateuse et

d'un mosaicisme X X I X Y . Arch. Fr. Pediatr. 24: 729.

23. Drash A, Sherman F, Hartmann WH, Blizzard RM. 1970. A

syndrome of pseudohermaphroditism, Wilms' tumor,

hypertension, and degenerative renal disease. J. Pediatr. 76:

5 85.

24. Habib R, Loiret C, Gubler M.C, Niaudet P, Bensman A, Levy

M, Broyer M. 1985. The nephropathy associated with male

pseudo hermaphroditism and Wilms' tumor (Drash

syndrome): A distinct glomerular lesion-Report of 10 cases.

Clin. Nephrol.24: 269.

25. Jadresic L, Leake J, Gordon I, Dillon M.J, Grant D.B. Pritchard

J, Risdon R.A, Barrat T.M. 1990. Clinicopathologic review of

twelve children with nephropathy, Wilms' tumor. and

genital abnormalities (Drash syndrome). J. Pediatr. 1 17:

26. Garfunkel J.M. 1985. Editors comments on Edidin, D.V.

Pseudohermaphroditism, glomerulopathy, and Wilms'

tumor (Drash syndrome). J. Pediatr. 107: 988.

27. Spear G.S, Hyde T.P, Gruppo R.A, Slusser R. 1971.

Pseudohermaphroditism, glomerulonephritis with nephrotic

syndrome, and Wilms' tumor in infancy. J. pediatr. 79: 677.

28. Barakat A.Y, Papadopoulou Z.L, Chandra R.S, Hollerman C.E,

Calcagno P.L. 1974. Pseudohermaphroditisrn, nephron

disorder and Wilms' tumor: A unifying concept. Pediatrics

54: 366.

29. McCoy F.E, Jr., Franklin W.A, Aronson A.J, and Spargo B.H.

1983. Glomerulonephritis associated with male

pseudohermaphroditism and nephroblastoma. Am. J. Surg.

Pathol. 7: 387.

30. Habib R, Loriat C, Gubler MC, Niaudet P, Bensman A, Levy

M, and Broyer M. 1985. The nephropathy associated with

male pseudohermaphroditism and Wilms' tumor (Drash

syndrome): A distinct glomerular lesion-Report of 10 cases.

Clin. Nephrol. 24: 269.

31. Gallo G, Chemes H.E. 1987. The association of Wilms' tumor,

male pseudohermaphroditism and diffuse glomerular

disease (Drash syndrome). Report of eight cases with

clinical and morphologic findings and review of the

literature. Pediatr. Pathol. 7: 175.

32. Jensen J.C, Ehrlich R.M, Hanna M.K, Fine RN, Grunberger

1.1989. A report of 4 patients with the Drash syndrome

and a review of the literature. J. UroI. 141: 1174.

33. Jadresic L, Leake J, Gordon 1, Dillon M.J, Grant D.B, Pritchard

J, Barrat T.M. 1990. Clinicopathologic review of twelve

chidren with nephropathy, Wilrns' tumor, and genital

abnormalities (Drash syndrome). J. Pediatr. 1 17: 7 17.

34. Tank E.S. and Melvin T. 1990. The association of Wilms'

tumor with nephrologic disease. J. Pediatr. Surg. 25: 724.

35. Pelletier J, Munroe D., and Housman D.1991. Molecular

Genetics of Wilms' tumor. Genome Analysis Volume 3:

Genes and Phenotypes. 135.

36. Francke U, Holmes L.B, Atkins L, and Riccardi V.M.1979.

Aniridia-Wilms' tumor association: Evidence for specific

deletion of 1 lp13. Cytogenet.Cel1 Genet. 24: 185.

37. Henry 1, Jeapierre M, Couillin P, Barichard F, Serre JL, et al.

1989. Molecular definition of the 1 1 pl 5.5 region involved

in Beckwith-Wiedemann syndrome and probably in

predisposition to adrenocortical carcinpma. Hum. Genet. 8 1 :

273.

38. Marion A. Maw, Paul E. Grundy, Lynn J. Millow, Michael R.

Eccles, et al 1992. A third Wilrns' tumor locus on

chromosome l6ql. Cancer Res 52: 3094.

39. Ton CCT, Hirvonen H, Miwa H, et al. 1991. Positional cloning

and characterization of a paired box- and homeobox-

containing gene from the aniridia region. Ce11 67: 1059.

40. Pelletier J, Bruening W, Li FP, Haber DA, Glaser T, Housman

DE. 1991. WTl mutations contribute to abnormal genital

system development and hereditary Wilms' tumor. Nature.

353: 431.

41. Pelletier J, Bruening W, Kashtan CE, et al. 1991. Germline

mutations in the Wilms' tumor suppressor gene are

associated with abnormal urogenital development in Denys-

Drash syndrome. Ce11 67: 437.

42. Haber DA., Sohn RL., Buckler AJ. 1991. Alternative splicing

and genomic structure of the Wilms' tumor gene WTI. Proc.

Natl. Acad. Sci Usa 88: 9618.

43. Brenner B, Wildhardt G, Schneider S.1992. RNA

polymerasechain reaction detects different levels of four

alternativel~ spliced WT 1 transcripts in Wilms' tumor.

Oncogene 7: 143 1.

44. M o ~ ~ s JI, Madden SL, Tournay OE. 1991. Characterization of

the zinc finger protein encoded by the WT1 Wilms' tumor

locus. Oncogene 6: 2339.

45. Telerman A, Dodernont H, Degraef C. 1992. Identification of

the cellular protein encoded by the human Wilms' tumor

(WTl) gene. Oncogene 7: 2545.

46. Mitchell PJ, Tijan T.1989. Transcriptional regulation in

mammaliam cells by seqence specific DNA binding proteins.

Science 24: 371.

47. Madden SC, Cook DM, Moms JF. 1991. Transcriptional

repression mediated by the WT1 Wilms' tumor gene

product. Science 253: 1550.

48. Evans B., Hollenferg S. 1988. Zinc fingers: Gilt by association.

Ce11 52: 1.

49. Joseph LJ, LeBean MM, Jamieson GA.1988. Molecular

cloning seqencing and mapping of EGR-2, a human early

growth response gene encodeing a protein with zinc-

binding finger structure. Proc. Natl. Acad Sci USA 85: 7164.

50. Sukhatime VP., Cao X., Chang LC. 1988. A zinc finger

encoding gene coregulated with c-fox during growth and

differntiation and after cellular depolarization. Ce11 53: 37.

51. Rauscher FJ, Morris JF, Tournay 0E.1990. Binding of the

Wilms' tumor locus zinc finger protein to the EGR-1

consensus seqence. Science 250: 1259.

52. Gashler AL, Bonthron DT, Madden SL.1992. Human

plateltderived growth factor A chain is transcriptionally

repressed by the Wilms' tumor suppressor WT1. Proc. Natl.

Acad. Sci. USA 89: 6010.

53. Drummond IA., Madden SL-, Rohwer-Nutter P. 1992.

Repression of the insulin-like growth factor II gene by the

Wilms' tumor supressor WTl. Science 257: 674.

54. Brown KW, Wilmore HP, Watson JE, Mott MG, Berry J, et

al. 1993. Low frequency of mutations in the WTl coding

region in Wilms' tumor. Genes Chromosomes Cancer 8: 74.

55. Cowell JK, Wadey RB, Haber DA, Cal1 KM, Housman DE,

Pritchard J. 1991. Structural rearrangements of the WTl

gene in Wilms' tumor cells. Oncogene 6: 595.

56. Gessler M, Konig A, Arden K, Grundy P, Orkin S, et a1.1994.

Infrequent mutation of the WTl gene in 77 Wilms' tumors.

Hum. Mutat. 3: 212,

57. Glaser T, Lane J, Housman D.1990. A mouse mode1 of the

aniridia-Wilms' tumor deletion syndrome. Science 250:

823.

58. Little MH, Prosser J, Condie A, Smith PJ, Van Heyningen V,

Hastie ND. 1992. Zinc finger point mutations within the WT1

gene in Wilms' tumor patients. Proc. Natl. Acad. Sci. U.S.A.

89: 4791.

59. Royer-Pokora B, Ragg S, Heckl-Ostricher B, Held M, Loos U,

et al. 1991. Direct pulsed field gel electrophoresis of Wilms'

tumors shows that DNA deletions in l lp13 are rare. Genes

Chromosomes Cancer 3: 89.

60. Tadokoro K, Fujii H, Ohshima A, Kakizawa Y, Shimizu K, et al.

1992. Intragenic homozygous deletion of the WT1 gene in

Wilms' turnor. Oncogene 7: 1215.

61. Varanasi R, Bardeesy N, Ghahremani M, Petruzzi MJ, Nowak

N, et al. 1994. Fine structure analysis of the WT.1 gene in

sporadic Wilms' tumors. Proc. Natl. Acad. Sci. USA. 91:

62. Hastie N.D.1994. The Genetics of Wilms' tumor-A case of

disrupted development. Annu. Rev. Genet. 28: 523.

63. Baird PN, Groves N, Haber DA, Housman DE, Cowell JK.1992.

Identification of mutations in the WTl gene in turnors from

patients with the WAGR syndrome. Oncogene 7: 2141.

64. Brown KW, Watson JE, Poirier V, Mott MG, Berry PJ,

Maitland NJ. 1992. Inactivation of the remaining allele of

the WT1 gene in a Wilms' tumor from a WAGR patient.

Oncogene 7: 763.

65. Gessler M, Konig A, Moore J, Qualman S, Arden K, et al.

1993. Homozygous inactivation of WTl in a Wilms' tumor

associated with the WAGR syndrome. Genes Chtomosornes

Cancer 7: 131.

66. Baird P.N., Santos A., Groves N., Jadresic L., Cowell J.K. 1992.

Constitutional mutations in the WT1 gene in patients with

Denys-Drash syndrome. Hum. Molec. Genet. l(5): 301.

67. Pelletier J, Bruening W, Kashtan C.E, Mauer S.M, Manivel J.C,

Housman D, et a1.1991. Germline Mutations in the Wilms'

tumor suppressor gene are associated with abnormal

urogenital development in Denys-Drash syndrome. Ce11 67:

43 7.

68. Armstrong JF., Pritchard-Jones K., Bickmore WA., Hastie ND.,

Bard JBL. 1992. The expression of the Wilms tumor gene

WTl in the developing mammalian embryo. Mech. Dev. 40:

85.

69. Pritchard-Jones K, Fleming S, Davidson D, Bickrnore W,

Porteous D, Pelletier J, Housman D, et a1.1990. The candidate

Wilms' tumor gene is involved in genitourinary development.

Nature 346: 194.

70. Pelletier J, Schalling M, Buckler AJ, Rogers A, Haber DA,

Housman DE. 1991. Expression of the Wilrns' tumor gene

WTI in the murine urogenital system. Genes & Dev 5:1345.

71. Sharrna PM, Yang X, Bowrnan M, Roberts V, Sukumar S.

1992. Molecular cloning of rat Wilms' tumor complementary

DNA and a study of messenger RNA expression in the

urogenital system and the brain. Cancer Res. 52: 6407.

72. King-Underwood L., Renshaw J. and Pritchard-Jone K. 1996.

Mutations in the Wilms' tumor gene WT1 in leukemias.

Blood. Vo1.87. No.6: 2171.

73. Pritchard-Jones K, Fleming S. 199 1. Ce11 types expressing the

Wilms' tumor gene (WT I ) in Wilms' tumor: Implications for

tumor histo-genesis. Oncogene 6: 22 1 1.

74. Gerald WL, Gramling S, Sens DA, et a1.1992. Expression of

the 1 lp13 Wilms' tumor gene, WT1, correlates with

histologie category of Wilms' tumor. AmJ Pathol 140: 1031.

75. Miwa H, Tomlinsom GE, Timmons CF, et a1.1992. RNA

expression of the WTl gene in Wilms' tumors in relation to

histology. J Natl Cancer Inst 84: 18 1.

76. Yeger H, Cullinane C, Flenniken A, et a1.1992. Coordinate

expression of Wilms' tumor genes correlates with Wilms'

tumor phenotypes. Ce11 Growth Different. 3: 855.

77. Leine A.L, Momand J, Finlay C.A.1991. The p53 tumor

suppressor gene. Nature (Lond.). 351: 453.

78. Vogelstein B, Kinzler K.W.1992. p53 function and

dysfunction. Cell. 70: 523.

79. Kartan M.B, Onyekwere O, Sidransky D, Vogelstein B, Craig

R.W. 1991. Participation of p53 protien in the cellular

response to DNA damage. Cancer Res. 51: 6304.

80. Nigro JM, Baker SJ, Preisinger AC, Vogelstein B, et a1.1989.

Mutations in the p53 gene occure in diverse hurnan tumor

types. Nature (lond.). 342: 705.

81. Hollstein M, Sidranky D, Vogestein B,, Harris CC. 1991. p53

mutations in human cancers. Science (Washington DC). 253:

49.

82. Imantura J, Bartram CR, Koeffler HP.1993. Mutation of the

p53 gene in neuroblastoma and its rekationship with N-myc

amplification. Cancer Res. 53: 4053.

83. Vogan K, Bernstein M, Leclerc J .M, Pelletier J, Gros P. 1993.

Absence of p53 gene mutations in primary neuroblastomas.

Cancer Res. 53: 5269.

84. Bardeesy N, Falkoff D, Petruzzi MJ, Nowak N, Zabel B,

Pelletier J. 1994. Anaplastic Wilms' tumor, a subtype

displaying poor prognosis, harbours p53 gene mutations.

Nature Genet. 7: 91.

85. Bardeesy N, Beckwith J.B, Pelletier J. 1995. Clona1 expansion

and attenuated apoptosis in Wilms' tumors are associated

with p53 gene mutation. Cancer Research 55: 215.

86. Schroeder WT, Chao LY, Dao DD, Strong LC, Pathak S, et al.

1987. Non-random loss of materna1 chromosome I l allele in

Wilms' tumors. Am. J. Hum. Genet. 40: 413.

87. Bartolomei M, Zemel S, Ti;ghman SM.1991. Parental

imprinting of the mouse Hl9 gene. Nature 351: 153.

88. Rachrnilewitz J, Goshen R, Ariel 1, Schneider T, et a1.1992.

Parental imprinting of the human H l 9 gene. FEBS Lett. 309:

25.

89. Pachnis V, Brannan CI, Tilghman SM, 1988. The structure

and expression of a novel gene activated in early mouse

embryogenesis. EMBO J. 7: 673.

90. Poirier F, Chan C-T3, Timmons PM, Roberson El, Evans MJ,

Rigby PWJ. 1991. The murine H l 9 gene is activated during

embryonic stem ce11 differentiation in vitro and at the time

of implantation in the developing ernbryo. Development.

113: 1105.

91. Rachmilewitz J, Gileadi O, Eldar-Geva T, Schneider T, et al.

l99Za. Transcription of the H l 9 gene in differentiating

cytotrophoblasts from human placenta. Mol Reprod Dev. 32:

196.

92. Davis RL, Weintraub H, Lassar AB. 1987. Expression of a

single transfected cDNA converts fibroblasts to myoblasts.

Cell. 51: 987.

93. Brannan CI, Dees EC, Ingrarn RS. 1990. The product of the

Hl9 gene may function as an RNA. Molecular and Cellular

Biology. Jan: 28.

94. Brunkow ME, Tilghman SM. 1991. Ectopic expression of the

Hl9 gene in mice causes prenatal lethality. Genes &

Development 5: 1092.

95. Hao Y, Crenshaw T, Tycko B, et al. 1993. Tumour-suppressor

activity of Hl9 RNA. Nature 365: 764.

96. Moulton T, Crenshaw T, Moosikasuwan J, Tycko B, et al.

1994. Epigenetic lesions at the H l 9 locus in Wilms' tumour

patients. Nature Genetics 7: 440.

97. Kmab A, Gruis A.N, Weaver-Feldhaus J, Liu Q, Harshman K,

et al. 1994. A ce11 cycle regulator potentially involved in

genesis of many tumor types. Science. 264: 436.

98. Hannon GJ, Beach D. 1994. pl5 INK4B is a potential effector

of TGF-B-induced ce11 cycle arrest. Nature 371: 257.

99. Serrano M, Hannon GJ, Beach D. 1993. A new regulatory

motif in cell-cycle control causing specific inhibition of

cyclin D/CDK4. Nature 366: 704.

100. Serrano M, Gomez-Lahoz E, Barsagi D, et a1.1995.

Inhibition of Ras-induced prolifefation and cellular

transformation by p l6INK4. Science 267: 249.

101. Wu Ying-Jin, Fraizer Gai1 C., Saunders Grady F. 1995. Gata-

1 trans activates the WTl hematopoietic specific enhancer.

J. Bio. Chem. 270: 5944.

102. Kozak M.1992. Annu. Rev. Ce11 Bio1.8:197.

103. Jackson R.J, Standart N. 1990. D o the poly(A) tail and

3' untranslated region control mRNA translation? Ce11 62:

15.

104. Kruys V, Wathelket M, Poupartt P, Contreras R, Flers W,

Huez G. 1987. The 3' untranslated region of the human

interferon-B mRNA has an inhibitory effect on translation.

Proc. Natl. Acad. Sci. U.S.A. 84. 6030.

105. Ch'ng JL, Shoemaker DL. Schimmel P. Holmes EW. 1990.

Reversal of creatine kinase translational repression by 3'

untranslated sequences. Science 245: 1003.

106. Kahana C, Nathans D. 1985. Translational regulation of

mammalin ornithine decarboxylase by polyamine. J. Bio.

Chem. 260: 5390.

107. Grens A, Scheffler IE, 1990. The 5 ' - and 3'- untranslated

regions of ornithine decarboxylase mRNA affect the

translational efficiency. J. Bio. Chem. 265: 1 18 10.

108. Wendy Bruening and Jerry Pelletier. 1996. A non-AUG

translational initiation event generates novel WT 1

isoform. J. Bio. Chem. 271: 8646.

109. Sarnbrook J., Fritsch E.F., Maniatis T. 1989. Molecular

Cloning. A Laboratory Manual. Cold Spring Harbor

Laboratory Press, Cold Spring Harbor, New York.

110. Sheffield V.C., Beck J.S., Kwitek A.E., Sandstrom D.W., Stone

E.M. 1993. The sensitivity of single-strand conformation

polymorphism analysis for the detection of single base

substitutions. Genomics 16: 325.

11 1. Grompe M. 1993. The rapid detection of unknown

mutations in nucleic acids. Nature Genet. 5: 11 1.

112. Orita M., Iwahana H., Kanazawa H., Hayashi K., Sekiya T.

1989. Detection of polymorphisms of human DNA by gel

electrophoresis as single-strand conformation

polymorphisms. Proc. Natl. Acad. Sci. USA 86: 2766

113. Mori T, Miura K, Aoki T, Nishihira T, Mori S, Nakamura Y.

1994. Frequent somatic mutation of the MTS 1KDK4I

(multiple . tumor suppressor/cyclin-dependent kinase 4

inhibitor) gene in esophageal squamous ce11 carcinoma.

Cancer Res. 54: 3396.

114. Zhou X, Tarmin L, Yin J, et al. 1994. The MTSl gene is

frequently mutated in primary human esophageal tumors.

Oncogene 9: 3737.

115. Hayashi N, Yoshihisa S, Tsuchiya E, Ogawa M, Nakamura Y.

1994. Somatic mutations of the MTSl (multiple tumor

suppressor l)ICDK41 (cyclin-dependent kinase-4

inhibitor) gene in human primary non-srna11 ceIl lung

carcinomas. Biochem Biophys Res Commun 202: 1426.

116. Giani C, Finocchario G. 1994. Mutation rate of the CDKN2

gene in malignant gliomas. Cancer Res 54: 6338.

117. Walker DG, Duan W, Popovic EA, Kaye AH, Tomlinson FH,

Lavin M.1995. Homozygous deletions of the multiple

tumor suppressor gene 1 in the progrssion of human

astrocytomas. Cabcer Res. 55: 20.

118. Hebert J, Cayuela JM, Berkeley J, Sigaux F. 1994. Candidate

tumor suppressor genes MTS 1 (p16) and MTS2 (p15)

display frequent homozygous deletions in primary cells

from T- but not from B ce11 lineage acute lymphoblastic

leukemias. Blood 84: 4038,

OntaM, Nagai H, Shimizu M, et al. 1994. Rarity of somatic

and germline mutations of the cyclin-dependent kinase 4

inhibitor gene, CDK41, in melanoma. Cancer Res 54: 5269.

Xu L, Sgroi D, Sterner CJ, et al. 1994. Mutation analysis of

CDKN2 (MTSlIP16) in human breast carcinomas. Cancer

Res 54: 5262.

Zhang S, Kiein-Szanto AJP, Sauter ER, et al. 1994. Higher

frquency of alterations in the p16fCDKN2 gene in

squamous ce11 carcinoma ce11 lines than in primary tumors

of the head and neck. Cancer Res 54: 5050.

Peiffer SL, Bartsch D, Whelan AJ, Mutch DG, Herzog TJ,

Goodfellow PJ. 1995. Low frequency of CDKN2 mutation in

endometrial carcinomas. Mol Carcinog 13: 2 10.

123. Ueki K, Rubio M. Ramesh V, et al. MTSllCDKN2 gene

mutations are rare in primary human astrocytomas with

allelic loss of chromosome 9p. Hum Mol Genet 3: 1841.

124. Han J, Brown T, Beutler B. 1990. Endotoxin-Responsive

Sequences Control Cachectin/Tumor Necrosis Factor

Biosynthesis At The Translational Level. J.Exp. Med. 171.

465.

APPLIED t IMAGE, lnc 1653 East Main Street - i Rochester, NY 14609 USA

-LI - - = Phone: 7161482-0300 -- -- - - Fax: 73 61288-5989

@ 1993. Applied Imge, Inc.. All Rights Resewed