Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
1
DETECTION AND SEQUENCE DETERMINATION OF
BEGOMOVIRUSES ASSOCIATED WITH LEAF CURL DISEASE
OF CAPSICUM SPP.
SAMINA YASMIN
07-arid-1269
Department of Botany
Faculty of Sciences
Pir Mehr Ali Shah
Arid Agriculture University Rawalpindi
Pakistan
2018
2
DETECTION AND SEQUENCE DETERMINATION OF
BEGOMOVIRUSES ASSOCIATED WITH LEAF CURL DISEASE
OF CAPSICUM SPP.
by
SAMINA YASMIN
(07-arid-1269)
A thesis submitted in the partial fulfillment of
the requirements for the degree of
Doctor of Philosophy
in
Botany
Department of Botany
Faculty of Sciences
Pir Mehr Ali Shah
Arid Agriculture University Rawalpindi
Pakistan
2018
3
4
5
6
7
CONTENTS
Page
List of Figures x
List of Tables xii
List of abbreviations xiv
Acknowledgments xviii
Abstract 1
1 INTRODUCTION 3
1.1 Bemisiatabaci BIOLOGY 4
1.2 VIRUS CLASSIFICATION 6
1.3 GEMINIVIRIDAE 7
1.3.1 Mastrevirus 7
1.3.2 Curtoviruses 8
1.3.3 Topocuvirus 8
1.3.4 Begomoviruses 8
1.3.4.1 Function of begomovirus protein 9
1.3.4.1.1 Replication encoded protein gene 9
1.3.4.1.2 Transcription activator protein 12
1.3.4.1.3 Replication enhancer protein 13
1.3.4.1.4 AC4 protein 13
1.3.4.1.5 Coat protein 13
1.3.4.1.6 Pre-coat associated protein 14
8
1.3.4.1.7 Nuclear shuttle protein and movement protein 15
1.4 GEMINIVIRUSES AND SATELLITE COMPONENTS 15
1.4.1 Betasatellites 16
1.4.2 Alphasatellites 17
2 REVIEW OF LITERATURE 18
3 MATERIALS AND METHODS 33
3.1 SAMPLE COLLECTION 33
3.2 ENZYME LINKED IMMUNOSORBENT ASSAY (ELISA) 33
3.2.1 Monoclonal Antibodies (Mabs) 33
3.2.2 Sample Preparation 33
3.2.3 Triple Antibody Sandwich Immunosorbent Assay (TAS-ELISA) 34
3.3 DNA EXTRACTION 35
3.4 DNA QUANTIFICATION 35
3.5 AMPLIFICATION OF EXTRACTED DNA 36
3.6 ROLLING-CIRCLE AMPLIFICATION (RCA) 36
3.7 CLONING OF AMPLIFIED DNA 37
3.7.1 Cloning of PCR Product 37
3.7.2 Transformation of heat-shock competent E. coli cells 37
3.7.3 Cloning of RCA Product 37
3.7.4 Plasmid DNA Isolation 38
3.8 MINIPREPARATION 38
3.9 DIGESTION OF PLASMID DNA 39
9
3.10 AGAROSE GEL ELECTROPHORESIS 39
3.11 PURIFICATION OF DNA 39
3.11.1 Gel Extraction And PCR Product Purification 39
3.12 SEQUENCING AND SEQUENCE ANALYSIS 40
4 RESULTS 43
4.1 SAMPLES COLLECTION AND SYMPTOMS 43
4.2 EPITOPE PROFILE OF BEGOMOVIRUS 43
4.2.1 Reaction of Chili Isolates with ACMV, ICMV and OLCV Mabs 43
4.2.1.1 Group I 48
4.2.1.2 Group II 48
4.2.1.3 Group III 48
4.2.1.4 Group IV 48
4.3 DETECTION OF BEGOMOVIRUSES 50
4.3.1 Phylogenetic Analysis Of Partial Sequence Of
Begomoviruses Obtained By Core AC1/AV1 Primers
50
4.3.2 Phylogenetic Analysis of Core Region of Begomovirus
Isolates With Reference Sequence
62
4.4 BETASATELLITE 61
4.4.1 Phylogentic Analysis of Beta Component 74
4.4.2 Phylogentic Analysis of Beta Component with Reference
Betasatellite Component
75
4.4.3 Presence of Multiple Betasatellite in Single Plant 81
4.5 ALPHASATELLITES 81
4.5.1 Phylogentic Relationship Among Alphasatellites 81
10
4.5.2 Phylogentic Analysis With Some Reference Alphasatellite 91
4.6 ROLLING CIRCLE AMPLIFICATION OF BEGOMOVIRUS(RCA) AND
RESTRICTION LENGTH FRAGMENT POLYMORPHISM (RLFP)
92
4.7 ANALYSIS OF SEQUENCE OF DNA-A COMPONENT OF
BEGOMOVIRUS ISOLATES
92
4.7.1 4.7.1 Phylogenic tree and Pairwise Comparison of Presently
Characterized Begomovirus Isolates
101
4.7.2 Pairwise Sequence Comparison between Complete DNA-A of
Isolates 248, 249-1, 249-2 and 251 with Selected
Begomoviruses Available in Gen Bank
101
4.8 PHYLOGENTIC ANALYSIS OF CP 104
4.9 PHYLOGENTIC ANALYSIS OF AV2 111
4.10 PHYLOGENETIC ANALYSIS OF Rep GENE 114
4.11 PHYLOGENETIC ANALYSIS OF TRANSCRIPTION ACTIVATOR
(TrAP) GENE
114
4.12 PHYLOGENETIC ANALYSIS OF REPLICATION (REn) GENE 118
4.13 PHYLOGENTIC ANALYSIS OF AC4 GENE 122
5 DISSCUSSION 131
SUMMARY 139
LEITERATURE CITED 142
APPENDIX 164
11
ABSTRACT
The genus begomovirusbelongs to the family Geminiviridae that have
emerged as serious constraints worldwide and infect variety of crops including
vegetables, ornamental plants and weeds. To determine the diversity of
begomoviruses on chillies,samples were collected on the basis of symptoms from
Attock, Talagang, Chakwal, Islamabad and Hyderabad. Samples were tested by
TAS-ELISA against begomoviruses by use of monoclonal antibodies of African
cassava mosaic virus (ACMV), Indiancassava mosaic virus (ICMV) and Okra leaf
curl virus (OLCV). The results indicated that all isolates showed range of high to
moderate or low level of reaction. A panel of four monoclonal antibodies of
ACMV, three of ICMV and three of OLCV were used. Epitope profile pattern
slightly differed within each group, depending upon the location and concentration
of the virus in the tested isolates. It was also confirmed that symptomatic chilli
samples contained multiple infections of the begomoviruses in the studied area.
Diverse patterns were found indicating great diversity among
begomoviruses infecting chillies. The core region was amplified using two sets of
degenerate primers. The sequencing data of nineteen samples indicates the presence
of nine different species of begomoviruses, namely;Chilli leaf curl virus
(ChLCV),Mesta yellow vein mosaic virus (MYVMV), Tomato enation leaf curl
virus (ToELCV), Tomato leaf curl Karnataka virus (ToLCKV),Tomato leaf curl
Gujarat virus (ToLCGV),Papaya leaf curl virus (PLCV),Tomato yellow leaf curl
virus (ToYLCV),Chilli leaf curl Oman virus (ChLCOV),Pedilanthus leaf curl
virus(PeLCV).More than one virus was isolated from the single sample indicating
1
12
thepresence of mixed populations of begomoviruses in chilli crop.
Full length genome of four different begomovirus species was obtained,
(248)Pedilanthus leaf curl virus (PeLCV), (249)Cotton leaf curl Burewala virus
(CLCuBV), Pepper leaf curlvirus (PepLCV) and (251)Tomato leaf curl Gujarat
virus (ToLCGV). No evidence for the presence of DNA-B was available, using
abutting primers from the Intergenic Region (IR), when the same samples were
tested. This indicates the monopartite nature of begomoviruses isolates, associated
with betasatellites and alphasatellites. It becomes clear that CLCuBV and
PepLCVwere associated with PLCVβ and CLCuBα. However PeLCV possesses
PLCVβ but there was no association of alphasatellites. Furthermore, ToLCGV was
associated EYVβ; however, alphasatellite was absent.
Apart from understanding the nature of mix infection, this study has both
epidemiological and pathological implications. Diseases caused by begomoviruses
and associated DNA satellites have been expanding rapidly both in geographical
distribution and host range. Given the presence of large number of begomoviruses
throughout Asia and Africa, and ability of DNA-β to substitute for DNA-B, the
probability may exist that new species/strains of begomoviruses emerge. Any effort
towards developing resistance to disease, either by conventional or non-
conventional means would be wise to take into account the possibility of more
complex situation becoming important in chilies in the future.
13
Chapter 1
INTRODUCTION
The green revolution increased yield of cereal crops through advanced
farming technologies and genetically improved seeds particularly in Asia and Latin
America. The production of wheat, maize andricedouble from 1975 to 1985. But
vegetable crops has been largely ignored, a key component of a healthy diet. In
addition, vegetables make staple food easily palatable. Vegetables are an important
source of micronutrients, deficiencies of which lead to poor physical and mental
growth (anonymous-CGIAR, 2015).
Among vegetables chilli is one of economical important vegetable and spice
crop cultivated round the year in tropical and sub-tropicalareas.They are cultivated
both for fresh and processed industry. The production and processing of chilies
requires large number of human labor and as a result generatesdirect and indirect
job opportunities in producing areas (Ribeiro, 2006).Along with tomato and potato
it belongs to family Solanaceae. Approximately 150 various kinds of chilies have
been distinguished on the basis of shape, color and pungency in taste (Berke,
2002). The most cultivated species are Capsicum frutescens L. and Capsicum
annuum L. All sweet types are included in C. annuum group whereas hot types are
included in C. frutescens. It is an important source of vitamin A, B complex, C, E,
iron, phosphorus, sulphur, calcium, carotenoids and capsainoids with active
ingredient of capsaicin (Mehmood and Seepul, 2006). Capsicum also contains
some medicinal values such as appetite stimulant, tonic, carminative, astringent,
3
14
antispasmodic, antiseptic, condiment, accentuator and anti-rheumatic etc.
(Anonymous, 2003; Berke, 2002).
In Pakistan, the area under chilies cultivation is 62.9 hectareswith production
rate of 146.2 tonnesin 2014-2015. (AS)Its main production is concentrated in Sindh
province which account for 85% of total production.In south Asian countries
production is declined by both biotic and abiotic factors, but biotic including pests
and pathogens are responsible for considerable yield loses (Green and Kim, 1991).
In few decades, whitefly becomes increasingly important in agricultural system.
Increase in whitefly population is responsible for spread of viral diseases throughout
the world (Jones, 2003; Naranjo and Ellsworth, 2001; Oliveiroet al., 2001). Chilies
are naturally susceptible to range of viruses (Nigam et al., 2015). So far 65 viruses
have been reported throughout world infecting peppers. Among
these,begomoviruses have become increasingly important (Morales and Anderson
2001; Moriones and Nava-Castillo, 2000). Commercially grown chilies were
severely affected by leaf curl disease in 2007 and 2008 with 100 % incidence and
resulted in severe yield losses at several locations in Punjab province (Pakistan),
especially in Faisalabad (Akhteret al., 2009).
1.1BEMISIA TABACI BIOLOGY
Whitefly, Bemisiatabaci(genn) (Homoptera; Aleyrodidae), is responsible for
all ofbegomovirus diseases (Muniyappa and Veeresha, 1984). The B-biotype B.
tabaciis reported to be a potential vector of spreading begomovirusesas well as
serious pest that causes various types of disorders in many agricultural and
horticultural crops in subtropical and tropical parts of the world. New strains of
whitefly have appeared which are very difficult to control. They spread from
15
relatively restricted home ranges to many other countries in last 15 years. The new
strains of B. tabaciare more efficient as virus vector and have high fecundity
(Perringet al., 1993). Whitefly causes damage to plants through direct feeding
(Perringet al., 1991), leading to stunting of plants and yield loss and indirectly,
through the production of sticky exudates or ‘honey dew’, which encourage
development and growth of sooty mold caused by saprophytic fungi
(Capnodiumspp.) on the affected plants (Byrne et al., 1990). They also cause
induction of phytotoxic disorders resulting in silvering in some plants known as
sliver leaf disorder which is restricted to a few genotypes (Bedford et al., 1994;
Byrne et al., 1995). These effects are especially severe when large population of B.
tabacicolonize plants.
Under natural field conditions an average, 12 generations of whitefly are
attained annually (Fishpool and Burban, 1994). Temperature is the key-determining
factor and higher temperatures (30-33°C) result in faster development of adults.
Increase in whitefly population isfavored by radiation, low rainfall and relative
humidity. Great variability has been reported on fecundity, which is affected by
environmental conditions and host-plant species (Byrne and Bellows, 1991).
Whiteflies exhibit distinct biological traits such as range and adoptability in host-
plant, inducement of plant physiological disorders and plant virus transmission
(Maruthiet al., 2002). B. tabaciis a polyphagous species and some biotypes and
genotypes are extremely polyphagous. It colonizes mainly annual, herbaceous plants
(Fishpool and Burban, 1994). However, nearly monophagousB.tabacipopulations
have been recognized, 10 on Jatrophagossypifolia n. and Croton lobatus n. while
theB. tabaci colonizes only cassava in Africa (Storey and Nichols, 1938). B.
16
tabacidisperses mainly by the aid of wind and can move short or long distances but
also by humans who transport plant material carrying the immature and adult stages
(Byrne and Bellows, 1991). Furthermore, cropping practices such as planting date,
crop disposition and intercropping influence whitefly population dynamics and
hence encourage the spread of whitefly-transmitted begomoviruses. The virus can
be spread by nonpropagative and circulative manner. Begomoviruses have been
reported in the epithelial cells of gut and in the salivary gland of B. tabaci as shown
in figure 1.1 (Fargette and Fauquet, 1988). Diverse disease symptoms appear in the
plant invaded by begomoviruses. The symptoms are: vein yellowing, leaf curl,
yellow mosaic, yellow leaf curl, stunting, chlorosis, leaf crumple, vein thickening,
dark green discoloration and leaf distortion (Qaziet al., 2007). New strains of
begomoviruses have apparently emerged in last twenty five years, and they are
dangerously damaging various crops such as cucurbits, beans, peppers, tomatoes,
ornamental and weeds (Brown and Bird, 1992; Polston and Anderson, 1997;
Morales and Anderson, 2001; Jones, 2003).
1.2 VIRUS CLASSIFICATION
Currently thereare 73 families, 9 sub families, 287 genera and 1938 virus
spieces. (Fauquetet al.,2004). The majority of plant viruses have RNA genome
although a few plant viruses have DNA genome. DNA viruses are further grouped
into two general types:1. Circular double stranded DNA, which replicate by reverse
transcription through RNA intermediate i.e. culimoviruses and badnaviruses. 2:
circular single stranded DNA, which replicate through double stranded DNA
intermediate by rolling circle mechanism i.e. geminivirdae. “Geminiviridae”is the
second largest family.
http://onlinelibrary.wiley.com/doi/10.1111/j.1365-3059.2005.01226.x/full#b6#b6http://onlinelibrary.wiley.com/doi/10.1111/j.1365-3059.2005.01226.x/full#b7#b7http://onlinelibrary.wiley.com/doi/10.1111/j.1365-3059.2005.01226.x/full#b8#b8http://onlinelibrary.wiley.com/doi/10.1111/j.1365-3059.2005.01226.x/full#b5#b5
17
1.3 GEMINIVIRIDAE
Gemninviruses are small, single-stranded, circular DNA genomes enclosed
in a protein shell which have a geminate (twinned) quasi-icosahedral shape, on the
basis of which the family name has been derived(Stanelyet al., 2005). Genome of
majority of geminiviruses ranges from 2.7 to 5.2 kb.Geminiviruses are classified by
the International Committee on Taxonomy of Viruses (ICTV) into seven genera,
Begomovirus, Mastrevirus, Curtovirus, Becurtovirus, Eragrovirus, Topocuvirus and
Turncurtovirus on the basis of their genome organization and insect
vectors[http://ictv.org/ssdna.viruses/geminivirdae].
1.3.1Mastrevirus
Mastrevirus is second large genus of family geminivirdae and its type specie
is Maize streak virus. The viruses are necessarily transmitted by leaf hopper and
infect monocot or dicot plants. These viruses are basically phloem limited
(Willmentet al., 2007). Mastrevirus encoded four genes, movement protein gene and
coat protein gene are encoded by V1 and V2 on virion strand while Rep gene is
present on complementary strand and encoded by C1 (Palmer and Rybicki, 1998).
Mastrevirus has unique character with reference to Rep gene as its
expression requires splicing (Wright et al., 1997). Two intergenic region (IR), one
large (LIR) and one small (SIR), opposite of each other containing regulatory
element have been found. Promoters for C1 and V1 are located in LIR (Palmer and
Rybicki, 1998). LIR also contains origin of replication for virion strand synthesis
just like begomoviruses (Willmentet al., 2007),whereas SIR contains origin of
replication for complementary strand synthesis.
18
1.3.2 Curtoviruses
Beet curly top virus is type specie of genus curtoviruses. Curtoviruses are
monopartitegeminiviruses that damage dicot plants and spread by leafhopper. In
contrast, IR of curtoviruses is not enough for full regulation of replication gene.
Only few of curtoviruses are responsible for damage of large number of plants
species (Huret al., 2007).
1.3.3Topocuvirus
Topocuviruses have only one single stranded genome that infects only
dicots. Tomato pseudo-curly top virus is well characterized specie of this. ToPCTV
genome organization is typical to both curtoviruses and begomovirues thus indicates
it is natural recombinant of both of these. However, functions of gene V2, C2, C3,
C4 remains unclear (Briddon and Markham, 2001). Figure 1.2 showed the vector
and genome organization.
1.3.4Begomoviruses
Begomoviruses are whitefly transmitted monopartite or bipartite viruses that
infect only dicot plantswith diverse host range. Only this genus of geminivirdae
contains large number of reported virus species. More than 230 species of
begomoviruses are submitted in Gen bank (Fauquetet al., 2008). Hence, they are
responsible for huge loss worldwide. This large amount of economic loss is due to
polyphagous nature of whitefly,whereas few biotypes are host specific.
Begomovirus infected plants exhibit very diverse symptoms (Briddon,
2003).Bipartite begomoviruses have two genomes designed as DNA-A and DNA-B.
Both of these component share highest nucleotide sequence identity and designed as
common region. (Hanley-Bowdoin,1999). This common region encodes origin of
19
replication gene. Component A contains open reading frame for replication gene,
coat protein gene, transcription activator gene, replication enhancer gene. While
component B encodes inter and intracellular movement protein gene and symptoms
expression genes. CR contains motif for rep gene expression, iteron motif and stem
loop structure with nonanucleotide TAATATTAC, a distinguished character of
geminiviruses (Hanley-Bowdoin, 1999).
Begomoviruses with one circular single stranded genome (DNA-A) is
designed as monopartite. DNA-A of monopartite encode total six ORF, four on
virion sense strand and two on complementary strands. Replication gene, replication
enhancer gene, transcription activator gene and symptoms expression gene are
present on virion sense strand while coat proteinand movement protein geneare
present on complementary strand. Highly conserved region of
monpartitebegomoviruses are known as intergenic region with hair pin motif that
contains nonanucleotide TAATTTAC as shown in figure1.2.
1.3.4.1 Function ofbegomovirus protein
1.3.4.1.1 Replication encoded protein gene
Replication protein gene is also known as AC1, AL1 or C1
ismultifunctionand obligatorily required for replication of virus. Rep protein is
required for several necessary functions such as initiation and termination of rolling
circle replication by cleavage and rejoining of oriC of viral DNA-A (Laufset al.,
1995). Among all geminiviruses AC1 proteins are very similar and showed
sequence conservation (Orozco et al., 2000). Four functional domains required for
begomoviruses rep gene, 1: N terminal domain of approximately 1 to 120 amino
20
acid which is involved in initia
Figure 1.1: Circulative, nonpropagative mechanism of transmission of
begomoviruses by whitefly. Virus is ingested from plant tissue, up the food canal of
stylets, through the esophagus, foregut and mid gut where the virus must pass
through the membrane into the hemcoel. The virus moves with the hemocoel, which
bathes all organs, until contacting the salivary gland membrane. Here the virus must
pass through the barrier of salivary gland membrane to salivary duct and salivated
out through salivary canal of stylets, thus being injected into plant phloem cells
(Fargette and Fauquet, 1988).
21
Figure1.2:Geminivirus genome and viral protein organization (Bowdoinet al., 2013)
http://www.nature.com/nrmicro/journal/v11/n11/box/nrmicro3117_BX1.html#auth-1
22
initiation, 2: site specificnonanucleotide sequence TAATATT↓AC (Heyraud-
Nitschkeet al., 1995). Between the TATA box and transcription start site AC1
protein binding site is located act as replication initiation site (Hanley-Bowdoinet
al., 2004).
AC1 protein alone can start replication without any viral accessory factors
(Honget al., 2003).AC1 also possess helicase activity (Clerotandand Bernardi,
2006). Specific repeated sequences are present in the conserve region known as
iterons these are specie specific. AC1 bind to these sequence during rolling circle
replication and hydrolyses the phosphodiester bond between the seventh and eight
nucleotide of nonanucleotide TAATATT↓AC (Stanley, 1995; Laufset al., 1995).
Many molecules are attached with these iterons sequence, AC1 bind in highly
ordered forms which are obligatory to destabilize the replication start site (Shung
and Sunter, 2007). AC3 assist the AC1, which is replication enhancer (REn also
called C3 or AL3) (Settlageet al., 2005).
1.3.4.1.2 Transcription activator protein (TrAP)
AC2 or AL2 is unique protein only present in genus begomoviruses hence
seems to play distinguished function(Liu et al., 1998).TrAPinteractand move to
nucleus of host plant and facilitate the efficient activation of transcription (Yang et
al., 2007).In this protein three conserved domains are present, a basic domain with
nuclear localization signals at N-terminal and centralDNA binding with zinc finger
motif and acidic domain at C-terminus(Hartitzet al., 1999).TrAP function is not
virus specific. From absence of functional specificity it can be concluded that all
begomoviruses contains common sequence promoters recognized by C2 to interact
23
common sequence of begomovirus host plant to effect transcription activation
(Wang et al., 2005).
1.3.4.1.3 Replication enhancer protein
REn is approximately 16Kd protein also known as AC3 or AL3.This protein
greatly enhances the viral DNA accumulation by interacting with rep. Hence
mutation of AC3/AL3 gene lead to reduced level of viral DNA in transient
replication assay (Wang et al., 2005). Experimental result suggests that AC3 might
increase the affinity of rep for origin (Sunteret al., 1994).
1.3.4.1.4 AC4 protein
This protein open reading frame is embedded in the AC1 open reading frame
and found to be highly variable. AC4 protein plays a key role in symptom
development. Mutation of this protein in bipartite begomoviruses resultes in
wildtype symptoms and found to be non function. Further, it was demonstrated that
C4enhanced the amount viral of DNA and have anti PTGS activity
(Vanitharani,2004).
1.3.4.1.5 Coat protein
Coat protein is encoded by AV1 or V1 gene (Zhang et al., 2001). Coat
protein plays an important role in systemic spread of virus in host plant in case of
monopartitebegomoviruses(Boultonet al., 1991; Briddonet al., 1989). While in case
of bipartite it is not obligatory for this task (Gardiner et al., 1988; Unseldet al.,
2004). Nuclear shuttle protein (NSP) is mandatory for this role (Ingham et al.,
1995). Beside this, CP plays an important role in vector specificity (Briddon, 1990;
24
Hoferet al., 1997; Hohnleet al., 2001) and prevent virus DNA from degradation
during transmission of virus by mechanical inoculation or through insect vector
transmission (Frischmuth and Stanley, 1998).
Muntant coat protein result in low level of virus SSDNA without reduced
level of dsDNA as experimentally concluded in host plant protoplast (Liu et al.,
2001). This is due to the reason that geminiviruses were inoculated in plant cell
cytoplasm followed by their transport in nucleus for replication. This must contain
nuclear localization signals (Gafni and Epel, 2002). These types of signals are
obligatory in both cases i.e. monopartite and bipartite viruses and found in N-
terminal region (Unseldet al., 2001). Host receptors recognize nuclear export signals
(NES) which are necessary for export of virus DNA from nucleus to cytoplasm.
These NESsequence are present in C-terminus of coat protein (Rhee et al., 2000).
1.3.4.1.6Pre-coat associated protein
Old world begomoviruses have an additional protein that contrary to new
world viruses. This protein gene is known as AV2/V2. Movement of
monopartitebegomoviruses is partly dependant on AV2 protein; however, in case of
bipartite viruses its role is still unclear (Rothensteinet al., 2006).But further analysis
suggested that AV2 have role in intracellular transport of bipartite viruses
(Selchow2007). This indicates that new world begomoviruses diverge from old
world begomoviruses (Zrachyaet al., 2006; Rojas et al., 2001).
1.3.4.1.7 Nuclear shuttle protein and movement protein
Movement protein transports the virus from cortical of cytoplasm to barrier
across the cell wall. However, in case of bipartite begomoviruses,DNA-B encodes
25
two proteins nuclear shuttle protein (NSP) and cell to cell movement protein(MP).
Both of these proteins act synergistly to transport virus DNA from nucleus of host
cell where it is replicated to the cytoplasm for systemic spread in to adjacent cell
(Sanderfoot and Lazarowitz, 1996). NSP recognize newly synthesized viral DNA
and transport from nucleus to cytoplasm, whereas MP recognize NSP-viral DNA
complex in cytoplasm and carry them to adjacent cells where NSP-viral DNA
complex dissociate and allow to start another new cycle. This whole process is
highly controlled (McGarryet al., 2003).In few bipartite begomoviruses, MP protein
induces disease symptoms (Houet al., 2000). This was further supported by
evidence that NSP protein have role in pathogenicity (Hussainet al., 2005).
1.4 GEMINIVIRUSES AND SATELLITE COMPONENTS
Satellite components are considered as nucleic acid or viruses which are
dependent on the helper viruses for their replication. However, they encode their
own coat protein, whereas RNA satellites are packaged inside the coat protein of
helper virus (Hussainet al., 2005).
1.4.1 β-Satellites
The first satellite was reported from tomato leaf curl virus (ToLCV) from
Australia (Dry et al., 1997). Sizeof betasatellite was found to be 682nt and sequence
was not similar to the ToLCV but dependant on helper for replication and
encapsidation. But has no remarkable effect on symptoms induced by ToLCV. This
is contrary to the betasatellites which has great influence on symptom induction in
host plant (Briddonet al., 2001; Jose and Usha, 2003; Saunders etal., 2000; Zhou et
al., 2003).Cotton leaf curl virus(CuLCV) from Pakistan and ageratum yellow vein
mosaic virus(AYVV) from Singapore aremonopartitebegomoviruses.They are found
26
to be pathogenic but do not cause any symptoms but a unique component was found
associated with both of these viruses and causes specific symptoms in both host
plants (Saunders et al., 2000; Briddonet al., 2001).
Detailed study of betasatellite genome revealed that half of the helper virus
in size and are dependent on helper virus for replication, encapsidation and spread in
host plant (Saunders et al., 2000; Briddonet al., 2001). Betasatellites have three
distinctive attributes; a highly conserved region, a single open reading frame
encodingβC1 gene, and A-richregion (Zhou et al., 2003).Mutant A-rich region
containing beta cause mild symptoms (Tao and Zhou, 2004).Accurate function of
single gene of betasatellite is still unclear. But contemporary finding showed that it
was found to be pathogencity determinant and suppressor of RNA silencing (Cui et
al., 2005; Qaziet al., 2007). Betasatellites possess no iterons like helper viruses but
they must possess sequences that are recognized by begomovirus encoded
replication gene so that transreplication of betasatellites could occur (Saunders et
al., 2000).
1.4.2 Alphasatellites
There is anotherclassofsatetellites known as alphasatellites, just like
betasatellite they are half in size to that of helper virus (Briddonet al., 2004 and
stanelyet al., 2004). Alphasatellites encode only single gene similar to the
nanoviruses. In contrast to betasatellite, alphasatellites are not required for induction
of symptoms and proliferation of helper virus.However they are dependent on
helper virus for their encapsidation and proliferation.
This study has been proposed with the following objectives:
27
Epitope profile for detection and diversity of the begomoviruses.
Amplification of begomovirus isolates using degenerate primers.
Amplification and DNA sequencing of full length genome of begomovirus
isolates.
Phylogenetic anaylsis of sequence data.
18
Chapter 2
REVIEW OF LITERATURE
Kumar et al.(2016) collected chilies samples from Binjnour region of
utherperdesh, India. Isolated DNA from collected plant samples was amplified and
PCR product was subjected to cloning and sequencing. Pairwise study of whole
genome showed that it is greater than 91% similar with Tomato leaf curl New Dehli
virus whereas associated betasatellite shared less than 90% identity with Tomato
leaf curl Bangladesh betasatellite. According to current criteria of specie
demarcation they identified new species of begomovirus infecting chilies in
Bijinour and named this new specie Chili leaf curl Bijinour virus.
Khamenehet al.(2016) surveyed vegetable grown fields during 2102-2014,
to determine the prevalence of begomoviruses in these crops. Symptomatic 787
samples of vegetables and some other crops were tested by enzyme linked immune
sorbent assay, 81 samples were found to be ELISA positive which were further
confirmed through polymerase chain reaction by specific primers TYLCV-
Sar/TYLCV-Isr. Expected PCR product of size 670bps confirm the association of
begomoviruses with peppers, tomato, spinach and alfalfa. Universal primers
Begomo-F/Begomo-R yielded 2.8kbs product and sequence of these isolates were
compared with previously reported sequence available in database, they shared
99% nucleotide sequence homology with Tomato leaf curl New Dehli virus
(ToLCNDV). Thus this study reported the natural spread of ToLCNDV in
vegetable grown area in Iran. Zaidiet al.(2016) collected symptomatic plant sample
sesbaniabispinosa from cotton leaf curl disease affected cotton field. Selected plant
19
showed typical begomovirus symptoms. Extracted DNA was amplified, cloned and
sequenced along with associated betasatellite. Sequence comparison revealed that it
shared highest 97.9% homology with Pedilanthus leaf curl virus (PeLCV)
previously reported from soya bean and cognate betasatellite showed 96-97%
homology with tobacco leaf curl betasatellite. These results indicated the expansion
of host range.
Zaidiet al.(2015) carried out investigation during 2014 in Gossypium
cultivating region of Punjab, Pakistan. They collected few diseased samples from
Gojra region of Punjab on the basis of leaf curl symptoms of cotton. Total genome
was extracted and resolved agrose gel was transferred to nylon membrane with
Cotton leaf curl Burewala virus (CLCuBV) probe. Probe detected the presence of
begomovirus in two out of six samples. Further begomovirus specific primers was
used and 2.8bps amplified product was obtained and cloned product was
sequenced. Comparison of sequence revealed 99% homology with Tomato leaf curl
Gujarat virus a bipartite virus reported from India. For confirmation of bipartite
nature DNA-B specific primers was designed and 2.7bps product was obtained
which confirmed bipartite nature of reported virus from cotton.
Kumar et al.(2015) conducted the survey of chili growing areas in India. It
is famous all over the world especially in sub continents as spice crop but its
production is limited due chili leaf curl disease caused by whitefly transmitted
begomoviruse. Survey indicated that beside chili leaf curl disease (ChLCD) there
was complex association of other begomoviruses and betasatellites in numbers of
different crops and weeds. Cognate betasatellite enhance the symptom severity in
20
infected chili crop. Recombination is more evident in intra-species. AV1 gene of
helper virus and βC1 of betasatellites showed high variability among all other
genes of begomoviruses. This study demonstrates the important role of betasatellite
in disease severity.
Tang et al.(2015) worked on M. coromandelianum, a weed from
Guangdong a province of china. They isolated Malvastrum leaf curl Guangdong
virus along with satellite virus from infected weed. They described that satellite
particles had typical betasatellites features, a highly conserved SCR with hair pin
motif, adenine rich region and single ORF, βC1. Blast result showed that it had
71.9% sequence similarity with tomato leaf curl Philippine associated betasatellite.
But dendrogram of this revealed that it showed grouping with Laguna 1 and
Laguna 2 of ToLCPB. Established criteria for betasatellites demarcation showed
that it is different strain; name malvastrum leaf curl Guandongbetasatellites
assigned.
Schreinemacherset al.(2015) reported that in tropical and sub-tropical
countries vector transmitted diseases are common and responsible for huge
economic losses. Integrated approaches, resistant crops and crop management are
employed to reduce the loss. But such strategies are very rarely used in developing
countries. They visited 800 vegetable (chilli, tomato and mung bean) field in India,
Thailand and Vietnam to know the farmers perception in yield loss and their
control measures. Majority of grower correlated damage with pest and some
disease and few had knowledge of insect vector and its role in spread of viral
diseases. Synthetic pesticides are commonly used as solution. Spread of knowledge
21
among farmers is very important to overcome the problem in affected areas. Best
solution in long term is to introduce disease resistant crops.
Kumar et al.(2015) found that leaf curl disease of cotton is highly
destructive in the subcontinent. They investigated three begomovirusesCotton leaf
curl Multan virus. (CLCuMV), Cotton leaf curl Kokhran virus (CLCuKV), Cotton
leaf curl Burewala virus (CLCuBV) in association with Cotton leaf curl Multan
virus betasatellite (CLCuMB) and Cotton leaf curl Multan virus alphasatellite
(CLCuMA) infecting cotton crop. CLCuBV with mutant transcriptional activator
protein (TrAP) was detected in some infected plants along with its cognate
betasatellite cotton leaf curl Multan betasatellite. To check the pathogenicity of
mutant CLCuBV, inoculation of healthy plant with mutant CLCuBV with its
associated beta and alphasatellite was done, these produce typical cotton leaf curl
disease symptoms. Inoculation of CLCuKV with CLCuMB/CLCuMA severe
disease symptom was observed. Whereas CLCuMV induces mild symptoms, as
CLCuMV was reported to be recombinant in nature. From these finding it was
concluded that two strainsof CLCuBV exist one with intact TrAP and one with
mutant TrAP. In same way two strains of CLCuMV exist one produces mild
disease symptoms and other with severe symptoms.
Akhtaret al.(2014) studied begomovirus disease complex on chilies, a
common problem throughout the Indian sub-continent. They carried out detailed
analysis of Tomato leaf curl New Dehli virus and associated Chilli leaf curl
betasatellites. Extracted DNA-A and DNA-B of ToLCNDV and ChLCBfrom chilli
host was inoculated in Nicotianabenthamianaby biolistic gene gun method.
22
Experimental plant produced typical symptoms induced by ToLCNDV and
associated satellite cause severity in symptoms. This experiment demonstrated that
betasatellites spread severe disease complex in infected host and geographic area as
well.
Shujaet al.(2014) reported that leaf curl of cotton is highly devastating in
Pakistan and North West region of India caused by single circular stranded
begomoviruses. Disease severity occurs in the presence of specific betasatellites,
Cotton leaf curl Multan betasatellite (CLCuMB). In 2001 when resistance to cotton
leaf curl disease is over since then only single strain of begomovirus, Cotton leaf
curl Burewala virus (CLCuBuV) with disease symptoms of CLCuD is prevalent
according data available in Gen bank. A survey was conducted in 2012 in Layyah
district in Punjab province of Pakistan. Nucleotide sequence analysis showed that
βC1 of betasatellite is recombinant, possess typical feature of post resistance break.
Helper virus CLCuBuV was different from previously reported and depicts new
strain. Virus contains recombination and sequence was derived from two species
that was common before resistance breaks but contain unique resistance break sites.
Bandaranayakeet al. (2014) found that cucurbits are famous all over the
world especially in tropic and sub tropic areas. Plant viruses are responsible for
economic loss in vegetable crops. There was a large list of viral diseases reported
from Sri Lanka but till date no begomoviruses were reported. A bitter gourd plant
with leaf curl symptom was collected and subjected to PCR analysis by using
universal but begomovirus specific primers. Sequence analysis confirmed the
association of the leaf curl symptoms with begomovirus. Similarly begomovirus
23
was detected from bitter gourd, ridge gourd, pumpkin, cucumber and snake gourd
by using CP specific primers, as CP is most conserve part among the
begomoviruses and this part is usually amplified for detection of begomoviruses. A
PCR product of 550bps was obtained which was sequenced. Nucleotide sequence
analysis and phylogenic analysis showed close relationship with Tomato leaf curl
New Dehli virus bitter Gourd (ToLCNDV-BG) reported from Pakistan.
Srivastavaet al. (2014) screenedTabernaemontanacoronaria and Cestrum
nocturnumby employing the rolling circle amplification. They investigated that
these isolated shared greatest homology 95% with each other and 93% sequence
similarity with Pedilanthus leaf curl virus. Further phylogenetic analysis confirmed
strong relationship with PeLCV. Hence these studied isolates were recognized as
variant of PeLCV. This was firs report of PeLCV from C. nocturnum and T.
coronaria from Indian and all other the world.
Marwalet al.(2014) collected Vincaalba plant on the basis of some disease
symptoms from Rajistan and Bhatida city of Punjab province, India. Coat protein
gene is highly conserved among geminiviruses, for detection of begomoviruses CP
specific primers was used and 550bps product was obtained.Confirms the
association of disease with begomovirus, beside helper virus alphasatellite was also
obtained by using alpha specific primers but they were unable to find the
betasatellite particles. Sequence comparison showed that CP was 95% similar with
Papaya leaf curl crumple virus and Rose leaf curl virus.Whereas helper
begomovirus and alphasatellite was identical with isolates reported from Pakistan,
China, India, Taiwan etc. this study indicated emergence of new specie through
24
recombination and posses great threat to agricultural and horticultural crops.
Jyothsnaet al.(2013) organized a survey in tomato growing area in 2008,
Maharashtra state of India where yield loss was 100%. Detection results revealed
the presence of three species of begomoviruses in studied area and more than 60%
of samples were infected with Tomato leaf curl Gujarat virus (ToLCuGV). These
isolates differed from Tomato leaf curl Gujarat virus-Varnasi, as in these isolates
DNA-B was absent in spite a single species of betasatellite was present. They are
like the begomoviruses from old world, in this case tomato yellow leaf curl
Thailand betasatellite. ToLCuG alone is speedy infectious agent and spread
systemic infection in tomato and Nicotianabenthamiana. Inoculation of ToLCuGV
with associated betasatellite enhanced symptoms severity and reduces the
incubation period of virus for symptoms expression.
Xieet al.(2013) isolated a new begomovirus species from
Malvastrumcoromandelianum and tomato from Yunnan, China. Whole genome
except for C4 gene, showed similarity with Tomato leaf curl China
virus(ToLCCV). On this basis name Tomato leaf curl Yunnan virus (ToLCYV) was
proposed. Isolated DNA was inoculated into Agrobactrium, inoculation experiment
showed that ToLCYV is infection to range of host plants but poorly infectious to
M. coromandelianum. Despite this it was found ToLCCV did not produce disease
severity in absence of betasatellite; however, ToLCYV alone was infectious
without betasatellite particle. In majority of field collected samples betasatellites
were not present. Transgenic expression AC4 of both TYLCYV and TYLCCNV,
was checked and come out with this view that TYLCYV causes some
25
developmental abnormalities whereas TYLCCNV do not showed such
abnormalities. AC4 gene of TYLCYV was highly methylated as compare to
TYLCCNV and more efficient in post transcriptional and transcriptional gene
silencing. Thus it was concluded that AC4 gene evolved from recombination was
more virulent and manage the pathogenicity of helper virus.
Vanithaet al.(2013) characterized the WTGS responsible for spread of leaf
curl disease of sunflower in northern Karnataka, south India, sunflower is important
oil yielding crop and leaf curl disease reduce the yield. They cloned and sequenced
the helper virus and betasatellite and found 2761bps DNA-A and 1373bps
betasatellite.DNA-A showed highest (97.17%) sequence homology with Tomato
leaf curl Karnataka virus clone KH13, (ToLCKV-KH13), (96.9%) Tomato leaf
curl Karnataka virus clone IK3 (ToLCKV-IK3) and satellite particles shared
(93.07%) with potato leaf curl apical betasatellite and 94% with papaya leaf curl
betasatellite (PaLCuB) from India. Tomato leaf curl Karnataka virus with
accompanying betasatellites responsible for leaf curl disease of sunflower was first
time reported from India.
Jyothsnaet al.(2013) investigated the weeds for reservoirs of
begomoviruses. They observed bright yellow symptoms on abutilon pictum in
Udhagamandalam, Tamil Nadu, India. Amplification, cloning and sequencing
confirmed the association of Abutilon mosaic virus (AbMV). Clones generated
through rolling circle, inoculated by gene gun in Nicotianabenthamania, three out
of nine showed the presence of viral DNA-A, beside this mutation was detected in
AC1 gene. This was the first report of AbMV in India.
26
Leonardo et al. (2012) found greatest economic loss in tomato crop in
Brazil. They collected infectious plant from field and applied molecular techniques
for identification of disease causing agent. They are able to get three full lengths
DNA-A of Brazilian begomoviruses, one of them is total new specie, Tomato
interveinalchlorosis virus (ToICV), while other two were shown to be previously
reportedTomato mottle leaf curl virus (TMoLCV), Tomato golden vein virus
(TGVV) and Tomato severe rugose virus strains were also reported. Dendrogram
of studied isolates with other isolates retrieved from Genbank showed that all
studied isolates segregates with tomato infecting Brazilian begomoviruses.
Wyantet al.(2012) examined the structure of small circular DNA by
combination of rolling circle amplification, restriction digestion and pyro-
sequencing. A bulk of 61 samples was analysed from Asia, South America and
Central America. 83 contig sequence of geminiviral DNA and 4 contig sequence of
satellite DNA were obtained. The efficacy of this approach was proven for
Brazilian begomoviruses. Accuracy of sequence was found by comparing cloning
and sequencing of Bovilianbegomoviruses reported few years ago. Therefore
mixtures of all these technique called circomics reduce cost and labor for
characterization of geminivirdae genome.
Yang et al.(2011) characterized novel specie of tomato infecting
begomovirus together with associated betasatellite from Guangxi province of china.
Different recombination anaylsis was carried out to check the recombination and to
find out from which strain of begomovirus diverge. Finding of analysis showed that
it diverged from Tomato leaf curl Gujarat virus (ToLCGV), Tomato leaf curl
27
Vietnam (ToLCVV) virus and another unknown virus. Hence name tomato leaf
curl China virus (ToLCCNV) was assigned, a betasatellite was detected with
helper Tomato leaf curl China virus. Infectious clone of ToLCCNV was
constructed to fulfill the Koach postulates, ToLCCNV alone was not sufficient for
disease symptoms. βC1 protein suppress the RNA silencing and promoted the
nuclear location. This was confirmed through mutation analysis of βC1 gene, so
ToLCCNVB is necessary for spread of disease.
Singh et al.(2012) reported that begomoviruses are important devastating
pathogen throughout the world especially in tropical and sub-tropical countries
because of most favorable condition for spread of insect vector Bemisiatabaci. A
vast diversity of begomoviruses is present in subcontinent; recombination, pseudo
recombination and mutation are major factor for this great diversity. They found
that leaf curl disease of Radish in India is spread by the interaction of two
begomoviruses from old world and betasatellites were identified as recombinant
radish leaf curl disease. It shared 87.7% highest sequence similarity with Pepper
leaf curl Bangladesh virus whereas radish leaf curl- Pataudi is isolate of Croton
yellow vein mosaic virus and had 95.8% homology. Recombination analysis by
RDP revealed that RaLCD is hybrid of Euphorbia leaf curl virus and Papaya leaf
curl virus. Clone of RaLCD and their betasatellite was inoculated to check
pathogenicity of virus. It was concluded that interaction of betasatellite with helper
virus increase the symptoms severity in host plant.
Pratabet al.(2011) amplified, cloned and sequenced the complete
component-A and component-B component. Total genome was extracted from egg
28
plant with yellow mosaic symptoms. Sequence comparison indicated that it is
97.6% identical with Tomato leaf curl New Dehli virus (ToLCNDV-IND) and
87.9% with Tomato leaf curl papaya virus-papaya reported from Lucknow.
Whereas DNA-B shared 94.1 % with Tomato leaf curl New Dehli virus Indian
isolate (ToLCNDV-IND) and 76.2% with Tomato leaf curl Lucknow virus. Hence
from this study they concluded that it is new strain of Tomatoleaf curl new Dehli
virus, for which the name Tomato leaf curl New Dehli-Nagpurproposed.
Pathogenicity was further confirmed by inoculation in healthy plants. This is first
experimental proof of Koch postulates of begomovirus association with yellow
mosaic disease of egg plant.
Paprotkaet al.(2010) first time reported two new strains of bipartite along
with naturally present two DNA-1 (alphasatellite) in new world. They showed
resemblance to nanoviruses. Genome organization was typical to that of
nanoviruses, conserved region with stem loop motif with characteristics
nonanucleotide sequence TAA/GTATTAC, adenine rich region and single ORF.
Alphasatellite along with helper virus Euphorbia mosaic virus (EuMV) and Cleome
leaf crumple virus (CILCrV) was inoculated in natural host and experimental plant
Arabidopsis thaliana. New satellite particle causes disease symptoms and helper
virus transreplicate the satellite virus.
Ilyaset al. (2010)conducted survey across Pakistan for occurrence of
Legume yellow vein mosaic virus. They determined complete nucleotide sequence
of 44 isolates, 23 DNA-A, 19 DNA-B and 2 betasatellites. Their finding showed
that Mung bean yellow mosaic virus is prevalent in legumes cultivated areas. A
29
devastating pathogen reported in weeds from India, first identified in non cultivated
plants. Later this species was found in Pakistan together with novel betasatellite.
These provide evidence of interspecies recombination with non legume infecting
begomoviruses. Thus findings lead to conclusion that more virulent strains of
legume infecting begomoviruses could appear.
Pandeyet al. (2010) collected symptomatic tomato plants. Rolling circle
amplification was done to increase the amount of viral DNA which was then
subjected to restriction digestion by selected enzyme, cloning and sequencing.
Sequence comparison showed typical begomovirus genome organization, they are
unable to identify any DNA-B component and betasatllite. Two studied isolates
showed homology with Tomato leaf curl virus (ToLCV-CTM) and ToLCVK3/K5,
but this value is less than threshold value for specie demarcation. As result CTM
and K3/K5 are reported as novel specie in genus begomovirus, there is probability
that these novel species evolve due to recombination. Thus occurrence of new
species might cause a great economic threat to vegetable production in Asian
continent.
Trisnoet al.(2009) analyzed the pepper samples from Indonesia for presence
of begomoviruses. Degenerate primers pAL1v 1978 and pARc 715 were used for
PCR amplification, a product of 1.6kbs was visualized on agrose gel which was
directly send for sequencing. Sequence analysis showed conserved stem loop motif
is present along with nonanucleotide TAATATTAC, a character confined only with
geminiviruses. Based on phylogentic analysis and hair pin structure comparison
that studied isolate showed closet relationship with Pepper yellow leaf curl
30
Indonesia virus (PYLVIV) and Tomato yellow leaf curl Indonesia virus (TYLCIV).
But found to be different from begomoviruses those reported from Asia.
Cuong Haet al. (2008) characterized sixteen different species of
begomoviruses that infect weeds and crops in Vietnam. Nine species are identified
as novel of which six are monopartite and three are bipartite and rest of five species
were identified first time in Vietnam. These helper viruses were found associated
with betasatellites, five of them were novel satellite particles. Corchorus golden
mosaic virus is bipartite begomovirus close relative of previously
reportedCorchorus golden mosaic virus and some other new world bipartite
viruses. These finding provide evidence for the presence of new world viruses in
old world. Recombinant viruses, satellite viruses and some previously not well
characterized viruses with variation in stem loop structure supported that there is
great diversity among begomoviruses particularly in Southeast Asia and Vietnam.
Santosoet al.(2008) collected tomato samples on the basis of typical
begomovirus symptoms from eight locations in Java and Sumatra, Indonesia. Coat
protein (AV1) is highly conserved among geminivirdae, AV1 specific primers were
used for coat protein gene amplification. PCR product was direct sequenced which
was then subjected to blast analysis. Nucleotide sequence and amino acid sequence
comparison confirmed the association of begomoviruses and further analysis
demonstrated that these are variant of AYVV reported from Indonesia.
Haibleet al.(2006) described economical, simplified and most reliable
method for amplification of circular single stranded genome DNA viruses like
geminiviruses, nanoviruses and circoviruses as compared to antibody and PCR
31
detection method. Success of rolling circle amplification (RCA) is due to following
reasons, no need of expensive machinery, easy to handle, low template, no need of
prior information of sequence, and more economical per reaction. Beside this RCA
can be subjected to restriction digest and direct sequencing of linear DNA up to
900 bases in single run. The invention of this method accelerates the accurate
detection of geminiviruses.
Delatteet al.(2005) have determined biological and molecular properties of
Tomato leaf curl Madagascar isolate from moronodova and toliary (ToLCMGV-
[Tol], -[Mor]), Tomato leaf curl Mayotte virus isolate from Dembeni (ToLCYTV-
[Dem], -[Kah]) and kahani and Tomato leaf curl virus isolate (TYLCV-Mld[RE])
from Reunion. That was shown to be infectious to tomato. They found that all these
viruses have typicalmomopartite genome organization, (ToLCMGV-[Tol],-[Mor]),
(ToLCYTV-[Dem],-[Kah]) showed similarity with African
begomovirusesbutinphylogenic tree represent different monophyletic group. They
named them as south west island of Indian Ocean isolates. All these isolates
showed recombination and provide evidence of isolation of virus population.
Fauquetet al.(2005) reported that the great diversity of whitefly transmitted
geminiviruses was found across the Nile and Mediterranean basin since last twenty
years. Great diversity emerged as result of recombination event. Recombination
and phylogenetic analysis revealed that tomato infecting begomoviruses in this
geographic area formed two major groups Tomato yellow leaf curl sardinia virus
and Tomato yellow leaf curl virus. Pairwise sequence similarity dendrogram and
gene conversion were carried out from which biodiversity of virus can be
32
concluded. A total of six hotspot and three similar sequence in genome of tomato
infecting begomoviruses was found which provide evidence that recombination is
not a random event.
Nagata et al.(2004) employed the phi-29 DNA polymerase for whole
genome amplification in single step. This method is economical and easiest way to
get whole genome. Total genome was extracted and amplified product can be direct
sequenced or subjected to RFLP, cloned and sequenced. This rolling circle
amplification simplified the amplification of circular genome and make cloning
successful.
Ambrozeviciuset al. (2002)were of view that begomviruses infecting
tomato are highly diverse group of begomoviruses. They collected plants leaves
from south east region of Brazil and analysed direct nucleotide sequence of PCR
product. 137 out of 369 tested samples were infected with begomoviruses.
Dendrogram of these isolates showed a wide range of diversity among detected
begomoviruses in tomato from selected area. Tomato cholortic mottle virus is
mainly present in Minas Gerais and distinct specie was reported from Rio de
Janeiro that was not completely characterized yet. Further finding indicated four
more new species were present. This high level of diversity provides evidence of
transfer of wild species of begomoviruses in tomatoes.
33
Chapter 3
MATERIALS AND METHODS
3.1SAMPLE COLLECTION
Symptomatic samples were collected from farmer’s fields from Chakwal,
Attock, Talagang, Rawalpindi/Islamabad and Sindh and photographed with digital
camera. Leaves of symptomatic plants were kept in sample storage bags, labeled
and transported on ice before being stored at -20oCuntil they were processed for
DNA extraction.
3.2 ENZYME LINKED IMMUNOSORBENT ASSAY (ELISA)
The chilli samples were tested by triple antibody sandwich enzyme linked
immune sorbent assay (TAS-ELISA). It was also applied to confirm the
transmission of virus and to study the epitope profiles of samples.
3.2.1 Monoclonal Antibodies (Mabs)
The panels of monoclonal antibodies (Mabs) raised against particles of
African Cassava Mosaic Virus (ACMV), (number SCR 17,18,20,23),
IndianCassava Mosaic Virus (ICMV), (SCR54,55,56) and Okra Leaf Curl Virus
(OLCV), (SCR 102,104,106) were used for epitope profiling (Thomas et al.,1986;
Swanson and Harrison,1993).
3.2.2 Sample Preparation
Leaf extracts were made by grinding leaf sample in extraction buffer (0.05
M Tris-HCl, 0.005 M EDTA, pH 8.0, containing 2 %(w/v) PVP (MWt 44,000) and
0.05% (v/v) Tween-20, in a pestle and mortar. Control samples including leaf
34
extracts from healthy tomato (Lycopersicumesculentum) leaf samples, and
extraction buffer only were also used in ELISA.
3.2.3 Triple Antibody Sandwich Immunosorbent Assay(TAS-ELISA)
Triple antibody sandwich ELISA was used as applied by Harrison et al. (1997).
The wells of the plates were coated with purified polyclonal antibody against
ACMV (100µl/well), diluted in coating buffer (0.05M sodium carbonate buffer pH
9.6) 1:10,000 and placed at room temperature for 3 hrs. Washing of the plates was
done three times with 0.01M phosphate buffered saline, pH 7.4 (PBS), containing
0.05% Tween-20 (v/v) (PBST). Micro plates were coated with test samples
(100µl/well) and then placed at 4ºC for 24 hrs. Washing step was followed as
described earlier. Test antigens were blocked by five percent skimmed milk in
PBST containing 2% (w/v) polyvinylpyrollidine (PVP) and allowed at
approximately 28ºC for half an hour. The plates were drained. Mabs to ACMV,
ICMV and OLCV diluted at 1:5 in PBST+PVP were added to the wells (100µl) and
placed at room temperature for 2-3 hrs. Then washing of the plates were done as
described earlier. The rabbit anti-mouse IgG (whole molecule) conjugated with
alkaline phosphatase enzyme (ALP) diluted to 1:5000 in the conjugate buffer
(PBST+PVP) containing 0.2%(w/v) 0.2% ovalalbumin was put in micro plates
(100µl/well) and placed for 2 hrs at room temperature. The washing was again
performed and attached ALP was detected by the use of p-nitro phenyl phosphate at
0.6mg/ml in substrate buffer (10% v/v) diethanolamine pH 9.3; 150µl/well).
Absorbance (A 405nm) was determined in TitertekMultiscan Plus. Measurement
was taken after 1 hr at room temperature, and again after incubating overnight at
4ºC. A 405 nm values were the means of duplicate wells minus values for the
35
buffer control. All the values which were less than twice of healthy control were
given a score of zero.
3.3DNA EXTRACTION
Total DNA was from symptomatic leaf samples by Cetyltriethyl
Ammonium Bromide (CTAB) as described by Doyle and Doyle (1990). 100mg
tissue was crushed in liquid nitrogen. Powdered tissue was transferred in
microcentrifuge tube and mixed with 700µL pre warmed CTAB buffer (100mM
Tris-HCl [pH 8.0], 20mM EDTA, 1.4M NaCl, 2% [w/v] CTAB and 0.02% β-
mercaptoethanol and incubated for half hour at 65oC.
Samples were incubated at room temperature until sample’s temperature
becomes equal to room temperature. Equal volume of chloroform/isoamyl alcohol
(24:1) was added, mixed well and centrifuged for 10 min at 9000 rpm in a
microfuge eppendorf. Aqueous phase containing DNA was taken into new
eppendorf tube and 0.6% isoproponal was added to precipitate the DNA.
Centrifugation for 10 min at 13200 rpm transfers the DNA into pellet form.
Supernatant was discarded and pellet was washed with 70% (v/v) ethanol. Air dried
pellet was dissolved in double distilled water for final use.
3.4 DNAQUANTIFICATION
Concentrations of DNA was found out using nano drop (Thermo Scientific)
by measurning the absorbance at a wavelength of 260nm with conversion factor of
1 OD = 50 μg
3.5AMPLIFICATION OF EXTRACTED DNA
For amplification of DNA by PCR a reaction mixture of 25μL containing
36
1μl template DNA, 2.5 µlPCR Buffer D, containing 100mM Tris, pH 8.3, 25mM
MgCl2 and 500mM KCl. 1μl of 10mM dNTP mix, 0.5μM each of primers AV and
AC and 0.1ul Polymerase was prepared. The reaction mixture was incubated in
thermal cycler.The thermal cycler was programmed for a preheat treatment of 95oC
for 1 minutes followed by 35 cycles of 95oC for 1min, 58oC for 1min and extension
at 72oCfor different times (1min per 1000 nucleotides to be amplified), followed by
a final extension for 10 min at 72oC and PCR cycler was set at 4oC for infinite time
until the samples were removed.
3.6 ROLLING-CIRCLE AMPLIFICATION(RCA)
To increase the number of copies of circular genome by RCA a total
volume of 33.6μl of reaction mixture containing 50ng genomic DNA of infected
plant samples was prepared. 15μl of sample DNA and 3μl of sample buffer was
mixed in a PCR tube. The mixture was incubated in PCR cycler at 95°C for 3
minutes to denature double stranded DNA. A master mix of 15μl of reaction buffer
and 0.6μl of Phi29 enzyme was prepared in separate micro centrifuge tube. After
denaturation of template and sample buffer, this mixture was cooled to 4°C and
master mix of reaction buffer and enzyme was added in denatured, cooled template
and sample buffer. Incubation was followed at 30°C for 18hours followed by
another incubation at 65°C for 10 minutes to deactivate the enzyme.
3.7 CLONING OF AMPLIFIED DNA
3.7.1 Cloning of PCR Product
PCR amplified DNA was cloned using the pGEM T-Easy Vector System I,
PCR Cloning Kit (Promega) according to the instructions given by the
37
manufacturer. In brief, a reaction mixture of 10μL-20 μL containing 18 to 540ng
PCR product (depends upon thelength of DNA fragment), 1μLpGEM T-
EasyVector, 5μL 5XRapid Ligation Bufferand 1μL T4DNA Ligase, was prepared
in a 1.5mL microcentrifuge tube and incubated at 4°Covernight. The following day
the ligation mixture was transformed to competent cellsofE.coli(DH5α) by the
heat-shock method.
3.7.2Transformation of Heat-Shock Competent E. coli Cells
Competent E. coli cells were transformed by the methods as explained by
Sambrook, Frisch and Maniatis (1989). Whole ligation mixture that was incubated
at 4°C for overnight was added to thawed competent E. coli (200ul), mixed very
carefully followed by incubation on ice for 20min.The cells were subjected to heat
shock at 42°C in water bath for 1min. After heat shock cells were transferred to ice
and incubated for 5min. 500μL LB medium was added in each tube and mixed very
gently and put at 37°C in shaking machine for 30 min. Transformed cells were
spread on solid LB media plates with 100μg/mL amplicillin, spread and (50mg/mL)
X-Gal were used for plating-out the transformed cells and incubated at 37°Cfor 16
hours. On appearance of colonies, white colonies were picked by sterile tooth picks
and colony PCR was done.
3.7.3 Cloning of RCA Product
RCA product was digested with unique cutter enzymes into monomers.
Cloning vector (usually pGEM3Z and pGEM5Z) was also restricted with same
enzyme. Vector and insert were ligated in a reaction mixture of 20 μL containing
vector and insert in 1:3 ratios, 4μL 5X ligation buffer and 1μL T4 DNA ligase.
38
Ligation mixture was kept at 16°Covernight and next day transformed into
competent E. coli cells.
3.7.4 Plasmid DNA Isolation
A single transformed bacterial colony from agar plate was picked up with
the help of sterile tooth pick and inoculated into 500µL LB broth in presence of
selective conditions, appropriate antibody in a sterile culture tube. Bacterial culture
was grown overnight at 37°Cwith shaking at 250 rpm for logarithmic phase. When
the culture was ready, supernatant was removed through centrifugation and pelleted
bacterial cells were retrieved.
3.8 MINIPREPARATION
For DNA sequencing, the plasmid was isolated by GeneJET Plasmid
Miniprep Kit (Fermentas). The culture of E. coli was decanted into 1.5 mL
microcentrifuge tube and centrifuged for 20 minutes. The pellet was re-suspended
in 250μL resuspension solution and cells were lysed with 250μL lysis solution.
350μL neutralization solution was added mixed thoroughly and the tube was
centrifuged at 13,200 for five minutes. A mini-column provided with the kit was
inserted into the collection tube and the supernatant was transferred to the column.
The column was centrifuged for one minute to bind the DNA to the matrix and the
flow through in the collection tube was discarded. The matrix was washed twice,
first 700μL wash solution was added and incubated at room temperature for one
minute and then centrifuged for one minute. The wash solution was removed from
the column and the column washed with 500μl column wash solution.
Subsequently the column was centrifuged for one minute with an empty collection
tube to remove residual ethanol. Finally the column was inserted into a fresh
39
microcentrifuge tube. DNA in the column was dissolved in 50μL double disttled
water, incubated at room temperature and recovered by centrifugation.
3.9 DIGESTION OF PLASMID DNA
Purified plasmids DNA was digested with restriction endonucleases and
their corresponding buffers in accordance with the supplier’s (Fermentas or
Promega) guidelines. Reaction volume of 10μl was used for screening plasmid
preparations. A distinct banding pattern was visualized on agrose gel and size of
plasmid was confirmed by simply adding the size of DNA band.
3.10 AGAROSE GEL ELECTROPHORESIS
Agrose gel electrophoresis is the simplest technique for separating the DNA
fragments. Different percentage (0.7-1%) of agrose gel containing
ethdiumbromide(0.5µg/mL) was prepared depending on the size of fragment to be
resolved. Agrose gel was prepared in either 1X TBE (890mM Tris [pH 8.3],
890mM boric acid, 20mM EDTA,) or 1X TAE (40mM Tris-acetate [pH 8.4], 1mM
EDTA) buffer. TBE gels were electrophoresed at approximately 60V and TAE gels
at 120V. Nucleic acid was mixed with 6X loading dye (Thermo Fisher Scientific).
The DNA resolved band was visualized under gel documentation system. Fragment
size was confirmed by comparison with a co-electrophoresis 1kbp molecular
marker (Fermentas).
3.11 PURIFICATION OF DNA
3.11.1 Gel Extraction and PCR Product Purification
DNA was run on 0.8% (w/v) agarose gels and the desired fragments were
cut out from the gel using a scalpel under UV light. DNA from the gel was isolated
40
and PCR Clean-Up System (Promega) by the method described by the
manufacturer. The excised gel slice was weighed and placed in a 1.5mL
microcentrifuge tube to which was added 10μL membrane binding solution per
10mg of gel slice. The tube was vortex and incubated at 60°Cuntil the gel slice was
completely dissolved. An equal volume of membrane binding solution was mixed
with the dissolved gel mixture and then transferred to the mini column assembly,
incubated at room temperature for 1 minute, and centrifuged at 16,000×g for 1
minute. The flow-through was discarded and the mini column was reinserted into
the collection tube. 500μL of membrane wash solution was added and the tube with
column centrifuged at 16,000×g for 1 minute. Again the flow-through was
discarded and 500μL membrane wash solution was added in the column. After 5
minutes of centrifugation at 16,000×g the collection tube was emptied and the mini
column with empty collection tube was centrifuged for 1 minute. Finally the mini
column was transferred to a clean micro centrifuge tube, 50μL nuclease-free water
was added to the mini column, incubated at room temperature for 1 minute, and
centrifuged at 16,000×g for 1 minute. The mini column was discarded and purified
DNA was stored at -20°C.
3.12 SEQUENCING AND SEQUENCE ANALYSIS
Plasmids were purified using a GeneJET Plasmid Miniprep Kit (Fermentas)
and their sequences were determined commercially. Sequences at the ends of
clones were determined using the M13forward (-20) and M13reverse (40) primers.
These sequences were then extended by designing specific primers; a process
known as primer walking. Sequence data were assembled and analysed with the aid
of Lasergene package of sequence analysis software (DNAStar Inc., UA, AZ,
41
USA). A sequence similarity search (Blast) was performed by comparing the
sequence to other begomovirus sequences in the database
(http://www.ncbi.nlm.nih.gov/BLAST/) and open reading frames were located
using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Final sequences
were submitted to the EMBL sequence database. Multiple sequence alignments
were performed using Clustal W (Thompson et al., 1997) and Mega Align program
of the Lasergene package. Phylogenetic trees were constructed using the Neighbor
Joining algorithm of Clustal W and displayed, manipulated, and printed using Tree
view.
42
Table 3.1:Sequences of primers used during the study
Primers Nucleotide Sequence
Core (AV) 5’ GCC HAT RTA YAG RAA GCC MAG RAT 3’
Core (AC) 5’ GGR TTD GAR GCA TGH GTA CAN GCC 3’
Beta F 5’GGTACCGCCGGAGCTTAGCWCKCC3’
Beta R 5’GGTACCGTAGCTAAGGCTGCTGCG3’
Alpha F 5’AAGCTT AGAGGAAACTAGGGTTTC3’
Alpha R 5’AAGCTTTTCATACARTARTCNCRDG3’
Bur-F 5’ TAGGAATTATGTCGAAGCGACC 3’
Bur-R 5’GCCCTTATTACCAGGATTAAATC 3’
PAL1v1978 5’GCATCTGCAGGCCCACAT(Y)GTCTT(Y)CCNGT3’
PAR1c496 5’AATACTGCAGGGCTT(Y)CTRTACATRGG 3’
43
Chapter 4
RESULTS
4.1 SAMPLES COLLECTION AND SYMPTOMS
Chilli plants showing begomovirus symptoms i.e. upward leaf curling and
stunted growth chorosis were collected and stored in ice box. These symptoms are
shown in figure 2A, B, D, E, G, H,I and J. The major areas of sampling were
around Attock, Chakwal, Talagang and Islamabad (NARC and surrounding farms
areas).The chilli samples from Sindh showed severed leaf curling, leaf shorting,
short internodes, overall retarded growth and no fruit at allas shown in figure 4.4.
The details of samples presented in table 4.2 showed coding of isolates and
sampling area is mentioned in map (Figure 4.3).
4.2 EPITOPE PROFILE OF BEGOMOVIRUS
4.2.1 Reaction of Chili Isolates with ACMV, ICMV and OLCV Mabs
Serological relationship among begomoviruses was determined with the
panel of monoclonal antibodies raised against African cassava mosaic virus
(ACMV SCR 17, 18, 20, and 23), Indian cassava mosaic virus(ICMV SCR 54, 55,
56) and Okra leaf curl virus (OLCV SCR 102,104,106). A total of twenty nine
samples were tested of which 17 gave very strong reaction upto level four. These
samples mostly reacted strongly with ACMV and ICMV. Further detail showed
that Mab 20 and 23 of ACMV and 54 and 55 of ICMV reacted to level four. Few
samples reacted with only Mab 106 of OLCV to level four.
However, the rest of the twelve samples were positive, but reaction strength
was weak, they reacted withall of the Mabs with strength one or two, this might be
44
Table 4.2: Locations and coding of samples collected
Plant Name Area Sample Name
Capsicum annuum (Chilli) Attock (ATK) 1
Capsicum annuum(Chilli) Attock 2
Capsicum annuum(Chilli) Attock 9
Capsicum annuum(Chilli) Attock 10
Capsicum annuum(Chilli) Islamabad (ISB) 245
Capsicum annuum (Chilli) Islamabad 246
Capsicum annuum (Chilli) Islamabad 248
Capsicum annuum (Chilli) Islamabad 249
Capsicum annuum (Chilli) Islamabad 250
Capsicum annuum (Chilli) Islamabad 251
Capsicum annuum (Chilli) Sindh (SND) 312
Capsicum annuum (Chilli) Sindh 320
Capsicum annuum (Chilli) Sindh 321
Capsicum annuum (Chilli) Sindh 331
Capsicum annuum (Chilli) Sindh 332
Capsicum annuum (Chilli) Talagang (TLG) 503
Capsicum annuum (Chilli) Talagang 504
Capsicum annuum (Chilli) Chakwal (CHK) 509
Capsicum annuum (Chilli) Chakwal 510
45
Figure 4.3: Red circles on map showing sample collection area
46
332
A B
C D
E
251
1 2
331
249
G
47
F
Figure 4.4: Naturally infected symptomatic plant used in current study
Symptomatic leaves (A, B), from Attock, (C, D) from Sindh, (E, F) from
Islamabad, (G,H) Talagang region,(I,J) Chakwal
503
H
509
J
G
504
I
510
48
due to low virus concentration orintegration of epitopes during storage. The details
of epitope profiling are presented in table 4.3.
4.2.1.1 Group I
As two ACMV Mab 20, 23 and only one ICMV Mab 55 reacted to level
four, this reactivity pattern differentiate group I from group II. Total of three
isolates 248, 249 and 250 formed second groups on the basis of Mabs reactivity,
they showed distinct epitope profiling as two ACMV Mabs 20, 23 and one ICMV
Mabs 55 reacted upto level 3 and 4.
4.2.1.2 Group 1I
Strong reactivity with two ACMV Mab 20, 23 and two ICMV Mab 54 and
55 make group II unique from rest of groups. Samples were grouped on the basis of
Mabs reactivity from strong to very strong level. Seven samples 1, 9,10, 245, 251,
503 and 504 were grouped together, as isolate 1 reacted upto level 3 with ACMV
Mab 23 whereas isolates 9, 10,245 and 251 reacted from level 3 to 4 with ACMV
Mab 23, ICMV Mabs 54 and 55 respectively. However, isolates 503 and 504
reacted strongly with upto level 3 with ICMV Mab 54.
4.2.1.3 Group III
Strong reaction with OLCV Mab 106 make group III unique from group I
and II. Four isolates 320, 321, 509 and 510 formed group three. Distinct pattern
was observed as only these isolates reacted from level 3 to 4 with OLCV Mab 106.
4.2.1.4 Group IV
This group is unique in the sense as it reacted with one ICMV Mab 60 and one
OLCV Mab 106. Three isolates 312, 331 and 332 reacted with ICMV Mab 60
49
Table 4.3: Epitope profile of Geminivirus isolates from chilies
code
Monoclonal antibodies
African Cassava Mosaic virus
(ACMV)
Indian Cassava Mosaic
Virus (ICMV)
Okra Leaf Curl
Virus (OLCV)
17 18 20 23 54 55 60 62 102 106
1 1 1 2 3 1 1 2 1 1 2
9 1 2 2 3 4 4 2 1 1 1
10 1 2 2 3 4 2 1 1 1 1
245 0 1 1 3 3 2 1 0 0 1
503 1 1 2 2 3 2 1 0 0 1
504 1 1 2 2 3 1 1 0 0 1
251 1 1 4 4 3 4 2 0 0 1
248 0 0 4 4 1 2 0 0 0 1
249 0 1 3 2 1 2 0 0 0 1
250 0 0 3 2 1 4 0 0 0 1
320 2 1 1 1 2 2 2 2 2 3
321 1 1 1 1 2 2 2 1 1 4
509 1 1 1 2 2 2 1 1 1 3
510 1 2 1 2 2 2 1 1 1 4
312 2 2 2 2 2 2 3 2 2 4
331 2 2 2 2 2 2 3 2 1 4
332 2 2 2 1 2 2 3 2 2 3
*Absorbance values at A405 nm following incubation with substrate. The reaction was scored as: 4
(>1.80), 3 (1.21-1.80), 2 (0.61- 1.20), 1 (0.15- 0.60), 0 (
50
and OLCV Mab 106 with strong reaction strength from 3 to 4, respectively. Hence,
they formed group four with unique epitope profile pattern.
4.3 DETECTION OF BEGOMOVIRUSES
The total DNA was extracted from symptomatic plants by CTAB method
and Gene Jet kit manufactured by Fermentas. The quantification of extracted DNA
was determined by nanodrop and details were presented in annexure 1. Two sets of
diagnostic primers (as mentioned in table1.1) were used for amplification of
begomovirus genomes. The first primer pair PAlv 1978 and PARc 496 was used to
amplify a product of 1.2 kbp. A total of 34 samples were tested and 19 of them
gave expected size of product. The details of samples that gave expected PCR
product are given in table 4.4.
The second primers pairs, core AC1/AV1 amplified all intergenic or
common regions, part of Rep and AV1 gene along with complete AV2 gene. A
product was amplified having 650bp in size as shown in figure4.5. This was cloned
in pGEM T-easy vector and colonies were confirmed by colony PCR using M13
forward and reverse primers. After confirmation, the plasmid product was
sequenced from School of Biological Sciences. The obtained sequence were
analyzed by Laser DNA package v. 12 and blast search was carried out and
sequence that had maximum query cover were selected for further analysis.
4.3.1 Phylogenetic Analysis of Partial Sequence of Begomoviruses Obtained by
Core AC1/AV1 Primers
All the 19 product sequenced were of 650 bps. They were aligned using
Clustal W program. The phylogenic tree was constructed by using the maximum
51
likelihood method with 1,000 bootstraps in Molecular Evolutionary Genetics
Analysis (MEGA) v.7.0 software. The Boot strapping was applied to statistically
validate the tree using ML-plot. Topography of phylogenetic tree revealed that tree
is divided into two major clades, clade I is sub divided into four sub clade and clade
II is sub divided into two sub clade as shown in figure4.6. The sub clade IA has
isolates 9b, 10a, 10b, 10c and 2b from Attock region whereas 245a, 246b and 246c
from Islamabad region and one isolate 504 from Talagang region. In sub clade IB
three isolates falls, 251a from Islamabad, 9a from Attock and 509c from Chakwal
region. Sub clade IC has all isolates (248a, 248c, 249b, 250a and 250b) Islamabad
region, 510b and 510c lies in same sub clade IIIA. Sub clade ID has all isolates
(312a, 312b, 312c, 320a, 320b, 321a and 331c) from Sindh region with exception
of 503c from Talagang region.
Clade II has three sub clades, in sub clade IB all Sindh isolates (331a, 332a,
332b and320c) group together with 100 bootstrap values. 509a and 509b lies in
samesub cluster but they formed separate group with high bootstrap value 99. 251b
also present in same sub cluster. Sub clade IIB showed two groups in one group
allIslamabad isolates (249b, 249c, 248b and 250c) are present with one exception
of 321b from Sindh area. In sub clade IIB three Attock isolates (1a, 1b and 2a) and
331b (Sindh isolate) showed grouping, while 504a, 504c,246a, 245b and 9c
grouptogether.
4.3.2 Phylogenetic Analysis of Core Region of Begomovirus Isolates with
Reference Sequence
All partial sequence was aligned with eleven most closely related sequences
52
Figure 4.5:Detection of begomovirus
Water 1 2 9 10
M
100bps
500bps
1000bp
s
2000bps
600bps
53
Figure4.6: Phylogentic analysis of core region of begomoviruses
Cluster I
Cluster II
Sub clade IA
Sub clade IB
Sub clade IC
Sub clade ID
Sub clade IIA
Sub clade IIB
Sub clade IIB
54
245b_Islamabad
245b_Islamabad 100.0 246a_Islamabad 246a_Islamabad 97.4 100.0 246b_Islamabad
246b_Islamabad 96.7 99.4 100.0 246c_Islamabad 246c_Islamabad 97.4 100.0 99.4 100.0 248a_Islamabad
248a_Islamabad 82.3 83.9 83.1 83.9 100.0 248b_Islamabad 248b_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 248c_Islamabad
248c_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 100.0 249a_Islamabad 249a_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 100.0 100.0 249b_Islamabad
249b_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 100.0 100.0 100.0 249c_Islamabad 249c_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 100.0 100.0 100.0 100.0 250a_Islamabad
250a_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 100.0 100.0 100.0 100.0 100.0 250b_Islamabad 82.3 84.7 83.9 84.7 99.4 99.7 99.7 99.7 99.7 99.7 99.7
250c_Islamabad 81.9 84.3 83.5 84.3 99.7 100.0 100.0 100.0 100.0 100.0 100.0 251a_Islamabad 57.7 58.4 58.3 58.4 56.0 56.5 56.5 56.5 56.5 56.5 56.5 251b_Islamabad 57.7 58.4 58.3 58.4 56.0 56.5 56.5 56.5 56.5 56.5 56.5 2a_Attock 88.4 89.8 89.1 89.8 80.2 80.6 80.6 80.6 80.6 80.6 80.6 2b_Attock 88.0 90.2 89.5 90.2 80.6 81.0 81.0 81.0 81.0 81.0 81.0 312a_Sindh 60.6 62.6 61.6 62.6 67.3 67.8 67.8 67.8 67.8 67.8 67.8 312b_Sindh 60.6 62.6 61.6 62.6 67.3 67.8 67.8 67.8 67.8 67.8 67.8 312c_Sindh 60.0