Upload
others
View
0
Download
0
Embed Size (px)
Citation preview
INFLUENCE OF PROBIOTIC SUPPLEMENTATION ON ENDOCRINE AND METABOLIC CHANGES FOR FERTILITY IMPROVEMENT
IN REPEAT BREEDING KARAN FRIES (KF) COWS UNDER FARM AND FIELD CONDITIONS
THESIS SUBMITTED TO THE
ICAR-NATIONAL DAIRY RESEARCH INSTITUTE, KARNAL
(DEEMED UNIVERSITY)
IN PARTIAL FULFILMENT OF THE REQUIREMENT
FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY IN
ANIMAL PHYSIOLOGY
BY DANDAGE SHASHIKANT DAMODHAR
M.V.Sc.
DAIRY CATTLE PHYSIOLOGY DIVISION ICAR-NATIONAL DAIRY RESEARCH INSTITUTE
(DEEMED UNIVERCITY) KARNAL-132001 (HARYANA), INDIA
2015
Regn. No. 1090903
Dedicated
to my
Beloved Daughter
“PRANJAL”
ABSTRACT
The present investigation was conducted on Karan-Fries crossbred cattle reared at cattle yard, National Dairy Research Institute (NDRI) Karnal, Haryana, India. The study was also conducted at field level reared by farmers of Darad and Indri villages of Karnal. Recently calved cows free from clinical reproductive tract infection, clinical mastitis and any injury were selected from farm and field conditions. Animals were monitored up to three consecutive services. Pregnancy diagnosis by rectal palpation post 45-60 day after each service was done. Animals conceiving up to three services were considered as regular breeders (RgB) and those that did not conceive up to three services were considered as repeat breeders (RB). There after RB group of animals were divided into two groups (a) supplemented with fermented yeast culture (RB-S) (b) Non supplemented (RB-NS) under both farm and field condition. To RB-S group fermented yeast culture (Saccharomyces cerevisiae; Diamond XP) was supplemented with concentrate @ 12 gm/animal twice daily (5.3 × 105 CFU/g) during experimental period (21st - 40th week).The present study was taken up for finding relationship between plasma IGF-1, Hp, Lactofferin calcium, glucose and urea with respect to repeat breeding problem and availability of energy fuel to lactating dairy cows and also to evaluate the effect of systematic supplementation of fermented yeast culture in alleviating repeat breeding problem. In the present study in vitro effect of IGF-I on expression of Toll-like receptor-4 (TLR-4) and Fas gene in neutrophils was studied in RB group. In the present study concentration of plasma IGF-1, Lactofferin, glucose and calcium were significantly (P<0.001) greater in RgB group when compared with RB group under both farm and field conditions. Concentration of plasma Hp and urea were significantly(P<0.001) lower in RgB group when compared with RB group under both farm and field conditions. DMI, milk yield and body weight were higher in RgB group when compared with RB group under both farm and field conditions, but they were not significantly different. From 22nd week when probiotic (Fermented yeast culture) was supplemented concentration of plasma IGF-1 Lactofferin, glucose and calcium were significantly (P<0.001) greater in RB-S group when compared to RB-NS group under both farm and field conditions. Concentration of plasma Hp and urea were significantly (P<0.001) lower in RB-S group when compared with RB-NS group under both farm and field conditions. DMI, milk yield and body weight were higher in RB-S group, when compared with RB-NS group, but not significantly different under both farm and field conditions. After supplementation, conception rate was significantly (P<0.01) higher in RB-S group when compared to RB-NS group under both farm and field conditions.Relative expression of TLR-4 and Fas gene in blood neutrophils of RgB group was significantly greater (P<0.001) when compared with RB (In vitro IGF-1 supplemented) group. Differential plasma level of IGF-l, Lactoferrin and Haptoglobin were related with Repeat Breeding problem in crossbred Karan Fries cows under both farm and field conditions. Supplementation of fermented yeast culture to repeat breeding crossbred Karan Fries Cows resulted in providing necessary nutrient, improvement in nutrient utilization, rumen functionand production performance which in turn might have reduced repeat breeding problem in crossbred cows under farm and field conditions. Relative expression of TLR-4 and Fas gene in neutrophils may relate with repeat breeding problem in Karan Fries cows.
laLFkk ds {ksf=; ,oa xzkeh.k {ksf=; fLFkFkh ds varxZr dj.k Qzht xk;ksa esa tuu {kerk esa
lq/kkj gsrq vUrjLrzkoh rFkk p;kip; ifjorZuksa ij izfrtSfod laiqjd dk izek.k
lkjka'k
orZeku vè;;u ladV d.kZ fQzt xk;ksa ij fd;k x;k Fkk] tksfd i'kq'kkyk jk"Vªh; Ms;jh vuqlaèkku
laLFkku djuky] gfj;k.kk Hkkjr esa ikbZ xbZ FkhA orZeku vè;;u djuky ftys ds njkj ,oa banzh xk¡oksa esa
xzkeh.kksa okyh ifjfLFkfr;ksa es Hkh fd;k x;k fkkA uSnkfud iztuu iFk ds lØe.k uSnkfud Lrj dh lwtu
,oa pksV eqDr gky gh esa C;kgh xk;ksa dk i'kq'kkyk ,oa xzkeh.kksa ls p;u fd;k x;k FkkA i'kqvksa dh rhu
yxkrkj iztuu lsokvksa rd fuxjkuh dh xbZ FkhA izR;sd iztuu lsok ds 40&60 fnu ckn rd
xHkkZoLFkk dh tk¡p xqnk VVksyus dh fofèk }kjk dh xbZ FkhA i'kvksa ftUgksaus rhu iztuu lsok dh vofèk
ds nkSjku xHkkZèkkj.k dj fy;k Fkk] mUgssa fu;fer iztud ¼vkj-th-ch-½ rFkk ftUgksaus iztuu lsok ds
i'pkr~ Hkh xHkZèkkj.k ugha fd;k Fkk] mUgsa iqu% iztuu ¼vkj-ch-½ lewg esa ekuk x;k FkkA blds i'pkr~
vkj-ch- lewg okys i'kqvksa dks nks lewgkas ¼v½ fd.kfor [kehn] laofèkZr ¼vkj-ch-,l-½ ¼c½ fd.kfor [kehn
vlaofèkZr ¼vkj-ch-,u-,l-½ esa nksuksa i'kq'kkyk ,oa xzkeh.kk ifjfLFkfr;ksa esa ck¡Vk x;k FkkA vkj-ch-,l- lewg
ds fy, iz;ksxkRed vofèk ¼21osa ls 40osa g¶rs ds nkSjku½ fd.kfor [kehn laoèkZd ¼lWdjksekbfll lfoZlh,
Mk;e.M ,Dl-ih-½ fnu esa nks ckj 12 xzke izfr i'kq ¼5-3x105 lh-,Q-;w- izfr xzke½ fn;k x;k FkkA
orZeku vè;;u IykTek vkbZ-th-,Q-&1] ,p-ih- ySDVksQsfju] dSfY'k;e] Xywdkst ,oa ;wfj;k dk iqu%
iztud leL;k ,oa nqèkk: xk;ksa dh ÅtkZ miyCèkrk esa lEcUèkksa dks [kkstus ds fy, fn;k x;k FkkA blds
vykok orZeku vè;;u] fd.kfor [kehn laoèkZ iwjdrk dk iqu% iztud leL;k ds Åij izHkko tkuus ds
fy, Hkh fd;k x;k FkkA orZeku vè;;u esa bu foVªks vkbZ-th-,Q-&1 dk Vksy leku fjlsiVj ,oa Qkl
thu dh vfHkO;fDr ij izHkko dk Hkh vè;;u fd;k x;k FkkA IykTek vkbZ-th-,Q-&1 ySDVksQsfju]
Xywdkst ,oa dSfY'k;e dh ek=k vkj-th-ch- lewg esa vkj-ch- lewg dh rqyuk esa nksuksa i'kq 'kkyk ,oa
xzkeh.k ifjfLFk;ksa esa egRoiw.kZ ¼ih<0-05½ :i esa T;knk ikbZ xbZ FkhA IykTek ,p-ih ,oa ;wfj;k dh ek=kk
vkj-th-ch- lewg esa vkj-ch- lewg dh rqyuk esa nksuksa xzkeh.k ,oa i'kq 'kkyk ifjfLFk;ksa esa egRoiw.kZ ¼ih<0-
05½ de FkhA Mh-,e-vkbZ-] nwèk mRikn ,oa 'kjhj Hkkj vkj-th- ch- lewg esa vkj-ch- lewg dh rqyuk esa
nksuksa xzkeh.k ,o i'kq 'kkyk ifjfLFkr;ksa esa T;knk ikbZ xbZA ijUrq ;s egRoiw.kZ :i ls fHkUu ugha FksA 22osa
g¶rs ds i'pkr~ tc izksckW;ksfVd ¼fd.kfor [kehn½ laoèkZu dh iwjdrk ds nkSjku IykTek] vkbZ-th-,Q- 1]
ySDVksQsfju] Xywdkst ,oa dSfY'k;e dh ek=k vkj-ch-,l- lewg esa vkj-ch-,u-,l- lewg dh rqyuk esa nksuksa
i'kq 'kkyk ,oa xzkeh.k ifjfLFkr;ksa esa T;knk ikbZ xbZ FkhA IykTek] ,p-ih- ,oa ;wfj;k dh ek=k vkj-ch-,l-
lewg esa vkj-ch-,u-,l- lewg dh rqyuk esa nksuksa ifjfLFkr;ksa esa egRoiw.kZ ¼ih<0-05½ :i ls de FkhA Mh-
,e-vkbZ-] nwèk mRikn ,oa i'kq Hkkj] vkj-ch-,l- lewg esa vkj-ch-,u-,l- lewg dh rqyuk esa nksuksa
ifjfLFkfr;ksa i'kq 'kkyk ,oa xzkeh.k ifjfLFkfr;ksa esa T;knk Fkh] ijUrq egRoiw.kZ :i esa fHkUu ugha FkhA
iwjdrk ds i'pkr~] nksukas xzkeh.k ,oa i'kq 'kkyk ifjfLFkfr;ksa esa xHkkZèkku dh nj egRoiw.kZ :i esa vkj-ch-
lewg esa vkj-ch-,u-,l- dh rqyuk esa T;knk FkhA Vh-,y-vkj- 4 ,oa Qkl thu dh vfHkO;fDr vkj-ch-
lewg dh U;wVªksfQyl dksf'kdkvksa esa vkj-ch- ¼vkbZ-th-,Q- 1 iwjd bu foVªks½ lewg esa dkQh T;knk FkhA
fHkUu IykTek] vkbZ-th-,Q- 1] ySDVksQsfju ,oa gS¶VksXyksfcu dk ek=k ladV d.kZ fQzt i'kqvksa esa nksuksa
xzkeh.k ,ao i'kq 'kkyk ifjfLFkfr;ksa ls lacafèkr FkkA iqu% iztud ladj xk;ksa esa fd.kfor [kehn laoèkZu dh
iwjdrk vko';d iks"k.k] iks"k.k mi;ksx esa csgrjh p;&ip; dk;Z ,oa mRiknu izn'kZu esa lqèkkj djrk gSA
U;wVkjksfQyl esa Vh-,Q-vkj- 4 ,oa Qkl ,e-vkj-,u-,- dh lacafèkr vfHkO;fDr d.kZ Qzkbt xk;ksa esa iqu%
iztuu leL;k ls lacafèkr gks ldrh FkhA
CONTENTS
Chapter No.
Title Page No.
1 INTRODUCTION 1-4
2 RIVIEW OF LITERATURE 5-28
2.1 Yeast culture (Saccharomyces cerevisiae) 6
2.1.1 Mode of action of Yeast and its effects on
performance of animals 7
2.1.1.1 Mode of action of yeast in the rumen: 8
2.1.1.2 Effect of Saccharomyces cerevisiae on Rumen
fermentation pattern
10
2.1.1.3 Effect of Saccharomyces cerevisiae on Milk Yield: 11
2.1.1.4 Effect of Saccharomyces cerevisiae on Dry Matter
Intake (DMI)
11
2.1.1.5 Effect of Saccharomyces cerevisiaeon Body Weight 12
2.2 Insulin Like Growth Factors-1 (IGF-1) 12
2.2.1 IGF-l in female reproduction 13
2.3 Haptoglobin (Hp) 15
2.3.1 Biological functions of Haptoglobin (Hp) 16
2.4 Lactoferrin 17
2.5 Blood profile and reproduction 18
2.5.1 Plasma calcium 18
2.5.2 Plasma glucose 19
2.5.3 Plasma urea 20
2.6 Neutrophils 21
2.6.1 Apotosis of neutrophils 22
2.7 Fas gene 24
2.7.1 Mechanisms of neutrophil apoptosis activated by
death receptors (Fas)
24
2.8 Toll-like receptor-4 (TLR-4) 26
2.8.1 Expression of TLR-4 Gene in different cells. 27
2.8.2 Neutrophils and TLR-4 Gene 28
Chapter No.
Title Page No.
3 MATERIALS AND METHODS 29-45
3.1 Location of the study areas and climate 29
3.2 Selection and grouping of experimental animals 29
3.3 Chemicals, glassware and plastic ware 30
3.4 Collection of blood samples 30
3.5 Feed provided under farm and field conditions. 30
3.6 Estimation of feed intake 31
3.6.1 Analysis of feed and fodder samples 31
3.7 Recording of body weight 31
3.8 Recording of milk yield 31
3.9 Estimation of plasma parameters 32
3.9.2 Estimation of blood plasma Lactoferrin 32
3.9.3 Estimation of blood plasma Insulin-like growth factor-
1 (IGF-1)
32
3.9.4 Estimation of blood plasma calcium 32
3.9.5 Estimation of blood urea 33
3.9.6 Estimation of blood glucose 35
3.10 IN VITRO STUDY 36
3.10.1 Chemicals for In Vitro study 36
3.10.2 Chemicals for gene expression studies 36
3.10.3 Separation and enumeration of Neutrophils 37
3.10.4 Determination of number of viable cells 38
3.11 IN VITRO EXPERIMENT 39
3.11.1 Preparation of reagents and glassware for RNA
isolation
40
3.11.2 Quality and quantity of RNA 40
3.11.3 RNA extraction from blood PMN Cells 40
3.11.4 Quality checking of RNA by agarose gel
electrophoresis
41
3.11.5 Quantification of RNA 42
3.11.6 Protocol For first strand cDNA synthesis: 42
Chapter No.
Title Page No.
3.11.7 Primers 43
3.11.8 Reaction mixture for real-time PCR 44
3.11.9 Statistical analysis of relative target gene expression 45
3.12 Statistical analysis 45
4 RESULTS AND DISCUSSION 46-85
4.1 Insulin-Like Growth Factor-1 (IGF-1) 46
4.1.1 Concentration of plasma Insulin-like growth factor-1 (ng/ml) in RgB and RB groups under farm conditions.
46
4.1.2 Concentration of plasma Insulin-like growth factor-1
(ng/ml) in RB-S and RB-NS groups under farm
conditions.
47
4.1.3 Concentration of plasma Insulin-like growth factor-1
(ng/ml) in RgB and RB groups under field conditions.
48
4.1.4 Concentration of plasma Insulin-like growth factor-1
(ng/ml) in RB-S and RB-NS groups under field
conditions.
49
4.2 Haptoglobin (Hp) 51
4.2.1 Concentration of plasma haptoglobin (ng/ml) in RgB
and RB groups under farm Conditions.
51
4.2.2 Concentration of plasma haptoglobin (ng/ml) in RB-S
and RB-NS groups under farm conditions.
52
4.2.3 Concentration of plasma haptoglobin (ng/ml) in RgB
and RB groups under field conditions.
53
4.2.4 Concentration of plasma haptoglobin (ng/ml) in RB-S
and RB-NS groups under field conditions.
54
4.3 Lactoferrin (LF) 56
4.3.1 Concentration of plasma lactoferrin(ng/ml) in RgB
and RB groups under farm conditions.
56
4.3.2 Concentration of plasma lactoferrin(ng/ml) in RB-S and RB-NS groups under farm conditions.
57
4.3.3 Concentration of plasma lactoferrin (ng/ml) in RgB
and RB groups under field conditions.
58
Chapter No.
Title Page No.
4.3.4 Concentration of plasma lactoferrin (ng/ml) in RB-S
and RB-NS groups under field conditions.
59
4.4 Glucose 60
4.4.1 Concentration of plasma glucose (mg/dl) in RgB and
RB groups under farm conditions.
60
4.4.2 Concentration of plasma Glucose (mg/dl) in RB-S
and RB-NS groups under farm conditions.
61
4.4.3 Concentration of Plasma glucose (mg/dl) in RgB and
RB groups under field conditions.
62
4.4.4 Concentration of plasma glucose (mg/dl) in RB-S
and RB-NS groups under field conditions.
63
4.5 Urea 64
4.5.1 Concentration of plasma urea (mg/dl) in RgB and RB
groups under farm conditions.
64
4.5.2 Concentration of plasma urea (mg/dl) in RB-S and
RB-NS groups under farm conditions.
65
4.5.3 Concentration of plasma urea (mg/dl) in RgB and RB
groups under field conditions.
66
4.5.4 Concentration of plasma urea (mg/dl) in RB-S and
RB-NS groups under field conditions.
67
4.6 Calcium 68
4.6.1 Concentration of plasma calcium (mg/dl) in RgB and
RB groups under farm conditions.
68
4.6.2 Concentration of plasma calcium (mg/dl) in RB-S
and RB-NS groups under farm conditions.
69
4.6.3 Concentration of plasma calcium (mg/dl) in RgB and
RB groups under field conditions.
70
4.6.4 Concentration of plasma calcium (mg/dl) in RB-S and RB-NS groups under field conditions.
71
4.7 Dry matter intake (DMI) 72
4.7.1 Dry matter intake (Kg/day) in RgB and RB KF groups
under farm conditions.
72
Chapter No.
Title Page No.
4.7.2 Dry matter intake (Kg/day) in RB-S and RB-NS
groups under farm conditions.
73
4.7.3 Dry matter intake (Kg/day) in RgB and RB groups
under field conditions.
73
4.7.4 Dry matter intake (Kg/day) in RB-S and RB-NS
groups under field conditions.
74
4.8 Milk yield 75
4.8.1 Milk yield (Kg/day) in RgB and RB groups under
farm conditions.
75
4.8.2 Milk yield (Kg/day) in RB-S and RB-NS groups under
farm conditions.
76
4.8.3 Milk yield (Kg/day) in RgB and RB groups under field
conditions.
76
4.8.4 Milk yield (Kg/day) in RB-S and RB-NS groups under
field conditions.
77
4.9 Body weight 78
4.9.1 Body weight (Kg) in RgB and RB groups under farm
conditions.
78
4.9.2 Body weight (Kg) in RB-S and RB-NS groups under
farm conditions.
79
4.9.3 Body weight (Kg) in RgB and RB groups under field
conditions.
79
4.9.4 Body weight (Kg) in RB-S and RB-NS groups under
field conditions.
80
4.10 Conception rate 81
4.10.1 Conception rate in RgBand RB groups under farm
conditions.
81
4.10.2 Conception rate in RB-S and RB-NSgroups under
farm conditions.
81
4.10.3 Conception rate in RgB and RB groups under field
conditions.
82
Chapter No.
Title Page No.
4.10.4 Conception rate in RB-S and RB-NS groups under
field conditions.
82
4.11 In Vitro Study 83
4.11.1 Relative expression of TLR-4 mRNA in neutrophils of
RB, RB (In vitro IGF-1 supplemented) and RgB
group.
83
4.11.2 Relative expression of Fas mRNA in neutrophils of
RB, RB (In vitro IGF-1 supplemented) and RgB
group.
83
5 SUMMARY AND CONCLUSIONS 86-92
6 BIBLIOGRAPHY i-xxvi
LIST OF TABLES
Table No. Titte After
page 3.1 Details of experimental animals under farm conditions. 30 3.2 Details of experimentals animal under field conditions. 30
3.3 Composition of concentrate feed supplemented to animal. 30 3.4 Protocol for the estimation of plasma glucose. 36 3.5 Composition of RPMI -1640 medium. 36 3.6 Details of primers of target and housekeeping genes. 42
3.7 Reaction mixture for Real-Time PCR. 43 3.8 Reaction programme for real time PCR. 43
4.1 Concentration of plasma IGF-1(ng/ml) in RgB and RB groups under
farm conditions. 47
4.2 Concentration of plasma IGF-1(ng/ml) in RB-S and RB-NS groups
under farm conditions. 48
4.3 Concentration of plasma IGF-1(ng/ml) in RgB and RB groups under
field conditions. 48
4.4 Concentration of plasma IGF-1(ng/ml) in RB-S and RB-NS groups
under field conditions. 49
4.5 Concentration of plasma Hp(ng/ml) in RgB and RB groups under
farm conditions. 51
4.6 Concentration of plasma Hp (ng/ml) in RB-S and RB-NS groups
under farm conditions. 52
4.7 Concentration of plasma Hp (ng/ml) in RgB and RB groups under
field conditions. 53
4.8 Concentration of plasma Hp (ng/ml) in RB-S and RB-NS groups
under field conditions. 54
4.9 Concentration of plasma Lactoferrin(ng/ml) in RgB and RB groups
under farm conditions. 56
4.10 Concentration of plasma Lactoferrin (ng/ml) in RB-S and RB-NS
groups under farm conditions. 57
4.11 Concentration of plasma Lactoferrin (ng/ml) in RgB and RB groups
under field conditions.
58
Table No. Titte After
page 4.12 Concentration of plasma Lactoferrin (ng/ml) in RB-S and RB-NS
groups under field conditions. 59
4.13 Concentration of Plasma Glucose (mg/dl) in RgB and RB groups
under farm conditions. 61
4.14 Concentration of Plasma Glucose (mg/dl) in RB-S and RB-NS
groups under farm conditions. 62
4.15 Concentration of Plasma Glucose (mg/dl) in RgB and RB groups
under field conditions. 62
4.16 Concentration of Plasma Glucose (mg/dl) in RB-S and RB-NS
groups under field conditions. 63
4.17 Concentration of Plasma Urea (mg/dl) in RgB and RB groups under
farm conditions. 65
4.18 Concentration of Plasma Urea (mg/dl) in RB-S and RB-NS groups
under farm conditions. 66
4.19 Concentration of Plasma Urea (mg/dl) in RgB and RB groups under
field conditions. 67
4.20 Concentration of Plasma Urea (mg/dl) in RB-S and RB-NS groups
under field conditions. 67
4.21 Concentration of Plasma Calcium in RgB and RB groups under farm
conditions. 69
4.22 Concentration of Plasma Calcium in RB-S and RB-NS groups under
farm conditions. 70
4.23 Concentration of Plasma Calcium (mg/dl) in RgB and RB groups
under field conditions. 70
4.24 Concentration of Plasma Calcium (mg/dl) in RB-S and RB-NS
groups under field conditions. 71
4.25 Dry Matter Intake (Kg/day) RgB and RB groups under farm
conditions. 72
4.26 Dry Matter Intake (Kg/day) in RB-S and RB-NS groups under farm
conditions. 73
4.27 Dry Matter Intake (Kg/day) RgB and RB groups under field
conditions. 74
4.28 Dry Matter Intake (Kg/day) in RB-S and RB-NS groups under field
conditions. 74
Table No. Titte After
page 4.29 Milk Yield (Kg/day) of RgB and RB groups under farm conditions. 75
4.30 Milk Yield (Kg/day) of RB-S and RB-NS groups under farm
conditions. 76
4.31 Milk Yield (Kg/day) of RgB and RB groups under field conditions. 77
4.32 Milk Yield (Kg/day) of RB-S and RB-NS groups under field
conditions. 77
4.33 Body Weight (Kg) of RgB and RB groups under farm conditions. 79 4.34 Body Weight (Kg) of RB-S and RB-NS groups under farm conditions. 79
4.35 Body Weight (Kg) of RgB and RB groups under field conditions. 79 4.36 Body Weight (Kg) of RB-S and RB-S groups under field conditions. 80
4.37 Conception rate of RgB and RB groups under farm conditions 81 4.38 Conception rate of RB-S and RB-NS groups under farm conditions. 81 4.39 Conception rate of RgB and RB groups under field conditions. 82 4.40 Conception rate of RB-S and RB-NS groups under field conditions. 82 4.41 Correlation coefficient of plasma parameters in RgB and RB groups
under farm conditions 82
4.42 Correlation coefficient of plasma parameters in RB-S and RB-NS
groups under farm conditions 82
4.43 Correlation coefficient of plasma parameters in RgB and RB groups
under field conditions 82
4.44 Correlation coefficient of plasma parameters in RB-S and RB-NS
groups under field conditions 82
4.45 Relative expression of TLR-4 and Fas mRNA in neutrophils of RB,
RB (In vitro IGF-1 supplemented) and RgB group. 83
LIST OF FIGURES Figure
No. Title of Figures After
page 2.1 Mode of action of live yeast in ruminants 8
2.2 Mechanism of fermented yeast culture in bacterial growth and
activity
10
2.3 Apoptosis signaling through death receptors 26
3.1 Standard curve for plasma IGF-1 32
3.2 Standard curve for plasma Hp 32
3.3 RT-PCR amplified products of TLR-4, Fas and House keeping
genes on agarose gel 3%
42
3.4 Amplification curve TLR-4 44
3.5 Amplification curve Fas 44
4.1 Concentration of plasma IGF-1 in RgB and during pre and post
supplementation period in RB-S and RB-NS groups under farm
conditions
49
4.2 Concentration of plasma IGF-1 in RgB and during pre and post
supplementation period in RB-S and RB-NS groups under field
conditions
49
4.3 Concentration of plasma Hp in RgB and during pre and post
supplementation period in RB-S and RB-NS groups under farm
conditions
54
4.4 Concentration of plasma Hp in RgB and during pre and post
supplementation period in RB-S and RB-NS groups under field
conditions
54
4.5 Concentration of plasma lactoferrin in RgB and during pre and post
supplementation period in RB-S and RB-NS groups under farm
conditions
59
4.6 Concentration of plasma lactoferrin in RgB and during pre and post
supplementation period in RB-S and RB-NS groups under field
conditions
59
4.7 Concentration of plasma glucose in RgB and during pre and post
supplementation period in RB-S and RB-NS groups under farm
conditions
63
4.8 Concentration of plasma glucose in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions
63
Figure No.
Title of Figures After page
4.9 Concentration of plasma urea in RgB and during pre and post
supplementation period in RB-S and RB-NS groups under farm
conditions
67
4.10 Concentration of plasma urea in RgB and during pre and post
supplementation period in RB-S and RB-NS groups under field
conditions
67
4.11 Concentration of plasma calcium in RgB and during pre and post
supplementation period in RB-S and RB-NS groups under farm
conditions
71
4.12 Concentration of plasma calcium in RgB and during pre and post
supplementation period in RB-S and RB-NS groups under field
conditions
71
4.13 DMI in RgB and during pre and post supplementation period in
RB-S and RB-NS groups under farm conditions
74
4.14 DMI in RgB and during pre and post supplementation period in
RB-S and RB-NS groups under field conditions
74
4.15 Milk yield in RgB and during pre and post supplementation period
in RB-S and RB-NS groups under farm conditions
77
4.16 Milk yield in RgB and during pre and post supplementation period
in RB-S and RB-NS groups under field conditions
77
4.17 Body weight in RgB and RB groups under farm conditions 80
4.18 Body weight in RB-S and RB-NS groups under farm conditions 80
4.19 Body weight in RgB and RB groups under field conditions 80
4.20 Body weight in RB-S and RB-NS groups under field conditions 80
4.21 Relative expression of TLR-4 and Fas mRNA in neutrophils of RB,
RB (In vitro IGF-1 supplemented) and RgB group.
83
LIST OF THE PICTURE
Picture No. Title After
page
3.1 RB-S animal under Darad village conditions 30
3.2 RB-S animal under Darad village conditions 30
5.1 Calf born of RB-S animal under Darad village conditions 82
5.2 Calf born of RB-S animal under Darad village conditions 82
LIST OF ABBREVIATIONS % = Percent
µg = Microgram
µl = Microlitre
µmol = Micromol
@ = at the rate of
°C = Degree centigrade
µg = microgram
BCS = Body condition score
BUN = Blood urea nitrogen
BW = Body weight
Ca = Calcium
DFM = Direct Fed microbials
DM = Dry matter
DMEM = Dulbecco’s modified Eagle’s medium
DMI = Dry matter intake
EDTA = Ethyelene Diamine Tetra-acetic Acid
EtBr = Ethidium Bromide
FCS = Foetal calf serum
g = Gram
h = Hour
KF = Karan Fries
Kg = Kilogram
mg = Milligram
mm = Millimeter
mmol = Milimole
MY = Milk yield
PCR = Polymerase Chain Reaction
RB = Repeat Breeder
RB-NS = Non Supplemented Repeat Breeder
RB-S = Supplemented Repeat Breeder
RgB = Regular Breeder
v/v = Volume by volume
w/v = Weight by volume
SE = Standard error
SEM = Standard error of mean
TLR-4 = Toll Like Receptor-4
FDA = Food and Drug Administration
YC = Yeast Culture
VFA = Volatile fatty acids
IGF-1 = Insulin Like Growth Factors -1
IGFBPs = IGF binding proteins
NSILA = non-suppressible insulin-like activity
Da = Dalton
GH = Growth Hormone
LH = Luteinizing Hormone
APP = Acute phase protein
Hp = Haptoglobin
LF = Lactoferrin
NK = Natural Killer
GnRH = Gonadotropin Releasing Hormone
TNF = Tumor necrosis factor
NGF = Nerve growth factor
FasL = Fas ligand
DD = Death domain
FADD = Fas-associated death domain-containing protein
DED = Death effector domain’
DISC = Death inducing signalling complex’
TRADDs = TNFR-associated death domain-containing proteins
TRAF2 = TNFR-associated factor-2
RIP = Receptor-interacting protein
LPS = Lipopolysaccharide
APC = Antigen-presenting cells
PMN = Polymorph nuclear neutrophils
PAMPs = Pathogen-associated molecular patterns
LRR = Leucine rich repeats
TIR = Interleucine receptor
IL8 = Interleukin-8
NDRI = National Dairy Research Institute
CFU = Colonies Forming Unit
AI = Artificial Insimination
NRC = Natinal Research Council
ELISA = Enzyme-link Immunosorbent Assay
TCA = Trichloroacetic acid
OD = Optical Density
TAE = Tris Acetate buffer
DPBS = Dulbecco’s phosphate buffer solution:
EtBr = Ethidium bromide
DEPC = Diethylpyrocarbonate
DPBS = Dulbecco’s Phosphate Buffer Saline
GAPDH = Glyceraldehydes 3-phosphate dehydrogenase ()
FCS = Fital Calf Serum
RNA = Ribonucleic Acid
DNA = Deoxyribonucleic Acid
UV = Ultra Violate
CD = Cluster of differentiation
Cp = Crossing point
CHAPTER –1
INTRODUCTION
INTRODUCTION
Optimum production of high quality milk is the core objective of dairy
sector. Introduction of cross breeding (the fastest method of improving animal
productivity) has certainly improved the milk production, but the issues and
challenges of cross breeding as per Indian conditions have remained largely
unsolved. Relative contribution of milk production by crossbred cattle to the total
milk production in the country is increasing steadily. However, in spite of higher
productivity, crossbred cattle are more prone to environmental stress. Their
performance is affected by high temperature, poor feeding and susceptibility to
diseases (Rao et al., 1995) making them a liability for the resource poor rural
farmer. Variation exists among studies on the overall incidence of mastitis,
retention of placenta (ROP), metritis, endometritis, pyometra and repeat
breeding. Crossbred cattle are more vulnarable to reproductive problem when
compared with the indigenous breed. The depressed immune status of
crossbred cattle due to harsh Indian climatic condition is one of the major
hurdles limiting its productivity. Hence, they require extra manage mental
practice in terms of feeding, housing and clinical aid to meet the high production.
Reproductive performance of dairy cattle is a major concern in both
organized and unorganized dairy farming. Reproductive performance is one of
the important factors determining the profitability of the dairy farmers. This can
be achieved by resuming postpartum ovarian cycle within 30 days; conception in
less than 90 days, with an average calving interval of one year. Fertility of animal
is lower in present scenario than the one that existed one or few decades earlier.
Gordon (2005) reported that decline in calving rate to first service is declining
significantly by 0.7-0.9% per year. Repeat breeding is one of the major
problems in dairy cattle that affects fertility and in turn incurs great economic loss
to farmers. The repeat breeding cow is one that has clinically normal
reproductive tract with regular oestrous cycles and has been bred two or more
times to a fertile bull but has failed to conceive (Roberts, 1971). Incidence of
repeat breeding in cows in various countries ranges from 10 to 18% (Kimura et
al., 1987). The incidence of repeat breeding in India has been reported to range
from 5.5 to 33.33 % in cattle and from 6 to 30 % in buffaloes (Saxena, 2004).
Haptoglobin (Hp) is one of the most specific acute phase protein which is
stimulated by inflammatory mediator and responds to an initial reaction of
infection, inflammation or trauma in animal. Hp acute phase response is coupled
with an increase in the release of pituitary adrenal and sympathetic hormones
and also as a result of increased activity of stress axis (Carroll, 2008). Hp
seemed to be promising marker of health status by reflecting broad spectrum of
ongoing clinical and sub clinical diseases (Petersen et al., 2004). Differential Hp
concentration in plasma could act as a useful indicator for identifying cattle with
reproductive problems like anestrous and repeat breeding. Lactoferrin (LF) has
been identified as having important role in innate immune responses. Among its
varied role, LF has been reported to have anti-bacterial, anti-fungal, anti-tumor,
anti-inflammatory and immunomodulatory properties. LF plays crucial role in iron
sequestration from bacteria, thus limiting bacterial proliferation (Valenti and
Antonini, 2005). IGF-1 is an important hormonal signal that influences
reproductive events such as stimulation of cell mitogenesis, hormonal production
and embryo development. It has been reported that higher concentration of
blood plasma IGF-I in early post partum stage is important for early resumption
of cyclicity and establishment of pregnancy (Flood et al., 1993). Increased blood
urea level leads to decreased uterine pH, and reduced conception rate in cattle
(Elrod and Butler, 1993). Plasma urea nitrogen and milk urea nitrogen
concentration > 19 mg/dL were associated with approximately a 20 percentage
decrease in pregnancy rate in lactating dairy cattle (Butler et al., 1996). Plasma
glucose concentration is good indicator of energy balance. Pregnancy rate was
higher among cows with greater plasma glucose concentration (Fahey et al.,
2002). Plasma glucose level at first insemination was significantly lower in cows
that failed to conceive (Plym-Forshell et al.,1991). Calcium plays an important
role in gonadotropic regulation of ovarian steriodogenesis. During infection,
neutrophils are exposed, often simultaneously to variety of stimuli that can
differentially modulate the antimicrobial activity of this cell. Blood neutrophils are
extremely short-lived cells that are programmed for rapid apoptosis after
differentiation in bone marrow. Fas is a major death receptor that stimulates
apoptosis in circulating neutrophils (Simon, 2003). Blood plasma IGF-1,
Lactoferrin and Haptoglobin (Hp) are indicators as well as modulators of stress
2
and mild infections. Their differential level in plasma may correlate with repeat
breeding problem in crossbred Karan Fries cows.
The term probiotic (a Greek word meaning for life) was first coined by
Parker (1974). The World Health Organization defines probiotics as “live
microorganisms, which, when administered in adequate amounts, confer health
benefits on the host.” Interest in the use of direct-fed microbials as feed
supplements for high producing dairy cows has increased markedly in recent
years. A commonly used direct-fed microbial is the yeast Saccharomyces
cerevisiae. Improvements in Dry Matter Intake (DMI), digestibility of nutrients,
milk production and milk components have been reported when cows were fed
yeast i.e. Saccharomyces cerevisiae(SC). Yeast culture is thought to be best
utilized by the animals under stress. Barling (2014) reported that during stress,
animals may have other nutrient requirements to overcome the condition of
stress.
At present, there is no scientific research information available on the
effect of Saccharomyces cerevisiae supplementation on reproductive
performance in crossbred cows under tropical conditions. However most of the
research has been done on Dry Matter Intake (DMI), digestibility of nutrients,
growth rate, milk production and milk components parameters in dairy cattle.
Little information is available on plasma level of IGF-l, Lactoferrin, Haptoglobin,
with respect to fertility and also, on influence of Saccharomyces cerevisiae
supplementation in repeat breeding crossbred Karan Fries cows under tropical
conditions. Report is not available on direct in vitro effect of IGF-I on expression
of Toll-like receptor-4 (TLR-4) and Fas gene in neutrophils of repeat breeding
crossbred Karan Fries Cows. Keeping these points in view, in the present study
was taken up for finding relationship between IGF-1 Hp lactofferin with respect to
repeat breeding problem and availability of energy fuel to lactating dairy cows. It
was also to see the effect of systematic supplementation of fermented yeast
culture (Saccharomyces cerevisiae) along with concentrate @ 12 g/animal twice
daily on improvement of reproductive performance of RB KF cows. Therefore,
the present study was taken up with the following objectives;
1. To study the relationship between the blood parameters and reproductive
performance of post partum KF cows under farm and field conditions.
3
2. Effect of probiotic (Saccharomyces cerevisiae) supplementation on blood
parameters in repeat breeding KF cows under farm and field conditions.
3. In vitro effect of IGF-I on differential expression of Toll-like receptor-4 and
Fas gene in blood neutrophils of supplemented and non supplemented
repeat breeding KF cows.
4
CHAPTER –2
REVIEW OF LITERATURE
REVIEW OF LITERATURE
The fertility of dairy herds has declined throughout the world in recent
years (McDougall, 2006; Royal et al., 2000; Lucy, 2001). The reason for this
decline include change in climate, stress, nutrient deficiency, increased milk
production, intensified genetic selection, and the uterine health of cows (Lucy,
2001). The repeat breeding cow is one that has clinically normal reproductive
tract with regular estrous cycles and has been bred two or more times to a fertile
bull but has failed to conceive (Roberts, 1971). The economic losses associated
with RB cows are considerable: increased veterinary expenses, insemination
costs, reduced productivity and losses due to involuntary culling. Incidence of
repeat breeding in cows in various countries ranged from 10 to 18% (Kimura et
al., 1987; Gustafsson and Emanuelson 2002). The incidence of repeat breeding
in India has been reported to range from 5.5 to 33.33 % in cattle and from 6 to
30 % in buffaloes (Saxena, 2004). Reproductive problems have been the
primary cause of culling in animal husbandry for many years (Coleman et al.,
1985 and Opsomer et al., 2000).
Efficiency of livestock production is closely related to feeding practices of
the animals. Feed additives especially probiotics have shown to increase nutrient
utilization and improvement in the productivity of ruminants. As a whole,
probiotics offer an alternate source of enhancing feed utilization and animal
productivity in a better way.
The term probiotic (a Greek word meaning for life) was first coined by
Parker (1974), who described it as “the organisms and substances that
contribute to intestinal microbial balance”. Later, Fuller (1989) redefined it as a
“live microbial feed supplement that beneficially affects the host animal by
improving its microflora”. Later on US Food and Drug Administration (FDA) in
1989 used the term “Direct Fed microbials (DFM)”. The joint expert panel of the
Food and Agricultural Organization of the United Nations and the WHO defined
these as “Live Microorganisms” which when administered in adequate amount
confer a health benefit on the host (Krehbiel et al., 2003)
Probiotics and yeast culture have many benefits when added to a diet.
They stimulate desirable microbial growth in the rumen and stabilize the rumen
pH. ruminal fermentation and end product production can be altered. Increase in
nutrient flow postruminally, nutrient digestibility, and the alleviation of stress
through enhanced immune response are other benefits of DFM (Yoon and Stern,
1996).
Yeast supplementation in the diet caused a significantly higher digestibility
of nutrients and increased production of carboxy methyl cellulose activity in the
rumen (Maurya et al., 1993 and Garg, 2008). Feeding of Saccharomyces
cerevisae for the improvement in digestibility and production of the animals was
demonstrated by Kamra et al. (1996), Prahalada et al. (2002) and Garg (2008).
Body weight and feed conversion ratio increased significantly. Increased
production of total VFA, ratio of acetate to propionate, especially 4 hr post
feeding and in vitro dry matter digestibility was reported in sheep (Garg, 2008).
The feeding of Saccharomyces cerevisae also significantly improved bacterial
count and volatile fatty acids production in rumen liquor and enhanced the
digestibility of nutrients in sheep (Rao et al., 2001).When fed to cattle, yeast
cultures have been shown to stimulate cellulolytic bacteria in the rumen, improve
fiber digestion, and stabilize rumen pH (Rossi et al., 2006).
2.1 YEAST CULTURE (Saccharomyces cerevisiae)
The most common YC used in ruminant diets is Saccharomyces cerevisiae.
Saccharomyces cerevisiae, the yeast cultures, are considered as a promising
probiotic for efficient nutrient utilization in ruminants leading to improvement in
animal productivity. The genus Saccharomyces has 16 species, including
Saccharomyces cerevisiae is described in the literature as containing
biotherapeutic agents. Saccharomyces cerevisiae is a species of budding yeast, a
single celled organism with a short generation time (doubling time 1.5–2 hours at
30 °C). All strains can utilize ammonia and urea as the sole nitrogen source, but
cannot utilize nitrate since they lack the ability to reduce them to ammonium ions.
They can also utilize most amino acids, small peptides and nitrogen bases as a
nitrogen source. Histidine, glycine, cystine and lysine are, however, not readily
6
utilized. S. cerevisiae is unique organism that has the ability to survive in gastric
acidity and are not adversely affected or inhibited by antibiotics. They do not
appear to alter or adversely affect the normal flora of the GI tract and can be
consumed with normal probiotic bacteria (Elmer and McFarland 2001). A yeast
culture (YC) is a yeast-fermented feed additive that contains both live and dead
yeast cells, the culture media the yeast cells were grown on, and the metabolic
byproducts produced by the yeast cells during fermentation (Linn and Raeth-
Knight 2006). In the dairy industry, these products were first used in cow rations to
increase dry matter intake during the transition period or periods of stress (Garrett,
2000). Cellulolytic bacteria in the rumen are stimulated by YC. Fiber digestion in
calves and cows is improved by adding YC to the diet.
Yeast also provides growth factors, such as malate and vitamins, which
stimulate lactate utilizing bacteria, which helps stabilize rumen pH preventing risk
of acidosis (Rossi et al., 2006). Yeast does not grow in rumen fluid but retains
metabolic activity and viability (Newbold et al., 1996).
2.1.1 Mode of action of yeast and its effects on performance of animals:
In ruminants the mode of action and beneficial effects of yeast as microbial
feed additive on the performance of animals were summarized by Kamra and
Pathak (2005) as:
• Increases the palatability of feed (Glutamic acid produced by yeast is
responsible for improvement in the taste of feed stuffs and a pleasant
odour).
• Stimulation of rumen microbes and enhanced microbial protein synthesis in
the rumen.
• pH stabilization in the rumen, viable yeast acts as a modulator of rumen pH.
• Oxygen scavenging from the rumen.
• Supply of vitamins and minerals to fiber degrading microbes.
• Reduced ammonia nitrogen in rumen liquor. This can be either due to a
reduced degradation of dietary protein, or due to an enhanced use of
ammonia by bacteria resulting in an enhanced production of microbial
protein or both.
7
• Increase rate of fiber digestion (thus directly affecting gut fill) and the rate of
digesta flow.
• Improves bacterial count and VFA in rumen liquor, decreases the ratio of
acetic to propionic acid, mainly due to higher production of propionic acid.
• Higher production of carboxymethyl cellulose activity in rumen liquor.
• Better ruminal digestion, metabolism and improved nutrient utilization.
• An increase in feed conversion efficiency and live weight gain in growing
animals.
• Improved milk production in dairy animals.
• The protection of young animals against enteropathic disorders such as
diarrhoea by inhibiting the colonization of coliform bacteria in the gut.
The mode of action of live yeast in ruminants were studied by Dawson et al.
(1990). The overall mode of action of live yeast is illustrated briefly in Figure 2.2.
2.1.1.1 Mode of action of yeast in the rumen:
Yeast cells are unable to develop in a durable manner in the ruminal milieu,
so that they have to be fed every day. However, they can stay alive in the rumen
upto about 30 hours. Several modes of action have been demonstrated. Yeast
respiratory activity lowers the redox potential. Because main ruminal
microorganisms are strictly anaerobic, this protects anaerobic rumen bacteria from
damage by O2, increases the number of cellulolytic bacteria (Dawson et al., 1990)
and improves ruminal digestion. Moreover, yeast action can utilize part of free
sugar in the rumen and limit a fermentation shift due to rapid degradation of these
compounds.
Only live yeast can use ruminal sugars and oxygen. Saccharomyces
cerevisiae can carry some metabolites that are useful for ruminal microorganisms.
Yeast cultures contain B vitamins, amino acids and organic acids, particularly
malate, which stimulates growth of ruminal bacteria that digest cellulose (Callaway
and Martin, 1997 and Kowalik et al., 2011). Malate has been shown to be a potent
growth promotor for lactate-fermenting bacteria in-vitro (Nisbet and Martin 1991),
but is not sufficient to increase the number of ruminal bacteria in-vivo. It was
8
Figure. 2.1 Mode of action of live yeast in ruminants.
Altered microbial protein synthesis
Increase
Decrease ammonia Altered amino acid profile
Live yeast
Increase feed intake
Improve
Stimulation of rumen microbes
Production response
Moderate
Altered VFA production
Decrease lactic
Decrease
suggested that addition of Yea-sacc to the rumen increased the number of
cellulolytic bacteria possibly by assisting hydrogen transfer (Williams and Lyons,
1988). Further, yeast culture provides soluble growth factors that stimulate growth
of ruminal bacteria that utilize lactate and digest cellulose.
(1) Oxygen scavenger:
Live yeast use oxygen to metabolize sugars and small oligosaccharides
solubilized from feed particles and produce peptides and amino acids as end
products which are used by the bacteria in the vicinity of yeast. Removal of
oxygen improves anaerobiosis in the microenvironment of solid feed particals and
provide better conditions for the growth of cellulolytic bacteria (Jouany, 2001).
(2) Supply of growth factors:
Role of fermented yeast culture in bacterial growth and activity given by Girard
(1996) is illustrated briefly in Figure 2.1.
(3) pH stabilization:
Yeast increase lactate utilization. Yeast is a source of dicarboxylic acid and
malic acid which is utilized by S. cerevisiae to produce propionate from lactate. S.
cerevisiae HD4 showed 3.8 fold more uptake of lactic acid in presence of yeast
(Nisbet and Martin, 1991).
(4) Stimulation of rumen microbes:
Oxygen uptake, supply of growth factors and pH stabilization
synergistically act for stimulation of rumen microbes. YC have also directly
stimulated rumen fungi, which may improve fiber digestion (Chaucheryas et al.,
1995; Gattass et al., 2008; Soccol et al., 2010). They increased the number of
rumen protozoa and neutral detergent fiber digestion in steers fed straw-based
diets (Plata et al., 1994).
(5) Microbial protein synthesis:
Reduction in rumen NH3-N concentration
Increase incorporation of NH3 into microbial protein
Improved amino acid profile of duodenal digesta. (Methionine and Lysine)
9
Erasmus et al. (1992) reported 10 % reduction in rumen ammonia
concentration and 9.4 % more NAN at duodenum by YC supplementation. Putnam
et al. (1997) reported improved methionine from 13.5 to 14.5 % and Lysine from
4.5 to 5.8% in total essential amino acids in duodenal digesta by supplementation
of 10 g YC /day.
2.1.1.2 Effect of Saccharomyces cerevisiae on rumen fermentation pattern:
Rumen pH:
A pH in this optimum range must occur for the establishment and survival
of a diverse and stable population of microorganisms. Establishment of microbial
populations in the rumen appears to follow a pattern with regards to substrates
available and ruminal pH. Ruminal pH is controlled by multiple factors including
relative concentration of bases, acids, and buffers (Owens et al., 1998). The
primary base in the rumen is NH3, with lactate being the primary acid and
bicarbonate and phosphate acting as major buffers.
Ruminal ammonia:
A decrease in NH3 concentration is attributed to ruminal microbial
proliferation, due to the increase of microbial use of available NH3. Beharka et al.
(1998) reported a decrease in NH3 concentrations in Holstein bull calves, fed
either a finely ground or unground diet consisting of chopped hay and rolled grain.
Their results indicated an increased incorporation of NH3 nitrogen into microbial
protein.
Volatile fatty acids:
The development of the rumen is primarily chemical being influenced by
volatile fatty acids (VFA) metabolism and absorption in the rumen. These VFA are
produced by naturally occurring microbes in the rumen. The major VFA produced
are acetic, propionic, butyric, and valeric acids. These end products of microbial
fermentation are absorbed and metabolized by the rumen epithelium. Stimulatory
effects of VFA on the developing rumen are not equal. Butyrate is the most
stimulatory, followed by propionate (Laborde, 2008).
10
Figure 2.2 Mechanism of fermented yeast culture in bacterial growth and activity
Metabolically active yeast cells
Short chain peptides
Stationary phase of bacteria
Protein synthesis in bacteria
Transitition to exponential growth
Increases bacterial growth and activity
Metabolic trigger
2.1.1.3 Effect of Saccharomyces cerevisiae on milk yield:
There are controversial results of Saccharomyces cerevisiae
supplementation on milk yield and composition of milk of cows.
Number of study shows that supplementation of Saccharomyces cerevisiae
significantly increases the milk yield and composition of milk of cows in early
lactation period (Sune and Muhlbach, 1998; Iwanska et al., 1999; Robinson and
Garrett, 1999).
Several studies (Piva et al., 1993; Dann et al., 2000; Majdoub-mathiuothi et
al., 2009) have demonstrated that supplementation of Saccharomyces cerevisae
had non significant effect on milk yield or milk composition in mid or late lactation
period of dairy cows.
Arambel and Kent (1990); Piva et al., (1993); Robinson (1997).They had
demonstrated significant effect on milk yield or milk composition of dairy cows
when Saccharomyces cerevisae was supplemented in early lactation or
peripartum period.
There are controversial results of Saccharomyces cerevisiae supplementation on milk yield and composition of milk of cows.
2.1.1.4 Effect of Saccharomyces cerevisiae on Dry Matter Intake (DMI):
Several research finding showed that significant improvement in DMI on
systematic supplementation of Yeast i.e. Saccharomyces cerevisiae in crossbred
cows during peripartum period or early lactation (Williams et al., 1991; Wohlt et al.,
1991; Dann et al., 2000).
Number of studies show non significant changes in DMI on systematic
supplementation of Saccharomyces cerevisiae in crossbred cows during mid or
late lactation (Arambel and Kent, 1990 and Soder and Holden, 1999).
Supplementation of Saccharomyces cerevisiae during stress to cattle
increases feed intake and nutrient availability to overcome the stress. Therefore
yeast culture is thought to be best utilized by animals under stress (Phillips and
von Tungelin, 1984 and Barling, 2014)
11
2.1.1.5 Effect of Saccharomyces cerevisiae on body weight:
Markusfeld et al. (1997) failed to observe any relationship between body
weight at calving and first service conception rate in crossbred cows.
Zhang et al. (2000) reported that the body weight gain was 1% higher in
the crossed bred cows group supplemented with Saccharomyces cerevisiae
than that of the controls but it was not-significant.
Addition of yeast cell suspension (Saccharomyces cerevisiae) in feed
crossbred cattle calves had increased body weight gain significantly (Prahalada et
al., 2002 and Anandlaxmi et al., 2012).
Anandlaxmi et al. (2013) reported that supplementation of Saccharomyces
cerevisiae to crossbred cows with anoestrous problem increases feed intake and
brought the animals into cyclicity early.
2.2 INSULIN LIKE GROWTH FACTOR-1 (IGF-1)
Insulin-like growth factor-1 was first identified by Salmon and Daughaday
(1956, 1957), and designated ‘sulphation factor’ due to their ability to incorporate
sulphate into rat cartilage in vitro. They were also known as NSILA (non-
suppressible insulin-like activity) I and II. A decade later, the terms sulphation
factor and NSILA were replaced by the term ‘somatomedin’ (Daughaday et al.,
1972) and subsequently they were renamed ‘insulin-like growth factor I and II’
due to their structural similarity with insulin and their growth-promoting activities
(Rinderknecht and Humbel, 1976a, 1976b).
Insulin-like growth factor-1 is one of two ligands of the IGF family (Hwa et
al., 1999 and Spicer 2004), is a small peptide consisting of 70 amino acids with a
molecular weight of 7649 Da (Laron, 2001). The established components of the
IGF system also include two receptors, six high-affinity IGF binding proteins
(IGFBPs) and IGFBP proteases (Giudice 1995; Hwa et al. 1999; Spicer 2004).
Furthermore, another group of low affinity binding proteins known as IGFBP-
related proteins (IGFBP-rPs) belongs to the IGF family. Its primary action is
mediated by binding to its specific receptor, the Insulin-like growth factor-1
receptor, abbreviated as "IGF-Ir", present on many cell types in many tissues.
Binding to the IGF-Ir, a receptor tyrosine kinase, initiates intracellular signalling.
12
IGF-1is produced mainly by liver but also produced in many other organs
(Zulu et al., 2002). Growth Hormone (GH) is dominant endocrine influence on
liver production and circulating concentrations of IGF-1which is 100 %
dependant with lower concentration in hypopituitary states and elevated
concentrations in condition of GH excess. Once released from the liver IGF-1has
endocrine functions, travelling via blood to act on distant tissues including those
of reproductive tract (Wathes 2008). Low level of IGF-1 and Lactoferrin reflect
lower immune status of repeat breeding groups when compared compared with
regular breeder groups (Nickerson, 1989; Oliver and Sordillo 1989).
In a variety of species (including farm animals, humans, and laboratory
animals) higher concentrations of blood IGF-1 are found in young, well
nourished, healthy individuals (Jones and Clemmons, 1995). Animals that are
old, diseased, or mal-nourished have low blood IGF-1 concentrations that reflect
a compromised state of tissue, organ, and cell function (Jones and Clemmons
1995; McNall et al., 1995). The changes in blood IGF-1 can be directly linked to
changes in growth hormone receptor expression or growth hormone receptor
second messenger systems in liver.
2.2.1 IGF-1 in female reproduction
Insulin-like growth factor-1 decreased in postpartum cattle when energy
requirements exceeded nutrient intake (Beam and Butler, 1999). Cattle in poor
body condition or cows failing to increase body condition during lactation also
have low blood IGF-1 (Wathes, 2008).
Several studies have established a correlation between blood IGF-
1concentrations of postpartum cattle and reproductive function. Thatcher et al.
(1996) Anand Laxmi et al. (2013) reported that anestrus dairy cows had lower
blood IGF-1compared with dairy cows that initiated estrous cyclicity earlier
during the postpartum period. A similar relationship was reported for beef cattle;
postpartum anestrus cows had lower IGF-1 compared with cyclic cows (Roberts
et al., 1997). Blood IGF-1 was was positively correlated with follicular fluid IGF-1
because the majority of IGF-1 in follicular fluid is derived from blood
(Leeuwenberg et al., 1996). Therefore, endocrine IGF-1under somatotropic
control influences ovarian function through it’s contribution to follicular fluid IGF-
13
1. According to the somatomedin hypothesis, nutritionally induced changes in
liver IGF-1 secretion have a direct effect on the ovary through the endocrine
actions of IGF-I. An association between IGF-1and ovulation in postpartum dairy
cows has been established, but a causative relationship should not be
extrapolated from these correlation studies.
Insulin-like growth factor-I and gonadotropins are synergistic for growth
and differentiation of the follicle (Adashi,1998; Giudice, 1992; Spicer and
Echternkamp, 1995). Follicular growth and steroidogenesis in postpartum cattle,
therefore, should be correlated with greater LH secretion as well as greater
blood IGF-1concentration. A positive correlation between LH pulsatility and
ovarian follicular development has been established for postpartum cows (Beam
and Butler, 1999). Likewise, positive correlation between plasma estradiol and
serum IGF-1 was found during the first post partum follicular wave (Beam and
Butler 1999). Postpartum ovarian function probably depends on both LH
pulsatility and blood IGF-1concentrations. The independent contribution of each
hormone to normal function is difficult to establish, however, because both LH
pulsatility and blood IGF-1concentrations increase during the postpartum period
when nutrient and feed intake of animal is improved.
IGF-1, a potent stimulator of cellular proliferation, differentiation and
development, regulates granulosa cell steroidogenesis and apoptosis during
follicular development as well as having acute anabolic effects on protein and
carbohydrate metabolism (Jones and Clemmons 1995; Hossner et al., 1997).
IGF-l plays a central role in these interactions with respect to both
steroidogenesis and survival responses (Adashi and Roban 1992; Giudice 1992;
Armstrong and Webb 1997). The most important role of IGF1 appears to be
reliant on its ability to synergize with gonadotrophins and to amplify their
steroidogenic output (Urban et al., 1990 and Balasubramanian et al., 1997).
There are, differences in these responses with respect to different species
(deMoura et al., 1997; Chung et al., 1998; Devoto et al., 1999; Mamluk et al.,
1999; Silverman et al., 1999), cows are mono ovulatory species. At regular
intervals during the bovine oestrous cycle, a group of small antral follicles grow
rapidly from about 1 to 5 mm in size. Growth during this phase is dependent on
gonadotrophin secretion, follicular function and also influenced by a variety of
14
growth factors. Among these, IGF1 and insulin are of key importance in the cow
as they can link follicular growth and steroid production with the metabolic status
of the animal (Spicer and Echternkamp, 1995; Wathes et al., 2003). In
ruminants, the major source of IGF-l in follicular fluid is the circulatory IGF-l
(Funston et al., 1996 and Perks et al., 1999) and there is substantial evidence
that follicular maturation is compromised when cows are in negative energy
balance and circulating concentrations of IGF-l and/or insulin are reduced
(Wathes et al., 2003).The IGF-1receptor has been localized in bovine oocytes,
cumulus cells, and in both granulosa and theca cells (Nuttinck et al., 2004; Sudo
et al., 2007). Wathes (2008) reported delays or failure of conception in post
partum dairy cows are associated with reduced IGF-1concentrations and either
higher or lower urea values.
2.3 HAPTOGLOBIN (Hp)
Acute phase protein (APP) refer to group hepatic glycoprotein which are
stimulated by inflammatory mediators and respond to an initial reaction of
infection or trauma in the animals. Hp is one of the most specific APP in cattle
(Alsemgeest et al., 1994; Salonen et al., 1996).
Haptoglobin is an α2-globulin with a molecular weight approximately 125
Da. It has a four chain structure, (αβ)2, linked by disulfide bonds (Putnam, 1975).
It was first described as a proteinaeous substance with the ability to increase the
stability of the peroxidase activity of hemoglobin at low pH (Polonovski and Jayle
1939). It has a four chain structure, (αβ)2, linked by disulfide bonds. Bovine Hp
was found to consist of monomers of 16 to 23 kDa (α-chains) and 35 to 40 kDa
(β-chains) (Eckersall and Conner 1990 and Morimatsu et al., 1991) and to exist
as a polymer in association with albumin with a molecular weight above 1000 Da
in cattle serum (Eckersall and Conner, 1990). A macromolecular protein in
bovine acute phase serum with a molecular weight of 1000 to 2000 Da has been
isolated and characterized as Hp (Morimatsu et al., 1991). This protein is present
at a basal level (≤200 ng/ml) in normal bovine serum. Large and heterogenous
molecular sizes with different degrees of polymerisation have also been reported
(Morimatsu et al., 1992).
15
2.3.1 Biological functions of haptoglobin (Hp)
The acute phase response (APP) is thought to be part of a general
defense response towards tissue injury (Gauldie et al., 1989). It is generally
accepted that the acute phase response induced fever and slow-wave sleep is in
some way beneficial to an organism under physical stress (Kluger et al., 1975).
A number of the common APP (i.e. those that are acute phase proteins in most
species) are likely to participate directly in the protection of the host. Conner and
Eckersall (1988) reported that Hp concentration may increase up to 100 fold
within 24 hrs of induced localized inflammation in cattle.
Numerous functions of Hp have been proposed, but the primary function
of Hp is to prevent the loss of iron by the formation of very stable complexes with
free hemoglobin in the blood (Keene and Jandl, 1965 and Putnam, 1975).
Hp is thus believed to have a bacteriostatic effect by restricting the
availability of iron necessary for bacterial growth (Eaton et al., 1982). For
example, human Hp was shown to inhibit the growth of Streptococcus pyogenes
in vitro (Delange et al., 1998). Hp has also been associated with bacterial
contamination of the uterus and delayed uterine involution (Sheldon et al., 2001).
A number of investigations indicate the ability of Hp as specific markers of
clinical and subclinical infections, to discriminate between acute and chronic
disease and for prognostic purposes, since the duration and magnitude of the
response reflect the severity of the disease and the effect of treatment (Skinner
et al., 1991; Horadagoda et al., 1999; Hultén et al., 1999; Petersen et al., 2002;
Hultén and Demmers, 2002; Lauritzen et al., 2003).
However, others have reported that Hp concentrations remain low in
acute postpartum metritis and high concentrations are seen only in cases of
severe metritis (Hirvonen et al., 1999). In dairy cows with toxic puerperal metritis,
antimicrobial therapy is associated with a decrease in serum Hp concentration
(Smith et al., 1998). In cattle, Hp has been proposed as an immunomodulator
(Murata and Miyamoto, 1993).
Uchida et al. (1993) suggested that only a negligible or low basal value of
Hp was detectable in normal bovine serum, but Hp could be induced by an acute
16
phase response such as inflammation, transportation, exhaustation, stress or
starvation.
2.4. LACTOFERRIN
Lactoferrin is an iron-binding glycoprotein belonging to the transferrin
family and is present in secondary granules in neutrophils and milk and is
released upon neutrophil activation (Furmanski and Li 1990; Baker and Lindley
1992; Crocker et al., 2000).
Lactoferrin (LF) is an 80kDa iron-binding glycoprotein that is a component
of the innate immune system and found in many body fluids and secretions
(Shugars et al., 2001).
LF exhibits diverse biological activities ranging from activation of innate
immunity (Miyauchi et al., 1998), to direct microbicidal activity (Ellison, 1994). LF
has been reported to bind to membranes of platelets (Mazurier et al.,1994) ,
monocytes/ macrophages (Birgens, 1994), eosinophils (Thomas et al., 2002),
Exposure of these cells to LF modulates subsequent cellular functions such as
cytokine gene activation (Crouch et al.,1992), cytotoxicity (Shau et al.,1992), and
cell maturation, and a number of immunopotentiating activities (Zuccotti et al.,
2006). Further, direct receptor mediated interactions have been demonstrated
via LF exposure to bacteria, parasites, and viruses, generally resulting in
microbicidal effects (Yu and Schryvers, 2002). Thus LF may play a broad but key
role in resistance to many types of diseases. Among its many roles, lactoferrin
has been reported to have antibacterial, anti-fungal, anti-tumor, antiinflammatory,
and immuno-modulatory properties (Vogel et al., 2003).
Antibacterial properties - Since neutrophils are the primary source of serum
LF, are the first to respond to monocyte: macrophage induced up-regulation of
adhesion molecules and leukocyte chemotaxis, lactoferrin is rapidly mobilized to
sites of infection (Valenti and Antonini 2005). Iron availability is important for the
growth of bacterial pathogens and has been strongly correlated with bacterial
virulence. It is also required for several aspects of microbial metabolism (electron
transport, cellular growth and division, and enzymatic pathways) (Arnold et al.,
1982). These phenomena have been repeatedly demonstrated in pathologic
situations where bacterial overgrowth occurs in the face of high serum iron
17
concentrations (Arnold et al., 1982). Given its iron-withholding ability, LF was
initially assigned its antibacterial role based on its iron-chelating ability (Valenti.
and Antonini 2005).
Anti-inflammatory properties - A major topic of debate over the years has
been the question of whether lactoferrin truly has an antiinflammatory role. There
is evidence that it is synthesized de novo by neutrophils during inflammation
(Baynes and Bezwoda, 1994; Steijns and van Hooijdonk, 2000).
Lipopolysaccharide the non-proteinaceous element of the outer membrane of
gram-negative organisms is a potent stimulator of inflammation (Baveye et al.,
2000). Central to the inflammatory response is stimulation of the host’s innate
immune cells and the endothelium to secrete pro-inflammatory cytokines and up
regulate the expression of adhesion molecules, respectively. The attraction of
inflammatory cells to activation sites leads to the development of deleterious
effects.
The strong association between lactoferrin concentration and incidence of
clinical and subclinical mastitis in dairy cows suggested that lactoferrin may play
an important role in host defense against microbial infection (Kawai et al., 1999;
Hagiwara et al., 2003).
During inflammation and in some pathological conditions, LF levels of
biological fluids may greatly increase. This is particularly noticeable in plasma
where LFconcentration can be as low as 0.4–2 mg/l under normal conditions but
increases to up 200 mg/l in septicaemia (Bennett and Kokocinski, 1978; Maaks
et al., 1989).
2.5 BLOOD PROFILE AND REPRODUCTION:
2.5.1 Plasma calcium:
Ovulatory disturbance is one of the major causes of repeat breeding in
crossbred dairy in India (Ibraheem and Ramachandran 2003). Mineral imbalance
or deficiencies may be cause repeat breeding in cattle (Rupde et al., 1993; Das
et al., 2002). The deficiency of a particular element may influence the level of
other elements in the body fluid and the functional characteristics of endocrine
glands, especially the hypophyseal-gonadal axis (Bhaskaran and Abdullakhan
1981).
18
Calcium (Ca) plays an important role in gonadotropic regulation of ovarian
steroidogenesis (Carnegie and Tsang 1984) and regulation of the membrane
potential of oocytes. Calcium plays an important role in the utilization of
cholesterol by mitochondria or by stimulating the conversion of pregnenolone to
progesterone. GnRH stimulation of LH release from pituitary cells involves a Ca-
dependent mechanism (Carnegie and Tsang 1984). Das et al. (2009) reported
significant (p <0.01) decrease in plasma level of calcium among crossbred cattle
with repeat breeding problem.
The role of calcium and phospholipid-dependent protein kinase and c-
AMP-dependent protein kinase may be crucial in mediating the hormone action.
Peracchia (1978) suggested that Ca is involved in the disruption of cumulus cell
cohesiveness by regulating the number of gap junctions between the cells which
contributes to the process of ovulation. Moreover, a disturbed calcium-
phosphorus ratio has a blocking action on the pituitary gland and consequently
on the ovarian function (Herrick and John, 1977).
Patel et al. (2008) reported that oestrus group had a significantly higher
calcium level at 7th, 8th, 17th and 21st week postpartum in comparison to
anoestrus problems group in Holstein Friesian cows.
2.5.2 Plasma glucose
Glucose, one of the nutrients apparently enhanced postpartum cyclicity
and reproductive performance by increasing the energy status of the animals
and thus stimulated the ovarian follicular growth and luteal functions (Highshoe
et al., 1991; Wehrman et al., 1991). Glucose is major source of energy for the
ovarian steriodogenesis (Rabiee et al., 1997, 1999) and in oocytes (Down et al.,
1996)
Jani et al. (1995) reported high incidence of repeat-breeding and
anoestrous are associated with the low plasma glucose level.
Parmer et al. (1986) reported greater concentration of glucose during the
luteal phase in repeat breeders. El-Belely (1993) suggested that lower
concentration of glucose might be the reason for reduced luteal function in
repeat breeding cows.
19
Richards et al. (1989) reported higher blood glucose concentration
increases progesterone production by increasing pulse and mean concentration
of LH. JoeArosh et al. (1998) suggested that hypoglycemic condition in repeat
breeder causes impaired hypothalamic hypophysial ovarian axis and reduce
ovarian activity. Miyoshi et al. (2001) suggested that cows with higher plasma
glucose concentration will have better ovarian activity. Hence in the present
study, RB group of animals had lower glucose concentration which might have
affected ovarian activity and might have decreased conception rate.
Higher blood glucose concentrations directly increased the progesterone
production by increasing the pulse and mean concentration of LH (Richards et
al., 1989) Poor energy status in repeat breeders due to hypoglycemia could be
the reason for impaired hypothalamic hypophyseal ovarian axis and reduced
ovarian activities (Joe Arosh et al., 1998).
Khan et al. (2010) reported showed significantly higher (P < 0.01) glucose
levels on day 5 of the cycle (50.31±4.19 mg/dl) and day 10 (45.60±6.60 mg/dl),
whereas significantly lower (P = 0.01) level (30.93±4.39 mg/dl) was recorded on
day 20 of the oestrous cycle when compared to day 5 and 10 of the cycle in the
repeat breeding cows.
2.5.3 Plasma urea
According to Dhali (2001) increased blood urea nitrogen concentration
results into negative energy balance. Greater serum or plasma urea nitrogen
concentration reduces LH binding to ovarian receptors, leading to decrease in
serum progesterone concentration and pregnancy rates.
In dairy cows the excess dietary protein increases blood urea level, alters
uterine fluid composition, decreases uterine pH and reduces conception rates
(Elrod and Butler, 1993; Elrod et al., 1993).
Elrod and Butler (1992) suggested that lower uterine pH may not directly
affect the developing embryo, but may alter the availability of ions to the embryo,
thereby affecting hormone receptor interactions, or amino acid, glucose or
lactate uptake by the embryo. It is also possible that changes in ion
concentrations may increase free radical challenge to the conceptus.
20
It has been observed that increased plasma urea concentration may
interfere with the normal inductive actions of progesterone on the
microenvironment of the uterus and, thereby, cause suboptimal conditions for
support of embryo implantation (Hamman et al., 2000 and Papadopoulas et al.,
2001).
Dhali et al. (2006) showed a positive relationship between the milk urea
concentration and interval from parturition to first service.
The conception rate to first service was registered as 68% (WestWood et
al., 1998) with plasma urea nitrogen concentration of approximately 23 mg/dl. In
virgin heifers the poor first service conception rate (82% vs. 61%) has been
found when the peak plasma urea values have increased from 17.5 to 23.6
mg/dl (Elrod and Butler, 1993).
Elrod and Butler (1993) have reported that the conception rate decreases
considerably when plasma urea nitrogen concentration exceeds 16 mg/dl. They
have recorded the conception rate of 87.5% and 42.8% with the plasma urea
nitrogen concentration of <9 mg/dl and >16 mg/dl, respectively.
Ferguson et al. (1993) have suggested that the likelihood of conception
rate decreases with increasing serum urea nitrogen level greater than 20 mg/dl.
Butler et al. (1996) have found the mean pregnancy rate of 68% and 47% with
the milk urea nitrogen concentration <19 mg/dl and >19 mg/dl, respectively.
Ferguson et al. (1993) have also reported that the 21 mg/dl plasma urea nitrogen
is high enough to depress the pregnancy rate.
2.6 NEUTROPHILS
Neutrophils are the most abundant cell type among circulating white cells
and pivotal effector cells in the innate immune response. They are phagocytic
cells that participate in inflammatory reactions as a first line of defense against
invading micro-organisms. They are terminally differentiated and normally have a
very short lifespan (8–20 hr) in circulation and in tissue (1–4 days). Neutrophils
are recruited to sites of inflammation by chemoattractants such as interleukin-8
(IL8). They contribute to the early innate response by rapidly migrating into
inflammed tissues, where their activation triggers microbicidal mechanisms such
as release of proteolytic enzymes and antimicrobial peptides, and rapid
21
production of reactive oxygen species (ROS). Neutrophils function in the innate
response through killing of pathogens by both oxidative and non-oxidative
mechanisms. In addition, neutrophils have a role in stimulation of adaptive
responses producing a variety of chemokines, cytokines and some granule
proteins that are chemotactic not only for neutrophils but for monocytes,
immature dendritic cells and T cells. Thus, activated neutrophils kill
microorganisms but also influence the local milieu through actions both on
immune and epithelial cells, with pro-inflammatory or regulatory effects (Ross et
al., 2006; Nathan, 2006).
Regulation of the neutrophil life span by apoptosis is a crucial process in
the resolution of inflammation, and alterations of apoptosis in neutrophils.
Neutrophils are programmed for spontaneous apoptosis (the intrinsic apoptotic
route). In these cells, this mechanism of apoptosis has special features, probably
due to peculiarities of neutrophil mitochondria, which are pivotal for apoptosis
(Simon, 2003). Importantly, neutrophil apoptosis is highly regulated. Extrinsic
pathway is mainly stimulated by death-inducing receptors belonging to the tumor
necrosis factor (TNF)/nerve growth factor (NGF) receptor super-family, such as
Fas, TNF-related apoptosis inducing ligand (TNFSF10) receptors, TNFRSF9
(CD137), and the type I TNF receptor (Simon, 2003).
Accelerated neutrophils death leads to a decrease of neutrophil counts
(neutropenia), augments the chance of contracting bacterial or fungal infections,
and impairs the resolution of such infections. On the other hand, delayed
neutrophil death elevates neutrophils counts (neutrophilia), which is often
associated with bacterial infection, myeloid leukemia, and acute myocardial
infarction (Akgul et al.,2001 and Maianski et al., 2004).
2.6.1 Apotosis of neutrophils
Apotosis of neutrophil is also an essential cellular event for maintaining
neutrophil number during infection and inflammation. Neutrophils are recruited to
the infected tissues to engulf, kill, and digest invading microorganisms. However,
the enzymes and reactive oxygen species (ROS) released by neutrophils can
also damage the surrounding tissues (Murray et al., 1997). To prevent senescent
neutrophils from releasing their toxic contents, these cells become apoptotic and
22
are then recognized, engulfed, and cleared by professional phagocytes such as
tissue macrophages. This safe clearance provides a mechanism of reducing the
number of viable and activated neutrophils without releasing the potentially
harmful enzymes and ROS, thereby facilitating the resolution of inflammatory
response. Delayed death and clearance of neutrophils in tissues causes
unwanted and exaggerated inflammation. Finally, neutrophil apotosis contributes
to neutrophils’ pathogen killing capability. It is an essential step for the
generation and release of neutrophils extracellular traps (NETs), extracellular
structures composed of chromatin, and granule proteins that bind and kill
invading microorganisms. This mechanism allows neutrophils to fulfill their
antimicrobial function even beyond their life span (Simon, 2003). Thus,
regulation of the neutrophil life span by apoptosis is a crucial process in the
resolution of inflammation, and alterations of apoptosis in neutrophils. In these
cells, this mechanism of apoptosis has special features, probably due to
peculiarities of neutrophil mitochondria, which are pivotal for apoptosis (Simon, 2003). Importantly, neutrophil apoptosis is highly regulated. Extrinsic pathway is
mainly stimulated by death-inducing receptors belonging to the tumor necrosis
factor (TNF)/nerve growth factor (NGF) receptor super-family, such as Fas, TNF-
related apoptosis inducing ligand (TNFSF10) receptors, TNFRSF9 (CD137), and
the type I TNF receptor (Simon, 2003).
Various proapoptotic and antiapoptotic signals at the site of inflammation
can interact on neutrophils and regulate their survival (Hughes and Piontkivska,
2008). Neutrophil apoptosis occurs through two main pathways (Fanning et al.,
1999), one that is mediated via exogenous death receptor signaling (Liles et al.,
1996) and the other that occurs spontaneously through mitochondrial membrane
changes under the influence of Bcl-2 family proteins (Lin et al., 1996). Fas (also
called CD95/APO-1) is a type I membrane glycoprotein belonging to the TNF-
receptor superfamily of molecules. Death signals are initiated in neutrophils when
Fas becomes trimerized upon interaction with its ligand, Fas ligand (FasL).
Activation of Fas receptor by FasL recruits numerous death-domain-containing
proteins to the cytoplasmic death domain of Fas, and these act as adaptor
molecules for the ultimate recruitment and activation of caspase 8 to initiate
apoptosis signaling via a variety of mechanisms (Schulze-Osthoff et al.,1998;
23
Sharma et al., 2000; Kuijpers 2002). Ultimately, caspase 8 activation results in
cleavage of proteins involved in cytoskeletal maintenance and DNA repair, leading
to membrane blebbing, nuclear condensation and collapse, and irreversible cell
death (Robertson et al., 2000 and Zimmermann et al., 2001). Fas receptor and
FasL are constitutively coexpressed in human blood neutrophils, rendering the
cells highly sensitive to apoptosis (Liles et al., 1996).
2.7 Fas GENE
Neutrophil apoptosis occurs through two main pathways (Fanning et al.,
1999), one that is mediated via exogenous death receptor signaling (Liles et al.,
1996) and the other that occurs spontaneously through mitochondrial membrane
changes under the influence of Bcl-2 family proteins (Lin et al., 1996). In the
current study, we chose to examine the main exogenous death receptor of
neutrophils, Fas. Fas (also called CD95/APO-1) is a type I membrane glycoprotein
belonging to the TNF-receptor superfamily of molecules. Death signals are
initiated in neutrophils when Fas becomes trimerized upon interaction with its
ligand, Fas ligand (FasL). Activation of Fas receptor by FasL recruits numerous
death-domain-containing proteins to the cytoplasmic death domain of Fas, and
these act as adaptor molecules for the ultimate recruitment and activation of
caspase 8 to initiate apoptosis signaling via a variety of mechanisms (Schulze-
Osthoff et al., 1998; Sharma et al., 2000). Ultimately, caspase 8 activation results
in cleavage of proteins involved in cytoskeletal maintenance and DNA repair,
leading to membrane blebbing, nuclear condensation and collapse, and
irreversible cell death (Robertson et al., 2000 and Zimmermann et al., 2001). Fas
receptor and FasL are constitutively coexpressed in human blood neutrophils,
rendering the cells highly sensitive to apoptosis (Liles et al., 1996).
2.7.1 Mechanisms of neutrophils apoptosis activated by death receptors (Fas)
Death receptors are cell surface receptors that transmit apoptosis signals
initiated by specific death ligands given by Ashkenazi and Dixit, 1998 in Figure
2.3. They include TNFRs, Fas (Apo-1/CD95), DR3 (Apo-3/TRAMP), DR4
(TRAIL-R1), DR5 (TRAIL-R2) and DR6. The two best-characterised death
receptors, TNFR1 and Fas, are both transmembrane protein members of an
24
expanding TNF nerve growth factor (NGF) family that signals for apoptosis in
many cell types (Ashkenazi and Dixit,1998), including neutrophils (Liles et al.,
1996; Murray et al., 1997). Each death receptor contains cysteine-rich
extracellular domains and a motif in the cytoplasmic region termed a ‘death
domain (DD)’ (Ashkenazi and Dixit, 1998). Death domains are mainly involved in
protein-protein interactions and connect the receptors with the components of
the intracellular apoptosis machinery. Associations between death domains
occur upon receptor-ligand binding and these interactions are necessary for
initiation of apoptosis (Ashkenazi and Dixit, 1998; Nagata, 1997). FasL is the
ligand for Fas and is a homotrimeric molecule. Binding of Fas with trimeric FasL
leads to cross-linking of three receptor molecules resulting in clustering of
intracellular death domains. The association of receptor death domains induces
the recruitment of adaptor proteins (Ashkenazi and Dixit, 1998 and Nagata,
1997). The major adaptor protein is the Fas-associated death domain-containing
protein (FADD), and recruited FADD associates with the activated receptor
through its own death domains. FADD also contains a ‘death effector domain’
(DED) that allows its interaction with procaspase- 8 via its respective DEDs.
Fas/FADD/pro-caspase-8 together form a protein complex called the
‘deathinducing signalling complex’ (DISC) (Medema et al., 1997). Pro-caspase-
has been suggested to be activated according to the ‘induced proximity model’ in
which caspase precursor aggregation mediated by FADD induces
autoprocessing and autoactivation through cross-cleavage (Muzio et al., 1998).
Indeed, gene knock-out experiments in mice in which FADD is deleted have
shown that FADD is one of the essential components of the apoptosis machinery
induced by FasL and TNF-a (Ashkenazi and Dixit, 1998), TNF-a, a trimeric
molecule, is the ligand for TNF receptors. Exposure of cells to TNF-a can induce
multiple effects including cell differentiation, proliferation, apoptosis and other
pro-inflammatory effects. TNF binding induces trimerisation of TNFR1 bringing
the death domains of the receptors into close proximity (Ashkenazi and Dixit,
1998; Nagata, 1997). Subsequently, TNFR-associated death domain-containing
proteins (TRADDs) bind to clustered receptors via their respective DDs. TRADD
can also associate with other secondary adaptor molecules including TNFR-
associated factor-2 (TRAF2) and receptor-interacting protein (RIP) leading to the
activation of the transcription factors, NF-kB and AP-1 (Ashkenazi and Dixit
25
1998; Nagata, 1997). However, TRADD can also associate with FADD, thereby
inducing the activation of pro-caspase-8 which leads to apoptosis (Ashkenazi
and Dixit, 1998 and Nagata, 1997). Whilst TNF-a can induce apoptosis through
TNFR1 in some cell types including neutrophils (Murray et al., 1997), triggering
the activation of NF-kB and AP-1 may induce the expression of survival factors,
thereby providing resistance against apoptosis (Ward et al., 1999; Zong et
al.,1999). In this respect, TNF-a is a bifunctional molecule and the response of a
cell to this agent probably depends upon interplay between pro- and anti-
apoptotic signaling effects.
2.8 TOLL LIKE RECEPTOR 4 (TLR-4) The term TOLL originally referred to a cell surface receptor governing
dorsal/ventral orientation in the early Drosophila larvae (Stein et al., 1991). A
variety of proteins homologous with toll-like receptors have been identified in
humans (Rock et al., 1998 and Takeuchi et al., 2000). TLR-4 is a type 1
transmembrane protein with an intracellular domain homologous to that of the
humans IL1 receptor (Medzhitov et al., 1997). Bovine TLR gene was discovered
by White et al. (2003). Bovine TLR-4 shares genomic structure with human and
mouse counterparts. The overall length of bovine TLR-4 is 11kb, which is
comparable to 10 kb for human and 14 kb for mouse. Most of the differences in
length are found in length of the introns. Toll and TLR family proteins are
characterized by the presence of two primary motifs. An extracellular domain
with leucine rich repeats (LRR) and an intracytoplasmic region containing a
TOLL/ interleucine receptor (TIR) signaling (Rock et al., 1998). Bovine TLR-4
protein consists of 841 amino acids, of which 1 - 23 amino acids form signal
peptide, 24 - 634 amino acid are outside the membrane, 635 - 657 amino acids
are transmembrane helices structure and 658 - 841 amino acids are inside the
membrane (Wang et al., 2007). Interleukin shows various biological actions but
most important action is to recruit and activate neutrophils to site of acute
inflammation (Harada et al., 1994). Neutrophils display several Toll-like receptors
on their surfaces.TLR-4 detects the lipopolysaccharide present on the cell wall of
gram negative microbes. TLRs on the surfaces of macrophages recognize
microbial components, such as LPS, peptidiglycans, and flagellin and cytokine
receptors detect cytokines released by other cells as part of the inflammatory
response.
26
Figure 2.3 Apoptosis signaling through death receptors.
Activation of TLRs can increase the phagocytic activity of macrophages
and neutrophils and change their physiology in ways that increase their ability to
kill and clear pathogens. Overall, recognition of LPS and initiation of signaling by
TLR-4 is a complex process, which involves several accessory proteins. LPS is
first bound by circulating lipopolysaccharide-binding protein (LBP), which
functions as an opsonin for CD14 (Schumann et al., 1990). CD14 then acts as a
catalyst for the binding of LPS to MD-2 (Wright et al., 1990). After the LPS is
transferred to MD-2, the LPS/MD-2 complex interacts with TLR4. Downstream
signaling by the TLR-4 receptor involves several intercellular TIR domain-
containing adaptors mediating proinflammatory gene expression (O’Neill and
Bowie, 2007; Vogel et al., 2003).Two pathways that initiate downstream TLR-4
signaling are known, namely, the MyD88- and TRIF-dependent pathways.
Sensing the presence of bacteria is an important function of the innate immune
system, and a prerequisite for an adequate immune response. Toll-like receptors
(TLR) have been identified as crucial molecules for detection of invading
pathogens and induction of host defense mechanism (Werling et al., 2006). Each
TLR distinguishes between specific patterns of microbial components, so-called
pathogen-associated molecular patterns.
2.8.1 Expression of TLR-4 Gene in different cells. TLR-4 gene is located on the surfaces of macrophages, neutrophils,
dendritic cells and natural killer cells. Neutrophils display several Toll-like
receptors on their surfaces.TLR-4 detects the lipopolysaccharide present on the
cell walls of gram – negative microbes. TLRs on the surfaces of macrophages
recognize microbial components, such as LPS, peptiglycans, and flagellin and
cytokine receptors detect cytokines released by other cells as part of the
inflammatory response (Janeway et al., 1999). Antigen-presenting cells (APC),
such as monocytes and dendritic cells (DCs), express TLR on their surface,
which recognize and bind these PAMPs and initiate a signalling pathway that
stimulates the host defences through the induction of reactive oxygen and
nitrogen intermediates (ROIs and RNIs) , respectively. The TLR-PAMP
interaction also initiates adaptive immunity as it activates APCs by inducing
production of pro- inflammatory cytokines and up- regulating co- stimulatory
molecules. Moreover , TLR signalling stimulates the maturation and migration
27
of APCs to the draining lymph nodes as observed in mice, although this
migration seems to be more constitutive in ruminants (Haig et al., 1999).
2.8.2 Neutrophils and TLR-4 gene Polymorph nuclear neutrophils (PMN) are key components of the first line
of defense against microbial pathogens (Babior, 1984). They contribute to the
early innate response by rapidly migrating into inflamed tissues, where their
activation triggers microbicidal mechanisms such as release of proteolytic
enzymes and antimicrobial peptides, and rapid production of reactive oxygen
species (ROS). PMN activation is initiated upon recognition of Ab- or
complement-opsonized particles (Greenberg and Grinstein 2002). PMN also
directly recognize microbial products via pattern recognition receptors such as
TLR (Medzhitov, et al., 1997). Ten human TLRs have so far been identified,
mediating responses to pathogen-associated molecular patterns (PAMPs)
shared by many microorganisms. Human PMN have been reported to express
all TLRs except TLR3 (Hayashi, et al., 2003). TLRs are members of the IL-1R
superfamily and share a common activation pathway mediated by their Toll/IL-
1R signaling domain, resulting in activation of NF-B and MAPK (Beutler, 2000).
Despite these shared pathways, TLRs probably show differences in their rate,
intensity, or efficiency of activation, involving unidentified mechanisms. Selective
pathways are reported to be triggered by some TLRs; in particular, TLR2, TLR4,
and TLR9 can activate the PI3K pathway (Yum, et al 2001; Strassheim, et al.,
2004). Activation of cell signaling cascades triggers immune responses leading
to pathogen eradication. PMN are usually short-lived immune cells, but the
prolongation of their life span is critical in their efficiency against pathogens
(Haslett, et al., 1994). PMN activation and survival is likely to be tightly regulated,
as the cytotoxic substances they release can damage adjacent healthy tissue
(Savill, et al., 2002). Many inflammatory mediators, including cytokines, regulate
cell survival by interfering with apoptosis (Murray et al., 1997; Moulding et al.,
1998; Cowburn et al., 2002). Regulation of PMN survival has been widely
studied but remains to be fully elucidated. Increase in TLR-4 expression in
neutrophils during bacterial infection reported by Wolfram et al. (2008) and
Goldammer et al. (2004).
28
CHAPTER –3
MATERIALS AND METHODS
MATERIALS AND METHODS
The present investigation was conducted on Karan-Fries crossbred cattle
reared at cattle yard, National Dairy Research Institute (NDRI) Karnal, Haryana,
India. The study was also conducted at field level reared by farmers of Darar and
Indri villages of Karnal District, Haryana from August 2010 till November, 2011.
3.1 Location of the study area and climate
Geographically Karnal is situated at an altitude of 250 meters above the
mean sea level (Indo-Gangetic alluvial plains) on 290 42// N latitude and 790 54// E
longitude. Darar village is situated at an altitude of 252 meters above the mean
sea level (Indo-Gangetic alluvial plains) on 290 41// N latitude and 790 53// E
longitude. Geographically Indri is situated at an altitude of 249 meters above the
mean sea level (Indo-Gangetic alluvial plains) on 290 42// N latitude and 790 54// E
longitude. The maximum ambient temperature of study area in summer goes up
to <42oC and minimum temperature in winter comes down to <4oC with a diurnal
variation in the order of 15-20oC. The annual rainfall is about 760 to 960 mm,
most of which is received during the month of July and August. Relative humidity
range from 41 to 85 percent (www. weather-forecast.com/locations/karnal).
3.2 Selection and grouping of experimental animals
Recently calved Karan Fries female cattle free from clinical reproductive
tract infections, clinical mastitis, any injury and of 2-3 Parity with Body weight
range 400-460 Kg and milk yield- (7-15 Kg/day) were selected under farm and
field conditions. The animals were monitored for reproductive performance post
partum and were grouped as follows. After selection, all the post partum cows
were monitored up to three consecutive services. Pregnancy diagnosis by rectal
palpation post 45-60 day after each service was done. Animals conceiving up to
three services were considered as regular breeders (RgB) and those that did not
conceive up to three services were considered as repeat breeders (RB). For
RgB group 6 animals were selected and for RB group 14 animals were selected
under both farm and field conditions. Based on conception rate further selected
RB group of animals was divided into two groups a) supplemented with
fermented yeast culture (RB-S) b) Non supplemented (RB-NS). To RB-S group
fermented yeast culture (Saccharomyces cerevisiae; Make Diamond XP) was
supplemented with concentrate @ 12 gm/animal twice daily (5.3 × 105 CFU/g)
during experimental period (21st - 40th week).
All animals were confirmed to be pregnant by 23rd week in RgB group,
where as in RB group none of the animals conceived to 3 services (by AI) till 21st
week under both farm and field conditions.
3.3 Chemicals, glassware and plasticware
Chemicals and utensils required for blood collection and chemical
analysis were purchased from Sisco Research Laboratories., New Mumbai.
3.4 Collection of blood samples
Blood (10 ml) was collected in sterile heparinised vacutainer tubes by
jugular vein puncture, posing minimum disturbance to the animal during
collection. Blood samples were collected at weekly intervals from selected
animals under both farm and field conditions. Blood samples from pregnant
animals were not taken after confirmation of pregnancy by rectal palpation. Immediately after collection, the samples were transported to the laboratory in
ice for further processing.
3.5 Feeding under farm and field conditions.
All cows were fed to meet the nutritional requirements as per NRC (1989)
standards. During postpartum period cows were fed ad lib (at least 15% in
excess of requirement) available green fodders, predominantly, Maize and Jowar
and to some extent Berseem, limited amount of wheat straw as roughage and
concentrates based on body weight and production level of milk. Concentrates
was fed to the individual cow in two major installments, first of which was offered
between 8.00 to 9.00 am. in the morning after weighing of residue left of the
previous day and the second installment was fed between 4.00-5.00 pm. in the
evening before filling their respective feeding manger with another installment of
fodder. Feeding schedule of individual animals was revised at monthly interval
and was reformulated on the basis of body weight of the animal and the milk
yield. The amount of feed and fodder and concentrate offered and residue left by
the individual animals were recorded daily and computed weekly.
30
Table 3.1 Details of experimental animals under farm conditions
Regular Breeder (RgB)
Sr. No. Animal No. Date of Calving Parity Body Weight (Kg)
1 6625 12.03.10 2 395
2 6751 16.04.10 2 415
3 6791 19.03.10 3 380
4 6880 02.05.10 3 400
5 6453 09.04.10 2 412
6 6741 11.04.10 3 392
NonSupplemented Repeat Breeder (RB-NS)
Sr. No. Animal No. Date of Calving Parity Body Weight( Kg)
7 6650 09.04.10 2 395
8 6817 12.03.10 2 401
9 6931 07.05.10 3 380
10 7045 11.03.10 3 400
11 7028 02.04.10 3 408
12 6333 08.04.10 2 392
13 6726 29.03.10 3 385
Supplemented Repeat Breeder (RB-S)
Sr. No. Animal No. Date of Calving Parity Body Weight(KG)
14 6647 21.03.10 2 400
15 6670 19.04.10 3 403
16 6903 25.03.10 2 397
17 6669 16.04.10 3 376
18 5853 02.05.10 2 407
19 6885 03.04.10 3 394
20 6553 30.03.10 3 389
Table 3.2 Details of experimental animals under field conditions
Regular Breeder (RgB)
Sr.
No. Animal No. Name of owner/village Date of Calving Parity
Body
Weight (Kg)
1 RgB 1 Joga Singh/Darar 12.06.10 3 386
2 RgB 2 Gurulal Singh/Darar 23.08.10 2 392
3 RgB 3 Rakesh Kumar/Darar 09.07.10 3 404
4 RgB 4 Deelip Singh/Darar 03.07.10 3 380
5 RgB 5 Amardeep Singh/Darar 09.08.10 2 406
6 RgB 6 Sompal Singh/Darar 11.07.10 3 384
Non Supplemented Repeat Breeder (RB-NS)
7 RB-NS 1 Jasvir Singh/Darar 19.06.10 2 397
8 RB-NS 2 Balvant singh/Darar 07.08.10 2 386
9 RB-NS 3 Amareet Pal/Darar 13.07.10 3 377
10 RB-NS 4 Darampal Singh/Darar 12.07.10 3 388
11 RB-NS 5 Malvinder Singh/Darar 23.08.10 3 376
12 RB-NS 6 Sompal Singh/Indri 24.06.10 2 392
13 RB-NS 7 Pawan Kumar/Indri 08.07.10 3 402
Supplemented Repeat Breeder (RB-S)
14 RB-S 1 Amanjeet Singh/Darar 16.06.10 2 393
15 RB-S 2 Harbhajan singh/darar 29.06.10 3 398
16 RB-S 3 Karnal Singh/Darar 11.07.10 3 409
17 RB-S 4 Raj Singh/Darar 18.08.10 2 394
18 RB-S 5 Pyarelal/Darar 25.07.10 3 391
19 RB-S 6 Rupesh Kumar/Indri 22.07.10 3 389
20 RB-S 7 Rajesh Kumar/Indri 28.08.10 2 381
Picture 3.1. RB-S animal under Darad village conditions
Picture 3.2 RB-S animal under Darad village conditions
Table 3.3 Composition of concentrate feed supplemented to animals
Components of concentrate Per 100 kg
Maize 30 parts
Deoiled mustard cake 25 parts
Soyabean extraction 10 parts
Wheat bran 10 parts
Deoiled rice bran 15 parts
Molasses 7 parts
Mineral mixture 2 parts
Common salt 1 part
3.6 Estimation of feed intake
The daily feed intake was estimated by subtracting the amount of refusals
from the amount of feed offered. During feeding trial, the amount of feed and
fodder and concentrate offered and residue left by the individual animals were
recorded daily and computed on weekly basis.
3.6.1 Analysis of feed and fodder samples
Samples of green fodders and concentrate mixture being fed and residues left
were analyzed for dry matter (DM) every week.
3.7 Recording of body weight
The body weight of the animals were recorded initially at start of experiment and
then at monthly intervals till the end of the experimental period under farm and
field conditions. Body weight of each animal was recorded early in the morning
between 7.30 am to 8.30 am on an electronic weighing scale before providing
feed to the animals.
3.8 Recording of milk yield
Milking of cows was mainly done by machine milking thrice daily at 5:00
am, 12: 00 noon and 7:00 pm, till the end of the experimental period under farm
and field conditions. The individual milk yields (kg) were recorded at each
milking.
31
3.9 Estimation of plasma parameters
3.9.1 Estimation of blood plasma haptoglobin (Hp):
Haptoglobin was estimated as per the instructions provided with ELISA
test kit (CUSABIO BIOTECH. CO. LTD., USA). The range for concentration of
standards varied from 15.6 ng/ml - 200 ng/ml. The minimum detectible
concentration of haptoglobin by this assay was estimated to be 0.1ng/ml.
3.9.2 Estimation of blood plasma lactoferrin
Lactoferrin was estimated as per the instruction provided with the kit
(Lactoferrin ELISA Quantification set, Belthyl Laboratories,Inc., USA). The range
for concentration of standards varied between 7.5 ng/ml to 500 ng/ml. The
minimum detectible concentration of Lactoferrin by this assay was estimated to
be 1.0 ng/ml.
3.9.3 Estimation of blood plasma insulin-like growth factor-1 (IGF-1)
IGF-1 was estimated as per the instructions provided with the kit Bovine
Insilin-like growth factor (IGF-1) ELISA kit, (CUSABIO BIOTECH CO. LTD,
USA). The range for concentration of standards varied between 3.12 ng/ml to
200 ng/ml. The minimum detectible concentration of IGF-1by this assay was
estimated to be 0.1ng/ml.
3.9.4 Estimation of blood plasma calcium
Plasma calcium was estimated with the help of Atomic absorption
Spectrophotometer (Model PU9100X Atomic Absorption Spectrophotometer,
Philips). The procedure described in AAS (1988) manual for preparation of stock
and standard solutions and choice of instrumental conditions were followed.
Principle
A solution containing small amount of mineral element is converted into
an atomic vapour, usually a flame. The flame breaks up the chemical bonds by
which molecules of specific element enabling individual atom to float freely.
Acetylene is used as fuel and air as oxidant. Specific hollow cathode lamp is
used for the determination of specific element. Thus, the light spectrum with
specific wavelength for minerals is emitted from mineral specific hollow cathode
32
0 10 20 30 40 50 60 700.0
0.5
1.0
1.5
Conc.(ng/ml)
O D
(nm
)
Figure 3.1 Standard curve for plasma IGF-1
0 250 500 750 1000 12500
1
2
3
4
5
Conc. of Hp (ng/ml)
OD
(nm
)
Figure 3.2 Standard curve for plasma Hp
lamp and allowed to pass through the vaporized sample. As a result, the light
source emitting radiation is absorbed by the vaporized sample and thus, there is
a decrease in the intensity of radiation which is measured by a detector. The
absorption of radiation energy is proportional to the concentration of the mineral
in the sample.
Preparation of reagents
Tri-acid mixture
Concentrated nitric acid (HNO3), perchloric acid (HClO4) and sulphuric
acid (H2SO4) were mixed in the ratio of 3:2:1, respectively to prepare tri-acid
mixture.
Working standard solution
Working standard solutions of Calcium (2-20ppm) was prepared by serial
dilutions using stock standard (1000ppm).
Working procedure
1. 1 ml of plasma sample was added to 5 ml of tri-acid mixture.
2. The contents were then kept on a hot plate and digested initially at low
temperature and later at higher temperature till the contents were clear
and perchloric acid fumes ceased to come out.
3. Upon cooling the clear solution was diluted with de-ionized water to a final
volume of 10 ml.
4. A blank was processed simultaneously by using the tri-acid mixture.
5. The instrument was set at zero density with the blank. Then, a series of
working standards were run in Atomic Absorption Spectrophotometer for
the preparation of the standard curve. Finally, the samples were run and
the readings (optical density value) were noted. The concentrations of
calcium were estimated with the help of regression equation from
standard curve.
3.9.5 Estimation of blood urea
The plasma urea was estimated according to protocol developed by
Rahmatulla and Boyde (1980).
33
Principle
Urea forms a complex with the Diacetyl monoxime reagent under hot
acidic conditions (H3PO4). The chemical reaction is stimulated by ferric ions and
is stabilized by thiosemicarbazide.
Urea + Diacetyl monoxime → Red colour complex
Thiosemicarbazide + Fe+
Preparation of reagents
1 Acid Ferric Solution - To 100 ml of concentrated phosphoric acid
(H3PO4; 85%) 300 ml of concentrated sulphuric acid (H2SO4; 97-98%) and 600
ml distilled water was added. Dissolved 100 mg of ferric chloride (Fecl3) in this
solution.
2 Diacetyl monoxime Thiosemicarbazide solution - Dissolved 500 mg of
Diacetyl monoxime (C4H7NO2) and 10 mg of Thiosemicarbazide (CH5N3S) in
distilled water and made to volume 100 ml.
Chromogenic Reagent- Mix two parts of reagent 1 with one part of reagent 2
immediately before use.
Working procedure
Deproteinisation of samples
To 0.2 ml of plasma sample, added 1.8 ml of 5% trichloroacetic acid
(TCA) solution in a centrifuge tube. Mixed well and centrifugd the samples for 10
min at 2000 rpm. After centrifugation, removed the precipitate and collected the
deproteinised samples in another test tube.
Plasma urea concentration
Take 0.2 ml of protein free sample and added 3 ml of chromogenic
reagent. Mixed well, boiled in water bath for 5 minutes. Cooled it at room
temperature and absorbance was read at 525 nm against a blank comprised of
distilled water (0.2 ml) and chromogenic reagent (3 ml).
34
Standard curve
Stock standard urea solution (500µg/ml) was prepared by dissolving 50
mg urea (NH2.CO.NH2) in 100 ml distilled water. Working standard (50 µg/ml)
was prepared by diluting 1 ml of stock with 9 ml of distilled water. Different
volumes of working standard 0.02 ml, 0.04 ml, 0.06 ml, 0.08 ml and 0.10 ml was
taken separately in test-tube and 0.18 ml, 0.16 ml, 0.14ml, 0.12 ml and 0.10 ml
of distilled water was added in respective tubes to make the volume upto 0.2 ml,
then 3 ml of chromogenic reagent was added to each test tube and mixed well.
The blank contained 0.2 ml, of distilled water and 3 ml of chromogenic reagent.
Tubes are then incubated in boiling water bath for 5 minutes exactly, and then
cooled to room temperature and absorbance was read against the blank at 525
nm. Absorbance was plotted against concentration to draw the standard curve.
Conc. of plasma total urea = OD value of unknown/OD value of standard ×
concentration of standard (mg/dl)
3.9.6 Estimation of blood glucose
Glucose in blood plasma was estimated by end-point o-Toluidine method
(Dubowski, 1962) and as given below:
Twenty µl of plasma aliquots were pipetted in 10×75mm test tubes, to
which 3.0 ml of glucose reagent was added. The tubes were then gently shaken
and kept in vigorous boiling water bath (1000 C) for exactly 8 minutes. The tubes
were removed quickly and cooled to room temperature by placing in cold water
for 3 min. The glucose was quantified using Specord 50 analyzer at 625 nm.
Along with each set of tubes, a series of tubes containing standard
glucose ranging from 20 mg/dl to 100 mg/dl were processed identically as for the
unknown tubes described above. In addition, a blank tube containing 20 µl
distilled water and 3 ml of glucose reagent was also added with each set of
estimations. Plasma glucose concentration was calculated from the plotted
graph.
Reagents
1. Trichloroacetic acid (C2HO2Cl3) solution (3% w/v): Dissolved 3 gm of TCA
in distilled water and made to volume upto100 ml.
35
2. O-Toluidine (CH3C6H4NH2) solution (6% v/v): Mixed 6 ml of O-Toluidine
with 94 ml glacial acetic acid (CH3COOH).
3. Glucose (C6H12O6) standard solution
4. Working standard = 1.2 mg/ml
a) The blood plasma, standards and blank were run according to the
protocol given below Table 3.4:
b) After making up to solutions with distilled water, tubes were kept in boiling
water bath for 8 minutes and then cooled under tap water.
c) Reading of absorbance was taken at 625 nm against reagent blank.
d) Plotted a standard curve and read the concentration of unknown sample.
Concentration of glucose (mg/100 ml) =
3.10 IN VITRO STUDY
3.10.1 Chemicals for in vitro study:
RPMI medium: Composition of RPMI -1640 medium given in Table 3.5
The pH of the resulting solution was adjusted to pH-7.2 with the help of IN
NaOH and filtered through 0.22 µm Millex – GV filter unit (Millipore). The medium
was aliquoted in sterilized 100 ml reagent bottles and stored at 4ºC in
refrigerator.
Dulbecco’s phosphate buffer solution: 9.4 gm DPBS (Powder) was dissolved
in 1000 ml water.
3.10.2 Chemicals for gene expression studies
50X Tris acetate buffer (TAE):
• Tris base-121g
• Glacial acetic acid-28.5 ml
• Sodium EDTA-18.6 g
Total volume was made to 500 ml with double distilled and autoclaved
water. The pH of solution was adjusted to 7.5. 50 X TAE buffer was stored at
room temperature.
sample OD × Concentration of standard × dilution factor × 100
standard OD
36
Table 3.4 Protocol for the estimation of plasma glucose
Reagent/solution (ml) Blank Plasma sample
Standard
1 2 3 4 5
Protein free sample - 0.2 - - - - -
Standard - - 0.04 0.08 0.12 0.16 0.20
Distilled water 0.20 - 0.16 0.12 0.08 0.04 0.00
O-Toluidine reagent 3.00 3.00 3.00 3.00 3.00 3.00 3.00
Table 3.5 Composition of RPMI -1640 medium
Ingredients Amount
RPMI – 1640 16.4 g
NaHCO3 2.10 g
Sodium pyruvate 110 mg
HEPES 5.26 g (50 mM)
Penicillin 61 mg (100 IV/ml)
Streptomycin 100 mg (100 µg/ml)
Amphoterecin 0.25 µg/ml
1 X TAE buffer: 2 ml of 50 X TAE buffer solution was diluted to 100 ml with
distilled water.
Ethidium bromide (10 mg/ml, stock): One EtBr tablet (100 mg) was dissolved
in 10 ml of DEPC treated water. Concentration of resulting solution was 10
mg/ml.
Ethidium bromide (0.5 µg/ml, working): EtBr was diluted 10 times (i.e.10 µl
EtBr stock was added to 90 µl DEPC treated water).Concentration after dilution
was 1000 µg/ml. 50 µl from working solution (1000 µg/ml) was added to 100ml
melted agarose gel to make 0.5 µg/ml.
Loading buffer: Loading buffer was prepared by dissolving 25 mg bromophenol
blue and 25 mg xylene cyanol in 10 ml of (aqueous) 50% glycerol.
1.5% Agarose: 1.5 g agarose was weighed and 100 ml of 1 X TAE buffer was
added. It was heated to dissolve and allowed to cool and EtBr in required
amount was added and poured on gel casting tray and was allowed to
polymerise.
0.1% DEPC water: Added 1ml DEPC to 1000 ml MilliQ water and mixed it
properly by vigorous shaking. It was incubated at 370C overnight and then
autoclaved twice at 15 psi for 45 min.
3.10.3 Separation and enumeration of neutrophils
All materials and reagents used for the isolation of blood PMN were
sterile. Isolation of PMN from peripheral blood was performed using hypotonic
lysis of erythrocytes as described by Mehrzad et al. (2001 and 2004). Briefly, 10
ml of heparinized blood was poured into the Falcon tubes and centrifuged (1000
X g, 15 min., 4°C); the plasma layer, buffy coat, and top layer of the blood-
packed cells were discarded. About 2.5 ml of the blood-packed cell was lysed by
adding 5 ml of double distilled water and gently mixed for 45 sec. using a
magnetic stirrer. After restoration of the isotonicity by addition of 2.5 ml of 2.7%
NaCl with gentle mixing for 60 sec., the suspension was centrifuged (1000 X g,
10 min., and 4°C). For the second lysis procedure, after resuspending of the
pellets in 2.5 ml of DPBS (without CaCl2 and MgCl2), 5 ml of double distilled
water was added and gently mixed for 30 sec., then 2.5 ml of 2.7% NaCl was
added, gently mixed for 60 sec., and centrifuged (1000 X g, 5 min., 4°C). The
37
remaining cell pellet was washed 3 times in PBS (300 X g, 10 min., 4°C) and the
final cell pellet was resuspended in RPMI media for further analysis. Cells were
counted in above described way.
The cell suspension (neutrophils and macrophages) was adjusted to 5 x
106 live cells/ml by the culture media (RPMI 1640) containing 10% FCS. 200 µl
of the diluted cell suspension per well in triplicate was placed in a 96 well flat
bottomed tissue culture plate. The cells were allowed to proliferate with
Zymosan (650 µg/ml) and NBT (250 µg/ml) concentrations that had been
determined previously to provide maximal stimulation of bovine phagocytes
(Chaudhury, 2009). In all the cases, final culture volume was 200 µl. The blank
wells consisted of 200 µl of culture media along with same concentrations of
NBT and zymosan. All cultures were allowed to incubate at 37oC in a humidified
CO2 incubator (95% air and 5% CO2) for 2h. After that OD was recorded at 540
nm multiwell scanning spectrophotometer (Microscan MS-5608A).
3.10.4 Determination of number of viable cells
Trypan blue exclusion method was used to determine the proportion of
viable cells in the separated neutrophils. This method is based on the principle
that since the dead cells take up the dye they appear blue whereas the live cells
appear colourless since they do not take up the dye. For finding out the
proportions of live and dead cells in the neutrophils cell suspension, a 50 µl
aliquot of the homogenous suspension was mixed with an equal amount of 0.4%
trypan blue solution (w/v). Haemocytometer chambers were charged with 10 µl
of the above mixture. This was done by touching the edge of the cover slip of the
haemocytometer with the pipette tip, allowing chambers to get filled by capillary
action. The number of colorless viable cells, which had not taken up the dye, and
blue dead cells which had taken up the dye, were counted in the four corner 1
mm squares in both chambers within 10 minutes of charging the
haemocytometer. With the cover slip in place, each corner of the
haemocytometer represents a total volume of 0.1 mm2 or 10-4 cm3. As 1 cm3 is
equivalent to approximately 1 ml, the cell concentration per ml was obtained as
follows.
38
Total cells per ml = Average count (viable + dead cells per square) x 2 (dilution
factor) x 104
The concentration of viable cells per ml was calculated as follows:-
Viable cell per ml = Average count of viable cells per square x 2 (dilution factor)
X 104
The total number of viable cells harvested was calculated as follows:-
Total viable cells = Concentration of viable cells per ml x the original volume of
suspension from which the aliquot was taken.
The cell viability was calculated as follows:-
Total viable cells Cell viability (%) = X 100 Total viable cells + total dead cells
The viability of blood neutrophils in different experiments was found to
range between 95-98% within 6h of processing and declined gradually
afterwards.
3.11 In vitro experiment
In experiment, relative expression of TLR-4 and FAS gene were studied in
blood neutrophils of regular and repeat breeder crossbred karan fries cows.
Glyceraldehydes 3-phosphate dehydrogenase (GAPDH) was kept as as house
keeping gene. For this, blood were collected from six animals of RgB group and
twelve animals of RB group. Blood samples (10 ml) were collected from these
animals into heperinized vaccutainer tubes during experimental period; they
were then subjected to neutrophil isolation as described above.
Then cell neutrophils was adjusted to 5 x 106 live cells/ml by the culture
media (RPMI 1640) containing 10% FCS. 200 µl of the diluted cell suspension
per well in triplicate was placed in a 96 well flat bottomed tissue culture plate.
Then Insulin-like Growth Factor-1 @ 100ng/ml was supplemented to
neutrophils isolated from six animals of repeat breeding group. All cultures were
allowed to incubated at 37oC in a humidified CO2 incubator (95% air and 5%
CO2) for 1hour and then processed further as described below.
39
3.11.1 Preparation of reagents and glassware for RNA isolation
All reagents were prepared in 0.1% DEPC treated sterilized milli Q water
and autoclaved at 1210C for 15 min at 15 lb pressure. All solutions were
prepared using RNase free glass wares and DEPC treated water. The chemicals
reserved for RNA work were handled with baked spatula. Wherever possible,
the solutions were treated with 0.1% DEPC for 12 hr at 370C and autoclaved.
Most of the times, sterile disposable plastic wares were used for the preparation
and storage of RNA. Beakers, tubes and other glass wares used for the RNA
work were treated with DEPC treated water (0.1% in milli Q water) and allowed
to stand for 2 hr at 370C and rinsed several times with sterile water and then
heated to 1000C for 2-3 hr. Disposable gloves were worn during the preparation
of materials and solutions used for the isolation and analysis of RNA.
3.11.2 Quality and quantity of RNA
Quality of RNA was checked by performing agarose gel electrophoresis.
Thirty ml of 1.5% agarose gel was used along with 3 µl EtBr for staining the
bands. It showed two clear sharp bands (28s and 18s). Concentration of RNA
was measured by using UV spectrophotometer.
3.11.3 RNA extraction from blood PMN cells
Total RNA from the blood neutrophils was extracted using Trizol method
as reported by Chonczynski and Sacchi, 1987. In brief, The cell suspension of
neutrophils which was isolated by method described elsewhere, was taken in a
2.0 ml centrifuge tube, 1ml of Trizol reagent (Invitrogen, USA) was added to it
and mixed by 4 to 5 times gentle pippeting. The homogenate was stored for five
minute at room temperature to permit complete dissociation of nucleoprotein
complexes. The lysate was supplemented with 200 μl chloroform per 1 ml of
Trizol reagent and the centrifuge tube was tightly capped and then shaken
vigorously for 15 sec. The resulting mixture was kept at room temperature for 15
min. The mixture was then centrifuged at 12,000 g for 15 min at 4°C, to separate
it into a lower red phenol-chloroform phase, inter phase and the colorless upper
aqueous phase. The aqueous phase was carefully transferred to a fresh tube
40
and RNA was precipitated from the aqueous phase by mixing with isopropanol at
the rate of 500 μl of isopropanol per 1ml of Trizol reagent used for the initial
homogenization. The mixture was incubated at room temperature for 10 min and
centrifuged at 10,000 g for 10 min at 4°C, to obtain RNA precipitate in the form of
a gel like or white pellet at the side and bottom of the tube. The RNA pellet was
washed twice with one ml of 75% ethanol by vortexing and subsequent
centrifugation at 7500 g for 5 min at 4°C. In cases, the RNA pellet got
accumulated at the side of the tube with a tendency to float; ethanol wash was
performed at 12,000 g. The RNA pellet was air dried for 15-30 min. A pellet was
dissolved in 25 μl of RNA storage solution and stored at -80°C for further use.
3.11.4 Quality checking of RNA by agarose gel electrophoresis
The 1.5% gel of high quality molecular biology grade agarose (Sigma
Chem. Co., USA) for molecular biology was prepared by dissolving the agarose
in 1X TAE buffer (pH 8.0) followed by heating in a microwave oven or by keeping
in boiling water bath. Ethidium bromide stock solution was added directly to
molten agarose solution at the rate of 0.5 µg/ml of gel volume before casting the
gel. The surface was leveled before pouring the gel. After complete setting of the
gel, the comb was removed carefully and the gel casting tray was placed in the
electrophoresis tanks containing 1X TAE (pH 8.0) buffer. The DNA samples
were mixed with 5 µl of tracking dye and were loaded slowly into the slots of
submarine gels using micropipette. Electrophoresis was carried out at 8 V/cm
for half an hour. After completion of electrophoresis, the gel was examined under
UV transilluminator.
DNase treatment (by Ambion®’s DNA free Kit)
• 0.1 v/v of DNase I buffer was added to the RNA and mixed gently.
• 1 µl rDNase I enzyme was then added to it, mixed and incubated at 37oC
for 30 mins.
• Then 2 µl DNase inactivation reagent was added and incubated for 2 mins
at room temperature (with occasional shaking).
• It was then centrifuged at 10000 x g for 2 mins.
41
• Upper phase (RNA) was carefully and very gently collected (without
touching or disturbing the white pellet) in a new vial and stored at -80oC
for further use.
3.11.5 Quantification of RNA
RNA was quantified by Nanodrop spectrophotometric analysis using the
convention that one absorbance unit at 260 nm wavelength equals 40 μg RNA
per ml. The ultra violet absorbance was checked at 260 and 280 nm for
determination of RNA concentration and purity. Purity of RNA was judged on the
basis of optical density ratio at 260:280 nm. The samples with acceptable purity
(i.e. ratio 1.65-2.0) were quantified using the following formula and used for
reverse transcription.
Concentration of RNA (μg/μl) = (OD 260 x Dilution factor x 40)/1000
3.11.6 Protocol for first strand cDNA synthesis:
First strand cDNA was prepared from 1µg of RNA using Novagen first
strand cDNA synthesis kit (La Jolla, CA) as follows:
1. In a sterile, RNase-free 1.5ml screw-cap microcentrifuge tube following
reagents were combined • 1 μg total RNA
• 0.5 μl (0.5μg) Oligo(dT)
• or 0.5 μl (50ng) Random Hexamers
• x μl Nuclease-free water
Total volume = 12.5 μl
2. It was incubated to 70°C for 10 minutes. This step helps to alleviate RNA
secondary structure and may allow more efficient priming and cDNA
synthesis.
3. Then it was chilled quickly on ice.
4. It was then centrifuged briefly to collect contents at the bottom of the
tube.
5. Then the remaining components for first strand cDNA synthesis were
added below
42
Figure 3.3 RT-PCR amplified products of TLR-4, Fas and House keeping genes on agarose gel 3%
• 4 μl 5X First Strand Buffer (5X = 250mM Tris-HCl, pH 8.3 at 25°C, 375mM
KCl, 15mM MgCl2) • 2 μl 100mM DTT
• 1μl dNTP Mix (10mM each)
• X μl Nuclease-free water
• 0.5 μl (100U) MMLV Reverse Transcriptase
Total volume = 20 μl
6. The reaction mixture was mixed gently by stirring with the pipet tip and
incubated at room temperature for 10 min before placing at 37°C.
Incubate at 37°C for 60 min. The reaction may be used directly for
amplification or stored at -20°C.
3.11.7 Primers
Specific primers for TLR-2, TLR-4, IL-8, β-actin and GAPDH were
designed to amplify a stretch of less than 200 bp preferably from the 3’ end of
cDNA. The sequence information of gene was retrieved from NCBI database
and suitable primers were designed using primer 3 web interfaces. Details of
primers were given in the table 3 6.
Table 3.6 Details of primers of target and housekeeping genes
Genes Sequence (5′→3′) Acc no. Size (bp)
Annealing Temp (0C)
TLR 4
F GGCATCATCTTCATCGTCCT R CTGGACTCTGGGGTTTACCA AY634630.1 178 59
Fas F- GAAGAGGAGGGACCACA R -TGGGGTGACCTATTGCT
JN380921.1
188 59
GAPDH*
F GGGTCATCATCTCTGCACCT R GGTCATAAGTCCCTCCACGA NM_001034034.1 176 59
*Glyceraldehydes 3-phosphate dehydrogenase
3.11.8 Reaction mixture for real-time PCR
Real-time PCR was performed by using SYBR Green. Reaction mixture
for all the genes, consisted crude first strand cDNA was diluted in 1:1 ratio and
was used for expression studies.
43
Table 3.7 Reaction mixture for Real-Time PCR Roche SYBR green (2X) 5 µl (1X)
Reverse and forward primers (10 µM each) 0.5 µl (0.5 µM each)
PCR grade water 3 µl
Template 1 µl
Reaction programme
Reaction programme for all the genes was as follows:
Table 3.8 Reaction programme for real time PCR Programme Steps Temperature Time Cycles
Initial denaturation - 95 0C 5 min 1
Extension Denaturation 95 0C 15 sec
45 Annealing 59 0C 15 sec Extension 72 0C 20 sec
Melting curve
Denaturation 95 0C 5 sec
1 Renaturation 65 0C 1 min
Final Denaturation 97 0C Continuous
mode Cooling - 40 0C 1 min 1
Melting peaks for all reactions were analyzed for the presence of primer
dimers or secondary structures (if any) in all samples.
Two housekeeping genes (GAPDH) used as reference gene for
normalization of target gene for relative quantification.
The expression of different genes in different samples was performed as:
ΔCP (experimental samples) = Cp (target gene of sample) – Reference index
ΔCP (calibrator) = Cp (target gene of calibrator) – Reference index
Where: Cp – Crossing point
Reference index = Mean (Cp GAPDH)
Fold expression level of all the genes for all the samples was calculated
as follows:
ΔΔCP (quantity of expression) = ΔCP (experimental samples) - ΔCP(calibrator)
expression= (2)–ΔΔCP
44
Figure 3.4 Amplification curve TLR-4
Figure 3.5 Amplification curve Fas
3.11.9 Statistical analysis of relative target gene expression
Generation of quantitative data by real-time PCR is based on the number
of cycles required for optimal amplification generated fluorescence to reach a
specific threshold of detection (the Quantification cycle) (Bustin et al., 2009). The
relative expression ratio of the target gene was tested for significance as per
method given by Pfaffl, (2001). 3.12 Statistical analysis
All statistical analysis were done using SYSTAT software package. Data
from different experiments are presented as Mean±SE. Significance was tested
within each group by one-way ANOVA with multiple comparisons. The Mean±SE
were analyzed by multiple t test between groups. The significance of Mean±SEM
values was tested by employing unpaired t test (Assuming unequal variance).
The correlation was tested by Spearman Rank Order Correlation.
45
CHAPTER –4
RESULTS AND DISCUSSION
RESULTS AND DISCUSSION
Although comparisons have been made between RgB and RB groups
from 4th week itself, animals were not classified as RB at this stage, they were
classified as RB at the end of 21st week of study tenure. All animals were
confirmed to be pregnant by 23rd week in RgB group, where as in RB group
none of the animal conceived to 3 consecutive services (by AI) post partum till
21st week under both farm and field conditions. In RgB group only two animals
were left by 19th week which were not confirmed pregnant. Supplementation of
fermented yeast culture to RB-S groups was initiated at 22nd week post partum
under both farm and field conditions. For first 21 week post partum RgB group
serve as control for RB group where as from 22nd week till 40th week of
experiment RB-NS serve as control for RB-S under both farm and field
conditions. Results for correlation studies are reported, only if they were
significant at least at P<0.05.
4.1 INSULIN-LIKE GROWTH FACTOR-1 (IGF-1)
4.1.1 Concentration of plasma Insulin-like growth factor-1 (ng/ml) in RgB and RB groups under farm conditions.
The Mean±SE concentration of plasma IGF-1 at weekly interval and
Mean±SEM values for RgB and RB groups under farm conditions is presented in
Table 4.1 and depicted in Figure 4.1.
Under farm conditions, at the beginning of experiment (4th week post
partum), level of plasma IGF-1 in RgB and RB groups was 73.14±2.34 and
69.35±3.81ng/ml respectively, the difference was not significant. The results in
the present study indicate concentration of plasma IGF-1 in RgB exhibited
increasing trend from initial week till 23rd week post partum. Within RgB group it
was observed that concentration of plasma IGF-1 increased significantly
(P<0.05) from initial value at 10th and 16th week post partum. It also increased
significantly (P<0.05) over initial value from 16th week post partum till end of
experiment. The percent increase in concentration of plasma IGF-1 over initial
value at 23rd week post partum in RgB groups was 26.1%. Similar increase was
observed in the concentration of plasma IGF-1 in RB group till 21st week post
46 Results & Discussion
partum but difference was not significant throughout the course of the
experiment. The percent increase in plasma IGF-1concentration over initial value
at 21st week post partum in RB groups was 7.74 %. When Mean±SE values for
concentration of plasma IGF-1 was compared between these two groups,
significant (P<0.05) greater concentration was observed in RgB group at all
week intervals except at 4th, 16th and 18th week post partum. The Mean±SEM
concentration of plasma IGF-1 for RgB and RB groups under farm conditions
was 85.31±2.22 and 72.79±2.46 ng/ml respectively, which was significantly
(P<0.05) greater in RgB when compared with RB group.
Concentration of plasma IGF-1 was significantly positively correlated with
concentration of plasma glucose, LF (P<0.01), calcium (P<0.05) and negatively
correlated (P<0.01) with concentration of plasma urea and Hp for RgB and RB
groups (Table 4.41).
4.1.2 Concentration of plasma Insulin-like growth factor-1 (ng/ml) in RB-S and RB-NS groups under farm conditions.
The Mean±SE concentration of plasma IGF-1 at weekly interval and
Mean±SEM values for RB-S and RB-NS groups under farm conditions is
presented in Table 4.2 and depicted in Figure 4.1.
From 22nd week, post partum when probiotic (Fermented yeast culture)
was supplemented concentration of plasma IGF-1 was observed to be
80.58±3.75 ng/ml and 79.83±2.67 ng/ml in RB-S and RB-NS group respectively.
An increasing trend in concentration of plasma IGF-1 was observed in RB-S
group whereas decreasing trend was observed in RB-NS group till 40th week
post partum. Within both RB-S and RB-NS group difference was not significant
from initial value throughout the course of the experiment. Concentration of
plasma IGF-1 in RB-S group increased to 85.54±0.39 ng/ml and in RB-NS group
deceased to 73.82±4.29 ng/ml over initial concentration at end of 40th week of
study. The percent increase in concentration of plasma IGF-1 over initial value
in RB-S group at end of experiment was 6.15 %. The percent decrease in
concentration of plasma IGF-1 over initial value in RB-NS group at end of
experiment was 7.52 %. When Mean±SE values for concentration of plasma
IGF-1 was compared between groups significantly greater (P<0.05)
47 Results & Discussion
Table 4.1 Concentration of plasma IGF-1(ng/ml) in RgB and RB groups under farm conditions.
Weeks RgB RB
4 73.14A ±2.34 69.35±3.81
5 76.23 a ±1.34 70.13b±2.36
6 81.48 a ±1.18 71.85±1.66
7 78.32 a ±1.91 70.72 b ±2.75
8 82.42 a±1.42a 69.09 b±0.95
9 83.03 a ±3.55 71.02 b ±3.52
10 87.63 Ba ±2.44 70.99 b ±2.75
11 84.34 a ±3.69 69.44 b ±1.06
12 81.84 a ±2.0Aa 71.21 b ±3.39
13 86.34 Ba ±1.02 73.81b±3.71
14 84.52 a±4.00 76.02 b±1.86
15 83.81a±2.27 73.66b±1.11
16 86.59B ±3.87 74.73±3.74
17 90.40 Ba ±2.45 71.06b±2.04
18 88.48 B±1.67 78.60±3.71
19 86.54 Ba ±2.61 77.41b±1.69
20 93.38Ba ±1.60 76.36b±1.66
21 91.67 Ba±2.21 74.72b±2.48
22 93.89B±1.60
23 92.23 B±1.31
Mean±SEM 85.31*±2.22 72.79±2.46
Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group. Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. * P<0.05
concentration was observed in RB-S group from 33rd to 38th week post partum.
The Mean±SEM concentration of plasma IGF-1 in RB-NS and RB-S groups was
83.20±2.79 and 75.55±3.45 ng/ml respectively, which was significantly (P<0.05)
greater in RB-S when compared with RB-NS group.
Concentration of plasma IGF-1 was significantly positively correlated with
plasma glucose, LF (P<0.01) and calcium (P<0.05) concentration and negatively
correlated (P<0.05) with concentration of plasma urea for both RB-S and RB-NS
groups (Table 4.42).
4.1.3 Concentration of plasma Insulin-like growth factor-1 (ng/ml) in RgB and RB groups under field conditions.
The Mean±SE concentration of plasma IGF-1 at weekly interval and
Mean±SEM values for RgB and RB groups under field conditions is presented in
Table 4.3 and depicted in Figure 4.2.
Under field conditions also, at the begining of experiment (4th week post
partum) level of plasma IGF-1 in RgB and RB groups was 79.91±2.10 and
69.94±0.85 ng/ml respectively. The results obtained in the present study
indicated that concentration of plasma IGF-1 exhibited an increasing trend from
initial concentration till 23rd week post partum in RgB group. The percent
increase in concentration of plasma IGF-1 by 23rd week post partum in RgB
group was 8.68%. Similarly, increasing trend in concentration of plasma IGF-1 in
RB group till 21th week post partum also observed. The difference was not
significant from initial value throughout the course of the experiment within both
RgB and RB groups. Plasma IGF-1 concentration in RB group at start of the
experiment was 69.94±0.85 ng/ml which increased to 73.71±3.09 ng/ml by 21st
week post partum. The percent increase in concentration of plasma IGF-1over
initial value at 21th week post partum in RB groups was 5.4 %. When Mean±SE
values for concentration plasma IGF-1 was compared between groups
significantly (P<0.05) greater concentration was observed in RgB group till end
of the experiment except at 8th and 21st week. The Mean±SEM concentration of
plasma IGF-1 for RgB and RB groups under farm conditions was 82.25±1.73 and
71.62±1.68 ng/ml respectively, which was significantly (P<0.05) greater in RgB
when compared with RB group.
48 Results & Discussion
Concentration of plasma IGF-1 was significantly positively correlated
(P<0.01) with concentration of plasma glucose, LF (P<0.01), calcium (P<0.05)
and negatively correlated (P<0.01) with concentration of plasma urea and Hp for
RgB and RB groups (Table 4.43).
4.1.4 Concentration of plasma Insulin-like growth factor-1 (ng/ml) in RB-S and RB-NS groups under field conditions.
The Mean±SE concentration of plasma IGF-1 at weekly interval and
Mean±SEM values for RB-S and RB-NS groups under field conditions is
presented in Table 4.4 and depicted in Figure 4.2.
At 22nd week post partum when probiotic was supplemented to RB-S
group concentration of plasma IGF-1 was 74.27±1.23 ng/ml and in RB-NS group
was 73.39±1.66 ng/ml. Within RB-S group, concentration of plasma IGF-1
increased from initial value but was significantly (p<0.05) greater only at 30th
week and further from 34th till 37th week. In RB-S group, concentration of plasma
IGF-1 exhibited increasing trend till 40th week. Concentration of plasma IGF-1 in
RB-S group increased to 83.94±1.41 ng/ml from the Mean±SE concentration at
22nd week post partum. The percent increase in plasma IGF-1 in RB-S group at
end of experiment was 13.02 %. In RB-NS group concentration of plasma IGF-1
did not increase significantly from initial value till end of experiment. In RB-NS
group only 2.7% increase was observed in concentration of plasma IGF-1 over
initial value. Concentration of plasma IGF-1 in RB-NS group varied between
72.29 and 77.10 ng/ml during the experimental period. Concentration of plasma
IGF-1 was significantly greater (P<0.05) in RB-S group at 25th, 29th, 33th, 34th,
35th and 40th weeks when compared with RB-NS group. The Mean±SEM
concentration of plasma IGF-1 in RB-NS and RB-S groups was 81.17±1.41 and
74.19±1.75 ng/ml respectively, which was significantly (P<0.05) greater in RB-S
when compared with RB-NS group.
Concentration of plasma IGF-1 was significantly positively correlated
(P<0.01) with plasma glucose, LF and calcium concentration and negatively
correlated (P<0.01) with concentration of plasma urea for RB-S and RB-NS
groups (Table 4.44).
49 Results & Discussion
Table 4.2 Concentration of plasma IGF-1(ng/ml) in RB-S and RB-NS groups under farm conditions.
Weeks RB-S RB-NS
22 80.58±3.75 79.83±2.67
23 80.01±3.12 78.78±3.96
24 78.73±3.52 79.00±4.65
25 80.35±3.71 77.69±2.87
26 82.27±3.06 77.91±3.76
27 80.50±2.71 77.57±2.18
28 80.42±4.79 76.95±3.57
29 80.20±1.27 75.44±2.38
30 86.71±3.57 75.74±4.94
31 83.59 a±1.42 75.32b±2.98
32 84.21±2.79 76.89±4.87
33 85.34 a±2.60 71.9 b±3.33
34 81.21a±2.63 72.93b±4.51
35 86.62a±4.25 73.80b±2.42
36 86.23a±1.86 72.11b±2.33
37 86.94a±4.31 71.95b±4.37
38 86.68a±0.66 73.89b±2.07
39 84.75±3.37 73.93±3.34
40 85.54±0.39 73.82±4.29
Mean±SEM 83.20*±2.79 75.55±3.45
Values with different superscripts (a, b) are significantly different (P<0.05) between RB-S and RB-NS groups. * P<0.05
Table 4.3 Concentration of plasma IGF-1 (ng/ml) in RgB and RB groups under field conditions.
Weeks RgB RB
4 79.91a±2.10 69.94b±0.85
5 75.25a±2.20 68.92b±0.65
6 78.30a±2.23 71.44b±1.71
7 77.09a±3.16 68.71b±1.94
8 77.19±2.48 73.15±0.95
9 78.80a±0.55 70.01b±2.16
10 81.40a±1.12 73.18b±2.27
11 82.11a±1.56 68.43b±1.05
12 81.11a±1.21 69.80b±1.30
13 79.53a±2.71 70.20b±1.37
14 81.61a±4.03 71.76b±2.01
15 83.42a±1.79 72.45b±1.59
16 85.60a±1.17 71.18b±1.37
17 84.41a±0.72 70.89b±2.16
18 86.49a±2.12 74.99b±1.81
19 84.55a±1.51 75.50b±1.59
20 87.59 a±0.72 74.95b±2.27
21 86.29a ±2.12 73.71 b±3.09
22 87.51±0.35
23 86.85±0.71
Mean±SEM 82.25*±1.73 71.62±1.68
Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. * P<0.05
Table 4.4 Concentration of plasma IGF-1(ng/ml) in RB-S and RB-NS groups under field conditions.
Weeks RB-S RB-NS
22 74.27A±1.23 73.39±1.66
23 74.96 A ±1.05 75.41±0.99
24 78.14 A ±1.94 73.51±1.00
25 76.16 A a±2.16 74.28 b ±0.90
26 81.84 A ±0.74 74.47±0.98
27 80.31 A ±2.98 72.33±2.54
28 79.61 A ±2.16 74.81±1.09
29 79.43 A a±1.48 75.13b±1.00
30 83.06B±0.85 72.29±1.92
31 82.78 A ±2.08 72.45±1.60
32 79.58 A ±1.37 74.24±1.49
33 82.49 A a±1.10 72.46b±2.30
34 85.48Ba ±0.60 73.28b±1.81
35 83.83Ba±2.01 74.35b±2.08
36 84.42B±0.63 76.66±2.47
37 83.17B±1.78 77.10±2.94
38 85.82 A ±0.57 73.57 b±3.21
39 82.89 A ±0.71 74.57 b±2.17
40 83.94 a±1.41 75.39b±1.18
Mean±SEM 81.17*±1.41 74.19±1.75
Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group. Values with different superscripts (a, b) are significantly different (P<0.05) between RB-S and RB-NS groups. * P<0.05
4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 4060
65
70
75
80
85
90
95
100RgB RB-S RB-NS
Weeks
Con
c. o
f pla
sma
IGF-
1(n
g/m
l)
Figure 4.1 Concentration of plasma IGF-1 in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm conditions.
4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 4060
65
70
75
80
85
90
95
100RgB RB-S RB-NS
Weeks
Con
c.of
pla
sma
IGF-
1(n
g/m
l)
Figure 4.2 Concentration of plasma IGF-1 in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions.
In the present study greater concentration of plasma IGF-1 was observed
in RgB when compared with RB group under both farm and field conditions. In a
variety of species (including farm animals, humans, and laboratory animals)
higher concentration of blood IGF-1 is found in young, well nourished, healthy
individuals (Jones and Clemmons, 1995;Thissen et al.,1994). Animals that are
old, diseased, or mal-nourished exhibited less concentration of plasma IGF-1
that reflect a compromised state of tissue, organ, and cell function (Jones and
Clemmons, 1995 Lucy et al., 1991; Thissen et al., 1994; McNall et al.,1995).
Several studies have established positive relationship between blood IGF-1
concentration and reproductive function of postpartum cattle. Thatcher et al.
(1996), Anandlaxmi et al. (2013) reported that anestrus dairy cows had lower
blood IGF-1 concentration when compared with cows that initiated estrous
cyclicity earlier during the postpartum period. A similar relationship was reported
for beef cattle, the postpartum anestrus cows had lower IGF-1 level when
compared with cyclic cows (Roberts et al., 1997). Blood IGF-1 was correlated
with follicular fluid IGF-1 because the majority of IGF-1 in follicular fluid was
derived from blood (Leeuwenberg et al., 1996). Beam and Butler (1999)
reported positive correlation among serum IGF-1, LH pulsatility and follicular
wave in post partum cows. Wathes (2008) reported that delay or failure of
conception in post partum dairy cows is associated with reduced IGF-1
concentration and also with concentration of urea in plasma.
Low level of IGF-1 and LF reflects lower immune status of repeat
breeding group when compared with regular breeder group. This is un
confirmation with the studies of Nickerson (1989), Oliver and Sordillo (1989) in
different physiological state. Therefore lower concentration of plasma IGF-1 may
be one of the reason for resulting in lower conception rate in RB group under
both farm and field conditions.
The positive correlation between plasma glucose and IGF-1 has also
been reported by Beam and Butler (1999). They observed that plasma level of
IGF-1 is directly related to energy status i.e. glucose and IGF-1 is critical for
ovarian follicular development. In our studies also similar results were observed.
The significant difference in concentration of plasma IGF-1 between RB-S and
RB-NS group as observed under both farm and field conditions, concentration of
50 Results & Discussion
plasma IGF-1 being higher in RB-S and RgB groups favored conception at an
earlier age when compared with their counterparts.
4.2 HAPTOGLOBIN (Hp)
4.2.1 Concentration of plasma Hp (ng/ml) in RgB and RB groups under farm Conditions.
The Mean±SE concentration of plasma Hp at weekly interval and
Mean±SEM values for RgB and RB groups under farm conditions is presented in
Table 4.5 and depicted in Figure. 4.3.
At the begining of experiment (4th week post partum) concentration of
plasma Hp in RgB and RB groups under farm conditions were 499.02±27.67and
763.47±28.86 ng/ml respectively. The results in the present study indicated that
within both RgB and RB groups there was significant (P<0.05) decrease in
Mean±SE values for concentration of plasma Hp from 7th week till end of the
experiment. The percent decrease in concentration of plasma Hp over initial
concentration at 13th week post partum in RgB groups was 52.56 % which was
maximum at 13th week. Similarly, decreasing trend in concentration of plasma
Hp in RB group till 21st week post partum also observed. Concentration of
plasma Hp in RgB group at the beginning of the experiment was 499.02±27.67
ng/ml which derceased to 290.24±13.43 ng/ml at 23rd week post partum. The
percent decrease in concentration of plasma Hp at 23rd week post partum over
initial value in RgB groups was 41.84 %. Concentration of plasma Hp in RB
group at 4th week was 763.47±28.86 ng/ml which decreased to
394.73±21.11ng/ml at 21st week post partum. The percent decrease in
concentration of plasma Hp at 21st week post partum over initial value in RB
groups was 48.29 %. In RgB group Mean±SE values for concentration of plasma
Hp was significantly less (P<0.05) when compared with RB group throughout the
course of the experiment. The Mean±SEM concentration of plasma Hp for RgB
and RB groups was 315.14±22.42 and 546.56±24.41 ng/ml respectively, which
was significantly (P<0.05) greater in RB when compared with RgB group. The
concentration of plasma Hp was within physiological range.
Concentration of plasma Hp was significantly positively correlated
(P<0.01) with concentration of plasma urea and negatively correlated (P<0.01)
51 Results & Discussion
Table 4.5 Concentration of plasma Hp (ng/ml) in RgB and RB groups under farm conditions.
Weeks RgB RB
4 499.02Aa±27.67 763.47Ab±28.68
5 447.02 A a±35.45 727.03 A b±10.86
6 421.86 A a±20.04 678.16 A b±39.92
7 347.86Ba±32.43 585.78Bb±40.50
8 372.86Ba±14.54 608.84Bb ±32.27
9 295.94Ba±12.29 580.43Bb±18.38
10 283.11Ba±23.40 587.26Bb±16.33
11 278.36Ba±14.39 565.69Bb±28.97
12 256.19 Ba ±32.68 527.94 Bb±24.93
13 236.27Ba±21.56 535.03Bb±31.49
14 254.60Ba±37.67 518.92Bb±14.28
15 296.35Ba±14.57 503.82Bb±28.01
16 263.93Ba±12.82 510.03 Bb ±13.51
17 278.35Ba±23.91 470.76Bb±23.06
18 318.85Ba±16.79 454.46Bb±19.57
19 309.85Ba±27.68 418.15Bb±31.11
20 264.08Ba±23.89 407.53Bb ±16.33
21 278.74Ba±19.68 394.73Bb±21.11
22 309.24B±23.46
23 290.24B±13.43
Mean±SEM 315.14±22.42 546.56*±24.41
Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group. Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. * P<0.05
Table.4.6 Concentration of plasma Hp (ng/ml) in RB-S and RB-NS groups under farm conditions.
Weeks RB-S RB-NS
22 412.14±18.38 422.9±25.54
23 398.93±31.11 411.52±37.73
24 386.52±12.26 411.37±13.91
25 389.16±27.12 410.82±36.88
26 385.25±18.57 424.31±25.07
27 375.36±36.97 444.56±11.11
28 366.35±25.46 425.08±37.98
29 361.35a±18.69 428.64b±22.09
30 350.22±25.57 424.33±43.27
31 350.84a±18.75 445.3 b±11.66
32 348.85±36.76 433.42±28.02
33 312.96a±10.92 420.53 b ±25.36
34 315.16±19.7 403.31±32.87
35 310.43±28.75 392.55±28.09
36 300.26a±12.22 389.37b±35.57
37 309.59±38.29 398.41±27.75
38 299.61a±26.67 390.33 b±17.93
39 305.78±31.49 380.71±34.41
40 295.73±17.82 374.75±27.51
Mean±SEM 346.03±23.97 412.22*±27.50
Values with different superscripts (a, b) are significantly different (P<0.05) between RB-S and RB-NS groups. * P<0.05
Table 4.7 Concentration of plasma Hp (ng/ml) in RgB and RB groups under field conditions.
Weeks RgB RB
4 478.14Aa ±27.27 705.56b±11.89
5 446.14 A a±32.06 708.72b±27.54
6 441.81 A a±43.88 690.25 b ±30.20
7 386.98 A a±27.92 699.87b±.1352
8 371.98 A a±36.82 690.93b±28.47
9 315.73Ba±27.95 630.52b±16.19
10 329.23 A a±40.84 599.3 b±38.38
11 297.48Ba±32.68 577.78Bb±24.57
12 315.31Ba±26.84 590.03b±13.24
13 281.39Ba±13.11 547.12Bb±33.62
14 289.01Ba±19.78 531.01Bb±19.00
15 315.76 A a±27.58 515.91 Bb ±13.71
16 273.34Ba±38.46 472.12Bb±24.99
17 297.76Ba±14.66 482.85 Bb±27.64
18 305.26Ba±23.21 464.55 Bb ±39.60
19 309.26 A a±35.56 430.24Bb±28.69
20 293.09Ba±27.25 417.62Bb±14.16
21 297.54 A a±32.35 446.82Bb±18.68
22 308.04 A ±20.41
23 309.04 A ±31.63
Mean±SEM 333.11±29.01 566.74*±23.56
Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group. Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. * P<0.05
with concentration of plasma LF, IGF-1(P<0.01), glucose and calcium (P<0.05)
for RgB and RB groups (Table 4.41).
4.2.2 Concentration of plasma Hp (ng/ml) in RB-S and RB-NS groups under farm conditions.
The Mean±SE concentration of plasma Hp at weekly interval and
Mean±SEM values for RB-S and RB-NS under farm conditions is presented in
Table 4.6 and depicted in Figure. 4.3.
At 22nd week post partum when probiotic supplementation was initiated, in
RB-S group concentration of plasma Hp was 412.14±18.38 ng/ml whereas in
RB-NS group was 422.9±25.54 ng/ml. In both the groups, concentration of
plasma Hp decreased at 40th week of experiment. The values were not
significantly different from initial value throughout the course of the experiment
within RB-S and RB-NS groups. Concentration of plasma Hp in RB-S and RB-
NS at 40th week of experimental period was observed to be 295.73±17.82 and
374.75±27.51ng/ml respectively. The decrease observed in Hp concentration in
RB-NS group was less; hence the difference in the Mean±SE concentration of
Hp in this group at the end of 40th week was not significant when compared with
the Mean±SE Hp concentration at 22nd week. The percent decrease in plasma
Hp concentration over initial value in RB-S and RB-NS group at end of
experiment was 28.24 and 11.38 % respectively. When Mean±SE values for
concentration of plasma Hp was compared between groups, concentration was
significantly (P<0.05) less in RB-S group at 29th, 31st, 33rd, 36th and 38th week.
Mean±SEM concentration of plasma Hp in RB-S and RB-NS groups were
346.03±23.97 and 412.22±27.50 ng/ml respectively, which was significantly
(P<0.05) greater in RB-NS when compared with RB-S group.
Concentration of plasma Hp was significantly positively correlated
(P<0.01) with concentration of plasma urea and negatively correlated (P<0.01)
with concentration of plasma LF for both the groups (Table 4.42).
52 Results & Discussion
4.2.3 Concentration of plasma Hp (ng/ml) in RgB and RB groups under field conditions.
The Mean±SE concentration of plasma Hp at weekly interval and
Mean±SEM values for RgB and RB groups under field conditions is presented in
Table 4.7 and depicted in Figure 4.4.
Under field conditions, at the beginning of experiment (4th week post
partum), level of plasma Hp concentration in RgB and RB groups conditions was
478.14±27.27 and 705.56±11.89 ng/ml respectively. The results in the present
study indicate that concentration of plasma Hp when compared within RgB group
it was observed that Mean±SE values for concentration decreased significantly
(P<0.05) at 9th, 11th-14th, 16th-18th and 20th week post partum. The percent
decrease in plasma Hp concentration over initial value at 16th week post partum
in RgB groups was 42.83%, at which Mean± SE concentration of Hp was least.
The percent decrease in plasma Hp concentration over initial value at 23rd week
post partum in RgB groups was 35.4 %. Similar, decreasing trend in
concentration of plasma Hp in RB group from initial value till 21st week post
partum was recorded. Within RB group, concentration of plasma Hp decreased
significantly (P<0.05) at 11th and 13th week and further till end of the experiment.
Mean±SE concentration of plasma Hp in RB group at 1st week of the experiment
was 705.56±11.89 ng/ml which decreased to 446.82±18.68 ng/ml at 21st week
post partum. The percent decrease in plasma Hp concentration over initial value
at 21st week post partum in RB groups was 36.67 %. In RgB group,
concentration of plasma Hp was significantly less (P<0.05) when compared with
RB group throughout the course of the experiment. Mean±SEM concentration of
plasma Hp for RgB and RB groups was 333.11±29.01 and 566.74±23.56 ng/ml
respectively, which was significantly (P<0.01) greater in RB when compared with
RgB group.
Concentration of plasma Hp was significantly positively correlated
(P<0.01) with concentration of plasma urea and negatively correlated with
concentration of plasma LF, IGF-1(P<0.01), glucose and calcium (P<0.05) for
both the groups (Table 4.43).
53 Results & Discussion
4.2.4 Concentration of plasma Hp (ng/ml) in RB-S and RB-NS groups under field conditions.
The Mean±SE plasma Hp concentration at weekly interval and
Mean±SEM values for RB-S and RB-NS groups under field conditions is
presented in Table 4.8 and depicted in Figure 4.4.
Within RB-S and RB-NS groups Mean±SE values for concentration of
plasma Hp exhibited decreasing trend but difference were not significant from
initial value throughout the course of the experiment. In RB-S group, plasma Hp
concentration decreased to 314.54±12.83 ng/ml by 40th week post partum over
the initial value. The percent decrease observed was 25.85 %. Mean±SE in RB-
NS group plasma Hp concentration increased to 424.83±23.54 ng/ml from
416.5±25.39ng/ml. A 2 % percent increase was observed in plasma Hp
concentration over initial value in RB-NS group at end of experiment. When
Mean±SE values for concentration of plasma Hp was compared between
groups, the concentration was significantly less (P<0.05) at 30th, 32nd- 38th and
40th week interval in RB-S group. The Mean±SEM concentration of plasma Hp
RB-NS and RB-S groups was 364.36±23.35 and 430.01±26.82 ng/ml
respectively, which was significantly (P<0.05) greater in RB-NS when compared
with RB-S group.
Concentration of plasma Hp was significantly positively correlated
(P<0.01) with concentration of plasma urea and negatively correlated (P<0.05)
with concentration of plasma lactofferrin for both the groups (Table 4.44).
Results obtained indicated that significant greater (P<0.01) concentration
of plasma Hp was present in RB group when compared with RgB under both
farm and field conditions. Hence, the results indicated that greater concentration
of plasma Hp (P<0.01) prevailed in repeat breeding animals when compared
with their counterpart. To the best of our knowledge no reports are available on
plasma level of Hp in repeat breeding animals under tropical conditions.
Although the Mean±SE concentration of plasma Hp in RB and RB-NS group was
significantly higher than their counterparts, the concentration of plasma Hp under
farm or field conditions was observed to be within physiological range (300-
500ng/ml) (Horadagoda et al., 1999; Anand Laxmi et al.,2013) in cows and does
54 Results & Discussion
not indicate pathological condition. Under pothological conditions it is reported to
increase in microgram range (Horadagoda et al., 1999). It indicates mild stress
or inflammation in the mentioned groups. Higher plasma Hp concentration at an
earlier stage post partum may be due to inflammatory condition persisting at
earlier stage which decreased later on as reflected by Hp concentration. Higher
plasma Hp concentration in cows with post partum reproductive problems has
been reported by Chan et al. (2004) and Petersen et al. (2004). It was concluded
that Hp seems to be a promising marker of health status by reflecting a broad
spectrum of ongoing clinical as well as subclinical diseases in cows. A low
concentration of plasma Hp in RgB group suggests healthy status of group as
supported by Uchida et al. (1993), who suggested that, only a less concentration
of Hp was detectable in normal bovine serum. This may be one of the reasons
due to which RgB group animals might have concieved ≤3 services. Lower
concentration of plasma Hp in RgB group indicates good health which might
have resulted in conception in less than 3 consecutive services under both farm
and field conditions. Number of investigations indicate the ability of Hp as
unspecific markers of clinical and subclinical infections, to discriminate between
acute and chronic disease and for prognostic purposes, since the duration and
magnitude of the response reflect the severity of the disease and the effect of
treatment (Skinner et al., 1991; Horadagoda et al., 1999; Hultén et al., 1999;
Petersen et al., 2002; Hultén and Demmers, 2002; Lauritzen et al., 2003). Higher
concentration of plasma Hp in RB group suggests subclinical infection or
stress due to which it resulted in delay in conception when compared with RgB
and RB-S groups under both farm and field conditions.
Saini and Webert (1991), reported that plasma Hp was considered to be
involved in dynamic process, involving systemic and metabolic changes
providing an early non-specific defence mechanism against infection before
specific immunity is achieved.
To best of our knowledge this is the first investigation which shows the
effect of Probiotic (Saccharomyces cerevisiae) supplementation to repeat
breeding crossbred cows under farm and field conditions. Different studies
revealed beneficial effect of S. cerevisiae on rumen pH, nutrient availability and
health of ruminant (Callaway and Martin, 1997; Kumar et al., 1997; Dann et al.,
55 Results & Discussion
Table 4.8 Concentration of plasma Hp (ng/ml) in RB-S and RB-NS groups under field conditions.
Weeks RB-S RB-NS
22 424.23±26.03 416.50±25.39
23 401.02±17.61 435.12±31.19
24 423.61±24.72 425.64±27.97
25 421.25±11.04 432.32±29.78
26 439.71±28.45 425.81±35.62
27 403.82±25.04 437.73±27.84
28 398.81±12.11 416.58±14.45
29 383.81±28.01 425.14±26.37
30 372.75a±25.89 425.83b±36.10
31 343.37±11.38 446.81±28.73
32 341.38 a±34.88 422.03 b±25.35
33 325.49 a±29.59 410.81b±19.16
34 317.69 a±36.47 444.92b±28.73
35 327.96 a±26.06 431.13b±26.27
36 310.29 a±18.20 425.83b±20.44
37 312.12 a±34.12 446.81b±33.48
38 336.42 a±14.14 444.92 b±11.44
39 324.59±27.07 431.43±37.51
40 314.54a±12.83 424.83b±23.54
Mean±SE 364.36±23.35 430.01*±26.82
Values with different superscripts (a, b) are significantly different (P<0.05) between RB-S and RB-NS groups. * P<0.05
4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40200
300
400
500
600
700
800RgB RB-S RB-NS
Weeks
Con
c. o
f pla
sma
Hp
(ng/
ml)
Figure 4.3 Concentration of plasma Hp in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm conditions.
4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40200
300
400
500
600
700
800RgB RB-S RB-NS
Weeks
Con
c.of
pla
sma
Hp
(ng/
ml)
Figure 4.4 Concentration of plasma Hp in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions.
2000). This improvement in health status of animal is reflected parttially due to
the significant lower concentration of plasma Hp in RB-S group when compared
with RB-NS group under farm and field conditions.
4.3 LACTOFERRIN (LF)
4.3.1 Concentration of plasma LF (ng/ml) in RgB and RB groups under farm conditions.
The Mean±SE concentration of plasma LF at weekly interval and
Mean±SEM values for RgB and RB groups under farm conditions is presented
in Table 4.9 and depicted in Figure 4.5.
Under farm conditions, at the beginning of experiment (4th week post
partum) level of plasma LF in RgB and RB groups under farm conditions was
248.33±18.40 and 203.84±25.43 ng/ml respectively. Within RgB group it was
observed that Mean±SE values of plasma LF concentration increased
significantly (P<0.05) only at 17th and 19th week post partum over the initial
value. The results in the present study indicated that concentration of plasma LF
in RgB exhibited an increasing trend from initial value till 23rd week.
Concentration of plasma LF in RgB group at start of the experiment was
248.33±18.40 ng/ml which increased to 376.97±24.54ng/ml at 23rd week post
partum. The percent increase in concentration of plasma LF over initial value at
23rd week post partum in RgB groups was 51.80 %. Similarly, increase in trend
in concentration of plasma LF from initial value till 21st week post partum of RB
group was observed. In RB group, concentration of plasma LF increased but
was not significantly different from initial value till end of experiment.
Concentration of plasma LF in RB group at start of the experiment was
203.84±25.43 ng/ml which increased to 305.06±17.35 ng/ml at 21st week post
partum. The percent increase in concentration of plasma LF over initial value at
21st week post partum in RB groups was 49.65 %. Concentration of plasma LF
was significantly higher (P<0.05) in RgB group at 6th, 10th, 12th, 13th, 15th and 18-
20th weeks when compared with RB group. The Mean±SEM concentration of
plasma LF for RgB and RB groups under farm conditions was 329.68±22.09 and
250.56±22.08 ng/ml respectively, which was significantly (P<0.01) greater in
RgB when compared with RB group.
56 Results & Discussion
Concentration of plasma LF was significantly positively correlated with
concentration of plasma IGF-1, glucose (P<0.01), calcium (P<0.05) and
negatively correlated (P<0.01) with concentration of plasma urea and Hp for RgB
and RB groups (Table 4.41).
4.3.2 Concentration of plasma LF (ng/ml) in RB-S and RB-NS groups under farm conditions.
The Mean±SE concentration of plasma LF at weekly interval and
Mean±SEM values for RB-S and RB-NS groups under farm conditions is
presented in Table 4.10 and depicted in Figure 4.5.
At 22nd week post partum when probiotic was supplemented to RB-S
group concentration of plasma LF was 288.39±24.57 ng/ml and in RB-NS
group was 301.92±17.25 ng/ml. Within both RB-S and RB-NS group difference
in concentration was not significant from the initial value till end of the
experiment. In RB-S group, concentration of plasma LF exhibited increasing
trend till the end of experiment. The percent increase in concentration of plasma
LF over initial value in RB-S group at end of experiment (at 22nd week) was
31.01 %. In RB-NS group change observed at 22nd week for concentration of
plasma LF from initial value was not significant. The range of concentration of
plasma LF in RB-NS group varied between 281.36 and 308.73 25 ng/ml during
the experimental period. Only 2 % increase in concentration of plasma LF over
initial value in RB-NS group at end of experiment was recorded. When Mean±SE
values for concentration of plasma LF was compared between groups, values
were significantly (P<0.05) greater in RB-S group at 29th, 31st- 35th and 37th
week. The Mean±SEM concentration of plasma LF in RB-S and RB-NS groups
was 345.41±20.55 and 296.24±21.32 ng/ml respectively, which was significantly
(P<0.05) greater in RB-S when compared with RB-NS group.
Concentration of plasma LF was significantly (P<0.01) positively
correlated with concentration of plasma IGF-1 and negatively correlated with
concentration of plasma urea (P<0.01) and Hp (P<0.05) for both RB-S and RB-
NS groups (Table 4.42).
57 Results & Discussion
Table 4.9 Concentration of plasma lactoferrin (ng/ml) in RgB and RB groups under farm conditions.
Weeks RgB RB
4 248.33A±18.40 203.84±25.43
5 256.83 A ±27.99 193.96±27.44
6 294.83a±22.63 190.13b±16.18
7 302.80 A ±23.83 234.67±29.18
8 270.17 A ±18.53 210.84±26.11
9 281.97 A ±21.55 229.84±13.99
10 317.47 A a±8.29 209.34 b±24.18
11 293.05 A ±27.99 254.67±14.73
12 339.93 A a±25.57 260.84b±21.90
13 350.02 A a±19.99 259.84b±25.18
14 313.72 A ±12.09 269.14±23.99
15 335.47 A ±18.50 277.70±24.50
16 362.10 A a±29.09 286.90b±16.18
17 376.18B±12.68 287.65±33.99
18 359.68 A a±18.06 278.23b±26.75
19 375.76Ba ±17.83 266.47b±14.85
20 391.85 A a ±17.50 290.99b±15.55
21 375.67 A ±23.95 305.06±17.35
22 370.77 A ±32.89
23 376.97 A ±24.54
Mean±SEM 329.68*±22.09 250.56±22.08
Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group. Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. * P<0.05
Table 4.10 Concentration of plasma lactoferrin (ng/ml) in RB-S and RB-NS groups under farm conditions.
Weeks RB-S RB-NS
22 288.39±24.57 301.92±17.25
23 293.14±16.18 287.78±22.76
24 310.47±23.29 282.95±25.94
25 332.42±18.23 306.82±15.84
26 326.35±16.15 312.57±27.34
27 351.59±35.22 304.15±16.15
28 322.14±25.76 305.57±25.19
29 326.38 a±27.35 300.66 b ±23.60
30 362.22±26.42 281.36±27.35
31 348.70 a±18.93 272.77b±26.42
32 376.26 a ±15.70 291.97b±28.93
33 373.76 a ±21.93 302.55b±16.70
34 361.50 a±23.76 282.79b±15.18
35 376.05 a ±18.70 290.40b±12.99
36 360.37±17.47 308.73±24.50
37 371.22 a±14.70 300.11b±16.14
38 360.69±13.34 288.90±31.96
39 343.41±15.66 298.58±16.20
40 377.82±17.07 308.02±14.49
Mean±SEM 345.41*±20.55 296.24±21.32
Values with different superscripts (a, b) are significantly different (P<0.05) between RB-S and RB-NS groups. * P<0.05
4.3.3 Concentration of plasma LF (ng/ml) in RgB and RB groups under field conditions.
The Mean±SE concentration of plasma LF at weekly interval and
Mean±SEM values for RgB and RB groups under field conditions is presented in
Table 4.11 and depicted in Figure 4.6.
Under field conditions, at the begining of experiment (4th week post
partum) concentration of plasma LF in RgB and RB groups under field conditions
was 259.11±21.31 and 187.11±24.56 ng/ml respectively. Mean±SE values for
concentration exhibited an increasing trend but difference was not significant
from initial value throughout the course of the experiment in both RgB and RB
groups. The results in the present study indicate that concentration of plasma LF
in RgB showed an increasing trend till 23rd week post partum. The percent
increase in concentration of plasma LF over initial value at 23rd week post
partum in RgB groups was 43.63 %. Similarly, inceasing trend in concentration
of plasma LF in RB group from initial week till 21st week post partum was
recorded. Concentration of plasma LF in RB group at beginning of the
experiment was 187.11±24.56 ng/ml which increased to 302.86±24.93 ng/ml at
21st week post partum. The percent increase in concentration of plasma LF over
initial value at 21st week post partum in RB group was 61.86%. When Mean±SE
values of plasma LF concentration was compared between groups, values were
significantly (P<0.05) greater for RgB group at 7th, 9th, 15th and 20th week. The
Mean±SEM concentration of plasma LF for RgB and RB groups under farm
conditions was 345.41±20.55 and 296.24±21.32 ng/ml respectively, which was
significantly (P<0.01) greater in RgB when compared with RB group.
Concentration of plasma LF was significantly positively correlated with
concentration of plasma IGF-1, glucose (P<0.01), calcium (P<0.05) and
negatively (P<0.01) correlated with concentration of plasma urea and Hp in RgB
and RB groups (Table 4.43).
58 Results & Discussion
4.3.4 Concentration of plasma LF (ng/ml) in RB-S and RB-NS groups under field conditions.
The Mean±SE concentration of plasma LF at weekly interval and
Mean±SEM values for RB-S and RB-NS groups under field conditions is
presented in Table 4.12 and depicted in Figure 4.6.
At 22nd week post partum when probiotic was supplemented to RB-S
group concentration of plasma LF was 317.96±26.12 ng/ml and in RB-NS
group was 322.54±29.18 ng/ml. Within RB-S and RB-NS groups difference was
not significant from the initial value throughout course of the experiment. In RB-S
group, concentration of plasma LF exhibited increasing trend till the end of
experiment. Concentration of plasma LF in RB-S group increased to
392.39±24.07 ng/ml. The percent increase in concentration of plasma LF over
initial value in RB-S group at end of experiment was 23.40 %. In RB-NS group
no significant change was recorded in concentration of plasma LF over initial
value. The range of concentration plasma of LF in RB-NS group varied between
294.81 and 335.96 ng/ml during the experimental period. When Mean±SE
values for concentration of plasma LF was compared between groups,
significantly (P<0.05) greater values were observed in RB-S group at 26th, 30th,
35th- 37th week. The Mean±SEM concentration of plasma LF in RB-S and RB-NS
groups was 368.69±22.27 and 315.43±22.76 ng/ml respectively, which was
significantly (P<0.05) greater in RB-S when compared with RB-NS group.
Concentration of plasma LF was significantly positively correlated
(P<0.01) with concentration of plasma IGF-1 and negatively correlated with
concentration of plasma urea (P<0.01) and Hp (P<0.05) for RB-S and RB-NS
groups (Table 4.44).
Results obtained in present study indicated that significant (P<0.01)
greater concentration of plasma LF in RgB was present when compared with RB
group under both farm and field conditions. Under both farm and field conditions
concentration of plasma LF in RgB and RB groups was within the normal
physiological range. Results of present study were in accordance with those of
Maaks et al. (1989) reported the normal range i.e. as 0.4–2 mg/l under normal
conditions. In present study animals selected were free from clinical infection.
59 Results & Discussion
Table 4.11 Concentration of plasma lactoferrin (ng/ml) in RgB and RB groups under field conditions.
Weeks RgB RB
4 259.11±21.31 187.11±24.56
5 270.41±26.31 188.41±27.57
6 279.61±22.99 217.61±35.18
7 269.92a±15.85 207.92 b ±22.07
8 263.59±27.05 201.59±25.18
9 280.69a±18.10 218.69 b ±14.24
10 269.59±28.71 207.59±19.29
11 290.17±22.00 228.17±27.42
12 277.59±30.95 215.59±18.83
13 319.21a±22.06 217.21b±18.18
14 290.84±33.91 228.84±20.85
15 309.12 a ±17.49 247.12 b ±15.18
16 331.29±26.72 269.29±20.02
17 336.04±35.88 274.04±24.43
18 328.87±25.88 266.87±22.18
19 345.79±27.25 283.79±27.50
20 341.04 a ±19.11 279.04 b±14.43
21 364.86±14.95 302.86±24.93
22 379.96±24.08
23 372.16±12.25
Mean±SEM 308.99*±23.65 235.65±22.34
Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. * P<0.05
Table 4.12 Concentration of plasma lactoferrin (ng/ml) in RB-S and RB-NS groups under field conditions.
Weeks RB-S RB-NS
22 317.96±26.12 322.54±29.18
23 310.16±18.26 313.4±27.66
24 333.54±25.29 320.1±26.42
25 325.99±34.27 315.97±22.70
26 346.09 a±15.18 310.22 b±20.44
27 357.33±28.26 304.8±14.13
28 375.54±26.18 298.22±26.90
29 376.79±31.18 294.81±25.35
30 386.29 a±13.80 302.92 b±15.33
31 370.77±24.96 320.01±23.50
32 387.5±32.67 297.54±27.83
33 376.33±18.83 309.21±26.96
34 397.23±19.67 332.38±26.64
35 395.12 a±21.57 321.19 b±20.98
36 401.11 a±15.59 334.99 b±16.99
37 381.95 a ±10.50 316.37b±22.56
38 391.43±15.35 335.96±16.21
39 381.64±21.21 318.5±14.82
40 392.39±24.07 324.01±24.21
Mean±SEM 368.69*±22.27 315.43±22.76
Values with different superscripts (a, b) are significantly different (P<0.05) between RB-S and RB-NS groups. * P<0.05
5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41100
150
200
250
300
350
400
450
500RgB RB RB-NS
Weeks
Con
c. o
f pla
sma
Lact
ofer
rin(n
g/m
l)
Figure 4.5 Concentration of plasma LF in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm conditions.
5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41100
150
200
250
300
350
400
450
500RgB RB-S RB-NS
Weeks
Con
c. o
f pla
sma
Lact
ofer
rin(n
g/m
l)
Figure 4.6 Concentration of plasma LF in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions.
Concentration of plasma LF in RgB and RB remained within normal physiological
range under both farm and field conditions. It is reported that there is 100 fold
increase in concentration of plasma LF during severe inflammation and under
some pathological conditions. It depends on the severity of the condition
(Bennett and Kokocinski, 1978; Maaks et al., 1989).
LF modulates functions of lymphocytes such as cytokine gene activation
(Crouch et al.,1992), cytotoxicity (Shau et al.,1992), B and T cell maturation and
a number of immunopotentiating activities have been ascribed to LF (Zuccotti et
al.,2006). Low level of IGF-1 and LF reflects lower immune status of repeat
breeding groups when compared with regular breeder groups. This is in
confirmation with the reports of Nickerson (1989), Oliver and Sordillo (1989). LF
exhibits diverse biological activities in activation of innate immunity (Miyauchi et
al., 1998). Hence, lower concentration of plasma LF in RB when compared with
RgB group may indicate weaker health and immune status of former group
under both farm and field conditions. This may also be one of reason for reduced
conception rate in RB group under both farm and field conditions.
Chaucheyras et al. (1995), Gattass et al. (2008), Soccol et al. (2010)
reported that S. cerevisiae had the ability to provide growth factors such as
organic acids (methionine and lysine) and vitamins, improving the number of
beneficial rumen microflora, inhibiting growth of pathogens and stimulating
immune function. As probiotic (Saccharomyces cerevisae) shows the positive
effect on immunity of animal which may be one of the reason for significant
greater concentration of plasma LF in RB-S group when compared with RB-NS
group under farm and field conditions. In the present study, supplementation of
fermented yeast culture which is rich source of amino acids and vitamins might
have improved the health status of RB-S group.
4.4 GLUCOSE
4.4.1 Concentration of plasma glucose (mg/dl) in RgB and RB KF cows post partum under farm conditions.
The Mean±SE concentration of plasma glucose at weekly interval and
Mean±SEM values for RgB and RB groups under farm conditions is presented in
Table 4.13 and depicted in Figure 4.7.
60 Results & Discussion
Under farm conditions, at the beginning of experiment (4th week post
partum) level of plasma glucose in RgB and RB groups under farm conditions
was 52.56±0.85 and 50.87±0.21 mg/dl respectively. Within RgB and RB groups,
Mean±SE values for concentration of plasma glucose exhibited increasing trend
but difference was not significant from initial value throughout the course of the
experiment. Concentration of plasma glucose ranged between 52.56 and 54.96
mg/dl in RgB group. Similarly in RB group during the experimental period up to
21st week it ranged between 50.87 and 53.26 mg/dl. When Mean±SE values for
concentration of plasma glucose was compared between groups, concentration
was significantly (P<0.05) greater in RgB group from 7th week except at 9th, 16th,
19th and 20th week. The Mean±SEM concentration of plasma glucose for RgB
and RB groups under farm conditions was 53.98±0.45 and 51.97±0.46 mg/dl
respectively, which was significantly (P<0.05) greater in RgB when compared
with RB group.
Concentration of plasma glucose was significantly positively correlated
(P<0.01) with plasma IGF-1, LF (P<0.01), calcium (P<0.05) and negatively
correlated (P<0.05) with plasma concentration of urea and Hp for both RgB and
RB groups (Table 4.41).
4.4.2 Concentration of plasma glucose (mg/dl) in RB-S and RB-NS groups under farm conditions.
The Mean±SE concentration of plasma glucose at weekly interval and
Mean±SEM values for RB-S and RB-NS groups under farm conditions is
presented in Table 4.14 and depicted in Figure 4.7.
At 22nd week post partum when probiotic was supplemented to RB-S
group concentration of plasma glucose was 52.13±0.36 mg/dl and in RB-NS
group was 52.19±0.016 mg/dl. After supplementation of probiotic to RB-S group,
concentration of plasma glucose increased significantly (P<0.05) from initial
value from 27th week post partum till the end of the experiment. Within RB-NS
group concentration of plasma glucose did not change significantly from the
initial value till end of experiment. Concentration of plasma glucose ranged
between 52.11and 52.80 mg/dl in RB-NS group during the experimental period.
Concentration of plasma glucose was significantly greater (P<0.05) in RB-S
61 Results & Discussion
Table 4.13 Concentration of plasma glucose (mg/dl) in RgB and RB groups under farm conditions.
Weeks RgB RB
4 52.56a±0.85 50.87±0.21
5 52.88 a±0.37 51.16±0.77
6 53.27a±0.71 51.53±0.35
7 52.73 a±0.16 51.09 b±0.31
8 53.40 a±0.50 51.29 b±0.46
9 53.02 a±0.67 51.58±0.16
10 53.32 a±0.37 51.19 b±0.37
11 53.59 a±0.48 51.56 b±0.48
12 54.12 a±0.27 51.95 b±0.76
13 53.89 a±0.15 51.95 b±0.20
14 54.55 a±0.57 52.84 b±0.35
15 54.79 a±0.26 52.79 b±0.52
16 54.60 a±0.78 52.74±0.46
17 54.40 a±0.31 52.80 b±0.55
18 54.66 a±0.55 51.93 b±0.69
19 54.96 a±0.50 53.26±0.71
20 54.92 a±0.24 52.64 b±0.14
21 54.80 a±0.67 52.27±0.75
22 54.49±0.38
23 54.61±0.26
Mean±SEM 53.98*±0.45 51.97±0.46
Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. * P<0.05
group from 25th weeks post partum till the end of experiment. The Mean±SEM
concentration of plasma glucose in RB-S and RB-NS groups was 53.76±0.37
and 52.11±0.38 mg/dl respectively, which was significantly (P<0.05) higher in
RB-S when compared with RB-NS group.
Concentration of plasma glucose was significantly positively correlated
(P<0.01) with plasma IGF-1, LF and calcium concentration and negatively
correlated with concentration of plasma urea and Hp for RB-S and RB-NS
groups (Table 4.42).
4.4.3 Concentration of plasma glucose (mg/dl) in RgB and RB groups under field conditions.
The Mean±SE concentration of plasma glucose at weekly interval and
Mean±SEM values for RgB and RB groups under field conditions is presented in
Table 4.15 and depicted in Figure 4.8.
Under field conditions, at the beginning of experiment (4th week post
partum) level of plasma glucose in RgB and RB groups under field conditions
was 52.47±0.47 and 50.38±0.69 mg/dl respectively. Within both RgB and RB
groups, Mean±SE values for concentration of plasma glucose exhibited
increasing trend but difference was not significant from initial value throughout
the course of the experiment. Concentration of plasma glucose ranged between
52.38±0.69 and 54.91±0.62 mg/dl in RgB group during 23 weeks of experimental
period. Similarly concentration of plasma glucose in RB group ranged between
50.38±0.69 and 52.72±0.41 mg/dl. When Mean±SE values for concentration of
plasma glucose was compared between groups, significantly (P<0.05) higher
concentration was observed in RgB group at 4th, 5th, 8th,9th , 11th , 14th , 16-19th
and 21st week post partum. The Mean±SEM concentration of plasma glucose for
RgB and RB groups under farm conditions was 53.68±0.44 and 51.76±0.43
mg/dl respectively, which was significantly (P<0.05) greater in RgB when
compared with RB group.
Concentration of plasma glucose was significantly (P<0.01) positively
correlated with concentration of plasma IGF-1, LF, calcium and negatively
(P<0.01) correlated with concentration of plasma urea and Hp for both RgB and
RB groups (Table 4.43).
62 Results & Discussion
4.4.4 Concentration of plasma glucose (mg/dl) in RB-S and RB-NS groups under field conditions.
The Mean±SE concentration of plasma glucose at weekly interval and
Mean±SEM values for RB-S and RB-NS groups under field conditions is
presented in Table 4.16 and depicted in Figure 4.8.
At 22nd week post partum when probiotic was supplemented to RB-S
group concentration of plasma glucose was 52.16±0.28 mg/dl and in RB-NS
group was 51.98±0.22 mg/dl. Mean±SE values for concentration exhibited
increasing trend but difference was not significant from initial value throughout
the course of the experiment in RB-S and RB-NS groups. After supplementation
of probiotic to RB-S group plasma glucose concentration increased to
54.41±0.18 mg/dl over initial value. Plasma glucose concentration ranged
between 51.63±0.51 and 52.96±0.28 mg/dl in RB-NS group throughout the
experimental period. When Mean±SE values of plasma glucose concentration
was compared between groups, significantly (P<0.05) greater values were
observed in RB-S group at 34th and further from 38-40th week. The Mean±SEM
concentration of plasma glucose in RB-S and RB-NS groups was 53.39±0.41
and 52.48±0.34 mg/dl respectively. Concentration of plasma glucose was
significantly (P<0.05) greater in RB-S when compared with RB-NS group.
Concentration of plasma glucose was significantly positively correlated
(P<0.01) with concentration of plasma IGF-1, LF and calcium and negatively
correlated with concentration of plasma urea and Hp for both RB-S and RB-NS
groups (Table 4.44).
Results of present study indicated significant higher concentration of
plasma glucose in RgB group when compared with RB group under both farm
and field conditions. It is reported by Richards et al. (1989) that higher blood
glucose concentration increases progesterone production by increasing pulse
and mean concentration of LH which would be one of the reasons for RgB and
RB-S groups to conceive earlier. JoeArosh et al. (1998) suggested that
hypoglycemic condition in repeat breeder causes impaired hypothalamic
hypophysial ovarian axis and reduces ovarian activity. Number of studies show
relation between plasma glucose and ovarian function (Highshoe et al., 1991;
63 Results & Discussion
Table 4.14 Concentration of plasma glucose(mg/dl) in RB-S and RB-NS groups under farm conditions.
Weeks RB-S RB-NS
22 52.13 A±0.36 52.19±0.01
23 52.39 A ±0.50 51.86±0.71
24 52.98 A ±0.70 51.95±0.38
25 52.60 A a±0.72 52.25 b±0.11
26 53.32 A a±0.62 52.00b±0.40
27 53.35 Ba±0.38 52.32 b±0.71
28 53.85 Ba±0.06 52.71 b±0.42
29 54.47 Ba±0.22 52.11 b±0.13
30 53.76Ba±0.78 52.90 b±0.52
31 54.30Ba±0.11 51.77 b±0.61
32 53.78Ba±0.35 52.4 b±0.28
33 54.46 Ba±0.24 51.99b±0.33
34 54.07Ba±0.38 51.90b±0.17
35 54.13Ba±0.20 51.87b±0.49
36 54.17Ba±0.28 52.80b±0.28
37 54.46Ba±0.48 51.53b±0.51
38 54.46Ba±0.26 51.92b±0.55
39 54.19Ba±0.17 51.70b±0.47
40 54.61Ba ±0.29 51.97b±0.23
Mean±SEM 53.76*±0.37 52.11±0.38
Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group. Values with different superscripts (a, b) are significantly different (P<0.05) between RB-S and RB-NS groups. * P<0.05
Table 4.15 Concentration of plasma glucose (mg/dl) in RgB and RB groups under field conditions.
Weeks RgB RB
4 52.47a±0.47 50.38 b±0.69
5 52.69 a±0.30 50.57 b±0.80
6 52.38±0.69 51.21±0.71
7 52.86±0.47 51.14±0.73
8 52.51±0.47 51.51±0.65
9 53.15a±0.60 51.04b±0.66
10 52.93±0.37 51.80±0.39
11 53.71a±0.46 51.58b±0.23
12 53.23±0.26 52.06±0.47
13 54.10±0.60 52.03±0.14
14 53.70 a±0.47 52.01 b ±0.29
15 53.92±0.68 52.45±0.37
16 54.13 a±0.37 52.12 b±0.30
17 53.85 a±0.50 52.31 b±0.40
18 54.41a±0.28 52.01b±0.23
19 54.73a±0.14 52.19b±0.19
20 54.24±0.60 52.72±0.41
21 54.91a±0.62 52.47b±0.10
22 54.75±0.36
23 54.87±0.22
Mean±SEM 53.68*±0.44 51.76±0.43
Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. * P<0.05
Table 4.16 Concentration of plasma glucose (mg/dl) in RB-S and RB-NS groups under field conditions.
Weeks RB-S RB-NS
22 52.16±0.28 51.98±0.22
23 52.72±0.11 51.63±0.51
24 52.13±0.47 52.63±0.44
25 52.51±0.65 52.17±0.33
26 52.34±0.44 52.62±0.56
27 52.73±0.33 51.90±0.38
28 53.09±0.52 52.42±0.21
29 53.36±0.66 52.59±0.18
30 53.24±0.62 52.78±0.58
31 53.46±0.56 52.96±0.28
32 53.64±0.27 52.40±0.47
33 53.74±0.57 52.78±0.38
34 53.78a±0.13 52.89b±0.31
35 54.27±0.38 52.45±0.28
36 54.30±0.55 52.79±0.37
37 54.02±0.42 52.80±0.19
38 54.24a±0.41 52.60b±0.28
39 54.34a±0.48 52.39b±0.34
40 54.41a±0.18 52.36b±0.13
Mean±SEM 53.39*±0.41 52.48±0.34
Values with different superscripts (a, b) are significantly different (P<0.05) between RB-S and RB-NS groups. * P<0.05
4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 4040
45
50
55
60
65
70
RgB RB-S RB-NS
Weeks
Conc
. of p
lasm
a G
luco
se(m
g/dl
)
Figure 4.7 Concentration of plasma glucose in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm conditions.
4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 4040
45
50
55
60
65
70
RgB RB-S RB-NS
Weeks
Conc
. of p
lasm
a G
luco
se(m
g/dl
)
Figure 4.8 Concentration of plasma glucose in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions.
Wehrman et al., 1991; Stewart et al., 1995; Rabiee et al., 1997). Miyoshi et al.
(2001) suggested that cows with higher concentration of plasma glucose will
have better ovarian activity. Even though concentration of plasma glucose was
not significantly different but practically, concentration of 50.38±0.69mg/ml in RB
group at 4th week of experiment, had negative effect on reproductive function.
Hence in the present study, RB group of animals had lower glucose
concentration which might have affected ovarian activity and might have
decreased conception rate. This might be one of the reason of infertility in repeat
breeding groups under both farm and field conditions. The finding of this study
are in accordance with the earlier reports by Jani et al. (1995) who observed
high incidence of repeat-breeding and anoestrous problem associated with the
low plasma glucose level. The present findings are also in agreement with El-
Belely (1993) who suggested that lower level of plasma glucose might be the
reason for reduced luteal function in repeat breeding cows. A contradictory
report (Kapadia et al., 2013) is also available stating no significant difference in
concentration of plasma glucose when compared between RgB and RB groups.
Action of Saccharomyces cerevisiae like oxygen uptake, supply of growth
factors and pH stabilization synergistically act for growth of rumen microbes.
Saccharomyces cerevisiae directly stimulated rumen fungi, which may improve
fiber digestion (Chaucheryas et al., 1995). Nisbet and Martin (1991), Gattass et
al. (2008) reported increase in glucogenic VFA production in rumen of cows
supplemented with Saccharomyces cerevisiae in comparision to RB-NS group.
Glucogenic VFA converts into glucose on metabolism. These mechanisms may
explain the significant (P<0.05) greater concentration of plasma glucose in RB-S
group when compared with RB-NS group under farm and field conditions.
4.5 UREA
4.5.1 Concentration of plasma urea (mg/dl) in RgB and RB groups under farm conditions.
The Mean±SE concentration of plasma urea at weekly interval and
Mean±SEM values for RgB and RB groups under farm conditions is presented in
Table 4.17 and depicted in Figure 4.9.
64 Results & Discussion
Under farm conditions, at the beginning of experiment (4th week post
partum) level of plasma urea in RgB and RB groups was 22.29±1.40and
26.03±1.34 mg/dl respectively. Within both RgB and RB groups, Mean±SE
values for concentration exhibited increasing trend but difference was not
significant from initial value till end of the experiment. The results in the present
study indicate that concentration of plasma urea in RgB decreased from initial
value to16.14±1.02 by 23rd week post partum. The percent decrease in
concentration of plasma urea over initial value at 23rd week post partum in RgB
groups was 27.6%. Concentration of plasma urea in RB group at start of the
experiment was 26.03±1.34 mg/dl which decreased to 21.03±0.92 mg/dl at 21st
week post partum. The percent decrease in concentration of plasma urea over
initial value at 21st week post partum in RB groups was 19.2%. When Mean±SE
values for concentration of plasma urea was compared between groups,
significantly (P<0.05) less concentration was observed in RgB group at 5th, 12th,
13th, 17th and 21st week. The Mean±SEM concentration of plasma urea for RgB
and RB groups was 18.6±1.30 and 22.53±1.18 mg/dl. Concentration of plasma
urea was significantly (P<0.01) greater in RB group when compared with RgB
group.
Concentration of plasma urea was significantly positively correlated
(P<0.01) with concentration of plasma Hp and negatively correlated (P<0.01)
with plasma concentration of LF, IGF-1(P<0.01), glucose and calcium (P<0.05)
for both RgB and RB groups (Table 4.41).
4.5.2 Concentration of plasma urea (mg/dl) in RB-S and RB-NS groups under farm conditions.
The Mean±SE concentration of plasma urea at weekly interval and
Mean±SEM values for RB-S and RB-NS groups under farm conditions is
presented in Table 4.18 and depicted in Figure 4.9.
At 22nd week post partum when probiotic was supplemented to RB-S
group concentration of plasma urea was 21.09±1.31 mg/dl whereas in RB-NS
group was 22.55±1.32 mg/dl. Within both RB-S and RB-NS groups,
concentration of plasma urea exhibited decreasing trend but difference was not
significant from initial value till 40th week of experiment. Concentration of plasma
65 Results & Discussion
Table 4.17 Concentration of plasma urea (mg/dl) in RgB and RB groups under farm conditions.
Weeks RgB RB
4 22.29±1.40 26.03±1.34
5 21.75a±0.81 25.31b±1.28
6 22.01±1.47 25.32±1.18
7 20.71±0.89 24.11±1.28
8 21.16±0.94 24.21±1.23
9 21.94±0.79 24.23±0.98
10 20.66±0.64 23.42±2.23
11 18.80±1.47 22.49±0.40
12 17.82a ±0.91 21.62 b ±1.28
13 17.92a ±2.26 20.90 b±1.61
14 16.72±1.57 20.68±1.18
15 17.45±0.90 20.33±1.28
16 17.41±1.92 20.99±1.27
17 16.67a±0.92 21.22 b±0.34
18 17.97±2.27 21.95±0.81
19 17.03±1.54 20.62±1.42
20 16.24±1.27 21.07±1.25
21 15.43a±0.82 21.03 b±0.92
22 15.97±2.15
23 16.14±1.02
Mean±SEM 18.6±1.30 22.53**±1.18
Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. ** P<0.01
urea in RB-S group decreased to 15.93±0.36 mg/dl and in RB-NS group
deceased to 21.19±0.94 mg/dl over initial value at 40th week. The percent
decrease in RB-S and RB-NS groups at end of experiment was 24.46 and 6.03
% respectively. When Mean±SE values for concentration of plasma urea was
compared between groups, concentration was significantly (P<0.05) less in RB-
S group from 32nd till end of the experiment except at 38th and 39th week. The
Mean±SEM concentration of plasma urea in RB-S and RB-NS groups was
18.23±1.28 and 22.41±1.13 mg/dl respectively. Concentration of plasma urea
was significantly (P<0.05) greater in RB-NS when compared with RB-S group.
Concentration of plasma urea was significantly positively correlated
(P<0.01) with concentration of plasma Hp and negatively correlated (P<0.01)
with concentration of plasma of IGF-1(P<0.05) and Lactofferrin (P<0.01) for both
RB-S and RB-NS groups (Table 4.42).
4.5.3 Concentration of plasma urea (mg/dl) in RgB and RB groups under field conditions.
The Mean±SE concentration of plasma urea at weekly interval and
Mean±SEM values for RgB and RB groups under field conditions is presented in
Table 4.19 and depicted in Figure 4.10.
Under field conditions, at the beginning of experiment (4th week post
partum) level of plasma urea in RgB and RB groups under field conditions was
23.92±1.23 and 25.55±1.10mg/dl respectively. The results in the present study
indicate that Mean±SE values for concentration decreased significantly (P<0.05)
from initial value from 17th-20th week post partum when compared within RgB
group. The percent decrease in concentration of plasma urea over initial value in
the plasma samples collected at 23th week post partum in RgB groups was
34.33%. Similarly, declining trend in concentration of plasma urea in RB group
from initial value till 21th week post partum was observed. Within in RB group
concentration of plasma urea decreased but difference was not significant from
initial value throughout the course of the experiment. Plasma urea concentration
in RB group at start of the experiment was 25.55±1.10 mg/dl decreased to
20.95±0.93 mg/dl at 21th week post partum. The percent decrease in plasma
urea concentration over initial value at 21th week post partum in RB groups was
66 Results & Discussion
18%. When Mean±SE values of plasma urea concentration was compared
between groups, significantly (P<0.05) less value was observed for RgB group at
8th, 11th, and further from 18th – 21st week. The Mean±SEM concentration of
plasma urea for RgB and RB groups was 18.55±1.21 and 23.03±1.13 mg/dl.
Concentration of plasma urea was significantly (P<0.05) greater in RB when
compared with RgB group.
Concentration of plasma urea was significantly positively correlated
(P<0.01) with concentration of plasma Hp and negatively correlated with
concentration of plasma of IGF-1, LF, glucose (P<0.01) and calcium (P<0.05) for
RgB and RB groups (Table 4.43).
4.5.4 Concentration of plasma urea (mg/dl) in RB-S and RB-NS groups under field conditions.
The Mean±SE concentration of plasma urea collected at weekly interval
and Mean±SEM values for RB-S and RB-NS groups under field conditions is
presented in Table 4.20 and depicted in Figure 4.10.
At 22nd week post partum when probiotic was supplemented to RB-S
group, concentration of plasma urea was 21.07±0.64mg/dl and in RB-NS group
was 21.71±0.95 mg/dl. Within RB-S and RB-NS groups, concentration of plasma
urea exhibited decreasing trend till the end of experiment tenure but the
difference was not significant from the initial value till 40th week. Plasma urea
concentration in RB-S group decreased to 16.10±1.03 mg/dl and in RB-NS
group decreased to 22.08±1.36 mg/dl over initial value. The percent decrease in
concentration of plasma urea from its initial concentration in both RB-S and RB-
NS groups at the end of the experiment were 23.58 and 1.7 % respectively.
When Mean±SE values for concentration of plasma urea was compared
between group, values were significantly (P<0.05) less for RB-S group from 29th
week till end of the experiment. The Mean±SEM concentration of plasma urea in
RB-S and RB-NS groups was 18.02±1.8 and 22.68±1.10 mg/dl respectively.
Concentration of plasma urea was significantly (P<0.05) greater in RB-NS when
compared with RB-S group.
Concentration of plasma urea was significantly positively correlated
(P<0.01) with concentration of plasma Hp and negatively correlated (P<0.01)
67 Results & Discussion
Table 4.18 Concentration of plasma urea (mg/dl) in RB-S and RB-NS groups under farm conditions.
Weeks RB-S RB-NS
22 21.09±1.31 22.55±1.32
23 20.83±1.28 22.58±0.53
24 20.35±1.35 23.28±1.27
25 21.42±2.14 23.07±1.24
26 20.82±1.28 23.75±1.43
27 20.93±1.39 22.42±0.92
28 19.87±1.28 22.88±0.99
29 20.00±1.27 22.80±1.24
30 18.27±1.21 22.08±1.28
31 17.80±1.37 23.20±1.20
32 16.88a±1.37 22.37b±1.55
33 16.06a±2.22 23.37b±1.45
34 16.38a±1.16 22.22b±0.95
35 16.34a±0.94 22.10b±1.15
36 15.73a±1.21 21.81b±1.31
37 16.79a±1.21 20.98b±0.21
38 15.55±0.12 20.98±1.23
39 16.32±1.01 22.24±1.26
40 15.93a±0.36 21.19b±0.94
Mean±SEM 18.23±1.28 22.41*±1.13
Values with different superscripts (a, b) are significantly different (P<0.05) between RB-S and RB-NS groups. * P<0.05
Table 4.19 Concentration of plasma urea (mg/dl) in RgB and RB groups under field conditions.
Weeks RgB RB
4 23.92A±1.23 25.55±1.10
5 22.75 A ±1.97 24.78±1.08
6 21.71 A ±1.31 23.94±1.44
7 22.41 A ±0.98 24.64±1.07
8 21.06 A a±1.27 24.74b±0.71
9 20.39 A ±2.12 24.76±0.52
10 19.32 A ±1.60 23.25±1.36
11 18.70 A a±1.93 23.98b±0.98
12 18.52 A ±0.82 22.05±1.42
13 17.40 A ±2.71 21.43±1.44
14 17.66 A a±1.21 23.13b±0.63
15 17.09 A a±0.96 22.15 b±1.48
16 17.22 A a±1.32 21.44 b±1.10
17 16.53 Ba±1.28 21.80 b±1.33
18 16.60 Ba ±1.28 22.39 b±0.95
19 15.44 Ba ±0.94 20.95 b±1.30
20 16.07 Ba±1.32 22.62 b±2.26
21 16.35 A a±0.95 20.95 b ±0.93
22 15.24 A ±1.30
23 15.71 A ±1.02
Mean±SEM 18.55±1.21 23.03*±1.13
Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group. Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. * P<0.05
Table 4.20 Concentration of plasma urea (mg/dl) in RB-S and RB-NS groups under field conditions.
Weeks RB-S RB-NS
22 21.07±0.64 21.71±0.95
23 21.36±1.14 22.63±2.30
24 19.82±0.99 22.24±2.20
25 20.92±1.30 22.62±1.23
26 21.35±0.94 22.85±0.96
27 18.81±1.42 22.58±1.51
28 19.59±0.65 21.54±2.45
29 19.47 a±1.30 23.78±1.30
30 17.57a±1.35 22.30 b±0.90
31 17.38a±2.18 22.36b±1.05
32 16.33a±1.37 23.51b±2021
33 17.95 a±0.81 22.57b±1.45
34 15.85a±2.16 23.36b±0.91
35 15.91a±1.24 23.28b±1.21
36 16.71a±0.94 22.89b±2.76
37 17.17a±1.18 24.14b±0.95
38 17.12a±0.94 22.20b±0.49
39 14.93a±1.06 22.28 b±1.17
40 16.10a±1.03 22.08 b±1.36
Mean±SEM 18.02±1.8 22.68*±1.10
Values with different superscripts (a, b) are significantly different (P<0.05) between RB-S and RB-NS groups. * P<0.05
5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 4110
20
30
40
RgB RB-S RB-NS
Weeks
Conc
.of p
lasm
a Ur
ea(m
g/dl
)
Figure 4.9 Concentration of plasma urea in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm conditions
4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 4010
15
20
25
30
RgB RB-S RB-NS
Weeks
Conc
. of P
lasma
Ure
a(m
g/dl)
Figure 4.10 Concentration of plasma urea in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions.
with concentration of plasma of IGF-1 (P<0.05) and Lactofferrin (P<0.01) for both
RB-S and RB-NS groups (Table 4.44).
In the present study concentration of plasma urea was greater in RB
when compared with RgB group under both farm and field conditions. The
results are in accordance with (WestWood et al., 1998) who reported negative
relationship between concentration of plasma urea and conception rate in cattle.
Number of studies reported negative relationship between plasma concentration
of urea and pregnancy rate (Elrod and Butler, 1993; Elrod et al., 1993; Ferguson
et al. 1993; Dhali et al., 2006). According to Dhali (2001) greater serum or
plasma urea nitrogen concentration reduces LH binding to ovarian receptors and
reduces or delays ovulation. It has been observed that increased concentration
plasma urea may interfere with the normal inductive actions of progesterone on
the microenvironment of the uterus and, thereby, cause suboptimal conditions
for support of embryo implantation (Hamman et al., 2000; Papadopoulas et al.,
2001). As delayed ovulation and inability of embryo implantation are the reasons
of repeat breeding in cattle. In RB group plasma level of urea was greater than
the physiological level, which might have altered uterine pH level and further
development of embryo. Higher concentration of plasma urea may be one of the
causes for repeat breeding under both farm and field conditions.
In the present study negative correlation was observed between plasma
glucose and urea which is in confirmation with other studies of Westwood et al.
(1998), Shingu et al. (2009) and Shehab-el-deen (2011).
4.6 CALCIUM
4.6.1 Concentration of plasma calcium (mg/dl) in RgB and RB groups under farm conditions.
The Mean±SE concentration of plasma calcium at weekly interval and
Mean±SEM values for RgB and RB groups under farm conditions is presented in
Table 4.21 and depicted in figure 4.11.
Under farm conditions, at the beginning of experiment (4th week post
partum) concentration of plasma calcium in RgB and RB groups was 9.44±0.26
and 9.12±0.30 mg/dl respectively. Within both RgB and RB groups, Mean±SE
values for concentration exhibited increasing trend but difference was not
68 Results & Discussion
significant from initial value throughout the course of the experiment. The
percent increase in concentration of plasma calcium post partum in RgB group
was 15.9 %. Concentration of plasma calcium in RB group at the beginning was
9.12±0.30 mg/dl which increased to 9.64±0.18 mg/dl by 21st week post partum.
Only 0.52 mg/dl increase was observed in concentration of plasma calcium by
21th week post partum in RB group. When Mean±SE values for concentration of
plasma calcium was compared between groups, significantly (P<0.05) greater
concentration was observed for RgB group at 14th, 15th, 18th, 19th and 21st week.
The Mean±SEM concentration of plasma calcium for RgB and RB group under
farm conditions was 10.36±0.28 and 9.52±0.27 mg/dl respectively. Concentration
of plasma calcium concentration was significantly (P<0.05) high in RgB when
compared with RB group.
Concentration of plasma calcium was significantly positively correlated
with concentration of plasma IGF-1, LF (P<0.05), glucose (P<0.01) and
negatively correlated with concentration of plasma urea (P<0.01) and Hp
(P<0.05) for RgB and RB groups (Table 4.41).
4.6.2 Concentration of plasma calcium (mg/dl) in RB-S and RB-NS groups under farm conditions.
The Mean±SE concentration of plasma calcium at weekly interval and
Mean±SEM values for RB-S and RB-NS groups under farm conditions is
presented in Table 4.22 and depicted in figure 4.11.
At 22nd week post partum when probiotic was supplemented to RB-S
group, concentration of plasma calcium was 9.73±0.30 mg/dl and in RB-NS
group was 9.79±0.31mg/dl. Mean±SE values for concentration of plasma
calcium exhibited increasing trend but difference was not significant from initial
value till 40th week in RB-S and RB-NS groups. In RB-S group, concentration of
plasma calcium increased from 22nd to 40th week post partum. Concentration of
plasma calcium in RB-S group increased to 10.50±0.29 mg/dl. The percent
increase in concentration of plasma calcium from 22nd to 40th week post partum
in RB-S and RB-NS group was 7.9 % and 1.73 % respectively. When Mean±SE
values of RB-S and RB-NS group was compared, difference was not significant
throughout the course the experiment. The Mean±SEM concentration of plasma
69 Results & Discussion
Table.4.21 Concentration of plasma calcium (mg/dl) in RgB and RB groups under farm conditions.
Weeks RgB RB
4 9.44±0.26 9.12±0.30
5 9.61±0.36 9.01±0.20
6 9.54±0.30 9.14±0.30
7 9.71±0.21 9.31±0.26
8 9.64±0.44 9.34±0.31
9 10.09±0.40 9.49±0.20
10 10.25±0.28 9.42±0.39
11 10.50±0.43 9.73±0.13
12 10.57±0.33 9.67±0.31
13 10.61±0.18 9.91±0.36
14 10.70a±0.25 9.57 b±0.10
15 10.50a±0.11 9.69 b ±0.17
16 10.52±0.36 9.49±0.40
17 10.72±0.36 9.79±0.24
18 10.94a±0.14 9.76 b±0.20
19 10.50a±0.13 9.57 b±0.34
20 10.81±0.36 9.73±0.40
21 10.82a±0.34 9.64 b±0.18
22 10.76±0.23
23 10.94±0.17
Mean±SEM 10.36*±0.28 9.52±0.27
Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. * P<0.05
calcium in RB-S and RB-NS groups was 10.29±0.32 and 9.96±0.25 mg/dl
respectively. The concentration of plasma calcium was not significantly different
between the groups.
Concentration of plasma calcium was significantly positively correlated
(P<0.05) with concentration plasma IGF-1 for RB-S and RB-NS groups (Table
4.42).
4.6.3 Concentration of plasma calcium (mg/dl) in RgB and RB groups under field conditions.
The Mean±SE concentration of plasma calcium at weekly interval and
Mean±SEM values for RgB and RB groups under field conditions is presented in
Table 4.23 and depicted in figure 4.12.
Under field conditions, at the beginning of experiment (4th week post
partum) concentration of plasma calcium in RgB and RB groups under field
conditions was 9.02±0.20 and 8.95±0.28 mg/dl respectively. The result in the
present study indicated that plasma calcium concentration in RgB group
increased from initial value till 23rd week but was significantly (P<0.05) different
from initial value only at 19th and 20th week post partum. The percent increase in
plasma calcium concentration over initial value at 23rd week post partum in RgB
groups was 19.3 %. Within RB group, concentration of plasma calcium did not
increase significantly from initial value till the end of experiment. Concentration of
plasma calcium in RB increased from 8.95±0.28 mg/dl to 9.55±0.13 mg/dl at 21st
week post partum. The percent increase in plasma calcium concentration at 21st
week post partum in RB groups was 6.7 %. When Mean±SE values of
concentration of plasma calcium was compared between groups, significantly
higher (P<0.05) values were observed for RgB group from 11th week till the end
of the experiment. The values were not significant except at 12th, 14th and 16th
weeks. The Mean±SEM concentration of plasma calcium for RgB and RB groups
under field conditions was 9.98±0.27 and 9.28±0.21 mg/dl respectively.
Concentration of plasma calcium was significantly (P<0.05) higher in RgB when
compared with RB group.
Concentration of plasma calcium was significantly (P<0.05) positively
correlated with concentration of plasma IGF-1, LF and glucose and negatively
70 Results & Discussion
correlated (P<0.05) with concentration of plasma urea and Hp for both RgB and
RB groups (Table 4.43).
4.6.4 Concentration of plasma calcium (mg/dl) in RB-S and RB-NS groups under field conditions.
The Mean±SE concentration of plasma calcium at weekly interval and
Mean±SEM values for RB-S and RB-NS groups under field conditions is
presented in Table 4.24 and depicted in figure 4.12.
At 22nd week post partum when probiotic was supplemented to RB-S
group concentration of plasma calcium was 9.44±0.16 mg/dl and in RB-NS
group was 9.59±0.28 mg/dl. Within both RB-S and RB-NS groups, Mean±SE
values for concentration exhibited increasing trend but difference was not
significant from initial value till the end of the experiment. The percent increase in
concentration of plasma calcium over initial value in RB-S group at end of
experiment was 10.27%. In RB-NS group only 6 % increase in concentration of
plasma calcium from initial value was observed. When Mean±SE values for
concentration of plasma calcium was compared between groups, values were
not significantly different till the end of the experiment. The Mean±SEM
concentration of plasma calcium in RB-NS and RB-S groups was 10.19±0.19
and 9.99±0.24 mg/dl respectively. The concentration of plasma calcium was not
significantly different between the groups.
Concentration of plasma calcium was significantly positively correlated
(P<0.05) with concentration of plasma IGF-1 for both RB-S and RB-NS groups
(Table 4.44).
Das et al. (2009) reported significant (p<0.01) decrease in plasma level of
calcium among crossbred cattle with repeat breeding problem. Calcium plays an
important role in gonadotropic regulation of ovarian steroidogenesis (Carnegie
and Tsang, 1984) and ovulation (Peracchia, 1978). Results of present study
indicate significantly greater concentration of plasma calcium in RgB group when
compared with RB group under both farm and field conditions. As disturbed
steriodogenesis and ovulation are causes of infertility, results of present study
may correlate with early conception in RgB group and delay in RB group under
both farm and field conditions.
71 Results & Discussion
Table 4.22 Concentration of plasma calcium (mg/dl) in RB-S and RB-NS groups under farm conditions.
Weeks RB-S RB-NS
22 9.73±0.30 9.79±0.31
23 9.65±0.27 9.71±0.31
24 9.97±0.37 9.93±0.28
25 10.12±0.24 9.98±0.11
26 10.22±0.21 9.83±0.30
27 10.16±0.40 9.87±0.23
28 10.35±0.40 10.10±0.28
29 10.33±0.23 9.96±0.30
30 10.40±0.46 9.93±0.10
31 10.28±0.18 9.98±0.24
32 10.50±0.46 10.06±0.26
33 10.28±0.46 9.94±0.13
34 10.30±0.32 9.86±0.29
35 10.54±0.32 10.04±0.31
36 10.50±0.29 10.06±0.23
37 10.50±0.26 10.14±0.26
38 10.66±0.29 10.02±0.27
39 10.44±0.40 10.10±0.32
40 10.50±0.29 9.96±0.21
Mean±SEM 10.29±0.32 9.96±0.25
Table 4.23 Concentration of plasma calcium (mg/dl) in RgB and RB groups under field conditions.
Weeks RgB RB
4 9.02A±0.20 8.95±0.28
5 9.14 A ±0.32 8.82±0.14
6 9.35 A ±0.15 8.95±0.18
7 9.28 A ±0.22 9.12±0.16
8 9.42 A ±0.32 9.05±0.28
9 9.32 A ±0.28 8.95±0.23
10 9.55 A ±0.36 9.16±0.34
11 9.98 A a±0.25 9.24 b±0.19
12 9.76 A ±0.48 9.08±0.33
13 10.06 A a±0.18 9.32 b±0.22
14 10.02 A ±0.30 9.48±0.26
15 9.92 A a±0.17 9.40 b±0.08
16 10.34 A ±0.30 9.40±0.29
17 10.54 A a±0.26 9.70 b ±0.12
18 10.36 va±0.30 9.67 b ±0.09
19 10.82 Ba±0.30 9.48b±0.25
20 10.63 Ba±0.12 9.74 b±0.26
21 10.84 A a ±0.25 9.55b±0.13
22 10.58 A ±0.28
23 10.76 A ±0.42
Mean±SEM 9.98*±0.27 9.28±0.21
Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group. Values with different superscripts (a, b) are significantly different (P<0.05) between RgB and RB groups. * P<0.05
Table 4.24 Concentration of plasma calcium (mg/dl) in RB-S and RB-NS groups under field conditions.
Weeks RB-S RB-NS
22 9.44±0.16 9.59±0.28
23 9.56±0.26 9.51±0.14
24 9.88±0.25 9.83±0.24
25 10.03±0.26 9.68±0.26
26 10.13±0.14 9.93±0.16
27 10.07±0.25 9.87±0.14
28 10.26±0.20 9.91±0.19
29 10.24±0.09 9.92±0.26
30 10.31±0.13 10.12±0.23
31 10.19±0.41 9.98±0.37
32 10.41±0.21 9.96±0.35
33 10.39±0.12 10.14±0.30
34 10.33±0.10 10.22±0.29
35 10.45±0.12 10.24±0.18
36 10.41±0.29 10.26±0.12
37 10.31±0.18 10.14±0.35
38 10.47±0.08 10.10±0.18
39 10.35±0.27 10.20±0.28
40 10.41±0.15 10.26±0.24
Mean±SEM 10.19±0.19 9.99±0.24
4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 407
8
9
10
11
12RgB RB-S RB-NS
Weeks
Con
c. o
f pla
sma
Cal
cium
(mg/
dl)
Figure 4.11 Concentration of plasma calcium in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm conditions.
4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 407
8
9
10
11
12RgB RB-S RB-NS
Weeks
Con
c.of
pla
sma
Cal
cium
(mg/
dl)
Figure 4.12 Concentration of plasma calcium in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions.
Although concentration of calcium is low in RB and RB-NS groups,
animals were not in hypocalcaemic condition. As phenonemena of
steriodogenesis and ovulation are affected by the circulatory level of calcium, the
less concentration of calcium in RB group may be one of the reason resulting in
nil conception rate in cows even after three consecutive services. But in the
present study it was observed that increase in concentration of plasma calcium
in RB-S group was not significant when compared with RB-NS group even after
supplementation. Results are in accordance with Nikkhah et al. (2004) who
reported that change was not significant with respect to level of plasma calcium
in different experimental groups receiving 3, 6 and 12 g of Saccharomyces
cerevisiae per day along with the diet.
4.7 DRY MATTER INTAKE (DMI)
4.7.1 Dry matter intake (Kg/day) in RgB and RB KF groups under farm conditions.
The Mean±SE DMI estimated at weekly interval and Mean±SEM values
for RgB and RB groups under farm conditions is presented in Table 4.25 and
depicted in figure 4.13.
Under farm conditions, at the beginning of experiment (4th week post
partum) Mean±SE DMI in RgB and RB groups under farm conditions was
12.08±0.43 and 11.80±0.36 kg/day respectively. Within both RgB and RB
groups, Mean±SE values of DMI did not differ significantly from initial value till
the end of the experiment. Highest DMI in RgB group was recorded at 12th week
i.e. 13.37±0.56 kg/day and highest DMI in RB group was recorded at 9th week
i.e. 12.97 kg/day. The percent increase in DMI from 4th week in RgB groups by
23 rd week post partum was 5.2 % and in RB groups by 21st week post partum
was 2.1 %. When Mean±SE values of DMI was compared between group, no
significant difference was observed till the end of the experiment. The
Mean±SEM DMI for RgB and RB groups under farm conditions was 12.71±0.38
and 12.42±0.46 kg/day respectively. But the difference between the DMI for the
two groups was not significantly different.
72 Results & Discussion
4.7.2 Dry matter intake (Kg/day) in RB-S and RB-NS groups under farm conditions.
The Mean±SE DMI estimated at weekly interval and Mean±SEM values
for RB-S and RB-NS groups under farm conditions is presented in Table 4.26
and depicted in figure 4.13.
At 22nd week post partum when probiotic was supplemented to RB-S
group Mean±SE DMI was 11.06±0.35 kg/day and in RB-NS group DMI was
11.18±0.39 kg/day. Within RB-S and RB-NS groups, Mean±SE values of DMI
exhibited decreasing trend but difference was not significant from initial value till
40th week post partum. The Mean±SE DMI in RB-S group decreased to
9.30±0.25 kg/day and in RB-NS group deceased to 9.03±0.35 kg/day over initial
DMI. The percent decreases in DMI over initial value in RB-S and RB-NS group
at end of experiment was 15.9 and 19.2 % respectively. When Mean±SE values
of DMI was compared between RB-S and RB-NS groups, significant difference
was not observed till the end of the experiment. The Mean±SEM DMI in RB-S
and RB-NS groups was 10.41±0.37 and 10.12±0.36 kg/day respectively. DMI
values for both RB-S and RB-NS groups were not significantly different.
4.7.3 Dry matter intake (Kg/day) in RgB and RB groups under field conditions.
The Mean±SE DMI estimated at weekly interval and Mean±SEM values
for RgB and RB groups under field conditions is presented in Table 4.27 and
depicted in figure 4.14.
Under field conditions, at the beginning of experiment (4th week post
partum) DMI in RgB and RB groups under field conditions was 11.83±0.23 and
11.43±0.33 kg/day respectively. Mean±SE values of DMI did not differ
significantly within RgB and RB groups from initial value throughout the course of
the experiment. Highest Mean±SE DMI in RgB group was recorded at 8th week
i.e. 12.92±0.44 kg/day and highest Mean±SE DMI in RB group was recorded at
11th week i.e. 12.64±0.09 kg/day. When Mean±SE values of DMI were compared
between groups, difference was not significant till the end of the experiment. The
Mean±SEM DMI for both RgB and RB groups under field conditions was
73 Results & Discussion
Table 4.25 Dry matter intake (Kg/day) of RgB and RB groups under farm conditions.
Weeks RgB RB
4 12.08±0.43 11.80±0.36
5 12.50±0.18 11.96±0.55
6 12.73±0.27 12.41±0.45
7 13.08±0.34 12.48±0.39
8 13.30±0.15 12.70±0.65
9 13.17±0.35 12.97±0.35
10 13.26±0.47 12.66±0.57
11 13.34±0.29 12.85±0.26
12 13.37±0.56 12.80±0.45
13 13.06±0.36 12.95±0.43
14 13.20±0.66 12.63±0.28
15 12.90±0.35 12.43±0.37
16 12.87±0.45 12.42±0.34
17 12.71±0.19 12.53±0.55
18 12.72±0.35 12.39±0.58
19 12.54±0.35 12.22±0.77
20 12.20±0.65 11.72±0.34
21 12.21±0.46 11.55±.54
22 11.50±0.25
23 11.45±0.47
Mean±SEM 12.71±0.38 12.42±0.46
Table 4.26 Dry matter intake (Kg/day) in RB-S and RB-NS groups under farm conditions.
Weeks RB-S RB-NS
22 11.06±0.35 11.18±0.39
23 11.12±0.27 11.25±0.35
24 11.08±0.29 10.96±0.32
25 10.90±0.46 10.62±0.25
26 10.90±0.66 10.58±0.26
27 10.75±0.36 10.40±0.45
28 10.57±0.25 10.40±0.43
29 10.68±0.36 10.25±0.28
30 10.57±0.35 10.07±0.47
31 10.48±0.47 10.18±0.34
32 10.41±0.16 10.07±0.45
33 9.96±0.45 9.98±0.28
34 10.20±0.37 9.61±0.37
35 10.22±0.28 9.76±0.26
36 10.27±0.55 9.69±0.49
37 9.86±0.43 9.62±0.36
38 10.03±0.45 9.57±0.55
39 9.50±0.39 9.09±0.27
40 9.30±0.25 9.03±0.35
Mean±SEM 10.41±0.37 10.12±0.36
12.27±0.27 and 12.11±0.34 kg/day respectively. But the difference between the
DMI for the two groups was not significantly different.
4.7.4 Dry matter intake (Kg/day) in RB-S and RB-NS groups under field conditions.
The Mean±SE DMI estimated at weekly interval and Mean±SEM values
for RB-S and RB-NS groups under field conditions is presented in Table 4.28
and depicted in figure 4.14.
At 22nd week post partum when probiotic was supplemented to RB-S
group Mean±SE DMI was 10.86±0.32 kg/day and in RB-NS group was
10.93±0.64 kg/day. Within both RB-S and RB-NS groups, Mean±SE values of
DMI exhibited decreasing trend but difference was not significant from initial
value till 40th week post partum. Mean±SE DMI till the end of study period (40th
week) in RB-S group decreased to 9.52±0.21 kg/day and in RB-NS group
deceased to 9.19±0.34 kg/day over initial value. The percent decrease in DMI
over initial value in RB-S and RB-NS groups at end of experiment were 12.33
and 15.9 % respectively. When Mean±SE values of DMI were compared
between groups, difference was not significant till end of the experiment. The
Mean±SEM DMI in RB-S and RB-NS groups under field conditions was
10.28±0.36 and 9.90±0.33 kg/day respectively. DMI values for both RB-S and
RB-NS groups were not significantly different.
In the present study non significantly greater DMI in RgB when compared
with RB groups under both farm and field conditions. Results are in accordance
with Markusfeld et al. (1997) who failed to observe any relationship between
body weight at calving and first service conception rate in crossbred cows.
Similarly, Wathes et al. (2007) did not find a relationship between calving BCS,
BCS at 60 day post partum, or BCS change with the conception at first service.
DMI values were greater in RB-S when compared with RB-NS groups
under both farm and field conditions. But the differences were not significant.
Effect of supplementation of Saccharomyces cerevisae on DMI in RB-S and RB-
NS groups under farm and field conditions are in accordance with study
conducted by (Arambel and Kent, 1990; Soder and Holden, 1999). They
reported non significant change in DMI on systematic supplementation of
74 Results & Discussion
Saccharomyces cerevisiae in crossbred cows. Results of present study are
controversial when compared with reports of Williams et al. (1991); Wohlt et al.
(1991) and Dann et al. (2000).They had reported significant increase in DMI on
systematic supplementation of yeast i.e. Saccharomyces cerevisiae in crossbred
cows during stressful conditions like pregnancy or early lactation. Phillips and
VonTungelin (1984) and Barling (2014) reported similarly for catlle under
environmental stress conditions.
4.8 MILK YIELD
4.8.1 Milk yield (Kg/day) in RgB and RB groups under farm conditions.
The Mean±SE milk yield estimated at weekly interval and Mean±SEM
values for RgB and RB groups under farm conditions is presented in Table 4.29
and depicted in figure 4.15.
Under farm conditions, at the beginning of experiment (4th week post
partum) milk yield in RgB and RB groups under farm conditions was 15.7±0.56
and 15.7±0.49 kg/day respectively. Mean±SE values of milk yield when
compared within RgB group significant (P<0.05) difference was observed at 12th
week post partum. Whereas in RB group milk yield was not significantly different
from initial value throughout the course of the experiment. Highest milk yield of
18.3±0.69 kg/day in RgB group was recorded at 12th week and in RB group was
also recorded at 12th week i.e. 17.8±0.58 kg/day. The percent decreased milk
yield over initial value at 23rd week post partum in RgB groups was 4.5% and the
percent decrease in milk yield over initial value at 21st week post partum in RB
groups was 2.5%. When Mean±SE values of milk yield was compared between
groups, significant difference was not observed till the end of the experiment.
The Mean±SEM milk yield for RgB and RB groups under farm conditions was
16.93±0.51 and 16.57±0.56 kg/day respectively. Milk yield recorded for both RgB
and RB groups was not significantly different.
75 Results & Discussion
Table 4.27 Dry matter intake (Kg/day) in RgB and RB groups under field conditions.
Weeks RgB RB
4 11.83±0.23 11.43±0.33
5 12.34±0.12 11.94±0.54
6 12.51±0.32 12.21±0.23
7 12.51±0.43 12.18±0.54
8 12.92±0.44 12.47±0.70
9 12.62±0.35 12.52±0.11
10 12.83±0.14 12.53±0.32
11 12.71±0.07 12.64±0.09
12 12.76±0.32 12.57±0.23
13 12.70±0.10 12.24±0.43
14 12.55±0.57 12.42±0.32
15 12.51±0.32 12.12±0.12
16 12.28±0.06 12.31±0.43
17 12.12±0.08 11.82±0.22
18 12.12±0.23 11.78±0.50
19 11.97±0.45 11.70±0.60
20 11.89±0.35 11.64±0.53
21 11.69±0.23 11.42±0.43
22 11.30±0.36
23 11.28±0.25
Mean±SEM 12.27±0.27 12.11±0.34
Table 4.28 Dry matter intake (Kg/day) in RB-S and RB-NS groups under field conditions.
Weeks RB-S RB-NS
22 10.86±0.32 10.93±0.64
23 11.05±0.53 10.68±0.42
24 10.68±0.54 10.57±0.26
25 10.44±0.23 10.33±0.21
26 10.77±0.10 10.29±0.10
27 10.41±0.32 9.99±0.22
28 10.39±0.56 10.16±0.43
29 10.36±0.23 10.06±0.34
30 10.51±0.44 9.98±0.35
31 10.16±0.52 9.76±0.12
32 10.22±0.21 9.88±0.07
33 10.40±0.60 9.64±0.42
34 10.20±0.46 9.53±0.60
35 10.18±0.32 9.72±0.27
36 10.00±0.53 9.46±0.32
37 9.70±0.21 9.32±0.54
38 9.84±0.10 9.30±0.44
39 9.62±0.32 9.26±0.14
40 9.52±0.21 9.19±0.34
Mean±SEM 10.28±0.36 9.90±0.33
4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 408
9
10
11
12
13
14
15RgB RB-NS RB-NS
Weeks
Dry
Mat
ter
Inta
ke(K
g/da
y)
4.13 DMI in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm condition
4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 408
9
10
11
12
13
14
15Regular Breeder Supplemented RB Non Supplemented RB
Weeks
Dry
Mat
ter I
ntak
e(K
g/da
y)
4.14 DMI in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions
Table 4.29 Milk yield (Kg/day) in RgB and RB groups under farm conditions.
Weeks RgB RB
4 15.7A±0.56 15.7±0.49
5 16.1 A ±0.31 16.2±0.68
6 16.8 A ±0.40 16.8±0.58
7 17.4 A ±0.47 16.5±0.52
8 17.8 A ±0.28 16.9±0.78
9 17.2 A ±0.48 16.7±0.48
10 18.0 A ±0.60 17.6±0.70
11 17.9 A ±0.42 17.4±0.39
12 18.3B±0.69 17.8±0.58
13 18.1 A ±0.49 17.1±0.56
14 17.9 A ±0.79 17.0±0.41
15 18.0 A ±0.48 17.1±0.50
16 17.1 A ±0.58 16.6±0.47
17 17.7 A ±0.32 16.5±0.68
18 16.6 A ±0.48 15.8±0.71
19 16.5 A ±0.48 15.7±0.50
20 16.0 A ±0.78 15.5±0.47
21 15.5 A ±0.59 15.3±0.68
22 15.2 A ±0.38
23 15.0 A ±0.60
Mean±SEM 16.93±0.51 16.57±0.56
Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group.
4.8.2 Milk yield (Kg/day) in RB-S and RB-NS groups under farm conditions.
The Mean±SE milk yield recorded at weekly interval and Mean±SEM
values for RB-S and RB-NS groups under farm conditions is presented in Table
4.30 and depicted in figure 4.15.
At 22nd week post partum when probiotic was supplemented to RB-S
group, milk yield was 14.5±0.48 kg/day and in RB-NS group milk yield was
14.3±0.52 kg/day. In both RB-S and RB-NS groups, milk yield gradually
decreased till the end of experiment. Within RB-S group, milk yield decreased
over initial value but was significantly (p<0.05) different from initial value only at
33rd and 35th to till the end of the experiment. Whereas within RB-NS group
significant (P<0.05) decreased from initial value was observed from 29th week to
till end of the experiment. Milk yield in RB-S group decreased to 10.3±0.38
kg/day and in RB-NS group it decreased to 9.6±0.58 kg/day from initial values.
The percent decrease in milk yield over initial value in RB-S and RB-NS groups
at end of experiment was 28.96 and 32.86 % respectively. When Mean±SE
values of milk yield was compared between groups, no significant difference was
observed till the end of the experiment. The Mean±SEM milk yield in RB-S and
RB-NS groups under farm conditions was 12.38±0.50 and 11.75±0.51 kg/day
respectively. Milk yield estimated in both RB-NS and RB-S groups was not
significantly different.
4.8.3 Milk yield (Kg/day) in RgB and RB groups under field conditions.
The Mean±SE milk yield at weekly interval and Mean±SEM values for
RgB and RB groups under field conditions is presented in Table 4.31 and
depicted in figure 4.16.
Under field conditions, at the beginning of experiment (4th week post
partum) milk yield recorded in RgB and RB groups under farm conditions was
15.5±0.56 and 14.9±0.49 kg/day respectively. Within RgB and RB groups,
Mean±SE values of milk yield exhibited not significant difference over initial
value throughout the course of the experiment. Highest Mean±SE milk yield in
RgB group was recorded at 10th week i.e 17.0±0.60 kg/day and in RB group was
recorded at 11th week i.e. 16.4±0.39 kg/day. The percent increase in milk yield
76 Results & Discussion
over initial value at 23rd week post partum in RgB groups was 7.74 % in RB and
in group was 4 %. At 21th week post partum. When Mean±SE values of milk yield
was compared between groups, not significant difference was observed till the
end of the experiment. The Mean±SEM milk yield for RgB and RB groups under
farm conditions was 16.11±0.51 and 15.53±0.56 kg/day respectively. Milk yield
recorded in both RgB and RB groups was not significantly different.
4.8.4 Milk yield (Kg/day) in RB-S and RB-NS groups under field conditions.
The Mean±SE milk yield recorded at weekly interval and Mean±SEM
values for RB-S and RB-NS groups under field conditions is presented in Table
4.32 and depicted in figure 4.16.
At 22nd week post partum when probiotic was supplemented to RB-S
group milk yield was 13.5±0.48 kg/day and in RB-NS group milk yield was
13.5±0.52 kg/day. In both in RB-S and RB-NS groups, milk yield showed
decreasing trend till the end of experiment. Mean±SE values of milk yield
decreased significantly (P<0.05) within RB-S group from initial value at 36th, 37th
and 40th week post partum. Whereas within RB-NS group significant (P<0.05)
decreased from initial from 28th week till the end of the experiment. Milk yield in
RB-S group decrease to 9.3±0.38 kg/day and in RB-NS group deceased to
8.4±0.48 kg/day over initial value. The percent decrease in milk yield over initial
value in RB-S and non-supplementation RB group at end of experiment was
31.1 and 37.7 % respectively. When Mean±SE values of milk yield was
compared between groups, not significant difference was observed till the end of
the experiment. The Mean±SEM milk yield in RB-S and RB-NS groups under
field conditions was 11.39±0.50 and 10.71±0.51 kg/day respectively. Milk yield
recorded in both RB-NS and RB-S groups was non significantly different.
Results of present study show higher milk yield in RgB group when
compared with RB under farm and field conditions but were observed to be not
significant. Since at the beginning of the study, the milk yield of RB group was
not significantly different from RgB group, milk yield might not have been a
critical factor resulting in the increase or decrease in blood plasma parameter
77 Results & Discussion
Table 4.30 Milk yield (Kg/day) in RB-S and RB-NS groups under farm conditions.
Weeks RB-S RB-NS
22 14.5A±0.48 14.3A±0.52
23 14.6 A ±0.40 14.1 A ±0.48
24 14.1 A ±0.42 13.7 A ±0.48
25 13.6 A ±0.59 13.5 A ±0.38
26 13.6 A ±0.79 13.0 A ±0.39
27 13.2 A ±0.49 13.2 A ±0.58
28 13.2 A ±0.38 12.6 A ±0.56
29 12.8 A ±0.49 11.8B±0.41
30 12.3 A ±0.48 11.6B±0.60
31 12.3 A ±0.60 11.2B±0.47
32 12.0 A ±0.29 11.1B±0.58
33 11.8B±0.58 11.1B±0.41
34 12.0 A ±0.50 10.8B±0.50
35 11.3B±0.41 10.7B±0.39
36 11.1B±0.68 10.8B±0.62
37 10.9B±0.56 10.4B±0.49
38 10.8B±0.58 9.8 B±0.68
39 10.8B±0.52 9.9B±0.50
40 10.3B±0.38 9.6B±0.58
Mean±SEM 12.38±0.50 11.75±0.51
Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group.
Table 4.31 Milk yield (Kg/day) in RgB and RB groups under field conditions.
Weeks RgB RB
4 15.5±0.56 14.9±0.49
5 16.1±0.31 15.2±0.68
6 16.1±0.04 15.4±0.58
7 16.4±0.47 15.5±0.52
8 16.8±0.26 15.9±0.78
9 16.7±0.42 15.7±0.48
10 17.0±0.60 16.1±0.70
11 16.7±0.42 16.4±0.39
12 16.8±0.69 16.2±0.58
13 17.1±0.49 16.1±0.56
14 16.3±0.79 16.0±0.41
15 17.0±0.48 16.1±0.50
16 16.3±0.58 15.6±0.47
17 16.7±0.32 15.5±0.68
18 15.6±0.48 15.4±0.71
19 15.5±0.34 14.7±0.52
20 15.0±0.78 14.5±0.47
21 14.5±0.59 14.3±0.68
22 14.2±0.38
23 14.3±0.60
Mean±SEM 16.11±0.51 15.53±0.56
Table 4.32 Milk yield (Kg/day) in RB-S and RB-NS groups under field conditions.
Weeks RB-S RB-NS
22 13.5A±0.48 13.5A±0.52
23 13.6 A ±0.40 13.0 A ±0.36
24 13.1 A ±0.42 12.9 A ±0.45
25 12.6 A ±0.59 12.3 A ±0.38
26 12.6 A ±0.79 12.0 A ±0.39
27 12.2 A ±0.49 11.5 A ±0.58
28 12.2 A ±0.38 11.7B±0.56
29 11.8 A ±0.43 11.0B±0.41
30 11.3 A ±0.48 10.8B±0.60
31 11.3 A ±0.60 10.4B±0.47
32 11.0 A ±0.29 10.3B±0.58
33 10.9 A ±0.58 10.3B±0.41
34 10.6 A ±0.47 10.1B±0.50
35 10.5 A ±0.41 9.5B±0.39
36 10.1B±0.68 9.1B±0.62
37 10.1B±0.56 9.2B±0.49
38 9.9 A ±0.58 8.9B±0.68
39 9.8 A ±0.52 8.5B±0.60
40 9.3B±0.38 8.4B±0.48
Mean±SE 11.39±0.50 10.71±0.51
Values with different superscripts (A, B) are significantly different (P<0.05) from initial value within each group.
4.15 Milk yield in RgB and during pre and post supplementation period in RB-S and RB-NS groups under farm condition
5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 416
8
10
12
14
16
18
20 RgB RB-S RB-NS
Weeks
Milk
Yie
ld(K
g/da
y)
4.16 Milk yield in RgB and during pre and post supplementation period in RB-S and RB-NS groups under field conditions
and for repeat breeding problem. No reports are available with respect to
comparative studies on milk yield in regular and repeat breeders.
Effect of supplementation of Saccharomyces cerevisae on milk yield in RB-
S and RB-NS groups under farm and field conditions are in accordance with study
conducted by Iwanska et al. (1999); Dann et al. (2000); Majdoub-mathiuothi et al.
(2009). They have demonstrated that supplementation of Saccharomyces
cerevisae had no significant effect on milk yield or milk composition in mid or late
lactation period of dairy cows.
Results of present study are contradictory with studies conducted by
others (Arambel, and Kent 1990; Piva et al., 1993; Robinson 1997).They had
demonstrated significant effect on milk yield or milk composition of dairy cows
when Saccharomyces cerevisae was supplemented in early lactation. Phillips
and VonTungelin, (1984) and Barling, (2014) reported increase in feed intake
and nutrient availability on supplementation of Saccharomyces cerevisiae during
stress to cattle to overcome the stress. Therefore yeast culture was thought to
be best utilized by animals under stress. As animals were in early lactation, they
were in stress. This might be one of the reasons for significant effect on milk
yield or milk composition of dairy cows when Saccharomyces cerevisae was
supplemented. Mostly reports on supplementation are available during early
lactation period.
4.9 BODY WEIGHT
4.9.1 Body weight (Kg) of RgB and RB groups under farm conditions.
The Mean±SE body weight recorded at monthly interval and Mean±SEM
values for RgB and RB groups under farm conditions is presented in Table 4.33
and depicted in figure 4.17.
Under farm conditions, at the beginning of experiment (4th week post
partum) body weight of RgB and RB groups under farm conditions was
402.67±9.18 and 379.22±15.6 kg respectively. When Mean±SE values of milk
yield was compared within and between groups, not significance difference was
observed till the end of the experiment. Highest Mean±SE body weight in RgB
group was recorded as. 453.00±16.26 kg at end of the experiment and in RB
group was recorded as 436.25±17.94 kg at 20th week. There after the body
78 Results & Discussion
weight did not change significantly. The Mean±SEM body weight for RgB and
RB groups under farm conditions was 438.30±14.14 and 424.56±17.36 kg
respectively. Body weight recorded for both RgB and RB groups was not
significantly different.
4.9.2 Body weight (Kg) of RB-S and RB-NS groups under farm conditions.
The Mean±SE body weight measured at monthly interval and Mean±SEM
values for RB-S and RB-NS groups under farm conditions is presented in Table
4.34 and depicted in figure 4.18.
At 22nd week post partum when probiotic was supplemented to RB-S
group, Mean±SE body weight was 438.33±13.12 kg and in RB-NS group
Mean±SE body weight was 434.17±17.84 kg. When Mean±SE values of milk
yield was compared between and groups, not significance difference was
observed till the end of the experiment. The percent increase in body weight at
10th month over initial value in RB-S groups was 3 % and in RB-NS group was
1%. The Mean±SEM body weight in RB-S and RB-NS groups under farm
conditions was 442.83±11.91 and 431.77±15.13 kg respectively. The body
weights RB-S and RB-NS groups were not significantly different from each other.
4.9.3 Body weight (Kg) of RgB and RB groups under field conditions.
The Mean±SE body weight recorded at monthly interval and Mean±SEM
values for RgB and RB groups under field conditions is presented in Table 4.35
and depicted in figure 4.19.
Under farm conditions, at the begining of experiment (4th week post
partum) Mean±SE body weight of RgB and RB groups under field conditions was
398.45 ±10.14 and 374.42±15.65 kg respectively. When Mean±SE values of milk
yield was compared between and groups, not significance difference was
observed till the end of the experiment. Highest Mean±SE body weight in RgB
group was recorded as 448.56±17.63 kg and in RB group was recorded as
434.75±18.47 kg at end of the experiment. The Mean±SEM body weight for RgB
and RB groups under field conditions was 429.82±13.00 and 419.03±15.39 kg
respectively. Body weight recorded for both RgB and RB groups was not
significantly different.
79 Results & Discussion
Table 4.33 Body weight (Kg) in RgB and RB groups under farm conditions.
Weeks RgB RB
4 402.67±9.18 379.22±15.6
8 439.33±12.91 428.98±21.20
12 445.00±11.84 438.57±12.16
16 451.50±20.5 439.78±19.84
20 453.00±16.26 436.25±17.94
Mean±SEM 438.30±14.14 424.56±17.36
Table 4.34 Body weight (Kg) in RB-S and RB-NS groups under farm conditions.
Weeks RB-S RB-NS
22 438.33±13.12 434.17±17.84
26 439.8±16.67 426.33±19.54
30 437±12.86 430.60±16.02
34 447.5±9.06 428.00±10.41
38 451.5±7.84 439.75±11.81
Mean±SEM 442.83±11.91 431.77±15.13
4.17 Body weight in RgB and RB groups under farm conditions
4.18 Body weight in RB-S and RB-NS groups under farm conditions
100.00
150.00
200.00
250.00
300.00
350.00
400.00
450.00
500.00
4 8 12 16 20
Body
Wei
ght
(Kg)
Weeks
RgB RB
100
150
200
250
300
350
400
450
500
22 26 30 34 38
Body
Wei
ght
(Kg)
Weeks
RB-S RB-NS
Table 4.35 Body weight (Kg) in RgB and RB groups under field conditions.
Weeks RgB RB
4 398.45±10.14 374.42±15.65
8 435.23±11.10 422.45±16.23
12 432.54±7.84 430.64±12.16
16 434.32±18.30 432.87±14.44
20 448.56±17.63 434.75±18.47
Mean±SEM 429.82±13.00 419.03±15.39
Table 4.36 Body weight (Kg) in RB-S and RB-S groups under field conditions.
Weeks RB-S RB-NS
22 437.23±8.12 432.17±14.04
26 435.9±12.68 428.34±16.50
30 436.12±7.74 429.70±15.02
34 439.7±12.06 430.56±9.42
38 441.3±14.71 431.75±11.05
Mean±SEM 438.05±11.06 430.50±13.21
4.19 Body weight in RgB and RB groups under field conditions
4.20 Body weight in RB-S and RB-NS groups under field conditions
0.00
100.00
200.00
300.00
400.00
500.00
4 8 12 16 20
Body
Wei
ght (
kg)
Weeks
RgB RB
0
100
200
300
400
500
22 26 30 34 38
Body
Wei
ght (
kg)
Month
RB-S RB-NS
4.9.4 Body weight (Kg) of RB-S and RB-NS groups under field conditions.
The Mean±SE body weight measured at monthly interval and
Mean±SEM values for RB-S and RB-NS groups under field conditions is
presented in Table 4.36 and depicted in figure 4.20.
Form 22nd week post partum when probiotic was supplemented Mean±SE
body weight was 437.23±8.12 kg and in RB-NS group Mean±SE body weight
was 432.17±14.04 kg. When Mean±SE values of milk yield was compared
between and groups, not significance difference was observed till the end of the
experiment. The increase in Mean±SE body weight of RB-S group was by 4.07
% and decrease in body weight in RB-NS group by 0.4 % over initial value at
10th month. The Mean±SEM body weight in RB-S and RB-NS groups under
field conditions was 438.05±11.06 and 430.50±13.21 kg respectively. Body
weight recorded for both RB-S and RB-NS groups were not significantly
different.
In the present study, even though the Mean±SE body weight of RgB was
higher than RB group, no significant difference was observed under both farm
and field conditions. Since at the beginning of the study, not significant difference
was observed for the body weight between RgB and RB groups. In adult animal
Saccharomyces cerevisae supplementation might have had the ability to provide
growth factors such as organic acids (methionine and lysine) and vitamins;
stimulating immune function; improving the numbers of beneficial rumen micro
flora and fiber digestion (Chaucheryas et al., 1995; Gattass et al., 2008; Soccol
et al., 2010). Our results suggest Saccharomyces cerevisae supplementation
might have improved health and feed efficiency of the animal which might have
resulted in increase in body weight, although results were not significantly
different. Results are confirmatory with the report of Markusfeld et al. (1997) who
failed to observe any relationship between body weight at calving and first
service conception rate in crossbred cows. Similarly, Wathes et al. (2007) did not
find a relationship between calving BCS, BCS at 60 day post partum, or BCS
change with the conception at first service.
Effect of supplementation of Saccharomyces cerevisae on body weight in
RB-S and RB-NS groups under farm and field conditions are in accordance with
80 Results & Discussion
study conducted by Zhang et al. (2000) who reported that the cows on
supplementation with Saccharomyces cerevisiae had a body weight gain of 1%
greater than that of the control group, but it was not significantly different from
control.
Since at the beginning of the study, the body weight of RB group was not
significantly different from RgB group, Hence body weight might not have been a
critical factor causing the increase or decrease in blood plasma parameters and
for cause of repeat breeding problem.
4.10 CONCEPTION RATE
4.10.1 Conception rate in RgB and RB groups under farm conditions.
Conception rate of RgB and RB groups under farm conditions is
presented in Table 4.37.
Percentage of conception rate of RgB group under farm conditions for first
service was 33.33%. Percentage of conception rate of RgB group under farm
conditions to second service 75%. Percentage of conception rate of RgB group
under farm conditions to third service 100% respectively. In RB group for first 3
services none of the animals conceived. Overall Percentage of conception rate
of RgB and RB groups under farm conditions up to three services was 100 and 0
% respectively.
4.10.2 Conception rate in RB-S and RB-NS groups under farm conditions.
Conception rate of RB-S and RB-NS groups under farm conditions is
presented in Table 4.38.
Percentage of conception rate of RB-S and RB-NS groups under farm
conditions for first service was 28.57 and 14.29 % respectively. Percentage of
conception rate of RB-S and RB-NS groups under farm conditions to second
service was 40.29 and 16.67 % respectively. Percentage of conception rate of
RB-S and RB-NS groups under farm conditions to third service was 33.3 and 20
% respectively. Overall percentage of conception rate of RB-S and RB-NS
groups under farm conditions up to three services was 71.42 and 42.85 %
respectively.
81 Results & Discussion
Table 4.37 Conception rate in RgB and RB groups under farm conditions.
Services RgB RB
1 2/6(33.33%) 0/14(0%)
2 3/4(75%) 0/14(0%)
3 1/1(100%) 0/14(0%)
Overall 6/6(100%) ** 0/14(0%)
Values were presented in percentage. **P<0.01
Table 4.38 Conception rate in RB-S and RB-NS groups under farm conditions.
Services RB-S RB-NS
1 2/7(28.57%) 1/7(14.29%)
2 2/5(40%) 1/6(16.67%)
3 1/3(33.33%) 1/5(20%)
Overall 5/7(71.42%)* 3/7(42.85%)
Values were presented in percentage. * P<0.05
4.10.3 Conception rate in RgB and RB groups under field conditions.
Conception rate of RgB and RB groups under field conditions is presented
in Table 4.39.
Percentage of conception rate of RgB group under farm conditions for first
service was 16.66%. Percentage of conception rate of RgB group under farm
conditions to second service 80%. Percentage of conception rate of RgB group
under farm conditions to third service 100% respectively. In RB group for first 3
services none of the animals conceived. Overall Percentage of Conception rate
of RgB and RB groups under farm conditions up to three services was 100 and 0
% respectively.
4.10.4 Conception rate in RB-S and RB-NS groups under field conditions.
Conception rate of RB-S and RB-NS groups under field conditions is
presented in Table 4.40.
Percentage of conception rate of RB-S and RB-NS groups under field
conditions to first service was 28.57 and 0 % respectively. Percentage of
conception rate of RB-S and RB-NS groups under field conditions to second
service was 40 and 28.56 % respectively. Percentage of conception rate of RB-S
and RB-NS groups under farm conditions to third service was 0 and 20 %
respectively. Overall percentage of conception rate of RB-S and an RB-NS
group under farm conditions up to three consecutive services was 71.42 and
42.85 % respectively.
To the best of our knowledge this is the first investigation which shows the
effect of Probiotic (Saccharomyces cerevisiae) supplementation on conception
rate of repeat breeding crossbred cows under farm and field conditions. As
discused earlier systematic supplementation of probiotic (Saccharomyces
cerevisiae) significantly improved the plasma level of lactofferin, IGF-1, and
glucose in RB-S group. These parameters are positively correlated with health
and reproductive performance of animal. Whereas systematic supplementation
of probiotic (Saccharomyces cerevisiae) significantly decreased plasma level of
urea and Hp in RB-S groups. These parameters were negatively correlated with
health and reproductive performance of animals. These beneficial changes in
plasma level may be the reason for greater conception rate in RB-S when
82 Results & Discussion
compared with RB-NS groups under farm and field conditions. No reports on
supplementation of lactating cows are available for short duration of time up to
120 d post partum in cattle.
4.11 In Vitro Study
4.11.1 Relative expression of TLR-4 mRNA in neutrophils of RB, RB (In vitro IGF-1 supplemented) and RgB groups.
Relative expression of TLR-4 gene in blood neutrophils of RB (In vitro
IGF-1 supplemented) and RgB is presented in Table 4.46 and also depicted in
Figure 4.21. Relative expression of TLR-4 gene in blood neutrophils of RB (In
vitro IGF-1 supplemented) with respect to RB and RgB groups which was
1.13±0.11 and 1.48±0.09 respectively. O’Neill and Bowie (2007) reported
activation of TLR-4 can increase the phagocytic activity of neutrophils and
change their physiology in ways that increase their ability to kill and clear
pathogens. Relative expression of TLR-4 and Fas mRNA in neutrophils may
show immune status of the animal which can be correlate with repeat breeding
problem in Karan Fries cows. Bacterial infection trigger and increase expression
of TLR-4 in neutrophils and lymph node, lower expression of TLR-4 in neutrophil
of RB group does not indicate any bacterial infection but indicating lower immune
status when compared with RgB group which were healthy, did not suffer clinical
infection during study tenure as reported by Wolfram et al., (2008); Goldammer
et al., (2004) increase in TLR-4 expression in neutrophils during bacterial
infection.
4.11.2 Relative expression of Fas mRNA in neutrophils of RB, RB (In vitro IGF-1 supplemented) and RgB groups.
Relative expression of Fas gene in blood neutrophils of RgB and RB (In
vitro IGF-1 supplemented) groups, with respect to RB group is presented in
Table 4.46 and also depicted in Figure 4.21 Relative expression of Fas in blood
neutrophils of RB (In vitro IGF-1 supplemented) and RgB were 1.11±0.10 and
1.41±0.13 which differed significantly (P<0.05).
Regulation of the neutrophil life span by apoptosis is a crucial process in
maintaining number of circulating neutrophils which is regulated by Fas gene
(Simon, 2003). Results of present study suggest that Fas gene has a particular
83 Results & Discussion
Table 4.39 Conception rate in RgB and RB groups under field conditions.
Services RgB RB
1 1/6(16.66%) 0/14(14.29%)
2 4/5(80%) 0/14(16.67%)
3 1/1(100%) 0/14(20%)
Overall 6/6(100%) ** 0/14(0%)
Values were presented in percentage. ** P<0.01
Table 4.40 Conception rate in RB-S and RB-NS groups under field conditions.
Services RB-S RB-NS
1 2/7(28.57%) 0/7(0%)
2 3/5(40%) 2/7(28.56%)
3 0/2(0%) 1/5(20%)
Overall 5/7(71.42%)* 3/7(42.85%)
Values were presented in percentage. * P<0.05
Picture 5.1 Calf born of RB-S animal under Darad village conditions
Picture 5.2 Calf born of RB-S animal under Darad village conditions
Table 4.41 Correlation coefficient of plasma parameters in RgB and RB groups under farm conditions.
Hp IGF-1 Glucose Lactoferrin Urea Calcium
Hp 1.000
IGF-1 -0.679** 1.000
Glucose -0.483* 0.872** 1.000
LF -0.829** 0.634** 0.656** 1.000
Urea 0.797** -0.684** -0.530* -0.848** 1.00
calcium -0.502* 0.374* 0.057** 0.407* -0.5* 1.000
Values with superscripts ** significantly(P<0.01) correlated Values with superscripts * significantly(P<0.05) correlated
Table 4.42 Correlation coefficient of plasma parameters in RB-S and RB-NS groups under farm conditions.
Hp IGF-1 Glucose Lactoferrin Urea Calcium
Hp 1.000
IGF-1 -0.300 1.000
Glucose -0.176 0.820** 1.000
Lactoferrin -0.541* 0.644** 0.310 1.000
Urea 0.635** -0.541* -0.255 -0.770** 1.000
calcium -0.260 0.369* 0.208 0.302 -0.16 1.000
Values with superscripts ** significantly(P<0.01) correlated Values with superscripts * significantly(P<0.05) correlated
Table 4.43 Correlation coefficient of plasma parameters in RgB and RB groups under field conditions.
Hp IGF-1 Glucose Lactoferrin Urea Calcium
Hp 1.000
IGF-1 -0.692** 1.000
Glucose -0.523* 0.892** 1.000
Lactoferrin -0.856** 0.660** 0.670** 1.000
Urea 0.781** -0.684** -0.557** -0.84** 1.00
Calcium -0.532* 0.389* 0.056** 0.41* -0.49* 1.000
Values with superscripts ** significantly(P<0.01) correlated Values with superscripts * significantly(P<0.05) correlated
Table 4.44 Correlation coefficient of plasma parameters in RB-S and RB-NS groups under field conditions.
Hp IGF-1 Glucose Lactoferrin Urea Calcium
Hp 1.000
IGF-1 -0.310 1.000
Glucose -0.197 0.710** 1.000
Lactoferrin -0.561* 0.668** 0.310 1.000
Urea 0.649** -0.566* -0.262 -0.792** 1.000
Calcium -0.274 0.380* 0.220 0.316 -0.174 1.000 Values with superscripts ** significantly(P<0.01) correlated Values with superscripts * significantly(P<0.05) correlated
role to play in the regulation of neutrophil life span which may play role in
immune function of the animal.
Table 4.45 Relative expression of TLR-4 and Fas mRNA in neutrophils of RB, RB (In vitro IGF-1 supplemented) and RgB group.
Gene RB RgB RB+IGF-l
TLR-4 1 a±0.0 1.48 b±0.09 1.13 a±0.11
FAS 1 a±0.0 1.41 b±0.13 1.11 a±0.10
Values with different superscripts are significantly different (P<0.05)
Figure 4.21 Relative expression of TLR-4 and Fas mRNA in neutrophils of
RB, RB (In vitro IGF-1 supplemented) and RgB group.
In the present study it was observed that whether it was under farm or
field Mean±SEM concentration of plasma IGF-1, Hp, LF and Urea exhibited an
important role in influencing conception rate in repeat breeding crossbred Karan
Fries. Greater concentration of IGF-1 and LF had positive effect on reproductive
performance in Regular breeder yielding 100% conception rate. A novel and
economic technique of supplementation of commercial product fermented yeast
culture to repeat breeding cows @12 g/animal/day from 22nd week till 40th week
post partum, could enhance the plasma level of IGF-1 and LF and decrease Hp
and Urea level, which resulted in attaining 71.42% conception rate. Usually
00.20.40.60.8
11.21.41.61.8
RB Regular Breeder RB+IGF-1
Rela
tive
expr
essi
on o
f mRN
A
TLR-4 FAS
84 Results & Discussion
within 23 week, when the repeat breeding animals does not conceive for three
number of services, it is considered as non productive and farmer feels that it’s
an economic loss to him. This simple technology, where repeat breeding
animals, when supplemented with fermented yeast culture, their fertility status
could be upgraded.
In Vitro studies depicted that expression of TLR-4 and Fas genes were
down regulated in neutrophils of repeat breeding cows implicating weak activity
and survival of neutrophils. The dose and time period of incubation for IGF-1 on
neutrophils gene expression parameters were not enough to increase the
expression of genes as observed in control group.
85 Results & Discussion
CHAPTER –5
SUMMARY AND CONCLUSIONS
SUMMARY AND CONCLUSIONS
INSULIN-LIKE GROWTH FACTOR-1 (IGF-1)
Concentration of plasma IGF-1 in both RgB and RB groups increased
from initial value till the end of the experiment period (40th week),underfarm and fieldconditions.Mean±SEM concentration of plasma IGF-1was significantly
higher (P<0.01) in RgB groupwhen comparedwithRB groupunder bothfarm and field conditions.
Systematic supplementation of fermented yeast culture(Saccharomyces
cerevisae)caused increasein plasma IGF-1concentrationwithin RB-S groupunder
bothfarm and fieldconditions. Whereas such change was notobserved in
plasma IGF-1concentration in RB-NS groupunder both farm and field conditions.
Mean±SEM plasma IGF-1concentration was significantly higher (P<0.05)in RB-S
groupwhen comparedwith RB-NS group under bothfarm and fieldconditions.
Under both farm and field conditions similar result was observed in which
concentration of plasma IGF-1 was significantly positively correlated with plasma
glucose, LF(P<0.01), calcium (P<0.05)and negatively correlated (P<0.01)
withconcentration of plasma urea and Hp for bothRgB and RB groups.
Concentration of plasma IGF-1 was significantly positively correlated with
plasma glucose, LF(P<0.01) and calcium (P<0.05) but negatively
correlated(P<0.05) with of plasma urea for both RB-S and RB-NS groupsunder
farm conditions.
Similarly under field conditions alsoconcentration ofplasma IGF-1was
significantly positively correlated (P<0.01) with concentration of plasma glucose,
LF, calcium (P<0.05)and negatively correlated (P<0.01) with plasma urea and
Hp for RB-S and RB-NS groups.
HAPTOGLOBIN (Hp)
Concentration ofplasma Hp decreased in RgB and RBgroupsover the
initial valueunderbothfarm and fieldconditions. Concentration plasma Hp
wassignificantlyless(P<0.05) in RgBgroup whencomparedwithRBgroup under
bothfarm and fieldconditions.
86
Systematic supplementation of fermented yeast culture (Saccharomyces
cerevisae)caused decreaseinconcentration of plasma HpofRB-S.Similarly it
wasobserved inRB-NS group till the end of experiment (40th week) under
bothfarm and fieldconditions. Mean±SEM plasma Hp was significantly
(P<0.05)lower inRB-S whencomparedwith RB-NS groupunder bothfarm and fieldconditions.
Under farm conditions, plasma Hp was significantly positively correlated
(P<0.01) with plasma urea concentration and negatively correlated (P<0.01) with
plasma LF, IGF-1(P<0.01), glucose and calcium (P<0.05) for RgB and RB
groups.
Under field conditions, for both RgB and RB groups, plasma Hp was
significantly positively correlated (P<0.01) with plasma urea and negatively
correlated (P<0.0) with plasma LF.
For RB-S and RB-NS groups, plasma Hp was significantly positively
correlated (P<0.01) with plasma urea and negatively correlated (P<0.01) with
plasma LF under farm conditions.
Concentration of Plasma Hp was significantly positively correlated
(P<0.01) with plasma urea and negatively correlated (P<0.01) with plasma LF,
IGF-1(P<0.01), glucose and calcium (P<0.05) for both RB-S and RB-NS
groupsunder field conditions.
LACTOFERRIN (LF)
Under bothfarm and fieldconditions, concentration of plasma LFexhibited
an increasing trend forRgB and RB groupsfrom theinitial value till end of the
experiment period. Mean±SEM concentration of plasma LFwas significantly
higher (P<0.05) in RgB groupwhen comparedwithRB group under bothfarm and fieldconditions.
Systematic supplementation offermented yeast culture (Saccharomyces
cerevisae) increased plasma LF concentration of both RB-S and RB-NS groups
till the end of experiment (40th week)under both farm and field
conditions.Mean±SEM concentration of plasma Hp was significantly
higher(P<0.05)inRB-S group when compared with RB-NS groupunder both farm
and field conditions.
87
Under farm and field conditions, similar correlations for plasma LFwas
observed where itwas significantly positively correlated with plasma IGF-1,
glucose (P<0.01), calcium (P<0.05)and negatively correlated (P<0.01) with
plasma urea and Hp for RgB and RB groups.
Concentration of plasma LFwas significantly (P<0.01) positively correlated
with plasma IGF-1 concentration and negatively correlated withof plasma
urea(P<0.01) and Hp(P<0.05) for both RB-S and RB-NS groupsunder farm conditions. Similar correlation results for concentration of plasma LFwas
observed with concentration of plasmaIGF-1, urea and Hp for both RB-S and
RB-NS groupsunder field conditions.
GLUCOSE
Under farm and field conditions, significantly (P<0.05) greater
concentration of plasma glucose was observed in RgB group when compared
with RB group at different intervals.Within RgB and RB groups, no significant
increasewas observed from initial value throughout the course of the experiment,
under farm and field conditions. Mean±SEM concentration of plasma glucose
was significantly higher (P<0.05)in RgB groupwhen compared with RB
groupunder both farm and field conditions.
Systematic supplementation of fermented yeast culture (Saccharomyces
cerevisae) causedincreasein concentration ofplasma glucosein RB-Sgroup
underfarm and fieldconditions. Whereas such trend was not recorded in
concentration ofplasma glucose inRB-NS group under both farm and field
conditions.Mean±SEM concentration ofplasma glucosewas significantly
higher(P<0.05) inRB-Sgroup when compared withRB-NSgroup under bothfarm and fieldconditions.
Concentration of plasma glucose was significantly positively correlated
with plasma IGF-1, LF(P<0.01), calcium (P<0.05)and negatively correlated
(P<0.05) with plasma urea and Hp for RgB and RB groupsunder farm conditions.
Under field conditions, concentration of plasma glucose was significantly
(P<0.01) positively correlated with plasma IGF-1, LF, calcium concentration and
88
negatively (P<0.01) correlated with plasma urea and Hp for both RgB and RB
groups.
Similar results were observed with glucose under farmand field
conditions, where concentration of plasma glucose was significantly positively
correlated (P<0.01) with plasma IGF-1, LF and calcium and negatively correlated
with plasma urea and Hp for RB-S and RB-NS groups.
UREA
Concentration of plasma urea decreased in RgB group over the initial
valueunder farm and field conditions. Mean±SEM concentration of plasma
ureawas significantly higher in RB group when compared withRgB group under
bothfarm and fieldconditions.
Systematic supplementation of fermented yeast culture (Saccharomyces
cerevisae)decreased concentrationof plasmaureainRB-S groupover the initial
value at the end of experiment (40th week) under bothfarm and fieldconditions.
The values were not significantly different. Whereassuch decrease was not
observed inRB-NS groupover the initial value at the end of experiment (40th
week)underboth farm and field conditions.Concentration ofplasma ureawas
significantly lower inRB-S groupwhen compared with RB-NS groupunder
bothfarm and fieldconditions.Concentration of plasma urea was significantly
(P<0.01) greater in RB-NS when compared with RB-S group, under both farm and field conditions.
Under farm and field conditions, concentration of plasma urea was
significantly positively correlated (P<0.01) withplasma Hp and negatively
correlated (P<0.01) with plasma LF, IGF-1(P<0.01), glucose and calcium
(P<0.05) for both RgB and RB groups.
Concentration of plasma urea was significantly positively correlated
(P<0.01) with plasma Hp and negatively correlated (P<0.01) with plasma IGF-
1(P<0.05) andLF(P<0.01) for both RB-S and RB-NS groups under farm and field conditions.
CALCIUM
89
The results in the present study indicated an increasing trend in plasma
calcium concentration in RgB and RB groups over the initial value till the end of
the experiment period (23rd week)under both farm and field
conditions.Mean±SEM concentration of plasma calcium was significantly
higher(P<0.05) in RgB groupwhen compared withRB groupunder both farm and
field conditions.
Systematic supplementation of fermented yeast culture (Saccharomyces
cerevisae)showed increasing trend in plasma calcium concentration inRB-S and
RB-NS groups till the end of experiment (40th week)under both farm and field
conditions.Concentration ofplasma calciumwas significantly higher(P<0.05)
inRB-S groupswhen compared withRB-NS groupsunder both farm and field
conditions.
Under farm conditions, concentration of plasma calcium was significantly
positively correlated (P<0.01) with concentration of plasma IGF-1, LF (P<0.05),
glucose (P<0.01)and negatively correlated (P<0.01) with plasma urea and Hp
(P<0.05) for RgB and RB groups.
Concentration of plasma calcium was significantly(P<0.05) positively
correlated with plasma IGF-1, LF andglucose and negatively correlated (P<0.05)
with plasma urea and Hp for both RgB and RB groupsunder field conditions.
Under farm and field conditions,plasma calcium was significantly
positively correlated (P<0.05) with plasma IGF-1 in both RB-S and RB-NS
groups.
DRY MATTER INTAKE (DMI)
DMI (Mean±SEM)washigher in RgB groupwhen compared withRB
groupbut was not significantly differentunderboth farm and fieldconditions.Mean±SEM DMIwashigherinRB-S groupwhen compared with
RB-NS group but was not significantly differentunderfarm and fieldconditions.
MILK YIELD
Milk yield (Mean±SEM) washigher in RgB groupwhen compared with RB
groupbut was not significantly differentunderboth farm and fieldconditions. Milk
90
yieldwas higherin RB-S group when compared with RB-NS group but was not
significantly differentunder bothfarm and fieldconditions.
BODY WEIGHT
Body weight (Mean±SEM) was higher in RgB groupwhen compared with
RB groupbut was not significantly differentunderboth farm and field conditions.Mean±SEM body weight was higherin RB-S group when compared
with RB-NS group but was not significantly differentunder farm and field
conditions.
CONCEPTION RATE
Percentage of conception rate to first service was 33.33 and 16.66%
respectively for RgB group under farm and field conditions. In RgB groups 100%
of the animals conceived and in RB group none of the animals conceived for first
3consecutive services under both farm and field conditions.
Percentage of conception rate to first service was 28.57 and 14.29 %
respectivelyfor RB-S and RB-NS groups underfarm conditions. Percentage of
conception rate of RB-S and RB-NS groups underfield conditions to first service
was 28.57 and 0 % respectively. Percentage of conception rate of RB-S and RB-
NS groups under farm conditions up to three services was 71.42 and 42.85 %
respectively under both farm and field conditions.
In Vitro Study
Relative expression of TLR-4 and Fas genes in blood neutrophils of RB
group was significantly less (P<0.05) when compared with the expression of
neutrophilic genes in RgB group. On in vitro supplementation of IGF-1 to RB
group neutrophils, it did not significantly change relative expression of mentioned
genes. The dose of IGF-1 and duration of incubation for the in vitro studies,
could not increase the expression level of genes. Still further work is required in
this area.
Supplementation of fermented yeast culture to RB cows led to increase in the
level of plasma IGF-1, glucose, calcium, LFand decreased the level of Hp and
urea which further resulted in improvement in fertility in crossbred KF cows
under both farm and field conditions. The positively correlated parameters with
91
IGF-1 had positive effect on fertility where as negatively correlated parameters
had negative effect. Supplementation of fermented yeast culture restricted the
decline in milk yield of repeat breeding animals when compared with non
supplementing animals under farm conditions. Whereas under field condition no
such condition was observe.The values for DMI, body weight were not
significantly different between the group under farm and field condition. This
suggests mild stress or inflammation to be persisting in RB animals post partum
which led to delay in conception.
In correlation studies, it was observed that Plasma IGF-1, Glucose,
Lactofferin and Calciumparameters related positively with conception rate were
all significantly positively correlated whereas plasma Hp and urea parameters
negatively related with conception rate were also positively correlated with each
other.
Finally it is concluded that,
Differential plasma levels of different parameters studied wererelated with
Repeat Breeding problem in crossbred Karan Fries cows under both farm
and field conditions.
Supplementation of fermented yeast culture to repeat breeding crossbred
Karan Fries Cows might have resulted in providing nutrient, improvement
in nutrient utilization, rumen function which in turn resulted in
improvement of production performance. Further it reduced the repeat
breeding problem in cross bred cows under both farm and field conditions.
Relative lower level of expression of TLR-4 and Fas mRNA in
neutrophils can be relatedwith repeat breeding problem in Karan Fries
cows.
92
BIBLIOGRAPHY
BIBLIOGRAPHY
Adashi, E.Y. and Roban, R.M.1992. Intraovarian regulation. Peptidergic
signaling systems. Trends Endocrinol. and Metabol. 3: 243–248.
Adashi, E.Y. 1998. The IGF family and folliculogenesis. J. Reprod. Immunol.
39:13–19.
Akgul, C., Moulding, D.A. and Edwards, S.W. 2001. Molecular control of
neutrophil apoptosis. FEBS Lett. 487:318–322.
Alsemgeest, S.P.M., Kalsbeek, H.C., Wensing,T., Koeman, J.P., Van-Ederen,
A.M. and Gruys, E. 1994. Concentrations of serum amyloid A (SAA) and
haptoglobin (hp) as parameters of inflammatory diseases in cattle. Vet. Q.
16: 21–23.
Anand Laxmi, N., Namagirilakshmi, S., Shashikant, D.D. and Shiv, P. 2012.
Implications of supplementation of fermented yeast culture to metritic
cross bred Karan Fries cows on plasma parameters and productive
performance. I. Res. J. Agricul. Sci. and Soil Sci. 2: 459-464.
Anand Laxmi, N., Namagirilakshmi, S., Shashikant. D.D. and Shiv, P. 2013.
Implications of fermented yeast culture supplementation on plasma
parameters and productive performance of anoetrus cross bred cows.
Vet. Praction. 12: 281-287.
Arambel, M.J. and Kent, B.A. 1990. Effect of yeast culture on nutrient digestibility
and milk yield response in early- to mid lactation dairy cows. J. Dairy Sci.
73:1560–1563.
Armstrong, D.G. and Webb, R. 1997. Ovarian follicular dominance: novel
mechanisms and protein factors. Revi.of Reprod. 2: 139–146.
Arnold, R.R., Russell J.E., Champion, W.J., Brewer, M., and Gauthier, J. 1982.
Bactericidal Activity of Human Lactoferrin: Differentiation from the Stasis
of Iron Deprivation. Infect. and Immun. 35: 792 - 799.
Ashkenazi A. and Dixit V.M. 1998. Death receptors: signaling and modulation.
Sci. 281: 1305–1308.
Babior, B.M.1984. Oxidants from phagocytes: agents of defense and destruction.
Blood. 64: 959.
Baker, E.N. and Lindley, P.F. 1992. New perspectives on the structure and
function of transferrins. J Inorg Biochem. 47:147–60.
Balasubramanian, K., Lavoie, H.A., Garmey, J.C., Stocco, D.M. and Veldhius,
J.D. 1997. Regulation of porcine granulosa cell steroidogenic acute
regulatory protein (StAR) by IGF-1: synergism with FSH or protein kinase
an agonist. Endocrinol. 138: 433–439.
Barling, K. 2014. Outsmart Stress in Beef Cattle. 2014. Stress.
http://beefmagazine.com.
Baveye, S., Elass, E., Fernig, D.G., Blanquart, C., and Legrand, D. 2000.
Human lactoferrin interacts with soluble CD14 and inhibits expression of
endothelial adhesion molecules, e-selectin and ICAM, induced CD14-
lipopolysaccharide complex. Infect. Immun. 68: 6519 - 6525.
Baynes, R.D., and Bezwoda, W.R. 1994. Lactoferrin and the inflammatory
response. Adv. Experim. Med. and Bio. 357: 133 -141.
Beam, S.W. and Butler, W.R. 1999. Effects of energy balance on follicular
development and first ovulation in post partum dairy cows. J. Reprod.
Fertil. Suppl. 54: 411–424.
Beharka, A.A., Nagaraja, T.G., Morrill, J.L., Kennedy, G.A. and Klemm, R.D.
1998. Effects of form of the diet on anatomical, microbial, and
fermentative development of the rumen of neonatal calves. J. Dairy Sci.
81: 1946-1955.
Bennett, R.M. and Kokocinski, T. 1978. Lactoferrin content of peripheral blood
cells. Br J Haematol. 39: 509–521.
Beutler, B. 2000. TLR4: central component of the sole mammalian LPS sensor.
Curr. Opin. Immunol. 12:20.
ii
Bhaskaran, B. and Abdullakhan, C.K. 1981. Role of blood serum inorganic
phosphorus in postparturient anoestrous cows. Livesto. Adviser. 9: 33-36.
Birgens, H,S. 1994. The monocytic receptor for lactoferrin and its involvement in
lactoferrin-mediated iron transport. Adv. Exp. Med. Biol. 357: 99–109.
Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggett, J., Kubista, M.,
Mueller, R., Nolan, T., Pfaffl, M. W., Shipley, G. L., Vandesompele, J. and
Wittwer, C.T. 2009. The MIQE guidelines: minimum information for
publication of quantitative Real-time PCR experiment. Clin.chem. 55:
611-622.
Butler, W.R., Calaman, J.J. and Beam, S.W.1996. Plasma and milk urea
nitrogen in relation to pregnancy rate in lactating dairy cattle. J Anim Sci.
74: 858-865.
Callaway, E.S. and Martin, S.A. 1997. Effect of Saccharomyces cerevisiae
culture on ruminal bacteria that utilize lactate and digest cellulose. J. Dairy
Sci. 80: 2035-2044.
Carnegie, J.A. and Tsang, B.K. 1984. The calcium calmodulin system;
participation in the regulation of steroidogenesis activity at different stages
of granulose cell differentiation. Biology of Reprod. 30: 515-522.
Carroll, J.A. 2008. Bidirectional communication: growth and immunity in
domestic livestock. J. Anim. Sci. 86: 126–137.
Chan, J.P., Chu, C.C., Fung, H.P., Chuang, S.T., Lin, Y.C., Chu, R.M. and Lee,
S.L. 2004. Serum Haptoglobin concentration in cattle. J. Vet.Med.Sci.
66:43-46.
Chaucheryras, F., Fonty, G., Bertin, G. and Gouet, P. 1995. In vitro utilization by
a ruminal acetogenic bacterium cultivated alone or in association with an
Archea methanogen is stimulated by a probiotic strain of Saccharomyces
cerevisiae. Appl. Environ. Microbiol. 61: 3466-3467.
Chaudhury, M. 2009. Evaluation of immune response by lymphocyte proliferation
and phygocytic activity during peripartum period in high producing cows.
iii
M V Sc Thesis submitted to department of animal physiology, National
Dairy Research Institute, Karnal, Harayana, India.
Choncznski, P. and Sccchi, N. 1987.Single-step method of RNA isolation by acid
guanidinium thiocynate phenol chloroform extraction.
Anim.biochem.162:156-159.
Chung, P.H., Sandhoff, T.W. and McLean, M.P. 1998. Hormone and
prostaglandin F2 regulation of messenger ribonucleic acid encoding
steroidogenic acute regulatory protein in human corpora lutea. Endocrino.
81:153–160.
Coleman, D.A., Thayne, W.V. and Dailey, R.A. 1985. Factors affecting
reproductive performance of dairy cows. J Dairy Sci. 68:1793–1803.
Conner, J.G., and Eckersall, P.D. 1988. Bovine acute phase response following
turpentine injection. Res. Vet. Sci. 44: 82–88.
Cowburn, A.S., Cadwallader, K.A., Reed, B.J., Farahi, N. and Chilvers, E.R.
2002. Role of PI3-kinase-dependent Bad phosphorylation and altered
transcription in cytokine-mediated neutrophil survival. Blood .100:2607.
Crocker, I.P., Baker, P.N. and Fletcher, J. 2000. Neutrophil function in pregnancy
and rheumatoidarthritis. Ann. Rheum. Dis. 59: 555–564.
Crouch, S.P., Slater, K.J. and Fletcher, J. 1992. Regulation of cytokine release
from mononuclear cells by the iron-binding protein lactoferrin. Blood. 80:
235–240.
Dann, H.M., Drackley, J.K., McCoy, G.C., Hutjens, M.F., and Garrett, J.E. 2000.
Effects of yeast culture (Saccharomyces cerevisiae) on prepartum intake
and postpartumintake and milk production of Jersey cows. J. Dairy Sci.
83:123–127.
Das, J.M., Dutta, P., Deka, K.C., Biswas, R.K., Sarmah, B.C. and Dhali, A. 2009.
Comparative study on serum macro and micro mineral profiles during
oestrus in repeat breeding crossbred cattle with impaired and normal
ovulation. Livest. Res. for Rural Devel. 21: 72.
iv
Das, S., Bandopadhya, S.K., Basu, S., Ghosh, B.B. and Dattagupta, R.
2002. Blood mineral profile of normal cyclic and repeat breeder crossbred
cows under rural condition. Ind. J. Anim. Reprod. 23: 167-169.
Daughaday, W.H., Hall, K., Raben, M.S., Salmon, W.D. Jr, Van Den Brande, J.L.
and Van Wik, J.J. 1972. Somatomedin: proposed designation for
sulphation factor. Nature. 235: 107.
Dawson, K.A., Newman. K.E. and Boling, J.A. 1990. Effect of microbial
supplement containing yeast and lactobacilli on roughage fed ruminal
microbial activities. J. Anim. Sci. 68: 3392 – 3398.
Delange, J., Langlois, M., Ouyang, J., Claeys, G., De Buyzere, M. and Wuyts, B.
1998. Effect of haptoglobin phenotypes on growth of Streptococcus
pyogenes. Clin. Chem. Lab. Med. 36: 691–696.
deMoura, M.D., Choi, D., Adashi, E.Y. and Payne, D.W. 1997. Insulin-like growth
factor-I mediated amplification of follicle-stimulating hormonesupported
progesterone accumulation by cultured rat granulosa cells:enhancement
of steroidogenic enzyme activity and expression. Biol. of Reprod. 56:
946–953.
Devoto, L., Christenson, L.K., MeAllister, J.M., Makrigiannakis, A. and Strauss,
J.F. 1999. Insulin and insulin-like growth factor-I and -II modulate human
granulosalutein cell steroidogenesis: enhancement of steroidogenic acute
regulatory protein (StAR) expression. Mol. Human Reprod. 5: 1003–1010.
Dhali, 2001. Studies on the effect of feeding management system on blood and
milk urea concentration in dairy cattle. Ph .D thesis, submitted to NDRI
(Deemed University), Karnal, Haryana, India.
Dhali, A., Mishra, D.P., Mehla. R.K., and Sirohi, S.K. 2006. Usefulness of Milk
Urea Concentration to Monitor the Herd. ReproductivePerformances in
Crossbred Karan-fries Cows. Asian-Aust. J. Anim. Sci. 19: 26-30
Down, S.M., Humpherson, P.Q., Martin, K.L. and Leese HJ .1996. Glucose
utilization during induced meiotic maturation in cumulus cells enclosed
mouse oocytes. Mol. Repro. Devlop. 44: 121-131.
v
Dubowski, K.M. 1962. An o-Toluidine method for body-fluid glucose
determination. Clinical Chemistry. 8: 215-235.
Eaton, J.W., Brandt, P. and Mahoney, J.R., 1982. Haptoglobin: A natural
bacteriostat. Sci. 215: 691–693.
Eckersall, P.D. and Conner, J.G. 1990. Plasma haptoglobin in cattle (Bos taurus)
exists as polymers in association with albumin. Comp. Biochem. Physiol.
96: 309–314.
El-Belely, M.S.1993. Progesterone, estrogen and selected biochemical
constituents in plasma and uterine flushings of normal and repeat breeder
buffalo cows. J. Agri. Sci. 120: 241 – 250.
Ellison, R.T. 1994. The Effect of lactoferrin on Gram-negative bacteria 3rd. Adv.
Exp. Med. Biol. 357: 71–90.
Elmer, G.W. and McFarland, L.V. 2001. Biotherapeutic agents in the treatment of
infections diarrhoca, gas fermenterol. Quin. North. Ameri. 30: 837-854.
Elrod, C.C. and Butler, W.R. 1993. Reduction of fertility & alteration of uterine pH
in heifers fed excess ruminally degradable protein. J. Anim. Sci. 71: 694.
Elrod, C.C., Amburgh, M.V. and Butler WR. 1993. Alteration of pH in response to
increased dietary protein in cattle are uniqueto the uterus. J. Anim. Sci.
71: 702-706.
Elrod, C.C. and Butler, W.R. 1992. Endometrial ion transport: Response to urea
and ammonia. J. Anim. Sci. 71: 271.
Enemark, J.M.D. 2008. The monitoring, prevention and treatment of sub-acute
ruminal acidosis (SARA): a review. Vet. J. 176: 32-43.
Erasmus, L.J., Botha, P.M. and Kistner, A. 1992. Effect of yeast culture
supplement on production, rumen fermentation, and duodenal nitrogen
flow in dairy cows. J. Dairy Sci.75: 3056-3065.
vi
Fahey, J., Sullivan, K.O., Crilly, J. and Mee, J.F. 2002. The effect of feeding and
management practices on calving rate in dairy herds. Anim. Reprod.
Sci.74: 133–150.
Fanning, N.F., Redmnd, H.P. and Bouchier-Hayes, D. 1999. Neutrophils and
apoptosis. In The Neutrophils: New Outlook for Old Cells. Ed. DI
Gabrilovich. London: Imperial College Press. 231–242.
Ferguson, J.D., Galligan, D.T., Blanchard, T. and Reeves, M. 1993. Serum
urea nitrogen and conception rate: The usefulness of the test information.
J. Dairy Sci. 76: 3742-3746.
Flood, M.R., Gage, T.L. and Bunch,T.D. 1993. Effect of various growth-
promoting factors on preimplantation bovine embryo development in vitro.
Theriogenol. 39: 823-833.
Fuller, R. 1989. A review: Probiotics in man and animals. J. Appl. Bact. 66: 365-
378.
Funston, R.N., Seidel, G.E., Klindt, J. and Roberts, A.J. 1996. Insulin-like growth
factor I and insulin-like growth factor-binding proteins in bovine serum and
follicular fluid before and after the preovulatory surge of luteinizing
hormone. Biol. of Reprod. 55: 1390–1396.
Furmanski, P. and Li, Z.P. 1990. Multiple forms of lactoferrin in normal and
leukemic humangranulocytes. Exp. Hematol.18: 932–945.
Garg, D.D. 2008. Efficiency of utilization of leguminous straw based complete
feed blocks alone and in combination with probiotics (Saccharomyces
cerevisiae) in ration of sheep. Ph. D. thesis, Rajasthan Agricultural
University, Bikaner, Rajasthan, India.
Garrett, J. 2000. “Use Yeast Culture to “Feed the Rumen First.” Diamond V.
Gattass, Carlos, Borges, and Assumpçao. 2008. Efeito da suplementaçao com
cultura de levedura na fermentaçao ruminal de bovinos de corte. R. Bras.
Zootec. 37: 711-716 .
vii
Gauldie, J., Richards, C., Northemann, W., Fey, G. and Baumann, H. 1989. IFN
beta 2/BSF2/IL-6 is themonocyte-derived HSF that regulates receptor-
specific acute phase gene regulation inhepatocytes. Ann. N.Y. Acad. Sci.
55:746–759.
Girard, I.D. 1996. Charactetization of stimulatory activities from Saccharomyces
cerevisiae on the growth and activities of ruminal bacteria. Ph.D.
Dissertation. University of Kentucky, Lexington, UK.
Giudice, L.C. 1992. Insulin-like growth factors and ovarian development. Endoc.
Rev. 13: 641–669.
Giudice, L.C. 1995. The insulin-like growth factor system in normal and abnormal
human ovarian follicle development. The Ameri. J. Med. 98 (Supplement
1): 48S-54S.
Goldammer, T., Zerbe, H., Molennar, A., Schuberth, H.J., Brunner, R.M., Kata,
S.R., and Seyfert, H.M. 2004. Mastitis Increases Mammary mRNA
Abundance of β-Defensin 5, Toll-Like-Receptor 2 (TLR2), and TLR4 but
Not TLR9 in Cattle. Clin. Diagn. Lab. Immunol. 11: 174–185.
Gordon, I. 2005. Reproductive Technologies in Farm Animals, CABI Publishing,
London, ISBN-10: 0851998623, pp: 346.
Greenberg, S. and Grinstein, S. 2002. Phagocytosis and innate immunity. Curr.
Opin. Immunol. 14:136.
Gustafsson, H., and Emanuelson, S. 2002. Charactrisation of repeat breeding
syndrome in swedish driry cattle. Acta Vet. Scan.43: 115-125.
Hagiwara, S., Kawai, K., Anri, A. and Nagahata, H. 2003.
Lactoferrinconcentrations in milk from normal and subclinical mastitic
cows. J. Vet. Med. Sci. 65: 319–323.
Haig, D.M., Hopkins, J. and Miller, H.R. 1999. Local immune responses in
afferent and efferent lymph. Immun. 96: 155-163.
viii
Hammon, H.M., Zanker, I.A. and Blum, J.W. 2000. Delayed colostrum feeding
affects IGF-I and insulin plasma concentrations in neonatal calves. J.
Dairy Sci. 83: 85-92.
Harada, A., Sekido, N., Akahoshi, T., Wada, T., Mukarda, N. and Matsushima, K.
1994. Essential involvement of interleukin-8 (IL-8) in acute inflammation. J
Leuko. Biol. 56:599-564.
Haslett, C., Savill, J., Whyte, M.K., Stern, M., Dransfield, I. and Meagher, L.C.
1994. Granulocyte apoptosis and the control of inflammation. Philos.
Trans. R. Soc. London Biol. Sci. 345: 327.
Hayashi, F., Means, T.K. and Luster, A.D. 2003. Toll-like receptors stimulate
human neutrophil function. Blood .102:2660.
Herrick, B. and John. 1977. External factors affecting reproduction in dairy cattle.
In: Some papers contributed to the 1st All India Symposium on Animal
Reproduction, Punjab Agricultural University, Ludhiana, India, 1-9.
Highshoe, A.P., Cochran, V., Corah, L.R., Kiracofe, G.H., Harmon, D.L. and
Perry, R.C. 1991. Effects of calcium soaps of fatty acids on postpartum
reproductive functions in beef cows. J. Anim. Sci. 69: 4097 – 4103.
Hirvonen, J., Huszenicza, G., Kulcsàr, M. and Pyörälä, S. 1999. Acute-phase
response in dairy cows with acute postpartum metritis. Theriogen. 51:
1071–1083.
Horadagoda, N.U., Knox, K.M.G., Gibbs, H.A., Reid, S.W.J., Horagoda, A.,
Edwards, S.E.R. and Eckersall, P.D. 1999. Acute phase proteinsin cattle:
discrimination between acute and chronic inflammation. Vet. Rec. 144:
437–441.
Hossner, K.L., McCusker, R.H. and Dodson, M.V. 1997. Insulin-like growth
factors and binding proteins in domestic animals. Anim.Sci..64:1–15.
Hughes, A.L. and Piontkivska, H. 2008. Functional diversification of the Toll-like
receptor gene family. Immunogenetics. 60: 249–256.
ix
Hultén, C., Sandgren, B., Skiöldebrand, E., Klingeborn, B., Marhaug, G.,
Forsberg, M.1999. The acute phase protein serum amyloid A (SAA) as an
inflammatory marker in equineInfluenza Virus infection. Acta Vet. Scand.
40: 323–333.
Hultén, C. and Demmers, S. 2002. Serum amyloid A(SAA) as an aid in the
management of infectious disease in the foal: comparison with
totalleucocyte count, neutrophil count and fibrinogen. Equine Vet. J. 34:
693–698.
Hwa, V., Oh, Y. and Rosenfeld, R.G. 1999. The insulin-like growth factor-binding
protein (IGFBP) superfamily. Endoc. Rev. 20: 761-787.
Ibraheem, K.C. and Ramachandran K. 2003. Bovine infertility: a field oriented
categorisation based on investigation among crossbred cattle in a district
of Kerala. Ind. J. of Anim. Sci. 73: 155-157.
Iwanska, S.D., Strusinska, W., Zalewski, D. and A. Opaka. 1999. The effect of
Saccharomyces cerevisiae 1026 used alone or with vitamin-mineral
premix on milk yield and milk composition in dairy cows. Acta Vet.
Hungarica. 47: 41-52.
Janeway, C.A., Travers, P., Walport, M. and Capra, J.D. 1999. The immune
system in health and disease. Immunobiology, New York: Elsevier
Science, London.
Jani, R.G., Prajapati, B.R. and Dave, M.R. 1995. Hematological and biochemical
changes in normal fertile and infertile Surti buffalo heifers. Ind. J. Anim.
Reprod. 5: 14 – 22.
JoeArosh, A., Kathiresan, D., Devanathan, T.G., Rajasundaram. R.C. and
Rajasekaran J. 1998. Blood biochemical profile in normal cyclical and
anoestrous cows. Indian. J. Anim. Sci. 68: 1154 – 1156.
Jones, J.I. and Clemmons, D.R. 1995. Insulin-like growth factors and their
binding proteins: biological actions. Endoc. Rev.16:3–34.
x
Jouany, J.P. 2001. Twenty years of research and now more relevant than ever
the coming of age of yeast cultures in ruminant diets. In: Responding to a
Changing Agricultural Landscape.Alltech’s European, Middle Eastern and
African Lecture Tour. 44-69.
Kamra, D.N. and Pathak NN. 2005. Improvement in livestock productivity by use
of probiotics: A review. Ind. J. Anim. Sci. 75: 128-134.
Kamra, D.N., Chaudhary, L.C., Singh, R. and Pathak, N.N. 1996. Influence of
feeding probiotics on body weight gain and nutrient digestibility in rabbits.
World rabbit Sci. 4: 85-88.
Kapadiya, F. M., Siddiquee, G. M., Sutariya, T. V., Patel, B. R. and Parmar, S.
M. 2013. Effect of Antibiotic Therapy on Blood Plasma Biochemical
Constituents In Repeat Breeder Mehsana Buffaloes. Wayamba J Anim.
Sci. 5: 719-722.
Kawai, K., Hagiwara, S., Anri, A. and Nagahata, H. 1999. Lactoferrin
concentration in milk of bovine clinical mastitis. Vet. Res. Commun. 23:
391–398.
Keene, W.R, Jandl, J.H. 1965. The sites of hemoglobin catabolism. Blood. 26:
705–718.
Khan, S., Thangavel, A. and Selvasubramaniyan, S. 2010. Blood Biochemical
profile in repeat Breeding cows. Tamilnadu J. Vet. Anim. Sci. 6: 75-80.
Kimura, M., Nakao, T., Moriyoshi, M. and Kawata, K. 1987. Luteal phase
deficiency as a possible cause of repeat breeding in dairy cows. British
Vet. J.143: 560–566.
Kluger, M.J., Ringler, D.H. and Anver, M.R. 1975. Fever and survival. Sci. 188: 166–168.
Kowalik, B., Michałowski. T., Pająk, J.J, Taciak, M. and Zalewska, M. 2011. The
effect of live yeast, Saccharomyces cerevisiae, and their metabolites on
ciliate fauna, fibrolytic and amylolytic activity, carbohydrate digestion and
fermentation in the rumen of goats. J Anim Feed Sci. 20: 526–536.
xi
Krehbiel, C.R., Rust, S.R., Zhang, G. and Gilliland, S.E. 2003. Bacterial direct-
fed microbials in ruminant diets: Perfomance response and mode of
action. J. Dairy Sci. 81: 120-132.
Kuijpers, T.W. 2002. Clinical symptoms and neutropenia: the balance of
neutrophil development, functional activity and cell death. European J
Pediatrics. 161: 75–82.
Kumar, U., Sareen, V.K. and Singh, S. 1997. Effect of yeast
culturesupplementation on ruminal microbial populations and metabolism
in buffalo calves fed a high roughage diet. J. Sci. Food Agric.73: 231–236.
Laborde, J.M. 2008. Effects of probiotics and yeast culture on rumen
development and growth of dairy calves. Thesis submitted to the
Graduate Faculty of the Louisiana State University and Agricultural and
Mechanical College, USA.
Laron, Z. 2001. Insulin-like growth factor 1 (IGF-1): a growth hormone. J Clin.
Pathol: Mol. Pathol. 54: 311-316.
Lauritzen, B., Lykkesfeldt, J., Skaanild, M.T., Angen, O., Nielsen, J.P. and Friis,
C. 2003. Putative biomarkers for evaluating antibiotic treatment: an
experimental model of porcineActinobacillus pleuropneumoniae infection.
Res. Vet. Sci. 74: 261–270.
Leeuwenberg, B.R., Hudson, N.L., Moore, L.G., Hurst, P.R., and McNatty, K.P.
1996. Peripheral and ovarian IGF-I concentrations during the ovine
oestrous cycle. J. Endocrinol.148: 281–289.
Liles, W.C., Kiener, P.A., Ledbetter, J.A., Aruffo, A. and Klebanoff, S.J. 1996.
Differential expression of Fas (CD95) and Fas ligand on normal human
phagocytes: implications for the regulation of apoptosis in neutrophils. J.
Exp. Med. 184: 429–440.
Lin, E.Y., Orlofsky, A., Wang, H.G., Reed, J.C. and Prystowsky, M.B. 1996. A1,
a Bcl-2 family member, prolongs cell survival and permits myeloid
differentiation. Blood. 87: 983–992.
xii
Linn, J. and Raeth-Knight, M. 2006. “Yeast in Dairy Cattle Diets.” 2006 Four
State Dairy Nutrition and Management Conference. 85-90.
Lucy, M.C., Beck, J., Staples, C.R., Head, H.H., De LaSota, R.L. and Thatcher,
W.W. 1991. Follicular dynamics, plasma metabolites, and growth factors
in lactating cows with positive or negative energy balance during the
periestrual period. Reprod.Nutr. Devel. 32: 331–341.
Lucy, M.C. 2001.Reproductive loss in high-producing dairy cattle: Where will it
end?. J. Dairy Sci. 84:1277–1293.
Maaks, S., Yan, H.Z. and Wood, W.G. 1989. Development and evaluation
ofluminescence based sandwich assay for plasma lactoferrin as amarker
for sepsis and bacterial infections in pediatric medicine. J. Biolumines
Chemilumines. 3: 221–226.
Maianski, N.A., Maianski, A.N., Kuijpers, T.W. and Roos, D. 2004. Apoptosis of
neutrophils. Acta Haematol.11:56–66.
Majdoub-Mathlouthi, L., Kraiem, K. and Larbier, M. 2009. Effects of feeding
Saccharomyces cerevisiae Sc 47 to dairy cows on milk yield and milk
components, in Tunisian conditions. Livest. Res. Rural Develop. 21: 73.
Mamluk, R., Greber, Y. and Meiden, R. 1999. Hormonal regulation of messenger
ribonucleic acid expression for steroidogenic factor-I, steroidogenic acute
regulatory protein and cytochrome P450scc in bovine luteal cells. Biol.
Reprod. 60: 628–634.
Markusfeld, D., Galon, N. and Ezra, E. 1997. Body condition score, health, yield
andfertility in dairy cows. Vet. Rec. 141: 67-72.
Maurya, M.S., Singh, R., Pathak, N.N. and Kamra, D.N. 1993. Effect of feeding
live yeast (Sachharomyces cerevisiae) on nutrient digestibility in goats. In:
Proceedings of Sixth Animal Nutrition Research Workers Conference,
Bhubaneswar, Sept. 13-16. 142.
Mazurier, J., Legrand, D., Leveugle, B., Rochard, E., Montreuil, J. and Spik, G.
1994. Study on the binding of lactotransferrin (lactoferrin) to human PHA-
xiii
activated lymphocytes and nonactivated platelets: Localisation and
description of the receptor-binding site.Adv. Exp. Med. Biol. 357:111–119.
McDougall, S. 2006. Reproduction performance and management of dairy cattle.
J. Reprod. Dev. 52:185–194.
McNall, A.D., Etherton, T.D. and Fosmire, G.J. 1995. The impaired growth
induced by zinc deficiency in rats is associated with decreased expression
of the hepatic insulin-like growth factor I and growth hormone receptor
genes. J. Nutr.125: 874–879.
Medema, J.P., Scaffidi, C., Kischkel, F.C., Shevchenko, A., Mann, M and
Krammer, P.H. 1997. FLICE is activated by association with the CD95
death-inducing signaling complex (DISC). EMBO J. 16: 2794–2804.
Medzhitov, R.P., Preston,H. and Janeway, C.A. Jr. 1997. A human homologue of
the Drosophila Toll protein signals activation of adaptive immunity.
Nature. 388:394.
Mehrzad, J., Duchateau, L. and Burvenich, C. 2004. Viability of milk neutrophils
and sevearity of bovine coliform mastitis. J. Dairy Sci. 87: 4150-4162.
Mehrzad, J., Dosogne, H., Meyer, E. and Burvenich, C. 2001. Local and
systemic effects of endotoxin mastitis on the chemiluminescence of milk
and blood neutrophils in dairy cows. Vet. Res., 32:131–144.
Miyauchi, H., Hashimoto, S., Nakajima, M., Shinoda, I., Fukuwatari, Y. and
Hayasawa, H. 1998. Bovine lactoferrin stimulates the phagocytic activity
of human neutrophils: Identification of its active domain. Cell Immunol.
187: 34–37.
Miyoshi, S., Pate, J.L., Palmquist, D.L. 2001. Effects of propylene glycol
drenching on energy balance, plasma glucose, plasma insulin, ovarian
function and conception in dairy cows. Anim. Reprod. Sci. 68: 29–43.
Morimatsu, M., Sarikaputi, M., Syotu, B., Saito, M., Yamamoto, S. and Naiki, M.
1992. Bovine haptoglobin: single radial immunodiffusion assay of its
xiv
polymeric forms and dramatic rise in acute-phase sera. Vet. Immunol.
Immunopathol. 33: 365–372
Morimatsu, M., Syoto, B., Shimada, N., Fujinaga, T., Yamamoto, S., Saito, M.
and Naiki, M. 1991.Isolation and characterization of bovine haptoglobin
from acute phase sera, J. Biol. Chem. 266: 11833–11837.
Moulding, D.A., Quayle, J.A., Hart, C.A. and Edwards, S.W. 1998. Mcl-1
expression in human neutrophils: regulation by cytokines and correlation
with cell survival. Blood. 92: 2495-2499.
Murata, H. and Miyamoto, T. 1993. Bovine haptoglobin as a possible immune
modulator in the sera of transported calves. Br. Vet. J. 149: 277–283.
Murray, J., Barbara, J.A., Dunkley, S.A., Lopez, A.F., VanOstade, X. and
Condliffe, A.M . 1997. Regulation of neutrophils apoptosis by tumour
necrosis factor-a: requirement for TNFR55 and TNFR75 for induction of
apoptosis in vitro. Blood. 90: 2772–2783
Muzio, M., Stockwell, B.R., Stennicke, H.R., Salvesen, G.S. and Dixit, V.M.
1998. An induced proximity model for caspase-8 activation. J. Biol. Chem.
273: 2926–2930.
NRC. 1989. Nutrient requirements of dairy cattle, 6th revised edition. National
Academy Press, Washington, DC,USA.
Nagata, S. 1997. Apoptosis by death factor. Cell. 88: 355–365.
Nathan, C. 2006. Neutrophils and immunity: challenges and opportunities.
Nature Revi. Immunol. 6: 173-182.
Newbold, C.J., Wallace, R.J. and McIntosh. F.M. 1996. Mode of action of the
yeast Saccharomyces cerevisiae as a feed additive for ruminants. British
J. Nutrition. 76: 249-261.
Nickerson, S.C. 1989. Immunological aspects of mammary involution. J. Dairy
Sci. 72: 1665-1678.
xv
Nikkhah, A., Bonadaki, M.D. and Zali, A. 2004. Effects of feeding yeast
(Saccharomyces cerevisiae) on productive performance of lactating
Holstein dairy cows. Iranian J. Agri. Sci. 35: 53-60.
Nisbet, D.J. and Martin, S.A. 1991. Effect of a Saccharomyces cerevisiae culture
on lactate utilization by the ruminal bacterium Selenomonas ruminantium.
J. Anim. Sci. 69: 4628-4633.
Nuttinck, F., Charpigny, G., Mermillod, P., Loosfelt, H., Meduri, G., Freret, S.,
Grimard, B. and Heyman, Y. 2004. Expression of components of the
insulin-like growth factor system and gonadotropin receptors in bovine
cumulus-oocyte complexes during oocyte maturation. Domestic Anim.
Endoc. 27: 179-195.
O’Neill, L.A. and Bowie, A.G. 2007. The family of five: TIR-domain-containing
adaptors in Toll-like receptor signaling. Nat. Rev. Immunol. 7: 353–64.
Oliver, S.P., and Sordillo, L.M. 1989. Approaches to the manipulation of
mammary involution. J.Dairy Sci. 72: 1647-1664.
Opsomer, G., Grohn, Y.T., Hertl, J., Coryn, M., Deluyker, H. and de Kruif A.
2000. Risk factors for post partum ovarian dysfunction in high producing
dairy cows in Belgium: A field study. Theriogenol. 53: 841–857.
Owens, F.N., Secrist, D.S., Hill, W.J. and Gill, D.R. 1998. Acidosis in cattle: A
review. J. Anim. Sci. 76: 275-286.
Papadopoulos, S., Lonergan, P., Gath, V., Quinn, K.M., Evans, C., O'Callaghan,
D. and Bolan, M.P. 2001. Effect of diet quantity and urea supplementation
on oocyte and embryo quality in sheep. Theriogenol. 55:1059-1069.
Parker, R.B. 1974. Probiotics in other half of the antibiotics story. Anim. Nutr.
And Health. 28: 4-8.
Parmer, K.I., Mehta, V.M. and Patel, J.M. 1986. Biochemical profile in repeat
breeding crossbred cows relations to different phases of oestrous cycle.
Indian J. Anim. Reprod. 2: 31-35.
xvi
Patel, P.M., Dhami, A.J. and Kavani, F.S. 2008. Postpartum Plasma Profile of
Calcium, Phosphorus and Magnesium in Holstein Friesian Cows With out
and with Hormone Therapy. Int. J. cow sci. 4: 6-10.
Peracchia, C. 1978. Calcium effect on gap junction structure and cell
coupling. Nature Land. 271: 669-671
Perks, C.M, Peters, A.R. and Wathes, D.C. 1999. Follicular and luteal
expression of insulin-like growth factors I and II and the type 1 IGF
receptor in the bovine ovary. J. Reprod. Ferti. 116: 157–165.
Petersen, H.H., Ersboll, A.K., Jensen, C.S. and Nielsen, J.P. 2002. Variation of
serum haptoglobin concentration in slaughter pigs of different health
status. Prev. Vet. Med. 54: 325–335.
Petersen, H.H., Nielsen, J.P., Heegaard, P.M.H. 2004. Application of acute
phase protein measurements in veterinary clinical chemistry. Vet. Res.35:
163–187.
Pfaffl, M.W. 2001. Relative Quantification in: Real-time PCR. International
University Line. 63-82.
Phillips, W.A., VonTungelin, D.L. 1984. Effect of adding yeast culture to the
receiving ration of stressed stocker calves. Anim. Sci. Rep. 117: 116-121.
Piva, G., Belladonna, S., Fusconi, G. and Sicbaldi, F. 1993. Effects of yeast on
dairy cow performance, ruminal fermentation, blood components, and milk
manufacturing properties. J. Dairy Sci. 76: 2717–2722.
Plata, F.P., Mendoza, G.D., BarcenaGama, J.R. and Gonzalez, S.M. 1994.
Effect of a yeast culture (Saccharomyces cerevisiae) on neutral detergent
fiber digestion in steers fed oat straw based diets. Anim. Feed Sci.
Technol. 49: 203-210.
Plym Forshell, K., Andersson, L. and Pehrson, B. 1991. The Relationships
between the Fertility of Dairy Cows and Clinical and Biochemical
Measurements, with Special Reference to Plasma Glucose and Milk
Acetone. J. vet. Med. 38: 608-616.
xvii
Polonovski, M. and Jayle, M.F. 1939. Peroxydasesanimales. Leur spécificité et
leur role biologique. Bull. Soc. Chim. Biol. 66: 91.
Prahalada, H.K., Kamra, D.N. and Pathak, N.N. 2002. Effect of feeding
Saccharomyces cerevisiae and Lactobacillus acidophilus on nutrient
utilization and performance of crossbred cattle calves. Int. J. Anim. Sci.16:
103-107.
Putnam, D.E., schwab, C.G., socha, M.T., whitehouse, N.L., kierstead, N.A. and
Garthwaite, B.D. 1997. Effect of Yeast Culture in the Diets of Early
Lactation Dairy Cows on Ruminal Fermentation and Passage of Nitrogen
Fractions and Amino Acids to the Small Intestine. J. Dairy Sci. 80: 374–
384.
Putnam, F.W. 1975. Haptoglobin, in: Putnam F.W.(Ed.), The plasma proteins,
Academic Press.
Rabiee, A.R., Lean, I.J., Gooden, J.M. and Miller, B.G. 1999. Relationships
among metabolites influencing ovarian function. J. Dairy Sci. 82: 39-44.
Rabiee, A.R., Lean, I.J., Gooden, J.M, Miller, B.G. and Scaramuzzi, R.J. 1997.
An evaluation of transovarian uptake of matabolites using arterio-venous
difference methods in dairy cattle. Anim. Repro. Sci. 48: 9-25.
Rahmatullah, M. and Boyde, T.R.C. 1980. Improvement in the determination of
urea using dacetylmonoxime method with and without deproteinization.
Clinica Chimica Acta. 107: 3-9.
Rao, T.N., Rao, Z.P. and Rama, P. 2001. Supplementation of probiotics on
growth performance in sheep. Indian J. Anim. Nutr. 20: 224 – 226.
Rao, S., Venkatasubramanian, V.N. and Wit, J.D. 1995. Consequenceces of
cross breeding Programme in India. Ecomo. Polit. Weekly. 30: 112-116.
Richards, M.W., Wettemann, R.P. and Schenemann, M.H. 1989. Nutitional
anestrus in beef cows: Concentrations of glucose and nonestrified fatty
acids in plasma and insulin in serum. J. Anim. Sci. 67: 2354 – 2362.
xviii
Rinderknecht, E. and Humbel, R.E. 1976. Amino-terminal sequences of two
polypeptides from human serum with non suppressible insulin-like and
cell-growth-promoting activities: Evidence for structural homology with
insulin B chain. PNAS. 73: 4379-4381.
Roberts, A.J., Nugent, R.A., Klindt, J. and Jenkins, T.G. 1997. Circulating insulin-
like growth factor I, insulin-like growth factor binding proteins, growth
hormone, and resumption of estrus in postpartum cows subjected to
dietary energy restriction. J. Anim. Sci. 75:1909–1917.
Roberts, S.J. 1971. Veterinary Obstetrics and Genital Diseases
(Theriogenology). Published by the Author, Ithaca, New York, USA. 496-
506.
Robertson, J.D., Orrenius, S. and Zhivotovsky, B. 2000. Review: nuclear events
in apoptosis. J. Struct. Biol.. 120: 346–358.
Robinson, P.H .1997. Effect of Yeast Culture (Saccharomyces cerevisiae) on
adaptation of cows to postpartum diets.J. Dairy Sci. 80: 1119-1125.
Robinson, P.H. and Garrett, J.E. 1999. Effect of yeast culture (Saccharomyces
cerevisiae) on adaptation of cows to postpartum diets and on lactational
performance. J. Anim Sci. 77: 988-999.
Rock, F.L., Hardiman, T.G., Kastelein, J.C. and Bazan, R.A. 1998. A family of
human receptors structurally related to Drosophila Toll. Proceedings of
the National Academy of Sciences (USA). 95: 588-593.
Ross, E.A., Douglas, M.R. and Wong, S.H. 2006. Interaction between integrin
a9b1 and vascular cell adhesion molecule-1 (VCAM-1) inhibits neutrophil
apoptosis. Blood.107:1178–1183.
Rossi, S., Dell-Orto C.A., Bassini, V., Chevaux, A.L.E. and Savoini, G. 2006.
“Effects of live yeast in beef cattle studied.” Feedstuffs. 11.
Royal, M.D., Darwash, A.O., Flint, A.P.F., Webb, R., Wooliams, J.A. and
Lamming, G.E. 2000. Declining fertility in dairy cattle: Changes in
traditional and endocrine parameters of fertility. Anim. Sci. 70: 487–501.
xix
Rupde, N.D., Rode, A.M., Sarode, D.B., Zade, N.N., Jagtap, D.G. and Kaikini,
A.S. 1993. Serum biochemical profile in repeat breeders. Indian J. Anim.
Reprod. 14: 79-81.
Saini, P.K. and Webert, D.W. 1991. Application of acute phase reactants during
antemortemand postmortem meat inspection. J. Am. Vet. Med. Assoc.
198:1898–1901.
Salmon, W.D. Jr., and Daughaday, W.H. 1956. Sulfation factor, a serum
component mediating the action of growth hormone in stimulating
incorporation of sulfate into cartilage. J.Clin. Invest. 35 (abstract): 733.
Salmon, W.D. Jr., and Daughaday, W.H. 1957. A hormonally controlled serum
factor which stimulates sulfate incorporation by cartilage in vitro. J. Lab.
Clini. Med. 149: 825-836.
Salonen, M., Hirvonen, J., Pyörälä, S., Sankari, S. and Sandholm, M. 1996.
Quantitative determination of bovine serum haptoglobin in experimentally
induced Escherichia coli mastitis. Res. Vet. Sci. 60: 88–91.
Savill, J., Dransfield I., Gregory, C. and Haslett, C. 2002. A blast from the past:
clearance of apoptotic cells regulates immune responses. Nat. Rev.
Immunol. 2: 965.
Saxena, M.S. 2004. Repeat breeding in cows and buffaloes. In Proc. “National
Symposium on conservation and propagation of indigenous breeds of
cattle and buffaloes” held at Pantnagar, Uttaranchal, from Feb 26-28.
Schulze-Osthoff, K., Ferrari, D., Los, M., Wesselborg, S. and Peter, M.E. 1998.
Apoptosis signaling by death receptors. European J. Biochem. 254: 439–
459.
Schumann, R.R., Leong, S.R., Flaggs, G.W., Gray, P.W., Wright, S.D.,
Mathison, J.C., Tobias, P.S. and Ulevitch, R.J. 1990. Structure and
function of liposaccharide binding protein. Sci. 249: 1429-31.
Sharma, K., Wang, R.X., Zhang, L.Y., Yin, D.L., Luo, X.Y., Solomon, J.C., Jiang,
R.F., Markos, K., Davidson, W., Scott, D.W. and Shi, Y.F. 2000. Death the
xx
Fas way: regulation and pathophysiology of CD95 and its ligand.
Pharmacol. Therapeuti.. 88: 333–347.
Shau, H., Kim A, Golub, S.H. and Leukoc, J. 1992. Modulation of natural killer
and lymphokine-activated killer cell cytotoxicity by lactoferrin. J. Leuko.
Biol. 51: 343–349.
Shehab-el-deen. 2011. Effects of metabolic stressors and high temperature on
oocyte and embryo quality in high yielding dairy cows. Ph D.Thesis
submitted to Faculty of Veterinary Medicine, Ghent University.Merelbeke.
Belgium.
Sheldon, I.M., Noakes, D.E., Rycroft, A. and Dobson, H. 2001. Acute phase
protein responses to uterine bacterial contamination in cattle after calving.
Vet. Rec. 148: 172–175.
Shingu, H., Hodate, K., Kushibiki, S., Touno, E., Oshibe, A., Ueda, Y. Shinoda,
M. and Ohashi S. 2009. Effects of growth hormone-releasing hormone
treatment on milk production and plasma hormones and metabolites in
lactating Japanese Black cows under negative energy balance. J. Anim.
Sci. 87:1247–1253.
Shugars, D.C., Watkins, C.A. and Cowen, H.J. 2001. Salivary concentration of
secretary leukocyte protease inhibitor, an antimicrobial protein, is
decreased with advanced age. Gerontol. 47: 246–253.
Silverman, L., Eimerl, S. and Orly, L. 1999. CCAAT enhancer binding protein
beta and GATA-4-binding regions within the promoter of the steroidogenic
acute regulatory protein (StAR) gene are required for transcription in rat
ovarian cells. J. Biol. Chem. 274: 17987–17996.
Simon, H.U. 2003. Neutrophil apoptosis pathways and their modifications in
inflammation. Immunol. Rev. 193: 101–110.
Skinner, J.G., Brown, R.A.L. and Roberts, L.1991. Bovine haptoglobin response
in clinically defined field conditions. Vet. Rec. 128: 147–149.
xxi
Smith, B.I., Donovan, G.A., Risco, C., Littell, R., Young, C., Stanker, L.H. and
Elliott, J. 1998. Comparison of various antibiotic treatments for cows
diagnosed with toxic puerperal metritis. J. Dairy Sci. 81: 1555–1562.
Soccol, C.R., Vandenberghe, L.P. de, S., Spier, M.R., Medeiros, A.B.P.,
Yamaguishi, C.T., Lindner, J.D.D., Pandey, A. and Thomaz-Soccol, V.
2010. The Potential of Probiotics. Food Technol. Biotechnol. 48: 413–
434.
Soder, K.J. and Holden L.A. 1999. Dry matter intake and milk yield and
composition of cows fed yeast prepartum and postpartum. Indian J.
Dairy Sci. 82: 605-610.
Spicer, L.J. and Echternkamp, S.E. 1995. The ovarian insulin and insulin-like
growth factor system with an emphasis on domestic animals. Domest.
Anim. Endocrinol. 12: 223–245.
Spicer, L.J. 2004. Proteolytic degradation of insulin-like growth factor binding
proteins by ovarian follicles: a control mechanism for selection of
dominant follicles. Biol. Reprod. 70: 1223-1230.
Steijns, J.M. and Van Hooijdonk, A.C.M. 2000. Occurrence, structure,
biochemical properties and technological characteristics of lactoferrin.
Brit. J. Nutri. 84, Suppl. 1: S11-S17.
Stein, D., Roth, S., Vogelsang, E. and Nusslein-Volhard, C. 1991. The polarity of
the dorsoventral axis in the Drosophila embryo is defined by an
extracellular signal. Cell. 65: 725-735.
Stewart, R.E., Spicer, L.J., Hamilton, T.D. and Keefer, B.E. 1995. Effect of
insulin-like growth factor-I and insulin on proliferation, and basal and
luteinizing hormone-induced steroidogenesis of bovine thecal cells:
involving of glucose and receptors for insulin-like growth factor1. J. Anim.
Sci. 73: 3719-3731.
Strassheim, D.K., Asehnoune, J.S., Park, J.Y., Kim, Q.H., Richter, D., Kuhn, K.,
Mitra, S. and Abraham, E. 2004. Phosphoinositide 3-kinase and Akt
xxii
occupy central roles in inflammatory responses of Toll-like receptor 2-
stimulated neutrophils. J. Immunol. 172: 5727.
Sudo, N., Shimizu, T., Kawashima, C., Kaneko, E., Tetsuka, M. and Miyamoto A.
2007. Insulin-like growth factor-I (IGF-I) system during follicle
development in the bovine ovary: relationship among IGF-I, type 1 IGF
receptor (IGFR-1) and pregnancyassociated plasma protein-A (PAPP-A).
Molecular Cellular Endocrinol. 264: 197- 203.
Sune, R.W. and Muhlbach P.R.F. 1998. Effect of yeast culture (Saccharomyces
cerevisiae) strain 1026 addition on milk yield and milk quality of Holstein
cows in pasture. Revista Brasileira-de-Zootecnia. 27: 1248-1252.
Takeuchi, O., Hoshino, K. and Akira, S. 2000. Cutting edge: TLR2-deficient and
MyD88-deficient mice are highly susceptible to Staphylococcus aureus
infection. J. Immunol. 165: 5392–5396.
Thatcher, W.W., LaSota, R.D., Schmitt, E.J., Diaz, T.C., Badinga, L., Simmen,
F.A., Staples, C.R. and Drost, M. 1996. Control and management of
ovarian follicles in cattle to optimize fertility. Reprod. Fertil. Devel. 8: 203–
217.
Thissen, J.P., Ketelslegers, J.M. and Underwood, L.E. 1994. Nutritional
regulation of the insulin-like growth factors. Endocr. Rev. 15: 80–101.
Thomas, L.L., Xu, W. and Ardon, T.T. 2002. Immobilized Lactoferrin Is a
Stimulus for Eosinophil Activation. J. Immunol.169: 993–999.
Uchida, E., Katon, N. and Takahashi, K. 1993. Appearance of Haptoglobin in
serum from cows at paruration. J. Vet. Med. Sci. 55: 893-894.
Urban, R.J., Garmey, J.C., Shupnik, M.A. and Veldhuis, J.D. 1990. Insulin-like
growth factor type-I increase concentrations of mRNA encoding
CYP450scc enzyme in primary cultures of porcine granulosa cells.
Endocrinology.127: 2481–2488.
Valenti, P. and Antonini, G. 2005. Lactoferrin an important host defence against
microbial and viral attack. Cellul. Molecul.Life Sci. 62: 2576- 2587
xxiii
Vogel, S.N., Fitzgerald, K.A. and Fenton, M.J. 2003. TLRs: Differential adaptor
utilization by toll –like receptors mediates TLR- specific patterns of gene
expression. Mol. Intervet. 3: 466-77.
Wang, X.P., Xu, S.Z., Gao, X. and Ren, H.Y. 2007. Genetic polymorphism of
TLR-4 gene and correlation with mastitis in cattle. J. Genet. and Genom.
34: 406-412.
Ward, C., Chilvers, E.R., Lawson, M.F., Pryde, J.G., Fujihara, S. and Farrow,
S.N. 1999 NF-kB activation is a critical regulator of human granulocyte
apoptosis in vitro. J. Biol. Chem. 274: 4309–4318.
Wathes, D.C., Fenwick, M., Cheng, Z., Bourne, N., Llewellyn, S., Morris, D.G.,
Kenny, D., Murphy, J. and Fitzpatrick R. 2007. Influence of negative
energy balance on cyclicity and fertility in the high producing dairy cow.
Theriogenol. 68: 232.
Wathes, D.C. 2008. Metabolic effects on the reproductive tract environment and
conception rates in the dairy cow. Havemeyer Found Monogr Ser. 21: 15–
19.
Wathes, D.C., Taylor VJ, Cheng Z and Mann GE. 2003. Follicle growth, corpus
luteum function and their effects on embryo development in postpartum
dairy cows. Reprod. Suppl. 61:219–237.
Wehrman, M.E., Welsh, T.H. and Williams, G.L. 1991. Diet induced hyperlipemia
in cattle modifies intracellular cholesterol environment, modulates ovarian
follicular dynamics and hastens the onset of postpartum luteal activity.
Biol. Reprod. 95: 514 – 523.
Werling, D., Piercy, J., Coffey, T.J. 2006. Expression of TOLL-like receptors
(TLR) by bovine antigen-presenting cells-potential role in pathogen
discrimination? Vet. Immunol. Immunopathol. 112: 2–11.
Westwood, C.T., Lean, I.J. and Kellaway, R.C.1998. Indications and implications
for testing of milk urea in dairy cattle: a quantitative review Part 2. Effect
of dietary protein onreproductive performance. N. Z. Vet. J. 46: 123–130.
xxiv
White, S.N., Taylor, K.H., Abbey, C.A., Gill, C.A. and Womack, J.E. 2003.
Haplotype variation in bovine Toll-like receptor 4 and computational
prediction of a positively selected ligand-binding domain. Proc. Natl. Acad.
Sci. 100: 10364-10369.
Williams, P.E.V. and Lyons, I. P. 1988. Understanding the biochemical mode of
action of yeast culture. Biotechnology in feed industry. In: Proceedings of
Alltech’s 4th Annual symposium. 79-99.
Williams, P.E., Tait, C.A., Innes,G.M. and Newbold C.J. 1991. Effects of the
inclusion of yeast culture (Saccharomyces cerevisiae plus growth
medium) in the diet of dairy cows on milk yield and forage degradation
and fermentation patterns in the rumen of steers. J. Ani. Sci. 69: 3016-
3026.
Wohlt, J.E., Finkelstein, A.D. and Chung, C.H. 1991. Yeast culture to improve
intake, nutrient digestibility and performance by dairy cattle during early
lactation. J.Dairy Sci. 74: 1395-1400.
Wolfram, P., Holm, Z., Juliane, G., Wei,.Y., Hans-Martin, S., Gerd, N. and Hans-
Joachim S. 2008. Escherichia coli, but not Staphylococcus aureustriggers
anearly increased expression of factors contributing to the innate immune
defense in the udder of the cow. Vet. Res. 39: 18.
Wright, S.D., Ramos, R.A., Tobias, P.S., Ulevitch, R.J. and Mathison, J.C. 1990.
CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS
binding protein. Sci. 249:1431-1433.
Yoon, I.K. and Stern, M.D.1996. Effects of Saccharomyces cerevisiae and
Aspergillus oryzae cultures on ruminal fermentation in dairy cows. J. Dairy
Sci. 79: 411-417.
Yu, R.H. and Schryvers, A.B. 2002. Bacterial lactoferrin receptors: Insights from
characterizing the Moraxella bovis receptors. Biochem. Cell Biol. 80: 81–
90.
Yum, H.K., Arcaroli, J., Kupfner, J., Shenkar, R., Penninger, J.M., Sasaki, T.,
Yang, K.Y., Park, J.S, and Abraham, E. 2001. Involvement of
xxv
phosphoinositide 3-kinases in neutrophil activation and the development
of acute lung injury. J. Immunol. 167: 6601.
Zhang, Y.L., Cheng, Q.F., Cao, Y.X., Wang, Y.H., Zhang, Z.S., Wu, Y.Q. and
Zhou, Y.Y. 2000. Effects of yeast (Saccharomyces cerevisiae) on milk
production and composition in Holstein dairy cows. China Dairy Cattle. 5:
20-22.
Zimmermann, K.C., Bonzon, C. and Green, D.R. 2001. The machinery of
programmed cell death. Pharmacol. and Therapeut. 92: 57–70.
Zong, W.X., Edelstein, L.C., Chen, C., Bash, J. and Gélinas, C. 1999. The
prosurvival Bcl-2 homolog Bfl-1/A1 is a direct transcriptional target of NF-
kB that blocks TNF-a-induced apoptosis. Genes Dev. 13: 382–387.
Zuccotti, G.V., Salvini, F., Riva, E. and Agostoni, C. 2006. Oral lactoferrin in HIV-
1 vertically infected children: an observational follow-up of plasma viral
load and immune parameters. J. Int. Med. Res. 34: 88–94.
Zulu, C.V., Nakao, T. and Sakamukai, Y. 2002. Insulin-Like Growth Fasctor-1 as
possible hormonal mediator of nutritional regulation of reproduction in
cattle. J. Vet. Med. Sci. 6: 657-665.
xxvi