CS273a Lecture 4, Autumn 08, Batzoglou DNA Sequencing

CS273a Lecture 4, Autumn 08, Batzoglou

DNA Sequencing


DNA sequencing

How we obtain the sequence of nucleotides of a species

…ACGTGACTGAGGACCGTGCGACTGAGACTGACTGGGTCTAGCTAGACTACGTTTTATATATATATACGTCGTCGTACTGATGACTAGATTACAGACTGATTTAGATACCTGACTGATTTTAAAAAAATATT…


Which representative of the species?

Which human?

Answer one:

Answer two: it doesn’t matter

Polymorphism rate: number of letter changes between two different members of a species

Humans: ~1/1,000

Other organisms have much higher polymorphism rates Population size!


Why humans are so similar

A small population that interbred reduced the genetic variation

Out of Africa ~ 40,000 years ago

Out of Africa

Heterozygosity: H

H = 4Nu/(1 + 4Nu)

u ~ 10-8, N ~ 104

H ~ 410-4

N


Human population migrations

• Out of Africa, Replacement “Grandma” of all humans (Eve) ~150,000yr

• Ancestor of all mtDNA

“Grandpa” of all humans (Adam) ~100,000yr• Ancestor of all Y-chromosomes

• Multiregional Evolution Fossil records show a continuous change of

morphological features Proponents of the theory doubt mtDNA and

other genetic evidence

• New fossil records bury “multirigionalists” Nice article in Economist on thathttp://www.economist.com/science/displaystory.cfm?story_id=9507453


DNA Sequencing – Overview

• Gel electrophoresis Predominant, old technology by F. Sanger

• Whole genome strategies Physical mapping Walking Shotgun sequencing

• Computational fragment assembly

• The future—new sequencing technologies Pyrosequencing, single molecule methods, … Assembly techniques

• Future variants of sequencing Resequencing of humans Microbial and environmental sequencing Cancer genome sequencing

1975

2015


DNA Sequencing

Goal:

Find the complete sequence of A, C, G, T’s in DNA

Challenge:

There is no machine that takes long DNA as an input, and gives the complete sequence as output

Can only sequence ~900 letters at a time


DNA Sequencing – vectors

+ =

DNA

Shake

DNA fragments

VectorCircular genome(bacterium, plasmid)

Knownlocation

(restrictionsite)


Different types of vectors

VECTOR Size of insert

Plasmid2,000-10,000

Can control the size

Cosmid 40,000

BAC (Bacterial Artificial Chromosome)

70,000-300,000

YAC (Yeast Artificial Chromosome)

> 300,000

Not used much recently


DNA Sequencing – gel electrophoresis

1. Start at primer(restriction site)

2. Grow DNA chain

3. Include dideoxynucleoside (modified a, c, g, t)

4. Stops reaction at all possible points

5. Separate products with length, using gel electrophoresis


Method to sequence longer regions

cut many times at random (Shotgun)

genomic segment

Get one or two reads from each segment

~900 bp ~900 bp


Reconstructing the Sequence (Fragment Assembly)

Cover region with high redundancy

Overlap & extend reads to reconstruct the original genomic region

reads


Definition of Coverage

Length of genomic segment: GNumber of reads: NLength of each read: L

Definition: Coverage C = N L / G

How much coverage is enough?

Lander-Waterman model: Prob[ not covered bp ] = e-C

Assuming uniform distribution of reads, C=10 results in 1 gapped region /1,000,000 nucleotides

C


Repeats

Bacterial genomes: 5%Mammals: 50%

Repeat types:

• Low-Complexity DNA (e.g. ATATATATACATA…)

• Microsatellite repeats (a1…ak)N where k ~ 3-6(e.g. CAGCAGTAGCAGCACCAG)

• Transposons SINE (Short Interspersed Nuclear Elements)

e.g., ALU: ~300-long, 106 copies LINE (Long Interspersed Nuclear Elements)

~4000-long, 200,000 copies LTR retroposons (Long Terminal Repeats (~700 bp) at each end)

cousins of HIV

• Gene Families genes duplicate & then diverge (paralogs)

• Recent duplications ~100,000-long, very similar copies


Sequencing and Fragment Assembly

AGTAGCACAGACTACGACGAGACGATCGTGCGAGCGACGGCGTAGTGTGCTGTACTGTCGTGTGTGTGTACTCTCCT

3x109 nucleotides

50% of human DNA is composed of repeats

Error!Glued together two distant regions


What can we do about repeats?

Two main approaches:• Cluster the reads

• Link the reads




• Link the reads




• Link the reads




3x109 nucleotides

C R D

ARB, CRD

or

ARD, CRB ?

A R B




3x109 nucleotides


Strategies for whole-genome sequencing

1. Hierarchical – Clone-by-clonei. Break genome into many long piecesii. Map each long piece onto the genomeiii. Sequence each piece with shotgun

Example: Yeast, Worm, Human, Rat

2. Online version of (1) – Walkingi. Break genome into many long piecesii. Start sequencing each piece with shotguniii. Construct map as you go

Example: Rice genome

3. Whole genome shotgun

One large shotgun pass on the whole genome

Example: Drosophila, Human (Celera), Neurospora, Mouse, Rat, Dog


Hierarchical Sequencing


Hierarchical Sequencing Strategy

1. Obtain a large collection of BAC clones2. Map them onto the genome (Physical Mapping)3. Select a minimum tiling path4. Sequence each clone in the path with shotgun5. Assemble6. Put everything together

a BAC clone

mapgenome


Hierarchical Sequencing Strategy

1. Obtain a large collection of BAC clones2. Map them onto the genome (Physical Mapping)3. Select a minimum tiling path4. Sequence each clone in the path with shotgun5. Assemble6. Put everything together

a BAC clone

mapgenome


Methods of physical mapping

Goal:

Make a map of the locations of each clone relative to one another

Use the map to select a minimal set of clones to sequence

Methods:

• Hybridization

• Digestion


1. Hybridization

Short words, the probes, attach to complementary words

1. Construct many probes

2. Treat each BAC with all probes

3. Record which ones attach to it

4. Same words attaching to BACS X, Y overlap

p1 pn


2. Digestion

Restriction enzymes cut DNA where specific words appear

1. Cut each clone separately with an enzyme2. Run fragments on a gel and measure length3. Clones Ca, Cb have fragments of length { li, lj, lk }

overlap

Double digestion:Cut with enzyme A, enzyme B, then enzymes A + B


Online Clone-by-cloneThe Walking Method


The Walking Method

1. Build a very redundant library of BACs with sequenced clone-ends (cheap to build)

2. Sequence some “seed” clones

3. “Walk” from seeds using clone-ends to pick library clones that extend left & right


Walking: An Example


Some Terminologyinsert a fragment that was incorporated in a circular genome, and can be copied (cloned)

vector the circular genome (host) that incorporated the fragment

BAC Bacterial Artificial Chromosome, a type of insert–vector combination, typically of length 100-200 kb

read a 500-900 long word that comes out of a sequencing machine

coverage the average number of reads (or inserts) that cover a position in the target DNA piece

shotgun the process of obtaining many reads sequencing from random locations in DNA, to

detect overlaps and assemble


Whole Genome Shotgun Sequencing

cut many times at random

genome

forward-reverse paired reads

plasmids (2 – 10 Kbp)

cosmids (40 Kbp) known dist

~800 bp~800 bp


Fragment Assembly(in whole-genome shotgun sequencing)


Fragment Assembly

Given N reads…Given N reads…Where N ~ 30 Where N ~ 30

million…million…

We need to use a We need to use a linear-time linear-time algorithmalgorithm


Steps to Assemble a Genome

1. Find overlapping reads

4. Derive consensus sequence ..ACGATTACAATAGGTT..

2. Merge some “good” pairs of reads into longer contigs

3. Link contigs to form supercontigs

Some Terminology

read a 500-900 long word that comes out of sequencer

mate pair a pair of reads from two endsof the same insert fragment

contig a contiguous sequence formed by several overlapping readswith no gaps

supercontig an ordered and oriented set(scaffold) of contigs, usually by mate

pairs

consensus sequence derived from thesequene multiple alignment of reads

in a contig


1. Find Overlapping Reads

aaactgcagtacggatctaaactgcag aactgcagt… gtacggatct tacggatctgggcccaaactgcagtacgggcccaaa ggcccaaac… actgcagta ctgcagtacgtacggatctactacacagtacggatc tacggatct… ctactacac tactacaca

(read, pos., word, orient.)

aaactgcagaactgcagtactgcagta… gtacggatctacggatctgggcccaaaggcccaaacgcccaaact…actgcagtactgcagtacgtacggatctacggatctacggatcta…ctactacactactacaca

(word, read, orient., pos.)

aaactgcagaactgcagtacggatcta actgcagta actgcagtacccaaactgcggatctacctactacacctgcagtacctgcagtacgcccaaactggcccaaacgggcccaaagtacggatcgtacggatctacggatcttacggatcttactacaca



• Find pairs of reads sharing a k-mer, k ~ 24• Extend to full alignment – throw away if not >98% similar

TAGATTACACAGATTAC

TAGATTACACAGATTAC|||||||||||||||||

T GA

TAGA| ||

TACA

TAGT||

• Caveat: repeats A k-mer that occurs N times, causes O(N2) read/read comparisons ALU k-mers could cause up to 1,000,0002 comparisons

• Solution: Discard all k-mers that occur “too often”

• Set cutoff to balance sensitivity/speed tradeoff, according to genome at hand and computing resources available



Create local multiple alignments from the overlapping reads

TAGATTACACAGATTACTGATAGATTACACAGATTACTGATAG TTACACAGATTATTGATAGATTACACAGATTACTGATAGATTACACAGATTACTGATAGATTACACAGATTACTGATAG TTACACAGATTATTGATAGATTACACAGATTACTGA



• Correct errors using multiple alignment

TAGATTACACAGATTACTGATAGATTACACAGATTACTGATAGATTACACAGATTATTGATAGATTACACAGATTACTGATAG-TTACACAGATTACTGA

TAGATTACACAGATTACTGATAGATTACACAGATTACTGATAG-TTACACAGATTATTGATAGATTACACAGATTACTGATAG-TTACACAGATTATTGA

insert A

replace T with Ccorrelated errors—probably caused by repeats disentangle overlaps

TAGATTACACAGATTACTGATAGATTACACAGATTACTGA

TAG-TTACACAGATTATTGA

TAGATTACACAGATTACTGA

TAG-TTACACAGATTATTGA

In practice, error correction removes up to 98% of the errors


2. Merge Reads into Contigs

• Overlap graph: Nodes: reads r1…..rn

Edges: overlaps (ri, rj, shift, orientation, score)

Note:of course, we don’tknow the “color” ofthese nodes

Reads that comefrom two regions ofthe genome (blueand red) that containthe same repeat

Documents

CS273a Lecture 4, Autumn 08, Batzoglou DNA Sequencing