Control of Prokaryotic (Bacterial) Genes

Gene Control Many biotech techniques make use of

existing mechanisms for controlling gene expression Gene expression = “gene activity,” the

process by which information from a gene is used to synthesize a protein

All genes are not being expressed at all times

Discussion Consider bacterial genes for metabolic

enzymes… Under what circumstances would the

prokaryote want those genes turned OFF? Why?

Under what circumstances would the prokaryote want those genes turned ON? Why?

Remember Regulating Metabolism? Feedback inhibition

product acts as an allosteric inhibitor of 1st enzyme in tryptophan pathway

but this is wasteful production of enzymes

= inhibition-

-Oh, I

remember thisfrom our

Metabolism Unit!

Different way to Regulate Metabolism Gene regulation

instead of blocking enzyme function, block transcription of genes for all enzymes in tryptophan pathway saves energy by

not wasting it on unnecessary protein synthesis

= inhibition-

--

Gene regulation in bacteria Cells vary amount of specific enzymes

by regulating gene transcription turn genes on or turn genes off

turn genes OFF exampleif bacterium has enough tryptophan then it doesn’t need to make enzymes used to build tryptophan

turn genes ON example if bacterium encounters new sugar (energy source), like lactose, then it needs to start making enzymes used to digest lactose

STOP

GO

Gene Regulation Regulatory sequence: a sequence of DNA that interacts

with regulatory proteins to control transcription of other genes

Regulatory gene: DNA encoding a regulatory protein or RNA

Bacteria group genes together Operon

genes grouped together with related functions, controlled by a single regulatory sequence example: all enzymes in a metabolic pathway

promoter = RNA polymerase binding site single promoter controls transcription of all genes in operon transcribed as one unit & a single mRNA is made

operator = DNA binding site of repressor protein structural genes = genes to be expressed

So how can these genes be turned off? Repressor protein

binds to DNA at operator site blocking RNA polymerase blocks transcription

Effector molecule Binds to repressor, changes its affinity for DNA binding site

operatorpromoter

Operon model

DNATATA

RNApolymerase

repressor

repressor = repressor protein

Operon: operator, promoter & genes they control

serve as a model for gene regulation

gene1 gene2 gene3 gene4RNA

polymerase

Repressor protein turns off gene by blocking RNA polymerase binding site.

1 2 3 4mRNA

enzyme1 enzyme2 enzyme3 enzyme4

mRNA

enzyme1 enzyme2 enzyme3 enzyme4

operatorpromoter

Trp operon

DNATATA

RNApolymerase

tryptophan

repressor repressor protein

repressortryptophan – repressor proteincomplex

Synthesis pathway modelWhen excess tryptophan is present, it binds to trp repressor protein & triggers repressor to bind to DNA

repressor without trp effector, inactive. With trp, active.

blocks (represses) transcription

gene1 gene2 gene3 gene4

conformational change in repressor protein!

1 2 3 4

repressortrpRNA

polymerase

trp

trp

trp trp

trp trp

trptrp

trp

trp

trp

Tryptophan operonWhat happens when tryptophan is present?Don’t need to make tryptophan-building enzymes

Tryptophan is allosteric regulator of repressor protein

http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120080/bio26.swf::The%20Tryptophan%20Repressor

mRNA

enzyme1 enzyme2 enzyme3 enzyme4

operatorpromoter

Lac operon

DNATATARNA

polymerase

repressor repressor protein

repressorlactose – repressor proteincomplex

lactose

lac repressor gene1 gene2 gene3 gene4

Digestive pathway model When lactose is present, binds to lac repressor protein & triggers repressor to release DNA

repressor without lac effector, active. With lac, inactive.

induces transcription

RNApolymerase

1 2 3 4

lac lac

laclac

lac

lac

lac

conformational change in repressor protein!

lac

lac

http://highered.mcgraw-hill.com/sites/dl/free/0072835125/126997/animation27.html

Lactose operon(notice, the lacI gene for the repressor protein precedes the promoter, handy!)

But wait!What if there’s lactose AND glucose present?Glucose is a much better energy source… do

we still want to bother breaking down lactose?

Lactose operonLac promoter has TWO binding sites

One for RNA polymeraseLac repressor protein can bind to operator and inhibit that

One for CAP, catabolite activating protein, before the promoter. RNA polymerase doesn’t bind well to this gene without CAP there.

Lactose operon As glucose concentration increases in a cell, the

concentration of cAMP, or cyclic AMP, decreases (+glucose=-cAMP)

When cAMP binds to CAP, it has the correct conformation to bind to DNA So, when glucose is low, the cAMP-CAP complex is

bound to DNA, and RNA polymerase can attach When glucose is high, cAMP doesn’t bind to CAP,

CAP doesn’t bind to DNA, and neither does RNA polymerase

Lactose operon

In order for the structural genes to be transcribed, the cAMP-CAP complex must be bound to the CAP binding site, AND the repressor protein must not be bound to the operator

http://www.youtube.com/watch?v=2sMFswbOgKk

Operon Regulation Operons can be regulated by positive or negative

means… Positive control: Regulatory proteins bind to DNA and

stimulate expression. Negative control: Regulatory proteins bind to DNA to

inhibit expression.

…and can be inducible or repressible. Inducible: “Off by default.” The effector (inducer) interacts

with regulatory proteins or DNA and turns expression on. Repressible: “On by default.” The effector (repressor)

interacts with regulatory proteins or DNA turns expression off.

Discussion The lac operon is termed negative

inducible. Why?

The trp operon is termed negative repressible. Why?

Discussion Example: In a positive repressible operon,

activator proteins are normally bound to the DNA and actually provide a binding site for RNA Polymerase. It’s therefore positive: the controlling protein stimulates expression.

An inhibitor can bind to the activator protein, change its conformation, and prevent it from binding to RNA polymerase. It’s therefore repressible: it’s normally on, and the molecule turned gene expression off.

That’s positive repressible. How might a positive inducible operon work?

Operon function Repressible operon

usually functions in anabolic pathways synthesizing end products

when end product is present in excess,cell allocates resources to other uses

Inducible operon usually functions in catabolic pathways,

digesting nutrients to simpler molecules

produce enzymes only when nutrient is available cell avoids making proteins that have nothing to do, cell allocates

resources to other uses

And some genes are continuously expressed (always turned on).

e.g. the genes that code for ribosomal complexes

Discussion Before we leave operons behind (for the

moment), look at their big picture. Knowing what attaches where is not the most important part, it’s only a prerequisite to this: WHY does the trp operon function as it does?

How is it advantageous? What is its adaptive significance?

WHY does the lac operon function as it does? How is it advantageous? What is its adaptive significance?

Control of Eukaryotic Genes

Eukaryotic Control The control of gene expression in

eukaryotes is complex! Involves regulatory genes, regulatory

proteins, transcription factors, and more!

Can occur at any step in the pathway from gene to functional protein:

1. packing/unpacking DNA

2. transcription

3. mRNA processing

4. mRNA transport

5. translation

6. protein processing

7. protein degradation

How do you fit all that DNA into nucleus?

DNA coiling & folding double helix nucleosomes chromatin fiber looped domains chromosome

from DNA double helix to condensed chromosome

1. DNA packing

Nucleosomes “Beads on a string”

1st level of DNA packing histone proteins

8 protein molecules positively charged amino acids bind tightly to negatively charged DNA

DNA packing movie

8 histone molecules

DNA packing as gene control Degree of packing of DNA regulates transcription

tightly wrapped around histones no transcription genes turned off

heterochromatindarker DNA (H) = tightly packed

euchromatinlighter DNA (E) = loosely packed

H E

Histone acetylation Acetylation of histones unwinds DNA

loosely wrapped around histones enables transcription genes turned on

attachment of acetyl groups (–COCH3) to histones conformational change in histone proteins transcription factors have easier access to genes

2. Transcription initiation transcription factors = proteins that bind to

DNA to regulate transcription Some are activators, increase expression Others are repressors, decrease expression

Actual rate of expression Depends on combination

of transcription factors

2. Transcription initiation Example control regions on DNA

Promoter sequence nearby control sequence on DNA binding of RNA polymerase & transcription

factors “base” rate of transcription

Enhancer sequence distant control

sequences on DNA binding of activator

proteins “enhanced” rate (high level)

of transcription

Transcription complex

Enhancer

ActivatorActivator

Activator

Coactivator

RNA polymerase II

A

B F E

HTFIID

Core promoterand initiation complex

Activator Proteins• regulatory proteins bind to DNA at

distant enhancer sites• increase the rate of transcription

Coding region

T A T A

Enhancer Sitesregulatory sites on DNA distant from gene

Initiation Complex at Promoter Site binding site of RNA polymerase

Discussion That’s how an activator binds to a

promoter or enhancer to increase expression… How could it work that I could attach a

repressor or “silencer” protein to those same sequences to decrease expression?

http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120080/bio28.swf::Transcription%20Complex%20and%20Enhancers

3. Post-transcriptional control Alternative RNA splicing

variable processing of exons creates a family of proteins

RNA interference Small interfering RNAs (siRNA)

short segments of RNA (21-28 bases) bind to mRNA create sections of double-stranded mRNA “death” tag for mRNA

triggers degradation of mRNA

cause gene “silencing” post-transcriptional control turns off gene = no protein produced

NEW!

siRNA

Action of siRNA

siRNA

double-stranded miRNA + siRNA

mRNA degradedfunctionally turns gene off

Hot…Hotnew topicin biology

mRNA for translation

breakdownenzyme(RISC)

dicerenzyme

5. Control of translation Block initiation of translation stage

regulatory proteins attach to 5' end of mRNA prevent attachment of ribosomal subunits &

initiator tRNA block translation of mRNA to protein

6-7. Protein processing & degradation Protein processing

folding, cleaving, adding sugar groups, targeting for transport

Protein degradation

initiation of transcription

1

mRNA splicing

2

mRNA protection3

initiation of translation

6

mRNAprocessing

5

Of turning genotypic diversity into even greater phenotypic diversity!

7 protein processing & degradation

4

4

Many methods

Discussion Work together with someone else, get a

blank piece of paper, and: Summarize the most important take-

home message or messages about control of gene expression... using only pictures and no text. (They don’t have to be pictures of DNA/RNA/etc itself!)

AP Biology 2007-2008

Biotechnology

AP Biology

A Brave New World

AP Biology

TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT

human genome3.2 billion bases

AP Biology

Biotechnology today Genetic Engineering

manipulation of DNA if you are going to engineer DNA &

genes & organisms, then you need a set of tools to work with

this unit is a survey of those tools…

Our tool kit…

AP Biology

Bacteria Bacteria review

one-celled prokaryotes reproduce by mitosis

binary fission rapid growth

generation every ~20 minutes 108 (100 million) colony overnight!

dominant form of life on Earth incredibly diverse

AP Biology

Bacterial genome Single circular chromosome

haploid naked DNA

no histone proteins ~4 million base pairs

~4300 genes 1/1000 DNA in eukaryote

How have theselittle guys gotten to

be so diverse??

AP Biology

Genetic Diversity Living things, eukaryotes and prokaryotes,

have a variety of ways of mixing up genetic information “horizontally” Transduction: Viral transmission of genetic

material Transposition: Movement of DNA segments

within and between DNA molecules And prokaryotes have unique methods

Conjugation: Cell-to-cell transfer of genetic material And…

AP Biology

Transformation Bacteria are opportunists

pick up naked foreign DNA wherever it may be hanging out have surface transport proteins that are

specialized for the uptake of naked DNA import bits of chromosomes from

other bacteria incorporate the DNA bits into their

own chromosome express new genes transformation form of recombination

mix heat-killed pathogenic & non-pathogenicbacteria

mice die

AP Biology

Plasmids Small supplemental circles of DNA

5000 - 20,000 base pairs self-replicating

carry extra genes 2-30 genes genes for antibiotic resistance

can be exchanged between bacteria Conjugation: “bacterial sex” rapid evolution

can be imported from environment transformation

AP Biology

How can plasmids help us? A way to get genes into bacteria easily

insert new gene into plasmid = vector insert plasmid into bacteria bacteria now expresses new gene

bacteria make new protein

+

transformedbacteriagene from

other organism

plasmid

cut DNA

recombinantplasmid

vector

glue DNA

AP Biology

Biotechnology Plasmids used to insert new genes into bacteria

gene we want

cut DNA

cut plasmid DNA

insert “gene we want” into plasmid...

“glue” together

ligase

like what?…insulin…HGH…lactase

recombinant plasmid

AP Biology

How do we cut DNA? Restriction enzymes

restriction endonucleases

evolved in bacteria to cut up foreign DNA “restrict” the action of the attacking organism protection against viruses

& other bacteriabacteria protect their own DNA by methylation &

by not using the base sequences recognized by the enzymes in their own DNA

AP Biology

How do restriction enzymes work? Take a normal piece of paper. Tear/cut it into 3 long segments (tear from top to

bottom) On each segment, write a random stream of DNA

bases and their complementary base pairs.

When you’re done, help me lay them all out end to end and tape them together so we have a nice long chromosome to demonstrate this with!

AP Biology

What do you notice about these phrases?

radarracecarMadam I’m AdamAble was I ere I saw Elbaa man, a plan, a canal, PanamaWas it a bar or a bat I saw?go hang a salami I’m a lasagna hog

palindromes

AP Biology

Restriction enzymes Action of enzyme

cut DNA at specific sequences restriction site

symmetrical “palindrome” produces protruding ends

sticky ends will bind to any complementary DNA

Many different enzymes named after organism they are found in

EcoRI (GAATTC, E. coli), HindIII (AAGCTT, Hemophilus influenzae), BamHI (GGATCC, Bacillus amyloli)…

Madam I’m Adam

CTGAATTCCGGACTTAAGGC

CTG|AATTCCGGACTTAA|GGC

AP Biology

Restriction enzymes Cut DNA at specific sites

leave “sticky ends”

GTAACG AATTCACGCTTCATTGCTTAA GTGCGAA

GTAACGAATTCACGCTTCATTGCTTAAGTGCGAA

restriction enzyme cut site

restriction enzyme cut site

AP Biology

Sticky ends Cut other DNA with same enzymes

leave “sticky ends” on both can glue DNA together at “sticky ends”

GTAACG AATTCACGCTTCATTGCTTAA GTGCGAA

gene you want

GGACCTG AATTCCGGATACCTGGACTTAA GGCCTAT

chromosome want to add

gene to

GGACCTG AATTCACGCTTCCTGGACTTAA GTGCGAA

combinedDNA

AP Biology

Sticky ends help glue genes together

TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTTAACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA

gene you want cut sitescut sites

AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTTTTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA

chromosome want to add gene tocut sites

AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene

sticky ends

chromosome with new gene addedTAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC

CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC

sticky ends stick together

DNA ligase joins the strands Recombinant DNA molecule

http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120078/bio37.swf::Restriction%20Endonucleases

AP Biology

Demo Suppose we add this sequence:

…o a solution containing these enzymes (whose restriction sites are): EcoRI (5’ G|AATTC 3’) HindIII (5’ A|AGCTT 3’) BamHI (5’ G|GATCC 3’)

How many pieces of DNA would I have?

5’ ATCGGTTAAGCTTGGGCAACGGATCCGAGATCATCGT 3’

AP Biology

Why mix genes together?

TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC

CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC

Gene produces same protein in different organism or different individual

aa aaaa aa aa aa aa aa aa aa

“new” protein from organism ex: human insulin from bacteria

human insulin gene in bacteria

bacteria human insulin

How can bacteria read human DNA?

AP Biology

The code is universal Since all living

organisms… use the same DNA use the same code

book read their genes

the same way

AP Biology

Copy (& Read) DNA Transformation

insert recombinant plasmid into bacteria

grow recombinant bacteria in agar cultures bacteria make lots of copies of plasmid “cloning” the plasmid

production of many copies of inserted gene!

production of “new” protein transformed phenotype

DNA RNA protein trait

AP Biology

Grow bacteria…make more

growbacteria

harvest (purify)protein

transformedbacteria

plasmid

gene fromother organism

+

recombinantplasmid

vector

http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter14/animation_quiz_2.html

AP Biology

Discussion But suppose I want to move a gene

from a bacterium into a multicellular eukaryote… I can inject a plasmid directly, but that’s

tedious and not highly effective Think back to the last unit… how could

VIRUSES be used to accomplish this purpose?

AP Biology

Uses of genetic engineering Genetically modified organisms (GMO)

enabling plants to produce new proteins Protect crops from insects: BT corn

corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)

Extend growing season: fishberries strawberries with an anti-freezing gene from

flounder

Improve quality of food: golden rice rice producing vitamin A

improves nutritional value

AP Biology

Green with envy??Jelly fish “GFP”

Transformed vertebrates

AP Biology

Cut, Paste, Copy, Find… Word processing metaphor…

cut restriction enzymes

paste ligase

copy plasmids

bacterial transformation is there an easier way??

find ????