J O U R N A L O F P R O T E O M I C S 7 5 ( 2 0 1 1 ) 6 6 8 – 6 7 6

Ava i l ab l e on l i ne a t www.sc i enced i r ec t . com

www.e l sev i e r . com/ loca te / j p ro t

Comparative proteomics of spinal cords of rat fetuses withspina bifida aperta

Yang Fana, Lili Wanga, Fenghua Zhoub, Yi Zhanga, Hui Lia, Liping Shanc, Zhengwei Yuana,⁎aKey Laboratory of Health Ministry for Congenital Malformation, Shengjing Hospital, China Medical University, Shenyang, 110004, P.R. ChinabDepartment of Physical Medicine and Rehabilitation, Shengjing Hospital, China Medical University, Shenyang, 110004, P.R. ChinacDepartment of Urologic Surgery, Shengjing Hospital, China Medical University, Shenyang, 110004, China

A R T I C L E I N F O

⁎ Corresponding author at: Key Laboratory ofNo. 36, Sanhao Street, Heping District, Sheny

E-mail address: yuanzw@hotmail.com (Z.

1874-3919/$ – see front matter © 2011 Elseviedoi:10.1016/j.jprot.2011.09.006

A B S T R A C T

Article history:Received 13 April 2011Accepted 8 September 2011Available online 17 September 2011

Neural tube defects (NTDs) are complex congenital anomalies of the central nervous system,with a prevalence of 5 per 10,000 worldwide. However, current therapeutics for NTDs areunsatisfactory. The neurological complications remain the main problem for therapy.Neurological dysfunction could result from the primary defect or injuries to the uncoveredneural tissue in the uterus. However, the pathological changes in the uncovered neuraltissue have not been described. Here, we present our comparative proteomics study of thespinal cord from rat fetuses with all-trans retinoic-acid-induced spina bifida aperta. Proteinsfrom spinal cords were subjected to 2-D gel electrophoresis, then protein identification bymass spectrometry. We identified 13 proteins with differential expression between normalspinal cords and those with spina bifida aperta. These identified proteins were reported tobe involved in signal transduction, cell adhesion andmigration, protein folding and apoptosis.We confirmed 4 identified proteins by immunoblot analysis and assessed their mRNA levelsby quantitative real-time PCR. This is the first comparative proteomics of spinal cords fromrat fetuses with spina bifida aperta. We demonstrate protein alterations that reflect the patho-logical situation of theuncoveredneural tissue,whichmayhelp improve the treatment ofNTDs.

© 2011 Elsevier B.V. All rights reserved.

Keywords:2-D electrophoresisAll-trans retinoid acidSpina bifida apertaNeural tube defects

1. Introduction

Neural tube defects (NTDs) are complex congenital anomalies ofthe central nervous system. Recent birth prevalence estimatesare 5 per 10,000 in the United States in 2001–2004 [1] and 10 to15 per 10,000 in Western Australia in 2001–2006 [2]. In China,the prevalence is much higher: in northern China, it was 6 per1000 births in 1992–1993 [3] and 20per 1000 in 2002–2004 [4]. Stan-dard early postnatal closure defects are followed by life-longmedical care, which impede social and psychological develop-ment in patients. Even after fetal surgery to repair the defect,patients show neurological deficits of varying degrees, such as

Health Ministry for Congeang, 110004, China. Tel./fYuan).

r B.V. All rights reserved

sensory and motor weakness in the leg, and bowel and bladderincontinence [5,6].

The neurological dysfunction leading to anNTD could resultdirectly from the primary defect in the neurulation process orsecondarily from injuries to the intrauterine environment,such as exposure of the uncovered neural tissue at the site ofthe spinal defect to amniotic fluid, which is believed to betoxic [7,8]. However, the pathological changes in the site of theuncovered neural tissue from the primary and secondary inju-ries have not been described.

Proteomics is a powerful tool to investigate themechanismofa biological process because it can identify a large number of

nital Malformation, Shengjing Hospital, China Medical University.ax: +86 024 23929903.

.

Fig. 1 – Schematic diagram for the animal modelestablishment. 12 pregnant rats were divided into 2 groups(n=6 each). Treated pregnant rats were killed at E17, andfetuses were harvested. All-trans retinoic-acid-treatedpregnancies resulted in 2 phenotypes: with (subgroup 1) andwithout (subgroup 2) spina bifida aperta. E indicates

669J O U R N A L O F P R O T E O M I C S 7 5 ( 2 0 1 1 ) 6 6 8 – 6 7 6

proteins simultaneously, and protein alterations correspondingto certain pathological conditions at a certain time can be consid-ered in an integrated way. Greene et al. [9] performed a proteo-mics study of normal mouse embryos at the stage of neuraltube closure. The authors usedwhole-mouse embryos to investi-gate differential protein expression from embryonic day (E) 8.5 toE10.5 and revealed a number of stage-specific proteins related toneural tube closure. However, we lack a protein profile of the spi-nal cord with spina bifida aperta at the late gestation stage. Theprotein alterations in the uncovered spinal cord exposed to theintrauterine environment are unknown, although such informa-tion may provide clues to new therapies for spina bifida.

Retinoid acid (RA) is the metabolic product of vitamin A(retinol) and is required for normal embryonic development[10]. However, excess RA in pregnant mammals causes a vari-ety of NTDs in progeny [11]. All-trans retinoic acid (ATRA) is awell-known teratogenic factor affecting neurological develop-ment. Maternal administration of ATRA has long been used toinduce an experimental model to study NTDs in fetal rats [12].

In this study, we used 2-D electrophoresis (2-DE) gel-basedproteomics to compare the protein profiles of spinal cordsfrom normal rat fetuses and those with ATRA-induced spinabifida aperta. We focused on the defective region of the spinalcord to provide information on proteins with differential ex-pression in the uncovered spinal cord at late gestation.

embryonic day, and the number in the brackets indicates thenumber of animals used. IB, immunoblot; The number at thebottom indicates the number of spinal cords used.

2. Material and methods

2.1. Animals and preparation of spinal cord

Outbred Wister rats 10–12 weeks old (250–300 g) were pur-chased from the animal center of China Medical University.The animals were maintained in a temperature — (20–24 °C)and humidity — (50–70%) controlled environment with a 12-h light/dark cycle. Solid laboratory chow andwater were avail-able ad libitum. The appearance of vaginal plugs in the femalerat the morning after mating was considered E0. We divided12 pregnant rats into 2 groups for treatment (n=6 each):spina bifida aperta — a single intragastric administration ofATRA (Sigma; 4% [wt/vol] in olive oil; 140 mg/kg body weight)by a single gavage feeding at E10 as previously described[13]; control — the same amount of olive oil (Fig. 1). Pregnantrats were killed with an overdose of pentobarbitone sodiumat E17, and fetuses were harvested. Fetuses from the treat-ment group were divided into subgroups 1 and 2 of fetuseswith and without spina bifida aperta. We obtained 40 spinalcords each from the 2 subgroups and 40 from the normal con-trol group. Among the 40 spinal cords, 20 from each groupwere used for 2-DE analysis, and the other 20 for immunoblotand real-timequantitative PCR analyses (Fig. 1). The lumbosacralspinal cords were removed under stereomicroscopy and storedat −80 °C. All animal experimentswere performedwith approvalfrom the appropriate local ethics committee.

2.2. Extraction of proteins from spinal cord

For 2-DE, spinal cords were homogenized in 10 volumes lysisbuffer (7 M urea,2 M thiourea, 4% [V/W] CHAPS, 2% [V/V] IPGbuffer [pH 4–7], 40 mM 1,4-dithioerythritol, 1 mM PMSF and 1%

[V/V] cocktail protease inhibitor, Sigma), and sonicated on icefor 1 min with 0.2-s pulse on and 1-s pulse off to prevent over-heating. To remove salt, samples were cleaned with use of a2-D Cleanup kit (GE Healthcare). For immunoblot analysis, weused a different set of spinal cord samples. Each spinal cordwas homogenized with 5 volumes of lysis buffer containing50 mM Tris (pH 7.4),150 mM NaCl,1% Triton X-100,1% sodiumdeoxycholate,0.1% SDS and 1% (V/V) cocktail protease inhibitor(Sigma) and sonicated as described. Then the solution was cen-trifuged at 20,000×g for 15min at 4 °C. The supernatant wasused as protein extract for immunoblot analysis. The proteinconcentration was determined by the Bradford method, andthen stored in aliquots at −80 °C.

2.3. 2-DE

2-DE was performed as described [14] and modified by Gorg etal. [15]. We loaded 800 μg protein extract onto an IPG strip(24 cm, pH 4–7; GE Healthcare, Uppsala, Sweden). For thefirst-dimension isoelectric focusing, the IPG strip was rehy-drated with 450 μl of solubilized sample at 30 V for 12 h onan IPGphor (GE Healthcare). IEF followed a multi-step proto-col: 300 V for 3 h, 600 V for 2.5 h, 1000 V for 3 h, gradient from1000 V up to 8000 V in 2 h and finally 8000 V was held for65,600 Vh at 20 °C. The IPG strips were equilibrated in 10mlequilibration solutions (6 M urea, 30% glycerol, 2% sodium dode-cyl sulfate [SDS], 115mM Tris–Cl [pH 8.8], 20 mM dithiothreitol[DTT]) for 15min, then equilibrated in the same solution contain-ing 100mM iodoacetamide instead of DTT. SDS–PAGE involveduse of 12.5%polyacrylamide gels in the EttanDALT twelve system

Fig. 2 – Sample preparation for 2-D electrophoresis. 20 spinal cords for each experimental group (subgroup 1, subgroup 2 of thetreatment group and the normal control group) were collected. At least 6 individual spinal cords from the same experimentalgroup were pooled. One protein mixture was run in triplicate in one set of gel runs. A total of 3 sets of gels were run by usingdifferent protein pools.

670 J O U R N A L O F P R O T E O M I C S 7 5 ( 2 0 1 1 ) 6 6 8 – 6 7 6

(GE Healthcare). Following SDS-PAGE, gels were stained withmodified colloidal Coomassie Brilliant Blue (mcCBB) G-250 as de-scribed [16]. For 2-DE, we pooled the proteins for 6 or 7 spinalcords from each experimental group (Fig. 2). For comparing 3 ex-perimental groups, we ran a set of 9 gels, with one pooled samplerun in triplicate per group. For good reproducibility, 3 sets of gelwere run by using 3 different pooled samples per group.

2.4. Image acquisition and data analysis

CBB-stained gels were scanned by use of a PowerLook 2100XLimage scanner (Umax, Taiwan). Spot detection, quantifica-tion, and matching involved use of 2-D gel analysis software(ImageMaster 2-D platinum 6.0, GE Healthcare) with the CBB-stained gels. The relative volume of spots [% vol. calculatedas the spot volume (the sum of the intensities of the pixelunits within the protein spot) normalized as a percentage ofthe total volume of all the spots present in a gel] was obtainedfrom 3 parallel experiments. Spots with at least 1.5-fold differ-ence in % vol showing statistical significance (P<0.05) weredefined as differentially expressed proteins and were excisedfor further analysis.

2.5. In-gel digestion and MALDI-TOF MS

Selected spots were chosenmanually. CBB-stained spots weredestained in 50% acetonitrile (ACN) in 25 mM ammonium bi-carbonate buffer and dried in the SpeedVac. The dried gelfragments were re-hydrated in trypsin solution (15 μg/ml) for1 h at 4 °C, followed by the addition of 5 ml 25 mM ammoniumbicarbonate buffer to completely immerse the gel fragments.After incubation for 16 h at 37 °C, the digested peptides were

extracted from the gel fragments with use of 5% trifluoroaceticacid (TFA) and 2.5% TFA/50% ACN at 37 °C for 1 h separately.Tryptic peptides were finally dissolved in MALDI matrix (5 mg/ml α-cyana-4-hydroxycinnamic acid in 0.1% TFA and 50%ACN), spotted onto 192-well stainless steel MALDI target plates,andanalyzed byuse of anABI 4800 ProteomicsAnalyzerMALDI-TOF/TOFmass spectrometer (AppliedBiosystems,USA). TheMSandMS/MS spectrawere searched against the International Pro-tein Index (IPI) rat database, version 3.18, with use of GPSExplorerTM v3.0 andMASCOT database search algorithms (ver-sion 2.0) with the search criteria trypsin specificity,cysteine carbamidomethylation (C) and methionine oxidation(M) as variable modifications; 1 trypsin miscleavage allowed;0.2-Da MS tolerance; and 0.3-Da MS/MS tolerance. Proteinidentifications were accepted with a Mowse score≥58 and ap<0.05.

2.6. Immunoblot analysis

In total, 50 μg protein extract was separated by 12.5% SDS-PAGEand then transferred with Tris–HCl methanol (20 mM Tris,150mM glycine, 20% methanol) onto polyvinylidene difluoridemembranes (Millipore, USA) in a trans-blot electrophoresistransfer cell (Bio-Rad). Blotting was probed with antibodiesagainst Collapsin responsemediator protein 4 (Crmp-4, Chemi-con AB5454), protein disulfide-isomerase A3 (Pdia3, StressgenSPA-585), heat shock cognate 71-kDa protein (HSC70, StressgenSPA-819), dolichyl-diphosphooligosaccharide-protein glycosyl-transferase 48-kDa subunit (DDOST 48, Santa Cruz Biotechnologysc-74407) or actin (SantaCruzBiotechnology sc-1616) asdescribed[17]. All immunoblots were run at least in triplicate. Visualizationof the antigen–antibody complexes involved use of enhanced

Table 1 – Primers for real-time PCR.

Target Forward (5′–3′) Reverse (5′–3′)

Crmp4 ACGGTGATGGCACGGAACA CCCAGGAGCAGGCACGAATDdost GGTTTATCTGGGAAGAAGGA ACCATTGTTGGCAAGTCATPdia3 ACATCATTGGCTGTGGCATC ACTGTAAGAACCTGGAACCCHsc70 TGTGGTCTCGTCATCAGCACAG ACACAGGAGTAGGTGGTGCCAAG

671J O U R N A L O F P R O T E O M I C S 7 5 ( 2 0 1 1 ) 6 6 8 – 6 7 6

chemiluminescence reagents (GE healthcare). Detected bandswere quantified by Gel-pro4.0 software(Media Cybernetics, LP).The relative density of each protein was calculated by dividingthe optical density value of eachprotein by that of loading control(actin).

2.7. Real-time quantitative PCR

Total RNA was extracted from spinal cords by use of TRIzol re-agent (Invitrogen) according to the manufacturer's protocol.cDNA syntheses involved use of 3 μg RNA with the TaKaRaRNA PCR kit (Takara). Real-time PCR amplifications were per-formed in triplicate on a Light Cycler (Roche Applied Science)

Fig. 3 – 2-DE of protein profile for spinal cords of normal rat fetusCoomassie-stained 2-DE gels of expression maps of proteins in scontrol), (B) thosewith spina bifida aperta by ATRA treatment (subby ATRA treatment (subgroup 2). Numbers indicate the differentlindicated.

with the primers in Table 1. The housekeeping gene β-actin(Takara DR3783) was used as an endogenous control. The rela-tive mRNA levels for each sample were calculated by the 2−△△ct

method.

2.8. Statistical analysis

Data for are expressed as means±SD (vol.% of spots for 2-DEanalysis, relative density of bands on immunoblot analysis,and 2−△△ct value of each sample for real-time quantitativePCR as parametric data). Statistical significance was deter-mined by using Student's t test, and a P<0.05 was consideredstatistically significant.

es and those with spina bifida aperta. Representativepinal cord from (A) rat fetus without ATRA treatment (normalgroup 1), and (C) thosewithout spina bifida aperta phenotypey expressed protein spots in Table 2. Accession numbers are

Table 2 – Proteins with differential expression in spinal cords from normal rats and those with spina bifida aperta identifiedby MALDI-TOF MS.

Spot no. Protein name Accessionno.

Mr(kDa) /pI

Mascotscore

Matchedpeptides

Cover% Expressionalfold change

P value

1 Serum albumin precursor P02770 68/6.0 418 14 21.9 ↑3.60 0.00371 Serum albumin precursor P02770 68/6.0 989 19 30.4 ↑4.20 0.00251 Serum albumin precursor P02770 68/6.0 926 28 58.1 ↑3.40 0.00571 Serum albumin precursor P02770 68/6.0 295 9 23.9 ↑3.30 0.00822 Heterogeneous nuclear

ribonucleoproteinH/F (hnRNPH/F)

Q8VHV7 /Q794E4 49/5.8 45/5.3 103/121 7/7 23.0 /21.6 ↑2.30 0.0070

3 60s acidic ribosomal protein p0 P19945 34/5.9 293 6 26.8 ↑2.80 0.00944 Isoform1 of Collapsin response

mediator protein 4 (Crmp-4)Q62952 61/6.0 447 21 69.8 ↑2.10 0.0097

5 Protein disulfide-isomerase A3( Pdia3 ) precursor

P11598 57/5.8 490 19 54.9 ↑4.70 1.43×10−5

6 Protein disulfide-isomerase A6( Pdia6) Q63081 48/5.1 559 8 25.2 ↓2.44 0.00857 Dolichyl-diphosphooligosaccharide —

protein glycosyltransferase 48 kDasubunit (DDOST 48)

Q641Y0 47/5.4 348 6 18.1 ↓2.33 0.0263

8 Heat shock cognate 71 kDa protein(Hsc70)

P63018 71/5.3 189 18 37.5 ↓2.13 0.0125

9 14-3-3 protein beta/alpha P35213 28/4.8 404 9 42.3 ↓2.27 0.001410 14-3-3 protein zeta/delta P63102 27/4.7 692 13 73.8 ↓3.33 0.000411 14-3-3 protein theta P68255 27/4.6 551 10 59.6 ↓4.76 4.71×10−5

12 14-3-3 protein epsilon P62260 29/4.6 657 10 50.0 ↓2.22 0.002213 Calponin-3 P37397 36/5.0 86 7 38.8 ↓1.72 0.0170

Spot no. was defined according to spot positions in the 2-DE gel as indicated in Fig. 2.Expressional fold change: the relatively quantitative alterations of proteins were determined based on the spot relative volume (vol.%)of protein.↑means the protein level in fetus with spina bifida aperta increased compare with normal fetus; ↓means the protein level in fetus with spinabifida aperta decreased compare with normal fetus.

672 J O U R N A L O F P R O T E O M I C S 7 5 ( 2 0 1 1 ) 6 6 8 – 6 7 6

3. Results

3.1. Protein profiles of rat spinal cords from normal fetusesand those with spina bifida aperta

The spinal cord proteome of the E17 rat fetus containedabout 900 detectable proteins on a single mcCBB-stained 2-DE gel (Fig. 3, see Supplemental figure for detailed informa-tion). More than 80% of protein spots were matched on 3sets of CBB-stained gels. Overall, the 2-DE protein spot pat-terns across all the gels were similar for normal rat fetusesand those with and without ATRA-induced spina bifidaaperta. We found 20 protein spots with at least 1.5-fold differ-ence in vol.% (P<0.05) between cords from normal fetuses andthose with spina bifida aperta and dissected them for furtheranalysis. Cords from normal fetuses and those without spinabifida aperta did not differ in expression of these 20 proteins.

Of 20 dissected spots, 13 were identified by MS as differen-tially expressed. Among them, five spots were upregulated,and eight spots were downregulated. (Tables 2, 3, see Supple-mental table for detailed information).

3.2. Immunoblot analysis of selected proteins

We selected 4 proteins for immunoblot analysis. Crmp-4 andPdia3 were upregulated in fetuses with spina bifida aperta,

by 1.6- and 2.0-fold, respectively (P<0.05, Fig. 4B), whereasDDOST 48 and Hsc70 were downregulated by 80% and 58% inthese fetuses (P<0.05, Fig. 4C). Consistent with 2-DE analysis(Fig. 4A and Table 2), cords from normal fetuses and thosewithout spina bifida aperta did not differ in protein expres-sion (P>0.05, Fig. 4C).

3.3. Transcription levels of selected proteins

Compared with normal spinal cords, those with spina bifidaaperta showed increased mRNA levels of Crmp-4 and Pdia3,by 2.12- and 2.16-fold, respectively (P<0.05) (Fig. 4D), with nodifference between cords from normal fetuses and thosewithout spina bifida aperta (P>0.05). Normal spinal cordsand those with or without spina bifida aperta did not differin mRNA expression of DDOST 48 or Hsc70 (P>0.05).

4. Discussion

NTDs are complex congenital anomalies of the central ner-vous system. However, current therapeutics for NTDs are un-satisfactory, with neurological complications being the mainproblem for therapy. Neurological dysfunction could resultfrom the primary defect or injuries to the uncovered neural tis-sue in the uterus. The pathological changes in the uncoveredneural tissue have not been described. We used comparativeproteomics study of the rat spinal cords from fetuses with

Table 3 – The function of identified proteins with differential expression between spinal cords from normal fetuses andthose with spina bifida aperta.

Spotno.

Protein name Location a Function b

1 Serum albumin precursor Secreted Regulation of the colloidal osmotic pressure of blood.2 Heterogeneous nuclear ribonucleoprotein

H/F (hnRNPH/F)Nucleus Component of the heterogeneous nuclear ribonucleoprotein (hnRNP)

complexes that provide the substrate for the processing events thatpre-mRNAs undergo before becoming functional, translatablemRNAs in the cytoplasm. Regulation of alternative splicing events

3 60s acidic ribosomal protein p0 Cytoplasm/nucleus Component of the eukaryotic ribosomal stalk. Identified in mRNPgranule complex and untranslated mRNAs

4 isoform1 of Collapsin response mediatorprotein 4 (Crmp-4)

Cytoplasm Necessary for signaling by class 3 semaphorins and subsequentremodeling of the cytoskeleton. Axon guidance, neuronal growthcone collapse and cell migration

5 Protein disulfide-isomerase A3 precursor(Pdia3)

Endoplasmicreticulum

Chaperone to promote the oxidative folding of newly synthesizedglycoproteins

6 Protein disulfide-isomerase A6 (Pdia6) Endoplasmicreticulummembrane

Chaperone to inhibit aggregation of misfolded proteins

7 Dolichyl-diphosphooligosaccharide–protein glycosyltransferase 48 kDa subunit(DDOST 48)

Endoplasmicreticulummembrane

Essential subunit of N-oligosaccharyl transferase enzyme thatcatalyzes the transfer of a high mannose oligosaccharide to anasparagine residue within an Asn-X-Ser/Thr consensus motif innascent polypeptide chains

8 Heat shock cognate 71 kDa protein (Hsc70) cytoplasm Binds to nascent polypeptides to facilitate correct protein folding.Functions as an ATPase in the disassembly of clathrin-coatedvesicles during transport of membrane components through the cell.

9 14-3-3 protein beta/alpha Cytoplasm Isoform of 14-3-3 protein family. Binds a multitude of functionallydiverse signaling proteins, including kinases, phosphatases, andtransmembrane receptors to mediate signal transduction

10 14-3-3 protein zeta/delta Cytoplasm Same as above11 14-3-3 protein theta Cytoplasm Same as above12 14-3-3 protein epsilon Cytoplasm Same as above13 Calponin-3 Cytoplasm Binds to actin, calmodulin, troponin C to regulation and modulation

of smooth muscle contraction.

a Location is based on information from http://www.uniprot.org/.b All the information about function is from the SWISS-PROT, NCBI database.

673J O U R N A L O F P R O T E O M I C S 7 5 ( 2 0 1 1 ) 6 6 8 – 6 7 6

ATRA-induced spina bifida aperta and identified 13 proteinswith differential expression between normal spinal cords andthose with spina bifida aperta. We confirmed 4 identified pro-teins by immunoblot analysis and assessed their mRNA levelsby quantitative real-time PCR. We demonstrate protein alter-ations that reflect the pathological situation of the uncoveredneural tissue, which may help improve the treatment of NTDs.

RA is the metabolic product of vitamin A (retinol) and is re-quired for normal embryonic development [10]. However, an ex-cess amount of RA in pregnantmammals leads to various NTDsin progeny [11]. Maternal administration of ATRA has long beenused to induce the experimental model for study of NTDs in thefetal rat [18]. We used ATRA administration to induce spinalbifida in our rat model and found 48% of fetuses with spinabifida aperta (subgroup 1) and 52% without (subgroup 2). Thisfinding is consistent with our previous results [13] and those ofDiez-Pardo et al. [18]. To avoid the influence of ATRA itself onthe alteration of protein expression, we included cords withoutspina bifida aperta as an experimental group. We used 2-DE-based proteomics to identify proteins with altered expressionin the spinal cord of E17 rat fetuses with spina bifida apertaand revealed 13 differently expressed proteins by MALDI-TOFMS/MS. Normal fetuses and those without spina bifida apertadid not differ in the expression of these proteins. Immunoblotand real-time PCR analysis confirmed the proteomics results.

Thus, the altered expression of fetal spinal cord proteins resultedfrom the defect of the spinal cord but not the ATRA itself.

The differently expressed proteins, including 14-3-3 pro-tein, Crmp-4, Hsc70, and calponin-3, are involved in signaltransduction, transcriptional regulation, apoptosis, proteinsynthesis and protein folding [19,20,21,22]. This study is thefirst to use a proteomics approach to screen differentiallyexpressed proteins in malformed fetal spinal cords, ratherthan in the whole embryo, and in NTDs of late gestation.

Among the differently expressed proteins, Pdia3, DDOST 48and Hsc70 have functions in protein folding, which wasreported to be related to neural damage of the brain and spinalcord [23,24], andCrmp-4was found closely related tonerve inju-ry [25]. We performed further studies of these 4 differentiallyexpressed proteins and found altered protein levels of Pdia3,DDOST 48 and Hsc70 in rat fetal spinal cords with spina bifidaaperta. These proteins are all known to be involved in proteinfolding. In eukaryotic cells, newly synthesized secretory pro-teins enter the secretory pathway via the endoplasmic reticu-lum (ER). The ER contains a variety of chaperone moleculesand folding factors that help the polypeptide chain fold intoma-ture and active proteins. After proper folding, proteins are thentransported out of the ER and folding-defective products areretained in the ER, thus initiating the ER-associated degradationprocess (ERAD) [26,27]. Correct folding is essential, because its

Fig. 4 – Immunoblot and real-time quantitative PCR analysis of mRNA expression of Crmp-4, Pdia3, Ddost 48 and Hsc70. A. 2-DEgel of spots identified as Crmp-4, Pdia3, DDOST 48 and Hsc70. Normal control indicates rat fetus without ATRA treatment,subgroup 1 indicates those with spina bifida aperta by ATRA treatment, and subgroup 2 those without spina bifida aperta byATRA treatment. B. Confirmation of 2-DE results by immunoblotting. Analysis of protein expression of Crmp-4, Pdia3, DDOST48, Hsc70 with actin as the internal control. C. Quantification of immunoblot result. Relative density of Crmp-4, Pdia3, DDOST48 and Hsc70 protein. D. Comparisons of total mRNA expression among Crmp-4, Pdia3, DDOST 48 and Hsc70 by real-timequantitative PCR. The number in the brackets indicates how many spinal cords were used. * P<0.05.

674 J O U R N A L O F P R O T E O M I C S 7 5 ( 2 0 1 1 ) 6 6 8 – 6 7 6

failure has been considered fatal [28]. Among the differentlyexpressed proteins, several were clustered functionally withprotein folding. Pdia3 is a member of the protein disulphide-isomerase (PDI) family, which acts as a chaperone in helpingprotein folding [29]. Hsc70 belongs to the heat shock proteinfamily, which can perform specific chaperone functions in de-livering the misfolded proteins to ERAD [30], and DDOST 48 fa-cilitates the nascent polypeptide entering the ER to undergofolding [31]. We found an elevated level of Pdia3 and reducedlevel of Hsc70 and DDOST 48 in spinal cords from fetuses withspina bifida aperata, which was confirmed by immunoblotanalysis (Fig. 4A, B, C). The altered level of proteins participatingin protein foldingmight affect the fate of neurons in the uncov-ered spinal cord, and then cause neural dysfunction. Althoughprotein folding was found essential for the development of Cae-norhabditis elegans [32], proteins involved in folding have notbeen reported in spina bifida aperta in mammals, and theroles they play during or after neural tube closure are not yetfully understood.

Our proteomics analysis suggests disturbance in the proteinfolding process in the uncovered spinal cord of fetuses withspina bifida aperta at late gestation. The protein misfoldingcould originate directly from the defect in the uncovered spinalcord or be a response to secondary injuries within the uterus,such as exposure of the uncovered spinal tissue to amnioticfluid. Protein misfolding leading to neuronal cell death wasfound associated with many neurological diseases, such asAlzheimer's disease [29], Parkinson disease, brain ischemia

[33] and congenital diseases such as Hirschsprung disease[34].

However, our real-time PCR analysis revealed only Pdia3 ofthe protein folding proteins with results for mRNA level con-sistent with those for protein level (Fig. 4D). It implied thechanges of Hsc70 and DDOST 48 in spinal bifida was not atthe mRNA level. With the knowledge of noncoding RNA,RNA is not merely an intermediary between DNA and protein.mRNA is not always translated into protein [35]. For example,microRNA base pairs have complimentary regions of targetmRNAs to silence gene expression post-transcriptionally[36]. The inconsistency between mRNA and protein expres-sion for Hsc70 and DDOST 48 might be caused by post-transcriptional regulation. Zhao et al. [37] detected decreasedexpression of miR-9/9*, miR-124a and miR-125b in RA-treated spinal cords during embryonic development, whichsuggests the involvement of dysregulated microRNA in spinalbifida. This finding might explain the decrease in Hsc70 andDDOST 48 protein expression with invariant mRNA expres-sion in our rat fetuses with spina bifida aperta and that regu-lation of Hsc70 and DDOST 48 was at the protein level. In thisstudy, we found dysregulated protein folding in the mal-formed spinal cord at E17. We provide new information toour knowledge of NTDs. Adjustment to the protein foldingprocessmight alleviate injuries to the uncovered neural tissueand reduce the complications.

We found upregulated expression of Crmp-4 in spinalcords of rat fetuses with spina bifida aperta and increased

675J O U R N A L O F P R O T E O M I C S 7 5 ( 2 0 1 1 ) 6 6 8 – 6 7 6

mRNA abundance (Fig. 4). No reports exist of Crmp-4 involvedin NTDs. Crmp-4 is a member of Crmps family, a group of cy-tosolic phosphoproteins that participate in axonal growth.Crmps play a role in axon guidance and neuronal growthcone collapse [38]. Crmp-4 is expressed immediately afterneuronal birth [39], is induced by peripheral nerve injury,and is suggested to regulate regenerative neurite outgrowth[25,40]. However, Duplan et al. [41] found that upregulatedCrmp-4 could trigger axonal degeneration and motoneurondeath. Whether upregulation of Crmp-4 in spina bifida apertareflects an attempt by neurons to regenerate, a repair effect,or promotion of the apoptosis of neurons at the site of the un-covered spinal cord is unknown. Further investigation is re-quired to reveal the role of Crmp-4 in injury to the uncoveredspinal cord, which is critical for treatment of spina bifidaaperta. Complications of neural dysfunction may be reducedif we modulate the expression of Crmp-4 by gene therapywhile covering the open neural tube by surgery for spinalbifida aperta.

5. Conclusions

Weprovide anoverviewof proteomic changes in the spinal cordof E17 rat fetuses with neural defects of spina bifida aperta. Wefound differentially expressed proteins caused by the primarydefect or secondary injuries of the uncovered spinal cord ex-posed in the uterine environment. These proteins possess di-verse functions such as cell signaling and apoptosis. However,the precise role they play in late gestation of NTDs awaits fur-ther investigation. Our study may provide more insights intoNTDs and contribute to the therapeutic strategy.

Supplementary materials related to this article can befound online at doi:10.1016/j.jprot.2011.09.006.

Acknowledgments

This studywas supported by the National Natural Foundation ofChina (nos. 30872705, 30801242, 30571934), the Research Fund forthe Doctoral Program of Higher Education of China (no.20092104120010) and the Educational Commission of LiaoningProvince, China (no. L2010637). We thank Dr. Shawn Chen forhelp with the MS analysis and Dr. Jun Wang for revising thearticle.

R E F E R E N C E S

[1] Boulet SL, Yang Q, Mai C, Kirby RS, Collins JS, Robbins JM, et al.National Birth Defects Prevention Network. Trends in thepostfortification prevalence of spina bifida and anencephalyin the United States. Birth Defects Res A Clin Mol Teratol2008;82:527–32.

[2] Bower C, D'Antoine H, Stanley FJ. Neural tube defects inAustralia: trends in encephaloceles and other neural tubedefects before and after promotion of folic acid supplementationand voluntary food fortification. Birth Defects Res A Clin MolTeratol 2009;85:269–73.

[3] Moore CA, Li S, Li Z, Hong SX, Gu HQ, Berry RJ, et al. Elevatedrates of severe neural tube defects in a high-prevalence areain northern China. Am J Med Genet 1997;73:113–8.

[4] Gu X, Lin L, Zheng X, Zhang T, Song X, Wang J, et al. Highprevalence of NTDs in Shanxi province: a combinedepidemiological approach. Birth Defects Res A Clin MolTeratol 2007;79:702–7.

[5] Date I, Yagyu Y, Asari S, Ohmoto T. Long-term outcome insurgically treated spina bifida cystica. Surg Neurol 1993;40:471–5.

[6] Zurmohle UM, Homann T, Schroeter C, Rothgerber H, HommelG, Ermert JA. Psychosocial adjustment of children with spinabifida. J Child Neurol 1998;13:64–70.

[7] Drewek MJ, Bruner JP, Whetsell WO, Tulipan N. Quantitativeanalysis of the toxicity of human amniotic fluid to culturedrat spinal cord. Pediatr Neurosurg 1997;27:190–3.

[8] Correia-Pinto J, Reis JL, Hutchins GM, Baptista MJ, Estevão-CostaJ, Flake AW, et al. In uteromeconium exposure increases spinalcordnecrosis in a ratmodel ofmyelomeningocele. J Pediatr Surg2002;37:488–92.

[9] Greene ND, Leung KY, Wait R, Begum S, Dunn MJ, Copp AJ.Differential protein expression at the stage of neural tubeclosure in the mouse embryo. J Biol Chem 2002;277:41645–51.

[10] MadenM. Retinoids and spinal cord development. J Neurobiol2006;66:726–38.

[11] Lammer EJ, Chen DT, Hoar RM, Agnish ND, Benke PJ, Braun JT,et al. Retinoic acid embryopathy. N Engl J Med 1985;313:837–41.

[12] Diez-Pardo JA, Mariño JM, Baoquan Q, Delgado-Baeza E,Fernáneez A, Morales MC, et al. Neural tube defects: anexperimental model in the foetal rat. Eur J Pediatr Surg 1995;5:198–202.

[13] Cai W, Zhao H, Guo J, Li Y, Yuan Z, Wang W. Retinoicacid-induced lumbosacral neural tube defects: myeloschisisand hamartoma. Childs Nerv Syst 2007;23:549–54.

[14] Berkelman T, Stenstedt T. 2-D Electrophoresis usingImmobilized pH Gradients: Principles & Methods. 2 Edition.Uppsala, Sweden: Amersham Biosciences; 2002.

[15] Gorg A, Postel W, Gunther S. The current state oftwo-dimensional electrophoresis with immobilized pHgradients. Electrophoresis 1988;9:531–46.

[16] Candiano G, Bruschi M, Musante L, Santucci L, Ghiggeri GM,Carnemolla B, et al. Blue silver: a very sensitive colloidalCoomassie G-250 staining for proteome analysis.Electrophoresis 2004;9:1327–33.

[17] Towbin H, Staehelin T, Gordon J. Electrophoretic transfer ofproteins from polyacrylamide gels to nitrocellulose sheets:procedure and some applications. Proc Natl Acad Sci U S A1979;76:4350–4.

[18] Diez-Pardo JA, Mariño JM, Baoquan Q, Delgado-Baeza E,Fernáneez A, Morales MC, et al. Neural tube defects: anexperimental model in the foetal rat. Eur J Pediatr Surg 1995;5:198–202.

[19] Skoulakis EM, Davis RL. 14-3-3 proteins in neuronaldevelopment and function. Mol Neurobiol 1998;16:269–84.

[20] Wang LH, Strittmatter SM. A family of rat CRMP genes isdifferentially expressed in the nervous system. J Neurosci1996;16(19):6197–207.

[21] Fan J, Xu G, Nagel DJ, Hua Z, Zhang N, Yin G. A model ofischemia and reperfusion increases JNK activity, inhibits theassociation of BAD and 14-3-3, and induces apoptosis ofrabbit spinal neurocytes. Neurosci Lett 2010;473:196–201.

[22] Krecic AM, Swanson MS. hnRNP complexes: composition,structure, and function. Curr Opin Cell Biol 1999;11:363–71.

[23] PaschenW. Dependence of vital cell function on endoplasmicreticulum calcium levels: implications for the mechanismsunderlying neuronal cell injury in different pathologicalstates. Cell Calcium 2001;29:1–11.

676 J O U R N A L O F P R O T E O M I C S 7 5 ( 2 0 1 1 ) 6 6 8 – 6 7 6

[24] Tarabal O, Calderó J, Casas C, Oppenheim RW, Esquerda JE.Protein retention in the endoplasmic reticulum, blockade ofprogrammed cell death and autophagy selectively occur inspinal cord motoneurons after glutamate receptor-mediatedinjury. Mol Cell Neurosci 2005;29:283–98.

[25] Jang SY, Shin YK, Jung J, Lee SH, Seo SY, Suh DJ, et al.Injury-induced CRMP4 expression in adult sensory neurons; apossible target gene for ciliary neurotrophic factor. NeurosciLett 2010;485:37–42.

[26] Hebert DN, Molinari M. In and out of the ER: protein folding,quality control, degradation, and related human diseases.Physiol Rev 2007;87:1377–408.

[27] Ellgaard L,MolinariM, Helenius A. Setting the standards: qualitycontrol in the secretory pathway. Science 1999;286:1882–8.

[28] Selkoe DJ. Folding proteins in fatal ways. Nature 2003;426:900–4.

[29] Ferrari DM, Söling HD. The protein disulphide-isomerasefamily: unraveling a string of folds. Biochem J 1999;339:1–10.

[30] Walsh D, Li Z, Wu Y, Nagata K. Heat shock and the role of theHSPs during neural plate induction in early mammalian CNSand brain development. Cell Mol Life Sci 1997;53:198–211.

[31] Kelleher DJ, Gilmore R. An evolving view of the eukaryoticoligosaccharyl transferase. Glycobiology 2006;16:47R–62R.

[32] Shen X, Ellis RE, Lee K, Liu CY, Yang K, Solomon A, et al.Complementary signaling pathways regulate the unfoldedprotein response and are required for C. elegansdevelopment. Cell 2001;107:893–903.

[33] Schröder M, Kaufman RJ. The mammalian unfolded proteinresponse. Annu Rev Biochem 2005;74:739–89.

[34] Kjaer S, Ibáñez CF. Intrinsic susceptibility to misfolding of ahot-spot for Hirschsprung diseasemutations in the ectodomainof RET. HumMol Genet 2003;12:2133–44.

[35] Ambros V. microRNAs: tiny regulators with great potential.Cell 2001;107:823–6.

[36] Noncoding RNAs. In: Barciszewski J, Erdmann VA, editors.Molecular Biology and Molecular Medicine. Georgetown, TX:Landes Bioscience; 2003. p. 292.

[37] Zhao JJ, Sun DG, Wang J, Liu SR, Zhang CY, Zhu MX. Retinoicacid downregulates microRNAs to induce abnormaldevelopment of spinal cord in spina bifida rat model. ChildsNerv Syst 2008;24:485–92.

[38] Quinn CC, Chen E, Kinjo TG, Kelly G, Bell AW, Elliott RC, et al.TUC-4b, a novel TUC family variant, regulates neuriteoutgrowth and associates with vesicles in the growth cone. JNeurosci 2003;23:2815–23.

[39] Minturn JE, Fryer HJ, Geschwind DH, Hockfield S. TOAD-64, agene expressed early in neuronal differentiation in the rat, isrelated to unc-33, a C. elegans gene involved in axonoutgrowth. J Neurosci 1995;15:6757–66.

[40] Gögel S, Lange S, Leung KY, Greene ND, Ferretti P.Post-translational regulation of Crmp in developing andregenerating chick spinal cord. Dev Neurobiol 2010;70:456–71.

[41] Duplan L, Bernard N, Casseron W, Dudley K, Thouvenot E,Honnorat J, et al. Collapsin response mediator protein 4a(CRMP4a) is upregulated in motoneurons of mutant SOD1mice and can trigger motoneuron axonal degeneration andcell death. J Neurosci 2010;30:785–96.