Upload
datura498762
View
26
Download
2
Embed Size (px)
Citation preview
Arbuscular Mycorrhiza–Specific Signaling in Rice Transcendsthe Common Symbiosis Signaling Pathway W
CarolineGutjahr,aMari Banba,b VincentCroset,a KyungsookAn,c AkioMiyao,dGynheungAn,cHirohikoHirochika,d
Haruko Imaizumi-Anraku,b and Uta Paszkowskia,1
a Department of Plant Molecular Biology, University of Lausanne, 1015 Lausanne, Switzerlandb Division of Plant Sciences, National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8602, Japanc National Research Laboratory of Plant Functional Genomics, Pohang University of Science and Technology, Pohang 790-784,
Koread Division of Genome and Biodiversity Research, National Institute of Agrobiological Sciences, Tsukuba, Ibaraki 305-8602,
Japan
Knowledge about signaling in arbuscular mycorrhizal (AM) symbioses is currently restricted to the common symbiosis
(SYM) signaling pathway discovered in legumes. This pathway includes calcium as a second messenger and regulates both
AM and rhizobial symbioses. Both monocotyledons and dicotyledons form symbiotic associations with AM fungi, and
although they differ markedly in the organization of their root systems, the morphology of colonization is similar. To identify
and dissect AM-specific signaling in rice (Oryza sativa), we developed molecular phenotyping tools based on gene
expression patterns that monitor various steps of AM colonization. These tools were used to distinguish common SYM-
dependent and -independent signaling by examining rice mutants of selected putative legume signaling orthologs predicted
to be perturbed both upstream (CASTOR and POLLUX) and downstream (CCAMK and CYCLOPS) of the central, calcium-
spiking signal. All four mutants displayed impaired AM interactions and altered AM-specific gene expression patterns,
therefore demonstrating functional conservation of SYM signaling between distant plant species. In addition, differential
gene expression patterns in the mutants provided evidence for AM-specific but SYM-independent signaling in rice and
furthermore for unexpected deviations from the SYM pathway downstream of calcium spiking.
INTRODUCTION
The arbuscular mycorrhizal (AM) symbiosis occurs in all plant
lineages, including angiosperm dicotyledons and monocotyle-
dons, and thus also in important crop grasses such asmaize (Zea
mays), wheat (Triticum aestivum), and rice (Oryza sativa). The first
step in the development of AM symbiosis (reviewed in Smith and
Read, 1997; Harrison, 2005; Paszkowski, 2006) is a molecular
dialogue prior to contact. At the root surface, the fungal hypha
differentiates into a hyphopodium from which a penetration peg
enters the rhizodermis. The fungus progresses through the outer
into the inner root cortex and spreads intercellularly along the
longitudinal axis of the root, forming highly ramified structures,
termed arbuscules, inside cortex cells. At the whole root level,
development of the AM symbiosis is asynchronous, with various
stages of colonization being present simultaneously. Thus, sig-
naling between the symbiotic partners occurs, at least partly, cell
autonomously with fine-tuned stage specificity.
Despite the progress made in past years, knowledge of the
molecular events and components involved in these signaling
processes is still limited and mostly derived from studies in
legumes, in which forward genetic screens uncovered a major
signaling pathway, the common symbiosis (SYM) pathway,
which is nonspecifically required for the formation of both rhizo-
bial and AM symbioses (for a recent review, see Parniske, 2008).
To date, the components identified are a symbiosis Leu-rich
repeat receptor kinase (SYMRK), DOES NOT MAKE INFEC-
TION2 (DMI2); two predicted cation channels, CASTOR and
POLLUX (DMI1); two nuclear porins, NUP85 and NUP133, which
are all necessary for the induction of Ca2+ spiking (Figure 1)
(Kosuta et al., 2008); and the calcium/calmodulin-dependent
protein kinase CCAMK (DMI3), which acts downstream of Ca2+
spiking (Figure 1) and is thought to transduce the calcium signals.
CCAMK physically interacts with and phosphorylates CYCLOPS
(INTERACTING PROTEIN OF DMI3 [IPD3]), a protein of unknown
function (Messinese et al., 2007; Parniske, 2008).
A better understanding of the molecular events governing the
development and function of the AM symbiosis is needed,
particularly in grasses, including major crops, to aid agricultural
exploitation of the symbiosis. Rice is an attractive model crop for
studying AM signaling because the genome sequence is avail-
able and there are extensive mutant collections for reverse-
genetics screens (Hirochika et al., 2004). Candidates for ortho-
logs of all seven commonSYM genes have been computationally
predicted to be present in the genomes of a number of dicotyl-
edons and monocotyledons (Zhu et al., 2006; Messinese et al.,
2007). Although roots perform equivalent functions in both
1 Address correspondence to [email protected] author responsible for distribution of materials integral to thefindings presented in this article in accordance with the policy describedin the Instructions for Authors (www.plantcell.org) is: Uta Paszkowski([email protected]).WOnline version contains Web-only data.www.plantcell.org/cgi/doi/10.1105/tpc.108.062414
The Plant Cell, Vol. 20: 2989–3005, November 2008, www.plantcell.org ã 2008 American Society of Plant Biologists
angiosperm classes and the cytological appearance of AM
symbioses is similar, the architecture of the root system and
cellular patterning differ considerably (Hochholdinger and
Zimmermann, 2008). The extent to which cereal roots utilize
the same SYM signaling pathway for the interaction with AM
fungi has been addressed for CCAMK (Chen et al., 2007) and
CYCLOPS (IPD3) (Chen et al., 2008), the two signaling compo-
nents operating downstream of the Ca2+ response. In rice,
mutation of either the CCAMK or the CYCLOPS gene leads to
a mycorrhizal mutant phenotype similar to that described for
legumes, and rice CCAMK was able to restore full mycorrhizal
and rhizobial colonization in the Medicago truncatula (barrel
medic) dmi3 mutant (Godfroy et al., 2006; Chen et al., 2007,
2008). The function of CCAMK and CYCLOPS, therefore, ap-
pears to be conserved between rice and legumes.
Transcriptional outputs associated with specific physiological
processes can be used as diagnostic tools to identify the
signaling pathways involved (Glazebrook et al., 2003; Bari
et al., 2006; Sato et al., 2007). To unravel the signaling cues
that uniquely affect the AM symbiosis demands the careful
selection of AM-specific indicator transcripts. Over the past
years, a number of transcriptome analyses have illustrated the
dramatic changes that occur in plant roots upon mycorrhizal
colonization (Liu et al., 2003; Guimil et al., 2005; Hohnjec et al.,
2005). A set of genes specifically expressed during the AM
symbiosis have been identified from M. truncatula (reviewed in
Krajinski and Frenzel, 2007), but their utility as diagnostic tools for
signaling has not been assessed. The dependence of transcrip-
tional induction on common SYM signaling components has
been demonstrated in Lotus japonicus andM. truncatula, and the
existence of additional AM signaling cues has been suggested
(Weidmann et al., 2004; Kistner et al., 2005; Massoumou et al.,
2007; Siciliano et al., 2007). However, to date, it has been difficult
to exclude symbiosis-independent influences on the induction of
these gene sets, since developmental, nutritional, and patho-
genic responses were not characterized. Thus, the relevance of
the common SYM pathway and the existence of additional
signaling cues for AM-specific processes are currently not
known for legumes or other mycorrhizal plant species.
Here, we have used rice to investigate functional conservation
of the SYM pathway and to determine additional signaling cues
for the AM symbiosis. We selected rice lines (rice sym mutants)
with insertions into signaling components upstream (CASTOR
and POLLUX) and downstream (CCAMK andCYCLOPS) of Ca2+
spiking and demonstrated that all of these genes are required for
AM colonization of rice, thus illustrating broad evolutionary
conservation of symbiotic signaling. Genome-wide transcrip-
tome profiling of mycorrhizal rice roots had previously predicted
a group of genes to be exclusively AM-induced (Guimil et al.,
2005). Here, we characterized and subsequently used these
genes as molecular indicators of AM-specific signaling. Their
application to the study of rice symmutants reveals that although
the common SYM signaling pathway is of central importance for
successful AM symbiosis in rice, it is supported by additional
symbiotic signaling cues that act in parallel to, or depart from,
common SYM signaling.
RESULTS
AM-Specific Marker Genes in Rice
Gene transcripts that accumulate exclusively in mycorrhizal
roots provide valuable readouts for the analysis of specificity in
AM signaling. We selected 18 rice genes previously identified by
whole genome transcriptome analysis as being strongly induced
during the development of AMsymbiosis but silent in response to
mock treatments, root pathogen inoculation, or the application of
different phosphate regimes (Guimil et al., 2005) (see Supple-
mental Table 1 online).
Corroborating the Specificity of Marker Gene Induction
To further corroborate the AM-specific expression of these
genes, we examined the effect of root colonization by another
beneficial fungus, Piriformospora indica, on marker gene expres-
sion. P. indica has been reported to promote the growth of a wide
variety of plant species, including cereal crops (Varmaet al., 1999;
Waller et al., 2005). Similar to AM fungi, root colonization by P.
indica is strictly confined to the cortex,where the fungusdevelops
intracellular coils that are different from the arbuscules formed by
AM fungi (Varma et al., 1999). Root colonization by P. indica is
accompanied by the production of pear-shaped chlamydospores
that are easy to detect (see Supplemental Figures 1A and 1B
online) (Varma et al., 1999; Waller et al., 2005). At 5 weeks
postinoculation (wpi), we found 50 6 8% (SE) of rice root length
colonized by P. indica; however, none of the 18 gene transcripts
was detected (see Supplemental Figures 2A and 2B online).
Figure 1. Components of the Legume SYM Signaling Pathway.
The SYM pathway shared between AM and rhizobial symbioses consists
of seven proteins: a receptor-like kinase encoded by SYMRK/DMI2
(Endre et al., 2002; Stracke et al., 2002); putative cation channels
encoded by the highly homologous genes CASTOR and POLLUX/
DMI1 (Ane et al., 2004; Imaizumi-Anraku et al., 2005); nuclear porins,
encoded by NUP85 and NUP133 (Kanamori et al., 2006; Saito et al.,
2007); a calcium/calmodulin-dependent kinase encoded by CCAMK/
DMI3 (Levy et al., 2004; Mitra et al., 2004); and a protein encoded by
CYCLOPS (IPD3) (Chen et al., 2008; Parniske, 2008). SYMRK, CASTOR,
POLLUX, NUP85, and NUP133 are required for Ca2+ spiking, an early
response of root hairs to Nod factor application and to approaching AM
fungi (Kosuta et al., 2008). The calcium/calmodulin-dependent kinase
CCAMK/DMI3 is thought to decipher the calcium signals (DMI3) (Levy
et al., 2004; Mitra et al., 2004; Kosuta et al., 2008). CYCLOPS (IPD3)
interacts with CCAMK, serves as a phosphorylation substrate for
CCAMK (Messinese et al., 2007; Parniske, 2008), and is required for
mycorrhizal colonization (Chen et al., 2008). The proteins shown in
boldface were investigated in this study.
2990 The Plant Cell
To investigate the expression of the 18 genes in other parts of
the plant, RT-PCRwas performed on cDNA from rice root, shoot,
stem, leaf, panicle, embryo, and callus. Since transcripts of four
genes (ARBUSCULAR MYCORRHIZA18 [AM18], AM20, AM29,
and AM42) were too low to be detected by RT-PCR, their
expression was analyzed by real-time RT-PCR. All 18 genes
were expressed in AM roots but not in other plant tissue or callus
cultures (see Supplemental Figures 2A and 2B online). We
conclude, therefore, that expression of this particular set of
genes is, most likely, AM-specific.
Temporal Expression of Marker Genes
Coordinated signaling pathways must underlie the consecutive
steps leading to the establishment of an AM symbiosis. Although
mycorrhizal colonization at the whole root level is asynchronous,
temporal expression studies permit enrichment for early (pre-
symbiotic molecular crosstalk, hyphopodia formation, and rhi-
zodermal penetration) and late (cortex invasion, cortical spread,
and arbuscule formation) stages of the interaction. To monitor
possible transcriptional responses at particular stages, we ex-
amined the temporal expression of our gene set at 3, 5, 7, and 9
wpi with Glomus intraradices. A low titer of fungal inoculum was
used to enhance resolution at early time points. Fungal coloni-
zation was microscopically inspected (Figure 2A) and quantified
(Figure 2B). At 3 wpi, no intraradical colonization was found, and
colonization was low at 5 wpi, with 1.5 6 0.2% of the total root
length containing arbuscules. The amount of intraradical hyphae
and arbuscules rose sharply between 5 and 7 wpi and remained
highwithout significant further elevation at 9wpi. By contrast, the
number of vesicles increased continuously throughout the time
course.
In mycorrhizal rice roots, activation of the mycorrhiza-specific
phosphate transporter PT11 (Paszkowski et al., 2002) was
detected at 7 and 9 wpi (Figure 2C), indicating arbuscule forma-
tion, in a manner similar to that observed for the putatively
orthologous genes Mt PT4, St PT4, and Le PT4 from M.
truncatula, potato (Solanum tuberosum), and tomato (Solanum
lycopersicum), respectively (Harrison et al., 2002; Nagy et al.,
2005). Transcripts of four rice genes (AM1, AM2, AM3, and
AM11) appeared very early (at 3 wpi) and their expression
increased sharply between 5 and 7 wpi, remaining high through-
out the course of the experiments (Figure 2C). Transcripts of the
other 14 genes were first detected at 7 wpi, in parallel with PT11
(Figure 2C). While some transcript levels reached maximal ex-
pression at 7 wpi, others increased further at 9 wpi. None of the
marker genes was expressed in mock-inoculated roots at any
time point. In summary, we observed two distinct expression
patterns that reflect signaling operating at early or later devel-
opmental stages of the AM association.
It has been well documented that expression of mycorrhiza-
specific phosphate transporter genes is restricted to arbuscu-
lated cells (Harrison et al., 2002;Nagy et al., 2005). According to a
recent report, such transporters are induced by lysophosphati-
dylcholine (LPC) in potato hairy roots and tomato cell cultures in
the absence of AM colonization (Drissner et al., 2007). Therefore,
use of LPC could distinguish arbuscule-expressed late genes
that are induced along with PT11. However, PT11 was not
expressed in roots treated with LPC, although CYCLOPHILIN2
transcripts could be visualized, thus indicating live roots after
LPC infiltration (see Supplemental Figure 3 online).
Robustness of the Marker Genes
Different AM isolates have been reported to stimulate different
transcriptional responses in their hosts (Hohnjec et al., 2005). To
determine the suitability of our gene set as universal AM-specific
markers, we characterized transcript accumulation in rice roots
inoculated with Gigaspora rosea, an AM fungus phylogenetically
distant fromG. intraradices (Schussler et al., 2001). Interestingly,
whileG. intraradices produced finely branched arbuscules in rice
(Figure 2A), Gi. rosea formed predominantly coils and coarse
arbuscular coils (Figure 2D). At 7 wpi, total root length coloniza-
tion had reached 32 6 14%, with frequent occurrence of
arbuscular coils (Figure 2E). Vesicles were absent from Gi.
rosea–colonized roots, as is typical for members of Gigaspor-
aceae. All marker gene transcripts were detected in roots col-
onized by Gi. rosea (Figure 2F), exhibiting expression levels
comparable to roots colonized byG. intraradices (Figure 2C), but
were absent in mock controls. Taken together, the transcripts of
all 18 genes could be correlated with the degree of fungal root
invasion by two distantly related AM fungi, corroborating the
robustness and universal character of the marker gene set for
monitoring AM symbioses.
Systemic Induction of Marker Genes
Transcriptional plant responses to interaction with AM fungi can
be cell autonomous, restricted to specific cell types, or systemic
(Chabaud et al., 2002; Harrison et al., 2002; Kosuta et al., 2003;
Liu et al., 2003, 2007; Nagy et al., 2005). To examine whether any
of the 18 ricemarker genes can be activated by systemic signals,
we studied their transcription in split-root experiments. In this
experimental setup, only half of the root system was inoculated
(mycorrhizal part). At 6 wpi, G. intraradices had colonized the
mycorrhizal part to 33 6 10% and was absent in the non-
inoculated part, reflected by the absence of fungal structures
(Figure 3A). Transcripts of all 18marker geneswere present in the
mycorrhizal part of the roots and, with the exception of two
genes, absent in the noninoculated part of the roots (Figure 3B).
AM3 and AM34 were expressed in both the inoculated and
noninoculated halves of the root system (Figure 3B), suggesting
activation by systemic signals elicited by and/or transmitted from
themycorrhizal half of the root system.AM3 belongs to the group
of early and continuously highly expressed genes (Figure 2C). By
contrast, transcripts of AM34 were only detected at later stages
of the interaction (Figure 2C). None of the 18 genes was system-
ically induced in shoots of mycorrhizal plants (see Supplemental
Figures 2A and 2B, online).
Spatial Expression of Rice AM Marker Genes
To investigate gene expression at cellular resolution, we selected
a subset of strongly inducedmarker genes from rice representing
particular expression profiles and examined the accumulation of
their transcripts using in situ hybridization. AM1 was chosen as
AM-Specific Signaling in Rice 2991
Figure 2. Expression Analysis of Rice Marker Genes during Colonization by G. intraradices and Gi. rosea.
(A) Trypan blue staining of wild-type roots at 6 wpi withG. intraradices.G. intraradices formed highly branched arbuscules. A, arbuscule; IH, intraradical
hypha. Bar = 50 mm.
(B) Percentage root length colonization by G. intraradices during a time-course experiment determined by a modified grid-line intersect method.
Harvest time points are indicated (wpi). Means6 SE of five plants represented by two replicate samples are shown. ext hyphae, extraradical hyphae; int
hyphae, intraradical hyphae.
(C) Real-time RT-PCR–based expression analysis of marker genes during a time-course experiment of rice roots inoculated with G. intraradices.
Expression levels are shown relative to the constitutively expressed CYCLOPHILIN2 gene. Error bars indicate SD from three technical replicates.
(D) Trypan blue staining of wild-type roots at 7 wpi withGi. rosea.Gi. rosea formed arbuscular coils but no arbuscules or vesicles. AC, arbuscular coil; C,
coil; EC, epidermal coil. Bar = 50 mm; bar in inset = 20 mm.
(E) Percentage root length colonization by Gi. rosea (Gr) at 7 wpi determined by a modified grid-line intersect method. Means 6 SE of five plants
represented by two replicate samples are shown.
(F) Real-time RT-PCR–based expression analysis of mock-inoculated and Gi. rosea–inoculated rice roots at 7 wpi. The experiment was repeated four
times with similar results. Expression levels are shown relative to the constitutively expressed rice CYCLOPHILIN2 gene. Error bars indicate SD from
three technical replicates.
2992 The Plant Cell
an early expressed gene, AM3 as an early and systemically
expressed gene, and PT11 as a late expressed gene. The
digoxigenin-labeled PT11 antisense probe revealed signals re-
stricted to arbusculated cells (Figure 4A). No signal was detected
when the sense probe was applied to sections from AM roots
(Figure 4B) or when antisense probe was applied to tissue
sections from mock-inoculated roots (Figure 4C). Thus, the
localization of PT11 expression corresponds to that of its
predicted orthologs Mt PT4 (Harrison et al., 2002), Le PT4, and
St PT4 (Nagy et al., 2005).
Expression of AM1 was detected in rice cells colonized by
small arbuscules and in cortex cells flanking intercellularly grow-
ing hyphae (Figure 4D). Due to resolution constraints, it was not
possible to distinguish the small arbuscules from developing or
senescing arbuscules. However, the early expression of AM1 is
consistent with transcript accumulation in developing arbus-
cules, and this is further supported by the observation that cells
with fully developed arbuscules did not produce signals with the
same AM1 antisense probe (Figure 4E). Sections from mycor-
rhizal roots hybridized to the AM1 sense probe (Figure 4F), and
sections from mock-inoculated roots treated with the AM1
antisense probe (Figure 4G) had no signals.
AM3 transcripts were visualized in arbusculated cells only
(Figure 4H). According to the results of the split-root experiment
(Figure 3B), a systemically induced AM3 expression was ex-
pected; but it was not detected. This, however, may result from
transcript accumulation below the limit of detection, but in a high
number of cells. No signal was observed using the sense probe
(Figure 4I) or hybridizing mock-inoculated root sections with
antisense probe (Figure 4J).
In summary, the variety of transcript accumulation patterns
found suggested the existence of cell-autonomous signaling
events operating selectively in certain cell types during the
colonization of rice by G. intraradices. As in M. truncatula, the
rice mycorrhiza-specific phosphate transporter PT11 is strictly
induced in arbusculated cells (Figure 4A). By contrast, AM1 is
transcribed in two types of cortex cells, those adjacent to
intercellularly growing hyphae and those containing small
Figure 3. Analysis of the Systemic Expression of Rice Marker Genes.
(A) Percentage root length colonization by G. intraradices of the inocu-
lated halves of the split roots at 6 wpi, determined by a modified grid-line
intersect method. ext hyphae, extraradical hyphae; int hyphae, intra-
radical hyphae.
(B) Real-time RT-PCR–based expression of marker genes in the mycor-
rhizal half (+G.i.) and the noninoculated half (�G.i.) of a split root and a
mock-inoculated control. Gene expression levels are shown relative to
the expression of the constitutive rice CYCLOPHILIN2 gene. Error bars
represent SD for three technical replicates. The experiment was repeated
twice with similar results.
Figure 4. Spatial Expression of Three AM Marker Genes.
In situ hybridization of PT11 ([A] to [C]), AM1 ([D] to [G]), and AM3 ([H]
to [J]).
(A), (D), (E), and (H) Sections from rice roots colonized by G. intraradices
and probed with antisense probes.
(B), (F), and (I) Sections from rice roots colonized by G. intraradices and
probed with sense probes.
(C), (G), and (J) Sections from mock-inoculated rice roots probed with
antisense probes.
In situ hybridizations were repeated at least twice with equivalent results.
Black arrowheads, fully grown arbuscules; red arrowheads, small arbus-
cules; blue arrowheads, apoplastic intraradical hyphae. Bars = 30 mm.
AM-Specific Signaling in Rice 2993
arbuscules (Figure 4D). The spatial expression is consistent with
the observed early and progressive gene induction associated
with fungal spread within the host root (Figure 2C). In addition
to being expressed systemically (Figure 3B), AM3 showed
arbuscule-specific transcript accumulation (Figure 4H).
Identification of AM-Specific Signaling in Rice
To examine the dependence of marker gene expression on the
nonspecific common SYM signaling pathway in rice, we first
determined the functional conservation of the pathway between
legumes and rice. Putative rice orthologs of legume SYMRK,
CASTOR, POLLUX, NUP85, NUP133, CCAMK, and CYCLOPS
have previously been identified computationally (Kanamori et al.,
2006; Zhu et al., 2006; Messinese et al., 2007; Saito et al., 2007),
and the requirement of CCAMKandCYCLOPS (the two signaling
proteins downstream of the Ca2+ response) for AM development
in rice was recently reported (Chen et al., 2007, 2008).
Expression of Common SYM Genes in Rice
To compare expression patterns of the common SYM genes
between rice and legumes, RT-PCR was performed on cDNA
from different organs of the rice plant as well as frommycorrhizal
roots and callus (see Supplemental Figure 4 online). SYMRK,
CASTOR, and POLLUX were expressed in almost all of the
tissues tested. High transcript levels of both genes encoding
nucleoporins were found in all samples tested. As reported
previously (Chen et al., 2007, 2008), RNA levels of rice CCAMK
(DMI3) were highest in roots and panicles (see Supplemental
Figure 4 online) and those of CYCLOPS (IPD3) (Messinese et al.,
2007) were highest in roots; however, only low levels could be
detected in other plant organs and callus. Interestingly, none of
the genes was differentially expressed in roots upon colonization
byG. intraradices. In general, all putative rice orthologs of legume
SYM pathway genes exhibited root expression, and where
available data permit comparison, expression patterns were
similar to those in legumes (Imaizumi-Anraku et al., 2005;
Kanamori et al., 2006; Saito et al., 2007). Exceptions were (1)
CCAMK, which was only weakly expressed in M. truncatula
flowers (Levy et al., 2004) but highly expressed in rice panicles,
and (2) POLLUX, which was expressed mainly in roots, but not in
any other organ, of M. truncatula (Ane et al., 2004) but in rice
showed broad expression with high RNA levels in panicles.
Identification and Characterization of Rice Common
SYM Mutations
To study the conservation of common SYM signaling in rice, we
screened for mutant lines with insertions in putative SYM
orthologs encoding signaling components upstream and down-
stream of Ca2+ spiking. Rice lines with insertions into CASTOR
andPOLLUX (upstream) and intoCCAMK andCYCLOPS (down-
stream) (Figure 1) were selected from public databases (http://
orygenesdb.cirad.fr/, http://signal.salk.edu/) and from PCR-
based screens of the retrotransposon Tos17-induced rice
mutant collection (Hirochika et al., 2004) (Figure 5; see Supple-
mental Table 2 online).
For each of the rice SYM genes, a full-length cDNA is available
that allows determination of the gene structure (http://cdna01.
dna.affrc.go.jp/cDNA/). Analogous to L. japonicus (Imaizumi-
Anraku et al., 2005), rice CASTOR and POLLUX consist of 12
exons and 11 introns, with CASTOR having longer introns than
POLLUX (Figure 5A). Rice CCAMK consists of seven exons and
six introns and is similar in structure to CCAMK of M. truncatula
(Chen et al., 2007). Rice CYCLOPS (IPD3) has 11 exons and a
similar structure to M. truncatula IPD3 (Figure 5A) (Messinese
et al., 2007; Chen et al., 2008). Thus, gene structure is highly
conserved.
For CASTOR, two lines predicted to contain T-DNA insertions
in the second exon (1B-08643 and 3D-50377) were retrieved
frommutant collections. PCR analysis confirmed the presence of
the T-DNA for line 1B-08643 (castor-1) (Figure 5A; see Supple-
mental Table 2 online) but not for 3D-50377. In the case of
POLLUX, three lines were identified: 1C-03411 (pollux-1) con-
tained a T-DNA insertion in the first intron; NC6423 (pollux-2) and
ND5050 (pollux-3) had Tos17 insertions in the third and fourth
exons, respectively (Figure 5A; see Supplemental Table 2 online).
Four insertion lines were identified for CCAMK: the three lines
NF8513, NG2508, and NE1115 carry Tos17 insertions, and line
2B-50404 contains a T-DNA insertion. While NF8513 and
NG2508 have been characterized previously (Chen et al.,
2007), NE1115 represents a novel allele containing a Tos17
insertion within the fourth exon. NE1115 and NF8513 were used
in our studies as rice ccamk-1 and ccamk-2, respectively (Figure
5A; see Supplemental Table 2 online). The fourth line, 2B-50404,
was not considered due to reduced germination frequency. We
identified 54 insertions in the region of CYCLOPS. We chose
three Tos17 insertion lines, NG0782, NC2415, and NC2713, for
characterization. In each of these lines, the retrotransposon is
inserted in the sixth exon. We refer to these lines as cyclops-1,
cyclops-2, and cyclops-3, respectively (Figure 5A; see Supple-
mental Table 2 online). To confirm the location of each insertion
relative to the given gene structure, sequencing across both the
59 and 39 gene-insertion boundaries was performed. The posi-
tions of all insertions were as reported in the databases of the
respective mutant collection (Figure 5A). Therefore, this study
included multiple mutant alleles of POLLUX, CCAMK, and CY-
CLOPS and one of CASTOR.
To quantify transcript accumulation in the mutant lines,
RT-PCR was performed using one primer pair flanking the
insertion and two other primer pairs targeting the regions up-
stream and downstream of the insertions corresponding to the
59 and the 39 ends of the cDNA, respectively (Figure 5A; see
Supplemental Table 3 online). CASTOR transcripts were not
detected in castor-1, suggesting that this is a null allele (Figure
5B). No RT-PCR products were obtained using primers spanning
the transposon insertion site for any of the three pollux, the
ccamk-2, and the three cyclops alleles; however, transcripts of
the respective genes were detected in each of the lines with
primer pairs targeting the 59 end of the transcript (Figure 5B). For
ccamk-2 and the three cyclopsmutants, transcripts correspond-
ing to the 59 and 39 regions of the insertions were monitored
(Figure 5). Although still partially transcribed, the genes are likely
compromised due to the several kilobases of T-DNA or retro-
transposon inserted within central exons (Figure 5A). In line
2994 The Plant Cell
NF8513 (ccamk-2), retrotransposon insertion into the third intron
of CCAMK led to missplicing of the third exon and an in-frame
fusion of the second and fourth exons (Chen et al., 2007). The
deletion of the third exon removes a putative Ca2+-dependent
autophosphorylation domain (Gleason et al., 2006; Tirichine
et al., 2006) and is predicted to disrupt CCAMK function.
CASTOR, POLLUX, CCAMK, and CYCLOPS Are Required
for AM Colonization in Rice
To define and compare the roles of CASTOR, POLLUX, CCAMK,
and CYCLOPS in AM colonization, siblings from segregating T1
families of each mutant line were used for phenotypic charac-
terization, enabling the direct comparison of mutant and wild-
type alleles in the heterozygous and homozygous state for each
locus under the same experimental setting. The sizes of the T1
families depended on seed availability and varied between 30
and 60 siblings. The genotypes of individual plants were deter-
mined, and at least seven plants from each genotype were
selected for microscopic inspection at 6 wpi.
Since the insertion mutants were generated in three different
rice japonica cultivars, Dongjin, Hwayoung, and Nipponbare, we
quantitatively and qualitatively examined colonization by G.
intraradices of each variety. Heterozygous and homozygous
Figure 5. Rice Common SYM Genes and Characterization of SYM Loci.
(A) Gene structures and positions of insertions in rice CASTOR, POLLUX, CCAMK, and CYCLOPS drawn to scale. The A of each ATG designates
nucleotide 1. Black boxes represent exons separated by introns (solid lines). Mutant line names and positions (in nucleotides) of the respective
insertions are indicated. The mutants castor-1 and pollux-1 carry T-DNA (LB, left border; RB, right border); the other mutants carry Tos17
retrotransposon insertions. Arrows indicate primers used in (B).
(B) Analysis of CASTOR, POLLUX, CCAMK, and CYCLOPS transcripts in mutant and wild-type rice by RT-PCR using primer pairs located 59 (black
arrows) or 39 (light gray arrows) of the insertion and flanking the insertion (IF, insertion flank; dark gray arrows). For castor-1 and pollux-1, cultivars
Dongjin and Hwayoung were used as wild-type controls, respectively. For all other mutants, Nipponbare was employed as the wild type. Amplification
of the wild-type control band corresponding to the 59 and 39 flanks of the pollux-2 and pollux-3 alleles was performed with the same primer pairs.
AM-Specific Signaling in Rice 2995
wild-type segregants aswell as nonsegregating individuals of the
parental varieties exhibited 69 6 9% of total root length coloni-
zation, which was accompanied by abundant production of
arbuscules and vesicles (Figures 6A to 6C and 7A). Root colo-
nization of the sym mutants exhibited a patchy pattern of
hyphopodia clusters accompanied by attempted penetration of
rhizodermal cells (Figures 6D to 6O). Each of the homozygous
mutants lacked cortex colonization and, therefore, arbuscules
and vesicles (Figures 6D to 6O; seeSupplemental Table 2 online).
Total root length colonization was low and reached 4 to 14%
(Figure 7B), including 1 to 10% of hyphopodia colonization of the
different mutants, respectively.
Fungal morphology in colonized homozygous mutant plants
was similar for mutant alleles of the same gene and across all
mutant lines, with occasional formation of hyphopodia (Figures
6D to 6L) or groups of twisted hyphae on the root surface (Figures
6D, 6I, 6L, and 6O). The fungus regularly penetrated individual
rhizodermal cells, accompanied by either hyphal branching
(Figures 6E to 6K) or coil formation (Figure 6E). Sometimes
extensive hyphal growth into neighboring rhizodermal cells was
observed, with cells almost entirely filled with deformed fungal
structures (Figure 6M). Rarely, fungal hyphae were observed to
grow through several cells of a file, branching inside cells, as
shown for pollux-1 (Figure 6N).
In summary, the morphological AM phenotypes were very
similar for all mutant lines. The phenotypes of the rice castor,
pollux, ccamk, and cyclops mutants resembled those of legume
mutants (Kistner et al., 2005; Parniske, 2008), thus suggesting
evolutionary conservation of these signaling components across
distant angiosperms.
Molecular Phenotyping of the Rice SYM Pathway Mutants
To account for the irregular distribution of hyphopodial clusters
on symmutants, we performedmolecular quantification of fungal
DNA to precisely estimate the total amount of fungus present in
each sample that could contribute to the elicitation of the host
root. For this purpose, we first confirmed the previously reported
(Isayenkov et al., 2005; Alkan et al., 2006) correlation between
microscopically and molecularly quantified colonization levels
(see Supplemental Figure 5 online). In a time-course experiment,
the kinetics of the relative amounts of fungal DNAmatched those
of the microscopically determined degree of fungal root coloni-
zation (i.e., both Gi ITS1 DNA levels and the amount of fungal
colonization structures were low at 3 wpi, increased slightly at 5
wpi, rose dramatically between 5 and 7 wpi, and were further
enhanced at 9 wpi) (see Supplemental Figure 5 online). In wild-
type and sym mutant rice, molecular determination of coloniza-
tion levels mirrored the microscopic data, with comparably high
amounts of fungal DNA for the wild type (Figures 7A and 7C) and
much lower amounts for the sym mutants (Figures 7B and 7D).
A subset of nine marker genes was selected for real-time
RT-PCR–based molecular phenotyping of rice sym mutants
inoculated with G. intraradices. The castor-1, pollux-1 and
pollux-2, ccamk-1 and ccamk-2, and cyclops-1 and cyclops-2
mutant alleles were analyzed. The selected marker genes reflect
particular expression patterns: four early expressed genes (AM1,
AM2, AM3, and AM11), the systemically expressed genes (AM3
and AM34), and the three highest accumulating, late expressed
genes (AM10, AM14, and AM15). Rice PT11 was used as a
marker for arbusculated cells. To test the suitability of the real-
timeRT-PCR primers for all cultivars used, transcript levels of the
nine marker genes were compared. All nine marker genes were
monitored reliably and at equivalent levels in mycorrhizal roots of
each of the three cultivars (Figure 7E). Expression of the nine
marker genes was determined in mutants (Figure 7F). Transcript
levels were normalized against fungal DNA present in identical
samples to account for possible variation in inoculum strength
(Figures 7G and 7H).
Despite indistinguishable morphological phenotypes of AM
interaction in all four mutants, the expression patterns of marker
genes differed among the mutants (Figures 7G and 7H). The
profile of gene expression was equivalent in castor-1 and the two
pollux alleles, both proteins acting upstream of Ca2+ spiking. The
patterns were different in the two lines mutated inCYCLOPS and
therefore perturbed downstream of the Ca2+ response. Such
profile specificity could not be attributed to differences in fungal
presence (Figures 7B and 7D). Interestingly, while ccamk-1 dis-
played an expression profile identical to those of castor-1 and the
pollux alleles, which is consistent with a loss of Ca2+ response,
ccamk-2 exhibited a pattern equivalent to those of the cyclops
mutants, which is in accordance with a defect in the interaction
with CYCLOPS. Although mutations in CASTOR, POLLUX,
CCAMK, and CYCLOPS blocked colonization of the root cortex,
the two early marker genes, AM1 and AM2, were expressed in all
seven mutants (Figures 7G and 7H). Elicitation of gene activity,
therefore, occurred in the absence of functional common SYM
signaling. Three additional genes were detected in ccamk-2 and
the two cyclops lines: the two systemically induced genes, AM3
and AM34, and the late induced gene, AM14 (Figures 7G and
7H). AM11 was the only one of the four genes induced at early
symbiotic stages not to be expressed in any mutant (Figures 7G
and 7H), indicating a dependence of gene activation on the intact
common SYM signaling pathway. Transcripts of the other late
and nonsystemically induced genes, such as AM10, AM15, and
PT11, were absent in the mutants. Whereas the spatial expres-
sion patterns of AM10, AM11, and AM15 are not known, PT11
expression depends on arbuscule formation. Since arbuscules
were not formed in the mutants, the absence of expression of
late induced genes could be due to either the absence of the
particular symbiotic structures or deficiencies in symbiotic sig-
naling. It would have been informative to determine gene ex-
pression at the cytological level in the mutant background, but
in situ hybridization was not sensitive enough to detect low-level
transcripts in inoculated mutant roots.
The mutant-specific gene expression patterns, such as the
lack of detectable mRNA encoding the early induced geneAM11
in all mutants, together with their deficient symbiotic phenotypes
are consistent with a crucial role of the common SYM pathway in
rice. By contrast, the detection of transcripts of early activated
genes in all mutants suggests the existence of AM signaling
operating independently of the common SYM pathway. Expres-
sion of three additional genes, AM3, AM14, and AM34, required
Ca2+ spiking but was independent of CYCLOPS, suggesting
signaling diverging from the common SYM pathway at the Ca2+
response.
2996 The Plant Cell
Figure 6. AM Phenotypes of Rice sym Mutants.
Trypan blue staining of mutant and wild-type rice roots at 6 wpi with G. intraradices is shown.
(A) to (C) Roots of the three cultivars, Dongjin (A), Hwayoung (B), and Nipponbare (C), show abundant arbuscules and vesicles.
(D) castor-1. The fungus formed a hyphopodium in a groove between two rhizodermal cells. Extraradical hyphae branching off the hyphopodium
showed septa formation.
(E) pollux-1. Arising from a hyphopodium, several penetration pegs entered a rhizodermal cell, but the fungus did not progress into the cortex.
(F) pollux-2. The fungus formed a hyphopodium from which two penetration pegs entered two rhizodermal cells, where hyphae branched and formed
septa.
(G) pollux-3. Fungal hyphae branched inside a rhizodermal cell and formed septa.
(H) ccamk-1. Several fungal hyphae entered a rhizodermal cell, branched, and formed finger-like swellings.
(I) ccamk-2. Penetration pegs from two small hyphopodia entered a rhizodermal cell and branched. Cortex colonization was not observed.
(J) cyclops-1. Penetration pegs starting from a hyphopodium entered into different neighboring rhizodermal cells, branched inside the cells, and formed
septa. The fungus did not colonize the cortex.
(K) cyclops-2. A hypha branched inside a rhizodermal cell, growing back and forward inside the cell and forming septa.
(L) cyclops-3. A hypha formed a swollen hyphopodium and entered a rhizodermal cell, filling it with a large swelling.
(M) castor-1. The fungus occupied several neighboring rhizodermal cells and formed branches and swellings.
(N) pollux-1. A hypha traveled intracellularly through rhizodermal cells, forming branches in the rhizodermis.
(O) cyclops-3. Fungal hyphae formed several swellings on the rhizodermal surface.
A, arbuscule; EH, extraradical hypha; HP, hyphopodium; HS, hyphal swelling; RB, rhizodermal branch (intracellular); RC, rhizodermal coil (intracellular);
RS, rhizodermal hyphal swelling (intracellular); V, vesicle. Arrowheads indicate septa. Bars = 50 mm.
AM-Specific Signaling in Rice 2997
Figure 7. Molecular Phenotypes of sym Mutants.
(A) and (B) Percentage root length colonization of wild-type cultivars Donjin (DJ), Hwayoung (HY), and Nipponbare (N) (A) and common symmutants (B)
by G. intraradices at 6 wpi, determined by the grid-line intersect method. Means 6 SE of five plants represented by two replicate samples are shown.
2998 The Plant Cell
DISCUSSION
Rice is the staple food for half of the global population; in addition
to being an important crop, it is also a powerful model system for
cereals. An improved understanding of the establishment and
functioning of AM symbiosis in rice has the potential to directly
impact management strategies for the optimization of sustain-
able agricultural systems. The goal of this study has been to pave
the way for investigations of AM-specific signaling in rice. In
contrast with previous work, we studied a comprehensive list of
genes specifically activated during AM symbiosis. This specific-
ity was concluded from the absence of their mRNAs in non-
mycorrhizal organs of the plant or in roots invaded by other
beneficial (see Supplemental Figure 2 online) or pathogenic fungi
or in response to varying phosphate regimes (Guimil et al., 2005).
Thus, these genes are an invaluable tool to molecularly dissect
signaling cascades specific to the AM symbiosis.
Temporal expression analysis of rice roots colonized by G.
intraradices distinguished early and late induced genes. Expres-
sion of the previously characterized rice mycorrhiza-specific
phosphate transporter PT11 (Paszkowski et al., 2002) served as
a marker for arbuscule formation, and in situ hybridization
confirmed specific expression in arbusculated cells, consistent
with a role in symbiotic phosphate uptake at the periarbuscular
interface (Harrison et al., 2002; Javot et al., 2007).
Activation of the genes AM1, AM2, AM3, and AM11 prior to
arbuscule development defined markers for early induction and
the existence of a signal acting at initial stages of the interaction
corresponding to presymbiotic recognition, hyphopodia forma-
tion, and early penetration. Transcription of these four genes
remained high at later time points, as a result of systemic root
elicitation, of continuously high but local induction, or of activa-
tion by additional AM-specific signals. Evidence for the existence
of all three signaling alternatives was obtained from split-root
experiments (Figure 3) and in situ hybridization (Figure 4). Ex-
pression of AM3 in both the colonized and noncolonized parts of
a split root indicated systemic induction (Figure 3B). Interest-
ingly, in situ hybridization revealed that mRNA of AM3 accumu-
lated in cells with fully developed arbuscules (Figure 4H). Thus,
activation of this gene is possibly regulated by two distinct
signaling pathways, the first operating systemically and the
second operating arbuscule-specifically. Although it was to be
expected that systemic induction would lead to hybridization
signals in nonarbusculated cells, systemic expression might
correspond to the relatively low amounts of mRNA per cell that
are undetectable by in situ hybridization but, when induced in
most cells of the root, are detectable by real-time RT-PCR.
Further support for a dual induction of AM3 is provided by
expression values during split-root experiments. Consistent with
the additive expression of systemic and arbuscule-associated
induction, mRNA levels in mycorrhizal roots were higher than
those in nonmycorrhizal roots, corresponding to only systemic
values (Figure 3B). Interestingly, AM3 encodes a small secreted
protein of only 98 amino acids containing a Lys motif (LysM)
domain. LysM domains are known to bindN-acetylglucosamine,
which is a component of rhizobial Nod factors, as well as of the
fungal cell wall constituent chitin (reviewed in Buist et al., 2008).
Intriguingly, legume receptor-like kinases that mediate percep-
tion of the bacterial Nod factors contain LysM domains that
physically interact with Nod factors (Radutoiu et al., 2007;
reviewed in Buist et al., 2008).
None of the other early induced genes exhibited systemic
induction, but AM1 was found to have a distinct spatial expres-
sion pattern. AM1 was expressed most strongly in cells neigh-
boring intercellularly growing hyphae and in cells containing
small arbuscules (Figure 4D) but was not detected in cells
hosting fully developed arbuscules (Figure 4E). Arbuscules
have a lifespan of only 4 to 10 d (reviewed in Hause and Fester,
2005), with different developmental stages simultaneously pres-
ent in each root system. Although microscopic resolution of the
in situ hybridization did not distinguish between developing
and collapsing arbuscules, the early induction of AM1 argues
for arbuscule formation rather than senescence. AM1 encodes
the putative type III peroxidase PRX53 (Passardi et al., 2004),
a secreted protein potentially involved in either the production
or the scavenging of reactive oxygen species. Hydrogen perox-
ide has been associated with mycorrhizal structures (Salzer
et al., 1999; Fester and Hause, 2005), but as AM fungi them-
selves produce hydrogen peroxide (Lanfranco et al., 2005),
these results are difficult to interpret. Interestingly, peroxidase-
generated hydroxyl radicals are involved in plant cell growth
by nonenzymatic loosening of the cell wall (Liszkay et al.,
2003, 2004).
The remaining 14 genes exhibited the second major expres-
sion pattern, typified by the absence ofmRNAat early time points
but having elevated transcript levels at later time points. The
presence of PT11 within this group suggests that some genes
followed arbuscule-specific induction and thus might be in-
volved in arbuscule development and/or function. LPC was
applied exogenously to determine which of the late induced
genes are activated in parallel to PT11 and thus are related to the
Figure 7. (continued).
(C) and (D) Real-time RT-PCR–based measurement of G. intraradices ITS DNA relative to rice CYCLOPHILIN2 DNA in G. intraradices–inoculated (Gi)
and mock-inoculated (M) wild-type roots of the three wild-type rice cultivars (C) and the common sym mutants (D) at 6 wpi.
(E) and (F) Quantitative PCR-based expression analysis of nine marker genes relative to expression of the constitutive rice CYCLOPHILIN2 gene in the
three mock-inoculated and G. intraradices–inoculated wild-type cultivars (E) and the common sym mutants (F). RNA for expression analysis was
extracted from the same root samples used for the experiments shown in (C) and (D).
(G) and (H) Expression of nine marker genes inG. intraradices–inoculated wild-type cultivars (G) and common symmutants (H) relative toG. intraradices
ITS DNA level (shown in [C] and [D] above).
All experiment were repeated at least twice with similar results. For all real-time RT-PCR experiments, mean values of three technical replicates are
displayed. Error bars indicate SD.
AM-Specific Signaling in Rice 2999
same signaling pathway. LPC did not induce PT11 (see Supple-
mental Figure 3 online), which may be due to technical short-
comings or to the absence of this signaling pathway in rice.
However, alternative expression patterns associated, for exam-
ple, with progressive cortex colonization or late systemically
activated genes may also be a feature of this group of genes.
Indeed, 1 of the 14 genes, AM34, was expressed in both halves
of the split-root system, suggesting systemic induction (Figure
3B). In contrast with the early and systemically induced AM3, the
relative expression of AM34 was similar in the colonized and
noncolonized parts of the root system, reflecting a single signal
governing the late systemic transcription ofAM34. The low levels
of AM34 mRNA did not permit in situ hybridization. This gene is
predicted to encode a UDP-glycosyltransferase, a class of
enzymes that catalyze the transfer of glucosemoieties to diverse
substrates, including plant hormones, secondary metabolites,
and xenobiotics, for their inactivation (Lim and Bowles, 2004). In
transcript-profiling experiments, various glucosyltransferases
were upregulated upon mycorrhizal colonization (Liu et al.,
2003, 2007; Manthey et al., 2004; Hohnjec et al., 2005; Deguchi
et al., 2007), consistent with the increased production of glyco-
sylated secondary metabolites in mycorrhizal roots (Schliemann
et al., 2008).
The 18 selected genes proved robust as a universal marker set
for AM symbioses in rice, since levels of their AM-induced
transcripts were comparable during interaction with the phylo-
genetically distant AM fungus Gi. rosea. This is particularly
striking considering that the intracellular infection structures of
Gi. rosea are rather coarse and simple arbusculated coils,
compared with the highly ramified, finely branched arbuscules
of G. intraradices. Moreover, the two fungi vary in symbiotic
functions, since some plant species benefit considerably more
from an association with G. intraradices than with Gi. rosea
(Burleigh et al., 2002; Smith et al., 2003, 2004). Notably, a core
set of plant genes was also found in M. truncatula to exhibit
related expression patterns during interactions with three dis-
tantly related AM fungi (Liu et al., 2007). Thus, AM signaling
routes appear to be common to different AM symbioses despite
morphological and nutritional differences.
AM-specific signaling might in part occur dependently or
independently of the unspecific commonSYMsignaling pathway
discovered in legumes. We analyzed a set of rice mutants
affected in genes coding for putative orthologs of legume pro-
teins representing components of the common SYM pathway
upstream and downstream of the Ca2+ response. Inability of the
mutants to establish mycorrhizal symbiosis demonstrated func-
tional conservation of the encoded proteins and of the SYM
signaling cascade across distant plant species. This finding is
supported by previous reports that two individual proteins,
CCAMK and IPD3 (CYCLOPS), are required for AM symbiosis
in rice (Chen et al., 2007, 2008). Functional conservation of
symbiotic signaling factors among dicotyledons and monocot-
yledons is consistent with an evolutionary origin of AM symbiosis
predating the divergence of the two main angiosperm classes.
This evolutionary conservation possibly also extends beyond the
angiosperms, but this remains to be demonstrated. Although our
rice mutant selection did not include putative orthologs of all
currently known legume SYM genes, it is likely that the complete
signaling pathway is conserved. This view is supported by the
recent observation that rice SYMRK restores AM colonization in
the L. japonicus symrk mutant (Markmann et al., 2008).
Confirmation of the relevance of the common SYM pathway
for AM development in rice led us to investigate the possibility of
signaling routes operating independently of the known pathway.
The similarly strong morphological and quantitative phenotypes
of the rice common sym mutants (Figure 6) allowed for their
dissection at the molecular level and the search for signaling
routes in addition to the commonSYMpathway in the absence of
secondary effects perturbing the comparison. Nine markers
corresponding to discrete signaling events reflected by their
different spatial and temporal expression patterns were selected
for molecular phenotyping. The absence of AM11 mRNA places
the activation of this gene downstream of the common SYM
pathway (Figure 8). Also, for the late markers AM10, AM15, and
OsPT11, no transcript was detected in any of themutants (Figure
8). However, PT11 expression was strictly dependent on arbus-
cule formation, consistent with its absence in themutants (Figure
8). The determination of whether induction of the two late genes
AM10 and AM15 depends on arbuscules or intact common SYM
proteins awaits spatial expression analysis. The activation of two
early genes, AM1 and AM2, in all mutants and three additional
genes, the early systemic AM3, the late systemic AM34, and the
late inducedAM14, in a subset of mutants indicated an induction
independent of cortex colonization and arbuscule formation.
While this was expected for the early systemic marker AM3, it
Figure 8. AM-Specific Signaling Pathways Including Bifurcation at the
Ca2+ Response.
The common SYM pathway displaying the components analyzed within
this study consists of CASTOR and POLLUX upstream and CCAMK and
CYCLOPS downstream of Ca2+ spiking. Expression of AM11 is induced
early and relies on an intact SYM pathway. Induction of systemically (S;
gray arrows) induced genes, AM3 and AM34, and the late (L; black
arrows) induced gene, AM14, relies on an intact Ca2+ response and thus
requires CASTOR, POLLUX, and CCAMK but is independent of CY-
CLOPS. Expression of PT11 is dependent on arbuscule formation. The
dependence of AM10 and AM15 on SYM pathway signaling or on
arbuscule formation is not known (dashed arrows with question marks).
AM1 and AM2 are induced early but do not require functional CASTOR,
POLLUX, CCAMK, or CYCLOPS, demonstrating the existence of an
alternative AM signaling pathway (AP).
3000 The Plant Cell
suggested that late systemic induction of AM34 in wild-type
roots, as well as late activation of AM14, does not require fungal
penetration of the cortex. Interestingly, the seven mutants
displayed two classes of expression patterns. The first pattern
is defined by the expression of two of the four early genes, AM1
and AM2, in all alleles of the four mutants, suggesting that their
induction is independent of the common SYM pathway, but
triggered by alternative signaling acting in parallel, either during
presymbiotic recognition or hyphopodium formation, or both
(Figure 8). The second pattern is characterized by the induction
of three further genes, AM3, AM14, and AM34, reliant on a
functional Ca2+ response but independent of CYCLOPS, thus
suggesting deviation from the common SYM pathway down-
stream of Ca2+ spiking (Figure 8). Intriguingly, the expression
pattern of the two mutant alleles of CCAMK differed, with
ccamk-1 showing a similar pattern to that of the castor and
polluxmutants and ccamk-2 having a pattern similar to that of the
cyclops mutants (Figures 7F and 7H). The expression pattern of
ccamk-1 can plausibly be explained by the lack of functional
perception of Ca2+ oscillations, which phenocopies the absence
of Ca2+ spiking. This is consistent with the transcriptional allele
characterization that predicts CCAMK function to be compro-
mised due to Tos17 insertion between the calmodulin binding
domain and the three EF hands. By contrast, the transcription
profile of ccamk-2 can be interpreted in different ways. In the first
scenario, low amounts of wild-type transcript might still be
produced for the induction of a subset of marker genes but
might not be sufficient to restore symbiosis. Alternatively, since
the ccamk-2 allele is predicted to encode a CCAMK derivative
mutated within the kinase domain (Chen et al., 2007), expression
of AM3, AM14, and AM34 appears reliant on CCAMK but might
be independent of its kinase function. A recent publication
reported that CCAMK phosphorylates CYCLOPS (Parniske,
2008). It is tempting, therefore, to speculate that the mutation
in the kinase domain affected CYCLOPS phosphorylation in
ccamk-2. The expression profile of the ccamk-2 mutant is
consistent with this interpretation, as it mimicked that of the
three cyclops mutants. Further experimental evidence is re-
quired to confirm the lack of kinase activity and thus CYCLOPS
phosphorylation in ccamk-2. In summary, the transcription
of AM3, AM14, and AM34 depended on functional CASTOR,
POLLUX, and CCAMK but not on CYCLOPS, thus indicating
the presence of novel AM-specific signaling components that
mediate the induction of the three marker genes downstream of
the Ca2+ response (Figure 8).
We conclude that AM-specific signaling in rice involves a
complex network, including the evolutionarily conserved, and
currently best defined, common SYM pathway. However, our
results also suggest alternative signaling routes that either de-
viate from, or are independent of, the common SYM pathway.
METHODS
Plant Material
Rice (Oryza sativa cv Nipponbare) was used for the characterization of
rice marker genes. Rice lines carrying T-DNA insertions in CASTOR and
POLLUX (lines 1B-08643 and 1C-03411, respectively) arose in the
japonica cultivars Dongjin and Hwayoung, respectively (Jeong et al.,
2002, 2006). In the Nipponbare background, Tos17 (Miyao et al., 2003)
insertions were identified in POLLUX (lines NC6423 and ND5050 for
pollux-2 and pollux-3, respectively), inCCAMK (lines NE1115 for ccamk-1
and NF8513 for ccamk-2 [Chen et al., 2007], respectively), and in
CYCLOPS (IPD3) (lines NG0782, NC2415, and NC2713 for cyclops-1,
cyclops-2, and cyclops-3, respectively). Segregating T1 individuals were
used from each line in this study. T1 corresponds to progeny from the
self-pollinated hemizygous or heterozygous primary T0 transformants
(T-DNA–induced alleles) or regenerants (Tos17-induced alleles), respec-
tively.
Plant Growth and Inoculation Conditions
Plants were grown in a phytochamber with a 12-h/12-h day/night cycle at
28/228C and 60% humidity. They were watered every 2nd d for the first
2 wpi and thereafter fertilized every 2nd d with a mix of 0.005% (w/v)
Hauert-Flory Typ A (Hauert) and 0.01% (w/v) Sequestren Rapid (Syngenta).
These growth conditions were shown previously to maintain efficient and
equal colonization.
Inoculation by AM Fungi
Rice seeds were surface-sterilized twice with 3.5% sodium hypochloride
solution for 15 min, washed extensively with sterile water, and pregermi-
nated in sterile water for 5 d at 258C in the dark. Germlings were
transplanted into washed and autoclaved quartz sand and inoculated
upon planting with ;1000 Glomus intraradices spores per plant from a
commercially available inoculum (Biorize). Plants were harvested at 6 wpi
or as indicated in the text. For time-course experiments, a low titer (100
spores per plant) of aseptically grown G. intraradices (Becard and Fortin,
1988) was used. Gigaspora rosea BEG9 inoculum was obtained from
Biorize. Gi. rosea spores were collected with forceps and immersed in
water, and 100 spores per plant were injected into the vicinity of the
seedling root with a Pasteur pipette. Mock-inoculated plants received
fungal growth medium or water.
Inoculation by Piriformospora indica
Cultures of P. indica were kindly provided by Phillip Franken (Institute for
Ornamental and Vegetable Crops), and rice plants were inoculated
according to Waller et al. (2005). P. indica–inoculated plants were
harvested at 5 wpi.
Split-Root Experiment
Plants were pregerminated for 2 weeks on 0.4% water agar until the
crown roots had reached a length of;10 cm. The rootswere then divided
into two pots, one of which was inoculated with G. intraradices and the
other mock-inoculated. At 6 wpi, the inoculated and noninoculated parts
of the root system were harvested separately.
Root Staining and Mycorrhizal Quantification
Roots were stained with trypan blue and mycorrhizal colonization was
quantified with a modified grid-line intersect procedure as described
previously (Paszkowski et al., 2006). Images were prepared with a Leica
DM 5000 B microscope equipped with a Leica DFC420 camera. Briefly,
total root length colonization, determined by the total amount of fungus
and by the presence of specific structures, was scoredmicroscopically at
100 random points per root sample. For reliable representation of root
length colonization by specific mycorrhizal structures, all structures
present at one random point were recorded separately.
AM-Specific Signaling in Rice 3001
LPC Infiltration of Rice Roots
Plants were germinated for 10 d on 0.4% water agar. Roots were then
infiltrated with LPC as described by Drissner et al. (2007) with minor
modifications: roots were separated from shoots and immersed in 100
mMLPC (stock, 100mM in methanol) in 10mM sodium phosphate buffer,
pH 6. The same buffer with equal amounts of methanol served as a
control. Roots were infiltrated three times for 2min followed by incubation
in nutrient solution (0.005% [w/v] Hauert-Flory Typ A and 0.01% [w/v]
Sequestren Rapid) for 3 h at 308C. Roots were then shock-frozen in liquid
nitrogen.
Identification of Homozygous Mutant Lines
DNA was extracted following Berendzen et al. (2005). Genotyping of
segregating seedling populations was performed by PCR. Wild-type and
mutated loci were distinguished by the use of specific primer pairs:
combining an insertion-specific primer with a gene-specific primer iden-
tified the mutant allele, while two gene-specific primers spanning the
insertion amplified the wild-type allele (see Supplemental Table 4 online).
The amplicon diagnostic of the mutant allele was subsequently se-
quenced following standard protocols.
RNA Extraction, cDNA Synthesis, RT-PCR, and Real-Time RT-PCR
RNA was extracted from 100 mg of ground root tissue using the
NucleoSpin Plant RNA extraction kit according to the manufacturer’s
instructions (Macherey-Nagel). cDNA synthesis and real-time RT-PCR
were performed as described earlier (Guimil et al., 2005). Primer se-
quences for real-time RT-PCRwere adopted fromGuimil et al. (2005) (see
Supplemental Table 5 online). The absence of contaminating genomic
DNA was confirmed by performing a control PCR on RNA not reverse-
transcribed (2RT). PCR amplification efficiencies were calculated with
the program LinRegPCR (Ramakers et al., 2003). Expression values were
calculated according to Guimil et al. (2005) and normalized to the
geometric mean of amplification of four nearly constitutively expressed
genes: ACTIN1 (The Institute for Genomic Research [TIGR] identifier,
LOC_Os03g50890),CYCLOPHILIN2 (TIGR identifier, LOC_Os02g02890),
GAPDH (TIGR identifier, LOC_Os08g03290), and POLYUBIQUITIN (TIGR
identifier, LOC_Os06g46770). Normalized expression values were dis-
played as a function of CYCLOPHILIN2 expression.
Fungal colonization was quantified by real-time RT-PCR according to
Isayenkov et al. (2004). Fungal DNA was extracted from the root homog-
enate used for RNA extraction employing the DNeasy Plant DNA extrac-
tion kit (Qiagen). Primer sequences to quantify G. intraradices were
retrieved from Alkan et al. (2006) (see Supplemental Table 5 online). RT-
PCR was performed according to standard PCR protocols using 35 PCR
cycles and the indicated primers (see Supplemental Table 6 online). The
rice CYCLOPHILIN2 transcript served as an internal constitutive control,
and genomic DNA served as a technical control for amplification.
Amplicons were visualized on a 1% agarose gel.
In Situ Hybridization
To generate probes for in situ hybridization, the primer pairs indicated
(see Supplemental Table 4 online) were used to amplify a stretch of;200
bp corresponding to gene-specific regions of PT11, AM1, and AM3. The
amplicons were sequenced and cloned in the sense and antisense
orientations into the pGEM-T Easy vector (Promega) with respect to the
T7 promoter. Digoxigenin-labeled RNA probes were synthesized from
linearized plasmids with T7 RNA polymerase (Promega) as described
(Langdale, 1993).
Root segments of;1 cm in length were fixed in 4% paraformaldehyde
in PBS overnight at 48C. The tissue was then dehydrated in a graded
ethanol series and subsequently in Rotihistol (Roth) in successive steps of
60-min duration. Finally, root pieces were embedded in Paraplast extra
(Kendall), sectioned to 8-mm thickness on a rotary microtome (Leitz), and
mounted on Superfrost Plus (Menzel) slides.
In situ hybridization was performed as described (Langdale, 1993) with
a modified washing buffer referred to as 0.23 SSC (13 SSC is 0.15 M
NaCl and 0.015 M sodium citrate). Alkaline phosphatase activity
was detected with Western Blue (Promega) supplemented with 1 mM
Levamisole (Sigma-Aldrich).
Accession Numbers
Sequence data from this article can be found in theOryza sativaGenome
Initiative (TIGR; http://rice.plantbiology.msu.edu/) database with the
following accession numbers: Os07g38070 (SYMRK), Os03g62650
(CASTOR), Os01g64980 (POLLUX), Os01g54240 (NUP85), Os03g12450
(NUP133), Os05g41090 (CCAMK), Os06g02520 (CYCLOPS),
Os01g46860 (PT11), Os04g04750 (AM1), Os08g34249 (AM2),
Os01g57400 (AM3), Os05g22300 (AM10), Os06g20120 (AM11),
Os11g26140 (Os AM14), Os01g57390 (Os AM15), Os03g40080 (AM18),
Os04g21160 (AM20), Os02g03190 (AM24), Os06g35930 (AM25),
Os12g30300 (AM26), Os06g34470 (AM29), Os02g03150 (AM31),
Os10g18510 (AM34), Os04g13090 (AM39), Os03g38600 (AM42).
Supplemental Data
The following materials are available in the online version of this article.
Supplemental Figure 1. Colonization of Rice Roots by P. indica.
Supplemental Figure 2. Expression Analysis of Marker Genes.
Supplemental Figure 3. Absence of PT11 Induction upon LPC
Treatment of Rice Roots.
Supplemental Figure 4. Expression of Rice Common SYM Genes.
Supplemental Figure 5. Quantification of AM Colonization by Mi-
croscopy and Real-Time RT-PCR.
Supplemental Table 1. Putative Functions of Proteins Encoded by
Genes Exclusively Expressed in Mycorrhizal Roots.
Supplemental Table 2. Insertion Lines of Rice Common SYM Genes
and Their Mycorrhizal Phenotypes.
Supplemental Table 3. Primers Used for SYM Transcript Analysis in
sym Mutants.
Supplemental Table 4. Primers Used for Genotyping of Rice Inser-
tion Lines.
Supplemental Table 5. Primers Used for Quantification of Fungal
DNA and Gene Expression by Real-Time RT-PCR.
Supplemental Table 6. Primers Used for Detection of Rice Gene
Expression by RT-PCR.
ACKNOWLEDGMENTS
We thank Patrick King and Ruairidh Sawers for editing the manuscript
and also Jerzy Paszkowski for valuable comments on the manuscript.
We are grateful to Manuel Bueno for his assistance with real-time RT-
PCR, Jaqueline Gheyselinck and Roman Zimmermann for advice on in
situ hybridization, Ivan Felipe Acosta for assistance with computational
programs, and Marcel Bucher for help with LPC infiltration. We thank
Phillip Franken for providing P. indica inoculum and Martin Parniske for
sharing unpublished information on CYCLOPS. This study was supported
by Swiss National Foundation Grant 3100AD-104132, by a National
3002 The Plant Cell
Centres of Competence in Research grant (Plant Survival), by a Ph.D.
scholarship of the German Academic Merit Foundation to C.G., and by
Swiss National Foundation Professeur Boursier Grant PP00A–110874 to
U.P. H.I.-A. was supported by the Ministry of Agriculture, Forestry, and
Fisheries of Japan (Rice Genome Project Grant PMI-0001), and G.A.
was partly supported by the Biogreen 21 Program (Grant 20070401-
034-001) of the Rural Development Administration, Korea.
Received August 5, 2008; revised November 4, 2008; accepted Novem-
ber 11, 2008; published November 25, 2008.
REFERENCES
Alkan, N., Gadkar, V., Yarden, O., and Kapulnik, Y. (2006). Analysis of
quantitative interactions between two species of arbuscular mycor-
rhizal fungi, Glomus mossae and G. intraradices, by real-time PCR.
Appl. Environ. Microbiol. 72: 4192–4199.
Ane, J.-M., et al. (2004). Medicago truncatula DMI1 required for
bacterial and fungal symbioses in legumes. Science 303: 1364–1367.
Bari, R., Datt Pant, B., Stitt, M., and Scheible, W.R. (2006). PHO2,
microRNA399, and PHR1 define a phosphate-signaling pathway in
plants. Plant Physiol. 141: 988–999.
Becard, G., and Fortin, J. (1988). Early events of vesicular-arbuscular
mycorrhiza formation on Ri T-DNA transformed roots. New Phytol.
108: 211–218.
Berendzen, K., Searle, I., Ravenscroft, D., Koncz, R., Batschauer, A.,
Coupland, G., Somsich, I., and Ulker, B. (2005). A rapid and versatile
combined DNA/RNA extraction protocol and its application to the
analysis of a novel DNA marker set polymorphic between Arabidopsis
thaliana ecotypes Col-0 and Landsberg erecta. Plant Methods 1: 4.
Buist, G., Steen, A., Kok, J., and Kuipers, O.P. (2008). LysM, a widely
distributed protein motif for binding to (peptido)glycans. Mol. Micro-
biol. 68: 838–847.
Burleigh, S.H., Cavagnaro, T., and Jakobsen, I. (2002). Functional
diversity of arbuscular mycorrhizas extends to the expression of plant
genes involved in P nutrition. J. Exp. Bot. 53: 1593–1601.
Chabaud, M., Venard, C., Defaux-Petras, A., Becard, G., and Barker,
D. (2002). Targeted inoculation of Medicago truncatula in vitro root
cultures reveals MtENOD11 expression during early stages of infec-
tion by arbuscular mycorrhizal fungi. New Phytol. 156: 265–273.
Chen, C., Ane, J.M., and Zhu, H. (2008). OsIPD3, an ortholog of the
Medicago truncatula DMI3 interacting protein IPD3, is required for
mycorrhizal symbiosis in rice. New Phytol. 180: 311–315.
Chen, C., Gao, M., Liu, J., and Zhu, H. (2007). Fungal symbiosis in rice
requires an ortholog of a legume common symbiosis gene encoding a
Ca+/calmodulin-dependent protein kinase. Plant Physiol. 145: 1619–
1628.
Deguchi, Y., et al. (2007). Transcriptome profiling of Lotus japonicus
roots during arbuscular mycorrhiza development and comparison
with that of nodulation. DNA Res. 14: 117–133.
Drissner, D., Kunze, G., Callewaert, N., Gehrig, P., Tamasloukht,
M.B., Boller, T., Felix, G., Amrhein, N., and Bucher, M. (2007). Lyso-
phosphatidylcholine is a signal in the arbuscular mycorrhizal symbi-
osis. Science 318: 265–268.
Endre, G., Kereszt, A., Kevei, Z., Mihacea, S., Kalo, P., and Kiss, G.B.
(2002). A receptor kinase gene regulating symbiotic nodule develop-
ment. Nature 417: 962–966.
Fester, T., and Hause, B. (2005). Accumulation of reactive oxygen
species in arbuscular mycorrhizal roots. Mycorrhiza 15: 373–379.
Glazebrook, J., Chen, W., Estes, B., Chang, H.-S., Nawrath, C.,
Metraux, J.-P., Zhu, T., and Katagiri, F. (2003). Topology of the
network integrating salicylate and jasmonate signal transduction
derived from global expression phenotyping. Plant J. 34: 217–228.
Gleason, C., Chaudhuri, S., Yang, T., Munoz, A., Poovaia, B., and
Oldroyd, G. (2006). Nodulation independent of rhizobia induced by a
calcium-activated kinase lacking autoinhibition. Nature 441: 1149–1152.
Godfroy, O., Debelle, F., Timmer, T., and Rosenberg, C. (2006). A rice
calcium-calmodulin dependent kinase restores nodulation to a le-
gume mutant. Mol. Plant Microbe Interact. 19: 495–501.
Guimil, S., Chang, H., Zhu, T., Sesma, A., Osbourn, A., Roux, C.,
Ioannidis, V., Oakely, E.J., Docquier, M., Descombes, P., Briggs,
S.P., and Paszkowski, U. (2005). Comparative transcriptomics of rice
reveals an ancient pattern of response to microbial colonization. Proc.
Natl. Acad. Sci. USA 102: 8066–8070.
Harrison, M. (2005). Signaling in the mycorrhizal symbiosis. Annu. Rev.
Microbiol. 59: 19–42.
Harrison, M., Dewbre, G., and Liu, J. (2002). A phosphate transporter
of Medicago truncatula involved in the acquisition of phosphate
released by arbuscular mycorrhizal fungi. Plant Cell 14: 2413–2429.
Hause, B., and Fester, T. (2005). Molecular and cell biology of
arbuscular mycorrhizal symbiosis. Planta 221: 184–196.
Hirochika, H., Guiderdoni, E., An, G., Hsing, Y., Eun, M., Han,
C., Upadhyaya, N., Ramachandran, S., Zhang, Q., Pereira, A.,
Sundaresan, V., and Leung, H. (2004). Rice mutant resources for
gene discovery. Plant Mol. Biol. Rep. 54: 325–334.
Hochholdinger, F., and Zimmermann, R. (2008). Conserved and
diverse mechanisms in root development. Curr. Opin. Plant Biol. 11:
70–74.
Hohnjec, N., Vieweg, M., Puhler, A., Becker, A., and Kuster, H.
(2005). Overlaps in the transcriptional profiles of Medicago truncatula
roots inoculated with two different Glomus fungi provide insights in
the genetic program activated during arbuscular mycorrhiza. Plant
Physiol. 137: 1283–1301.
Imaizumi-Anraku, H., et al. (2005). Plastid proteins crucial for symbi-
otic fungal and bacterial entry into plant roots. Nature 433: 527–531.
Isayenkov, S., Fester, T., and Hause, B. (2004). Rapid determination of
fungal colonization and arbuscule formation in roots of Medicago
truncatula using real-time (RT) PCR. J. Plant Physiol. 161: 1379–1383.
Isayenkov, S., Mrosk, C., Stenzel, I., Strack, D., and Hause, B. (2005).
Suppression of allene oxide cyclase in hairy roots of Medicago
truncatula reduces jasmonate levels and the degree of mycorrhization
with Glomus intraradices. Plant Physiol. 139: 1401–1410.
Javot, H., Varma Penmetsa, R., Terzaghi, N., Cook, D.R., and
Harrison, M.J. (2007). A Medicago truncatula phosphate transporter
indispensable for the arbuscular mycorrhizal symbiosis. Proc. Natl.
Acad. Sci. USA 104: 1720–1725.
Jeong, D., An, S., Kang, H., Moon, S., Han, J., Park, S., Lee, H., An,
K., and An, G. (2002). T-DNA insertional mutagenesis for activation
tagging in rice. Plant Physiol. 130: 1636–1644.
Jeong, D.H., et al. (2006). Generation of a flanking sequence-tag
database for activation-tagging lines in japonica rice. Plant J. 45:
123–132.
Kanamori, N., et al. (2006). A nucleoporin is required for induction of
Ca2+ spiking in legume nodule development and essential for rhizobial
and fungal symbiosis. Proc. Natl. Acad. Sci. USA 103: 359–364.
Kistner, C., Winzer, T., Pitzschke, A., Mulder, L., Sato, S., Kaneko,
T., Tabata, S., Sandal, N., Stougaard, J., Webb, K.J., Szczyglowski,
K., and Parniske, M. (2005). Seven Lotus japonicus genes required for
transcriptional reprogramming of the root during fungal and bacterial
symbiosis. Plant Cell 17: 2217–2229.
Kosuta, S., Chabaud, M., Lougnon, G., Gough, C., Denarie, J.,
Barker, D., and Becard, G. (2003). A diffusible factor from arbuscular
mycorrhizal fungi induces symbiosis-specific MtENOD11 expression
in roots of Medicago truncatula. Plant Physiol. 131: 952–962.
AM-Specific Signaling in Rice 3003
Kosuta, S., Hazledine, S., Sun, J., Miwa, H., Morris, R.J., Downie,
J.A., and Oldroyd, G.E. (2008). Differential and chaotic calcium
signatures in the symbiosis signaling pathway of legumes. Proc.
Natl. Acad. Sci. USA 105: 9823–9828.
Krajinski, F., and Frenzel, A. (2007). Towards the elucidation of AM-
specific transcription inMedicago truncatula. Phytochemistry 68: 75–81.
Lanfranco, L., Novero, M., and Bonfante, P. (2005). The mycorrhizal
fungus Gigaspora margarita possesses a CuZn superoxide dismutase
that is up-regulated during symbiosis with legume hosts. Plant
Physiol. 137: 1319–1330.
Langdale, J. (1993). In situ hybridization. In The Maize Handbook, M.
Freeling and V. Walbot, eds (Berlin: Springer Verlag), pp. 165–180.
Levy, J., et al. (2004). A putative Ca2+ and calmodulin-dependent
protein kinase required for bacterial and fungal symbioses. Science
303: 1361–1364.
Lim, E.K., and Bowles, D.J. (2004). A class of plant glycosyltransfer-
ases involved in cellular homeostasis. EMBO J. 23: 2915–2922.
Liszkay, A., Kenk, B., and Schopfer, P. (2003). Evidence for the
involvement of cell wall peroxidase in the generation of hydroxyl
radicals mediating extension growth. Planta 217: 658–667.
Liszkay, A., van der Zalm, E., and Schopfer, P. (2004). Production of
reactive oxygen intermediates (O2.2, H2O2 and OH) by maize roots
and their role in wall loosening and elongation growth. Plant Physiol.
136: 3114–3123.
Liu, J., Blaylock, L., Endre, G., Cho, J., Town, C.D., VandenBosch, K.
A., and Harrison, M.J. (2003). Transcript profiling coupled with
spatial expression analysis reveals genes involved in distinct devel-
opmental stages of the arbuscular mycorrhizal symbiosis. Plant Cell
15: 2106–2123.
Liu, J., Maldonado-Mendoza, I., Lopez-Meyer, M., Cheung, F., Town,
C.D., and Harrison, M.J. (2007). Arbuscular mycorrhizal symbiosis is
accompanied by local and systemic alterations in gene expression and
an increase in disease resistance in the shoots. Plant J. 50: 529–544.
Manthey, K., Krajinski, F., Hohnjec, N., Firnhaber, C., Puhler, A.,
Perlick, A.M., and Kuster, H. (2004). Transcriptome profiling in root
nodules and arbuscular mycorrhiza identifies a collection of novel
genes induced during Medicago truncatula root endosymbioses. Mol.
Plant Microbe Interact. 17: 1063–1077.
Markmann, K., Giczey, G., and Parniske, M. (2008). Functional adap-
tation of a plant receptor-kinase paved the way for the evolution of
intracellular root symbioses with bacteria. PLoS Biol. 6: e68.
Massoumou, M., van Tuinen, D., Chatagnier, O., Arnould, C.,
Brechenmacher, L., Sanchez, L., Selim, S., Gianinazzi, S., and
Gianinazzi-Pearson, V. (2007). Medicago truncatula gene responses
specific to arbuscular mycorrhiza interactions with different species and
genera of Glomeromycota. Mycorrhiza 17: 223–234.
Messinese, E., Mun, J., Yeun, L., Jayaraman, D., Rouge, P., Barre,
A., Lougnon, G., Schornack, S., Bono, J., Cook, D., and Ane, J.
(2007). A novel nuclear protein interacts with the symbiotic DMI3
calcium and calmodulin dependent protein kinase of Medicago
truncatula. Mol. Plant Microbe Interact. 20: 912–921.
Mitra, R.M., Gleason, C.A., Edwards, A., Hadfield, J., Downie, J.A.,
Oldroyd, G.E.D., and Long, S.R. (2004). From the cover. A Ca2+/
calmodulin-dependent protein kinase required for symbiotic nodule
development: Gene identification by transcript-based cloning. Proc.
Natl. Acad. Sci. USA 101: 4701–4705.
Miyao, A., Tanaka, K., Murata, K., Sawaki, H., Takeda, S., Abe, K.,
Shinozuka, Y., Onosato, K., and Hirochika, H. (2003). Target site
specificity of the Tos17 retrotransposon shows a preference for
insertion within genes and against insertion in retrotransposon-rich
regions of the genome. Plant Cell 15: 1771–1780.
Nagy, R., Karandashov, V., Chague, V., Kalinkevich, K.,
Tamasloukht, M., Xu, G., Jakobsen, I., Levy, A.A., Amrhein, N.,
and Bucher, M. (2005). The characterization of novel mycorrhiza-
specific phosphate transporters from Lycopersicon esculentum and
Solanum tuberosum uncovers functional redundancy in symbiotic
phosphate transport in solanaceous species. Plant J. 42: 236–250.
Parniske, M. (2008). Arbuscular mycorrhiza: The mother of plant root
endosymbioses. Nat. Rev. Microbiol. 6: 763–775.
Passardi, F., Longet, D., Penel, C., and Dunand, C. (2004). The class
III peroxidase multigenic family in rice and its evolution in land plants.
Phytochemistry 65: 1879–1893.
Paszkowski, U. (2006). A journey through signalling in arbuscular
mycorrhizal symbioses 2006. New Phytol. 172: 35–46.
Paszkowski, U., Jakovleva, L., and Boller, T. (2006). Maize mutants
affected at distinct stages of the arbuscular mycorrhizal symbiosis.
Plant J. 47: 165–173.
Paszkowski, U., Kroken, S., Roux, C., and Briggs, S. (2002). Rice
phosphate transporters include an evolutionarily divergent gene spe-
cifically activated in arbuscular mycorrhizal symbiosis. Proc. Natl.
Acad. Sci. USA 99: 13324–13329.
Radutoiu, S., Madsen, L.H., Madsen, E., Jurkiewicz, A., Fukai, E.,
Quistgaard, E.M.H., Albrektsen, A., James, E.K., Thirup, S., and
Stougaard, J. (2007). LysM domains mediate lipochitin-oligosaccharide
recognition and Nfr genes extend the symbiotic host range. EMBO J.
26: 3923–3935.
Ramakers, C., Ruijter, J., Lekanne Deprez, R., and Moorman, A.
(2003). Assumption-free analysis of quantitative real-time polymerase
chain reaction (PCR) data. Neurosci. Lett. 339: 62–66.
Saito, K., et al. (2007). NUCLEOPORIN85 is required for calcium
spiking, fungal and bacterial symbiosis and seed production in Lotus
japonicus. Plant Cell 19: 610–624.
Salzer, P., Corbiere, H., and Boller, T. (1999). Hydrogen peroxide
accumulation in Medicago truncatula roots colonized by the arbus-
cular mycorrhiza-forming fungus Glomus intraradices. Planta 208:
319–325.
Sato, M., Mitra, R.M., Coller, J., Wang, D., Spivey, N.W., Dewdney,
J., Denoux, C., Glazebrook, J., and Katagiri, F. (2007). A high-
performance, small-scale microarray for expression profiling of many
samples in Arabidopsis-pathogen studies. Plant J. 49: 565–577.
Schliemann, W., Ammer, C., and Strack, D. (2008). Metabolite profil-
ing of mycorrhizal roots of Medicago truncatula. Phytochemistry 69:
112–146.
Schussler, A., Schwarzott, D., and Walker, C. (2001). A new fungal
phylum, the Glomeromycota: Phylogeny and evolution. Mycol. Res.
105: 1413–1421.
Siciliano, V., Genre, A., Balestrini, R., Cappellazzo, G., deWit, P.J.G.M.,
and Bonfante, P. (2007). Transcriptome analysis of arbuscular mycor-
rhizal roots during development of the prepenetration apparatus. Plant
Physiol. 144: 1455–1466.
Smith, S., and Read, D. (1997). Mycorrhizal Symbiosis. (London:
Academic Press).
Smith, S., Smith, F., and Jakobsen, I. (2004). Functional diversity in
arbuscular mycorrhizal (AM) symbioses: The contribution of the my-
corrhizal P uptake pathway is not correlated with mycorrhizal re-
sponses in growth or total P uptake. New Phytol. 162: 511–524.
Smith, S.E., Smith, F.A., and Jakobsen, I. (2003). Mycorrhizal fungi can
dominate phosphate supply to plants irrespective of growth re-
sponses. Plant Physiol. 133: 16–20.
Stracke, S., Kistner, C., Yoshida, S., Mulder, L., Sato, S., Kaneko, T.,
Tabata, S., Sandal, N., Stougaard, J., Szczyglowski, K., and
Parniske, M. (2002). A plant receptor-like kinase required for both
bacterial and fungal symbiosis. Nature 417: 959–962.
Tirichine, L., et al. (2006). Deregulation of a Ca2+/calmodulin dependent
kinase leads to spontaneous nodule formation. Nature 441: 1153–
1156.
3004 The Plant Cell
Varma, A., Savita, V., Sudha, Sahay, N., Butehorn, B., and Franken,
P. (1999). Piriformospora indica, a cultivable plant-growth-promoting
root endophyte. Appl. Environ. Microbiol. 65: 2741–2744.
Waller, F., Achatz, B., Baltruschat, H., Fodor, J., Becker, K., Fischer,
M., Heier, T., Huckelhoven, R., Neumann, C., von Wettstein, D.,
Franken, P., and Kogel, K. (2005). The endophytic fungus Piriformo-
spora indica reprograms barley to salt stress tolerance, disease resis-
tance and higher yield. Proc. Natl. Acad. Sci. USA 102: 13386–13391.
Weidmann, S., Sanchez, L., Descombin, J., Chatagnier, O.,
Gianinazzi, S., and Gianinazzi-Pearson, V. (2004). Fungal elicitation
of signal transduction-related plant genes precedes mycorrhiza es-
tablishment and requires the dmi3 gene in Medicago truncatula. Mol.
Plant Microbe Interact. 17: 1385–1393.
Zhu, H., Riely, B.K., Burns, N., and Ane, J. (2006). Tracing nonlegume
orthologues of legume genes required for nodulation and arbuscular
mycorrhizal symbiosis. Genetics 172: 2491–2499.
NOTE ADDED IN PROOF
During review of this article, confirmation of the functional conservation
between legume and rice of common SYM signaling components oper-
ating upstream of calcium spiking (CASTOR and POLUX) was provided
by Banba et al. (2008) and Chen et al. (2008).
Banba, M., Gutjahr, C., Miyao, A., Hirochika, H., Paszkowski, U.,
Kouchi, H., and Imaizumi-Anraku, H. (2008). Divergence of evolu-
tionary ways among common sym genes: CASTOR and CCaMK show
functional conservation between two symbiosis systems and consti-
tute the root fo a common signaling pathway. Plant Cell Physiol. 49:
1659–1671.
Chen, C., Fan, C., Gao, M., and Zhu, H. (2008). Antiquity and func-
tion of CASTOR and POLLUX, the twin ion channel-encoding genes
key to the evolution of root symbioses in plants. Plant Physiol.,
in press.
AM-Specific Signaling in Rice 3005
S
H
S
H
Supplemental Figure 1. Colonization of rice roots by Piriformpora indica(A) Roots inoculated with P. indica at 5 wpi stained with trypan blue.
H = hyphae, S = zoospores, size bar = 50 µm. (B) Amplification of Pi Tef from cDNA
of colonized roots. Rice CYCLOPHILIN2 (CP2) was used as an internal control.
A
P. i. M H2O
Pi Tef
CP2
B
Supplemental Data. Gutjahr et al. (2008). Arbuscular mycorrhiza-specific signaling in rice
transcends the common symbiosis signaling pathway.
Supplemental Figure 2: Expression analysis of marker genes
(A) RT-PCR-based expression analysis of 14 genes in different rice organs and
callus, in roots and shoots of plants colonized by G. intraradices (Gi) and in roots
colonized by P. indica (Pi). Genomic DNA (gDNA) was used as technical control for
RT-PCR and rice CYCLOPHILIN2 (CP2) served as a constitutively expressed control
gene. (B) Real-time RT-PCR-based expression analysis of low-abundant transcripts.
Error bars represent S.D. for three technical replicates. The experiment was
repeated twice with similar results.
APT11AM1AM2AM3AM10AM11AM14AM15
AM25AM26AM31 AM34 AM39
AM24
Root G
i
Root M
(Gi
B
)
Em
bryo
Ste
mLea
f
Pan
icle
Cal
lus
gDNA
-RT
Root P
i
Root M
(Pi)
Shoot Gi
Shoot M
(Gi)
CP2
1,E-04
1,E-03
1,E-02
1,E-01
1,E+00
Ro
ot
Gi
Ro
ot
M (
Gi)
Sh
oo
t G
i
Sh
oo
t M
(G
i)
Em
bry
o
Ste
m
Le
af
Pa
nic
le
Ro
ot
Pi
Ro
ot
M (
Pi)
Ca
llus
rela
tive
ex
pre
ss
ion
AM18AM20AM29AM42
LPCcontro
l
gDNA-RT
PT11
CP2
Supplemental Figure 3. Absence of PT11 induction upon LPC treatment of rice roots
RT-PCR-based expression analysis of PT11 in roots treated with lysophphatidylcholine
(LPC). Solvent treated roots were used as a control. Genomic DNA (gDNA) was used as a
technical control for PCR and rice CYCLOPHILIN2 (CP2) served as a constitutively
expressed control gene. -RT, control PCR reaction on RNA not reverse transcribed.
The experiment was repeated twice with similar results.
RootG
i
Root M
Em
bryo
Ste
mLea
f
Pan
icle
gDNA
-RT
SYMRK
CASTOR
POLLUX
NUP85
NUP133
CCAMK
CYCLOPS
CP2
Cal
lus
Supplemental Figure 4: Expression of rice common SYM genes
Expression of rice SYMRK, CASTOR, POLLUX, NUP85, NUP133, CCAMK and
CYCLOPS in mycorrhizal (Gi) and mock-inoculated (M) roots and other organs
or callus of rice. Genomic DNA (gDNA) was used as a technical control for PCR.
Rice CYCLOPHILIN2 (CP2) served as a constitutively expressed control gene.
The experiment was repeated twice with similar results.
Supplemental Figure 5. Quantification of AM colonization by microscopy and
real-time RT-PCR. (A) Percent (%) root colonization of different structures of G.intraradices. The mean ± S.E. are displayed (n = 5). (B) Quantity of G. intraradicesITS-DNA relative to rice CYCLOPHILIN 2 (CP2) at each indicated time-point. The
mean ± S.D. for three technical replicates is shown.
A
B
0
10
20
30
40
50
60
70
80
90
3 5 7 9
wpi
roo
t le
ng
th c
olo
niz
ati
on
[%
] total
ext hyphae
hyphopodia
int hyphae
arbuscules
vesicles
1,E-04
1,E-03
1,E-02
1,E-01
1,E+00
3 5 7 9
wpi
rela
tive G
iIT
SD
NA
le
ve
l
Supplemental Table 1. Putative function of proteins encoded by genes exclusively
expressed in mycorrhizal roots
TIGR –ID Gene-ID Putative Function
LOC_01g46860 PT11 PT11 ph phate transporter
LOC_04g04750 AM1 putative class III peroxidase (Prx53)
LOC_08g34249 AM2 hypothetical protein (O. s.), proteinase inhibitor I13 in potato 1
LOC_01g57400 AM3 contains peptidoglycan binding LysM domain 1
LOC_05g22300 AM10 similarity to putative hypersensitivity-related (Hsr) protein
LOC_06g20120 AM11 hypothetical protein, similarity to nucleoid DNA-binding protein cnd41
LOC_11g26140 AM14 serine-threonine kinase like
LOC_01g57390 AM15 contains peptidoglycan binding LysM domain 2
LOC_03g40080 AM18 putative scarecrow-like gene regulator
LOC_04g21160 AM20 similar to AB-hydrolase associated lipase region
LOC_02g03190 AM24 putative cDNA
LOC_06g35930 AM25 putative MIP aquaporin, nodulin 26-like
LOC_12g30300 AM26 serine-threonine kinase, calcium dependent (EF hand)
LOC_06g34470 AM29 similar to Ring-H2 zinc finger protein-like
LOC_02g03150 AM31 hypothetical protein (O. s.), proteinase inhibitor I13 in potato 2
LOC_10g18510 AM34 putative UDP-glucuronyl/UDP-glucyltransferase
LOC_04g13090 AM39 cysteine peptidase, protease family C1
LOC_03g38600 AM42 putative secretory carrier membrane protein
Supplemental Table 2. Insertion lines of rice common SYM signaling genes and their mycorrhizal phenotypes
Mycorrhizal Structure
SYM gene TIGR ID RAP ID Insertion line HyphopodiaRhizodermal
Coils/Branches/Swellings
CortexHyphae Vesicles Arbuscules
wild-type Dongjin (DJ) + + + ++ ++wild-type Hwayoung (HY) + + + ++ ++wild-type Nipponbare (N) + + + ++ ++
SYMRK LOC_07g38070 07g0568100 no insertion lineCASTOR LOC_03g62650 03g0843600 1B-08643 (DJ) + + - - -POLLUX LOC_01g64980 01g0870100 1C-03411 (HY) + + - - -
NC6423 (N) + + - - -ND5050 (N) + + - - -
NUP85 LOC_01g54240 01g0746200 no insertion lineNUP133 LOC_03g12450 03g0225500 no insertion lineCCAMK LOC_05g41090 05g0489900 NE1115 (N) + + - - -
NF8513 (N)a
+ + - - -CYCLOPS LOC_06g02520 06g0115600 NG0782 (N) + + - - -
NC2415 (N) + + - - -NC2713 (N)
b+ + - - -
aPreviously described by Chen et al., 2007.
bPreviously described by Chen et al., 2008.
Supplemental Table 3: Primers used for SYM transcript
analysis in sym mutants.
Gene Primer Sequences
Forward: GAGCAGCAGAAGCAGCAGCAG CASTOR 5’ Reverse: CGGATACCATCCCTGACCATCG
Forward: CGATGGTCAGGGATGGTATCCG castor-1 insertion flanking Reverse: GTTACAAGCCCAAGCATCATGG
Forward: GGGAACGAGATGCAAATACG CASTOR 3’ Reverse: TCCGCCTTGAAACTTTGTCT
Forward: GACAGATGGGGCACCAGCAAC POLLUX 5’ Reverse: GAAGAGCCTCGCTTCCGTGG
Forward: GGAGGAGAAGAGCCTCGCTTCC pollux-1 insertion flanking Reverse: GGAAGCTAAATTCCAGTCCGCG
Forward: GGAGGAGAAGAGCCTCGCTTCC pollux-2 insertion flanking Reverse: CACAAGCCCAAGCATTGTGGC
Forward: GCCACAATGCTTGGGCTTGTG pollux-3 insertion flanking Reverse: CTCCACATGGAACAGCGTCAGG
Forward: GCGGCACTTAGAAAGTTTGC POLLUX 3’ Reverse: ATGCCATGCTGACAAGTTCA
Forward: AAGGAGGGGAGTGAGCAAGT CCAMK 5’ Reverse: CGTCGGAGATCGATACCTGT
Forward: GATCTCATGGATGCAGAGGTCGTC ccamk-1 Insertion flanking Reverse: TGATGCAGCCTGACCGATCAG
Forward: TTTGAGCAGGTGCTGAGAGC CCAMK 3’ Reverse: TGATGCAGCCTGACCGATCAG
Forward: GCGATGATGGAGAACTCGATGG CYCLOPS 5’ Reverse: CTGCATTCCTGTCATGGGAGAC
Forward: CTGATTCCGCAGAATTTGGC cyclops-1,2,3 insertion flanking Reverse: ATGCTGTACCAAGCCAAACC
Forward: GGCAGAAGCAAAGGAAAGAA CYCLOPS 3’ Reverse: CGCTCTTTTTCTTCCACCAG
Supplemental Table 4: Primers used for genotyping of rice insertion lines.
Gene Primer Sequences
Castor.genot.F CGATGGTCAGGGATGGTATCCGCASTOR1B-08643
WT Castor.genot.R GCCAACCGCTTGTTTATGGG
Castor.genot.F CGATGGTCAGGGATGGTATCCGCASTOR1B-08643
mutant p2717_2364.R CGCGTCGGCAGTTTGCTGC
Pollux.genot.F1 GGAGGAGAAGAGCCTCGCTTCCPOLLUX1C-03411
WT Pollux.genot.R1 GGAAGCTAAATTCCAGTCCGCG
GUS1 RB GCCGTAATGAGTGACCGCATCGPOLLUX1C-03411
mutant Pollux.genot.R1 GGAAGCTAAATTCCAGTCCGCG
Pollux.genot.F2 GCAGCTAGCTATAGCAAACAAGAGPOLLUXNC6423
WT Pollux.genot.R2 TTTCATCGGATGCTAAAACAATAA
Pollux.genot.F2 GCAGCTAGCTATAGCAAACAAGAGPOLLUXNC6423
mutant T17_left ATTGTTAGGTTGCAAGTTAGTTAAGA
Pollux.genot.F3 AGCTGCTGTGCTATATATGTTTGGPOLLUXND5050
WT Pollux.genot.R2 TTTCATCGGATGCTAAAACAATAA
Pollux.genot.F3 AGCTGCTGTGCTATATATGTTTGGPOLLUXND5050 mutant T17_left ATTGTTAGGTTGCAAGTTAGTTAAGA
CcamK.genot.F1 TGTTCTCTTCCACAAAAGACACATCCAMKNE1115
WT CcamK.genot.R1 GAGGTTTTAGGCTGATCAAGTCAT
CcamK.genot.F1 TGTTCTCTTCCACAAAAGACACATCCAMKNE1115mutant T17_right CAGCAACGATGTAGATGGTCAAGC
CcamK.genot.F2 GCTCTCAGCACCTGCTCAAACCCAMKNF8513
WT CcamK.genot.R2 CTGAAGAATTATGGGTTCCATTATC
CcamK.genot.F2 GCTCTCAGCACCTGCTCAAACCCAMKNF8513mutant T17_left ATTGTTAGGTTGCAAGTTAGTTAAGA
Cyclops.genot.F1 CACCCAGTCAGACTCCAACACYCLOPSNG0782
WT Cyclops.genot.R1 ATGCTGTACCAAGCCAAACC
Cyclops.genot.F2 AGGCATTTTCATCACCCATCCYCLOPSNG0782mutant T17_left ATTGTTAGGTTGCAAGTTAGTTAAGA
Cyclops.genot.F1 CACCCAGTCAGACTCCAACACYCLOPS
NC2415WT Cyclops.genot.R1 ATGCTGTACCAAGCCAAACC
Cyclops.genot.F2 AGGCATTTTCATCACCCATCCYCLOPS
NC2415mutant T17_left ATTGTTAGGTTGCAAGTTAGTTAAGA
Cyclops.genot.F1 CACCCAGTCAGACTCCAACACYCLOPS
NC1713
WT Cyclops.genot.R1 ATGCTGTACCAAGCCAAACC
T17_left ATTGTTAGGTTGCAAGTTAGTTAAGACYCLOPS
NC2713mutant Cyclops.genot.R1 ATGCTGTACCAAGCCAAACC
Supplemental Table 5 : Primers used for quantification
of fungal DNA and gene expression by real-time RT -PCR.
Gene Primer Sequences
Forward: GAGACCATGATCAGAGGTCAGGT
Gi ITS1 Reverse: GGTCATTTAGAGGAAGTAAAAGTCGTAAC
Forward: GATGTTACGGATCTGGGTATATCGA
Gr ITS2 Reverse: CGGCTATAATTAGTACGCTTCACATT
Forward: GAGAAGTTCCCTGCTTCAAGCA
PT11 Reverse: CATATCCCAGATGAGCGTATCATG
Forward: ACCTCGCCAAAATATATGTATGCTATT
AM1 Reverse: TTTGCTTGCCACACGTTTTAA
Forward: ATGCCGTTGTCGTCCATGA
AM2 Reverse: CCCTCACGCCGGATTTC
Forward: CTGTTGTTACATCTACGAATAAGGAGAAG
AM3 Reverse: CAACTCTGGCCGGCAAGT
Forward: AGAACACTTGTGGCCGTACTATAAGA
AM10 Reverse: CCTCTCGACGAAAGTACGGACTA
Forward: TGAACGAAGACAGCAATACATCAA
AM11 Reverse: CGATCGATGGATTCATACTTCAGT
Forward: CCAACACCGTTGCAAGTACAATAC
AM14 Reverse: GCACTTTGAAATTGGACTGTAAGAAA
Forward: TCCGGCGCCACATAGTG
AM15 Reverse: TCCGTCGCACACGAGAAG
Forward: TGCCATGTGGATGATGCATAG
AM18 Reverse: CGACGAGGAAGATCAATGGTTAGT
Forward: TTTGGAAGGAACACTACTGGAGAAT
AM20 Reverse: CCGAAATCTAGTTTCGACAATGATT
Forward: TCTTCATCACCGCCGACAT
AM24 Reverse: CGGCGAGATAGTGAGCATAAAGA
Forward: CTTGCTGCCTTCCTCTATGGA
AM25 Reverse: CGAGAAGTCGACGACTCCTACAC
Forward: GGTTGTTGCGGCATGTGTAC
AM26 Reverse: AGCCATGTCCCTAGCGAGGTA
Forward: TGCGACGTGATCAGCCAC
Os AM29 Reverse: TGCACGCACCTGTTCCAC
Forward: CGATGAAGTTGTTGTCCACGAA
AM31 Reverse: CGTCTCGCCGGAGTTCAA
Forward: TTGCCAAAAATAGAAGCATCACA
AM34 Reverse: CATAGTACTTAAAGTGAAAGGGCAAGGT
Forward: CCGAATCTCAAGCAGGATGTG
AM39 Reverse: AAATTGTCGTTTGTGTACCCTGACT
Forward: ATTTGTTGAACGAGCACAATCG
AM42 Reverse: ACATCAACACTCTTACACTCACACACA
Forward: TCTAATTCTTCGGACCCAAGAATG
ACTIN1 Reverse: AGCAGGAGGACGGCGATAA
Forward: GTGGTGTTAGTCTTTTTATGAGTTCGT
CYCLOPHILIN2 Reverse: ACCAAACCATGGGCGATCT
Forward: CTGATGATATGGACCTGAGTCTACTTTT
Os GAPDH Reverse: CAACTGCACTGGACGGCTTA
Forward: CATGGAGCTGCTGCTGTTCTAG
Os UBIQUITIN Reverse: CAGACAACCATAGCTCCATTGG
Supplemental Table 6: Primers for detection of rice gene expression by RT-PCR.
For AM1, AM3 and PT11 the same primers were used to generate probes for in situhybridization.
Gene Primer Sequences
Forward: AGCTCTCCTAGATCTGTGCTG
CYCLOPHILIN 2 Reverse: GCGATATCATAGAACGAGCGAC
Forward: CCTGGCATAAAAGGGCAATA
SYM RK Reverse: GTGCTTTCGATGGACCTCAT
Forward: GGGAACGAGATGCAAATACG
CASTOR Reverse: TCCGCCTTGAAACTTTGTCT
Forward: GCGGCACTTAGAAAGTTTGC
POLLUX Reverse: ATGCCATGCTGACAAGTTCA
Forward: GCACAAGAAGGAAGGACTGG
NUP85 Reverse: GCATGGCTTGGTAGGTGAAT
Forward: CTGATCGAGATGTGCCTGAA
NUP133 Reverse: AGGACAGTGCCCTGAAGAGA
Forward: GATCTCATGGATGCAGAGGTCGTC
CCAM K Reverse: GCTCTCAGCAC CTGCTCAAAC
Forward: GGCAGAAGCAAAGGAAAGAA
CYCLOPS Reverse: CGCTCTTTTTCTTCCACCAG
Forward: CATCACCAACATGCTCGGCTTC
PT11 Reverse: GTATGCATATCCCAGATGAGC
Forward: CACCAAGAGCTGCAGGG CTACCAAC
AM1 Reverse: TTTGCTTGCCACACGTTTTAA
Forward: ATGAGCCAGAAGTCGT CGTG
AM2 Reverse: TATTTCGCGATGACGGGAAT
Forward: GTTACGTGGTGGTGGAGGAT
AM3 Reverse: GTCGAGGCAGACCCACTG
Forward: GAGGAGGGGTATGTGCAGTC
AM10 Reverse: CCCCTTGTTCACCTCCTGTA
Forward: ACTTCAGTTTCGTCGCGATT
AM11 Reverse: GGCAAAATCTGCTTCAATCC
Forward: GATTCAAAGGTTGGCAGAGC
AM14 Reverse: CCAACACCGTTGCAAGTACA
Forward: CGAGAAGTTCCACGGAGACG
AM15 Reverse: AGTTGATGTTCGGGTTGAGG
Forward: CGGCGAGATAGTGAGCATAA
AM24 Reverse: GTCGTTGAGGAAGACGAGGA
Forward: TCGTCATCGAGTTCGTCATC
AM25 Reverse: TCCCAAGATGTACACCCACA
Forward: CAACCAAATCATGCGAAACA
AM26 Reverse: TGAATGCCATTTAGCCCATT
Forward: TGGAGAAGAAGAAGGTGAGGTG
AM31 Reverse: TAACTGATGACGGGGACCTT
Forward: AAAGTGAAAGGGCAAGGTGA
AM34 Reverse: CTCAAGAGGGGAGGTTGGAT
Forward: TAGCATTGACACGCTTCCAGC
AM39 Reverse: TGCCGCTGTGTATGGGTACTTAG
DOI 10.1105/tpc.108.062414; originally published online November 25, 2008; 2008;20;2989-3005Plant Cell
Hirochika, Haruko Imaizumi-Anraku and Uta PaszkowskiCaroline Gutjahr, Mari Banba, Vincent Croset, Kyungsook An, Akio Miyao, Gynheung An, Hirohiko
PathwaySpecific Signaling in Rice Transcends the Common Symbiosis Signaling−Arbuscular Mycorrhiza
This information is current as of February 5, 2014
Supplemental Data http://www.plantcell.org/content/suppl/2008/11/21/tpc.108.062414.DC1.html
References http://www.plantcell.org/content/20/11/2989.full.html#ref-list-1
This article cites 70 articles, 30 of which can be accessed free at:
Permissions https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X
eTOCs http://www.plantcell.org/cgi/alerts/ctmain
Sign up for eTOCs at:
CiteTrack Alerts http://www.plantcell.org/cgi/alerts/ctmain
Sign up for CiteTrack Alerts at:
Subscription Information http://www.aspb.org/publications/subscriptions.cfm
is available at:Plant Physiology and The Plant CellSubscription Information for
ADVANCING THE SCIENCE OF PLANT BIOLOGY © American Society of Plant Biologists