ClC-3 Chloride Channel Function as a Mechanical Sensitive · ClC-3 Chloride Channel Function as a Mechanical Sensitive Channel in Osteoblast Journal: Biochemistry and Cell Biology

Draft

ClC-3 Chloride Channel Function as a Mechanical Sensitive

Channel in Osteoblast

Journal: Biochemistry and Cell Biology

Manuscript ID: bcb-2015-0018.R1

Manuscript Type: Article

Date Submitted by the Author: 15-May-2015

Complete List of Authors: wang, huan; State Key Laboratory of Military Stomatology, School of Stomatology, The Fourth Military Medical University, Department of Oral Biology and orthodontics Wang, Rong; State Key Laboratory of Military Stomatology, School of Stomatology, The Fourth Military Medical University, Department of Oral Biology

Liu, Qian; State Key Laboratory of Military Stomatology, School of Stomatology, The Fourth Military Medical University, Department of Oral Biology Wang, Zhe; State Key Laboratory of Military Stomatology, School of Stomatology, The Fourth Military Medical University, Department of Oral Biology Mao, Yong; State Key Laboratory of Military Stomatology, School of Stomatology, The Fourth Military Medical University, Department of Prosthodontics Duan, Xiaohong; State Key Laboratory of Military Stomatology, School of Stomatology, The Fourth Military Medical University, Department of Oral Biology

Keyword: chloride channels, ClC-3, mechanical stimulation, osteodifferentiation, gene regulation

https://mc06.manuscriptcentral.com/bcb-pubs

Biochemistry and Cell Biology

Draft

1

ClC-3 Chloride Channel Function as a Mechanical Sensitive Channel in Osteoblast

Huan Wang, Rong Wang, Zhe Wang, Qian Liu, Yong Mao, and Xiaohong Duan

Huan Wang*, Rong Wang*, Zhe Wang, Qian Liu, Yong Mao, and Xiaohong Duan.

State Key Laboratory of Military Stomatology, Department of Oral Biology, School of

Stomatology, The Fourth Military Medical University, Xi’an 710032, China

Huan Wang. State Key Laboratory of Military Stomatology, Department of

Orthodontics, School of Stomatology, The Fourth Military Medical University, Xi’an

710032, China

Yong Mao. State Key Laboratory of Military Stomatology, Department of

Prosthodontics, School of Stomatology, The Fourth Military Medical University, Xi’an

710032, China

* These authors contributed equally to this work.

Corresponding author: Prof. Xiaohong Duan (E-mail address: [email protected])

There are 7 figures and 1 table in the article.

Funded by: National Natural Science Foundation (No. 31070835, No. 81200648 and

No. 31170898)

Page 1 of 32



Draft

2

Abstract

Mechanical stimulation usually causes the volume changes of osteoblasts.

Whether this volume changes could be sensed by ClC-3 chloride channel, a volume

sensitive ion channel, and further promotes the osteodifferentiation in osteoblasts

remains to determine. In this study, we applied the persistent static compression on

MC3T3-E1 cells to detect the expression changes of ClC-3, osteogenic markers as well

as some molecules related with signaling transduction pathway. We tested the key

role of ClC-3 in transferring the mechanical signal to osteoinduction by ClC-3

overexpressing and siRNA technique. We found that ClC-3 level was up regulated by

mechanical stimulation in MC3T3-E1 cells. Mechanical force also up regulated the

mRNA level of osteogenic markers such as alkaline phosphatase (Alp), bone

sialoprotein (Bsp) and osteocalcin (Oc), which could be blocked or strengthened by

Clcn3 siRNA or overexpressing, and Alp expression was more sensitive to the changes

of ClC-3 level. We also found that runt-related transcription factor 2 (Runx2),

transforming growth factor-beta 1 (TGF-β1) and Wnt pathway might be involved in

ClC-3 mediated mechanical transduction in osteoblasts. The data from the current

study suggest that ClC-3 chloride channel play as a mechanical sensitive channel to

regulate osteodifferentiation in osteoblasts.

Key words：：：：Chloride channels, ClC-3, Mechanical stimulation, Osteodifferentiation,

Gene regulation

Page 2 of 32



Draft

3

Introduction

Bone is sensitive to mechanical loading, which is one of the most important

physiological factors regulating bone mass and shape. Lack of mechanical loading

causes an acceleration of bone turnover with bone resorption overwhelming bone

formation. As we know, in dental clinic treatment, appropriate force can move teeth

by remodeling of the surrounding alveolar bones, whilst lack of the chewing force

usually causes the apparent resorption of alveolar bone in edentulous area. Bone’s

adaptive response is regulated by the ability of resident bone cells to perceive and

translate mechanical energy into a cascade of structural and biochemical changes

within the cells - a process known as mechanotransduction (Iolascon et al., 2013).

Mechanical-stress plays an important role in the Wnt/β-catenin signaling pathway

and is involved in bone formation. Flow pulsating fluid stimulation up regulated the

gene expression levels of adenomatous polyposis coli, alkaline phosphatase, LRP5,

Wnt3a and β-catenin in ROS17/2.8 osteoblasts and induced the differentiation

of osteoblasts and the activation of the Wnt/β-catenin signaling pathway (Jia et al.,

2014).

Studies have showed that there are many ion channels associated with the

osteogenic differentiation of cells, such as Ca2+

, K+, etc. (Amagai and Kasai, 1989; Gu

et al., 2001; Moreau et al., 1996). The role of voltage-gated chloride channel ClC

family in osteogenesis has been explored in our previous work. ClC-3, ClC-4 and ClC-5

belong to the same ClC branch due to the similarity of their genetic, and function as

endosomal chloride channels. We found that these three channels may regulate

Page 3 of 32



Draft

4

osteoblast differentiation. Over expression of ClC-3, ClC-4 and ClC-5 could up regulate

osteogenic makers, such as Alp, Bsp, Oc, as well as the calcification ability of

MC3T3-E1 cells. We also found that ClC-3 regulate osteoblast function through Runx2

and TGF-β1 (Wang et al., 2010a; Wang et al., 2010b). According to the recent reports,

ClC-3 also participates in cell proliferation, apoptosis, intracellular acidification

regulation of osteoclast, etc (Hara-Chikuma et al., 2005; Hermoso et al., 2002; Jin et

al., 2003; Maki et al., 2007; Okamoto et al., 2008; Tang et al., 2008; Wang et al.,

2006).

ClC-3 was also defined as a volume sensitive chloride channel (Duan et al., 1997).

Its cellular volume regulation has been proved in AGS human gastric epithelial cells

(Jin et al., 2003), mouse ventricular myocytes (Wang et al., 2005), HeLa cells and

xenopuslaevis oocytes (Hermoso et al., 2002), human acute lymphoblastic leukemia

cells (Cao et al., 2011), acinar cells isolated from the rat lacrimal gland and

submandibular salivary gland (Majid et al., 2001) and atrial and ventricular tissues

(Britton et al., 2000). Volume changes are one of characteristics of osteoblast during

the mechanical stimulation (Martin and Seeman, 2008). It is not clear whether

mechanical force stimulated volume changes could be sensed by ClC-3 which might

further induces the osteogenic differentiation in osteoblasts. Here we study the role

of ClC-3 on the mechanical stimulated changes in MC3T3-E1 osteoblastic cells with

the self-made mechanical loading equipment.

Materials and methods

Page 4 of 32



Draft

5

Cell culture and persistent static pressure stimulation

MC3T3-E1 cells were cultivated in alpha-minimum essential medium (α-MEM,

Gibco-Invitrogen, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS,

Gibco), 100 U/ml penicillin G (Sigma, St. Louis, MO, USA) and 100 μg/ml streptomycin

(Sigma, St. Louis, MO, USA) in a humidified incubator at 37°C with 95% air and 5%

CO2. The cells were subcultured every 72 h using 0.25% trypsin plus 0.02% EDTA

(Gibco) in phosphate-buffered saline (PBS, Gibco) and loaded with static compression

using the self-designed culture chamber for 8 h and 24 h respectively. The gas phase

of the chamber was maintained at a pressure of 1 atmospheres (atm) by

continuously infusing a compressed mixed gas (O2: N

2:CO

2 = 7.0%:91.3%:1.7%).

ClC-3 plasmid and gene transfection

For gene transfection, MC3T3-E1 cells were plated at 1 x 104

cells/ml cultured in

α-MEM supplemented with 10% FBS in six-well plates overnight and were

transfected with ClC-3 plasmid or pCMV-HA plasmid as a control with Lipofectamine

2000 (Invitrogen, Carlsbad, CA, USA). The culture medium was renewed after 8 h

incubation. pCMV-Clcn3-HA carrying a full-length rat Clcn3 cDNA was a gift from Dr.

Sandra. E. Guggino of Johns Hopkins University.

ClC-3 siRNA and gene silencing

The small interfering RNA (siRNA) duplexes that target the mouse Clcn3 gene were

generated as described previously (Wang et al., 2010b). The isoforms of Clcn3 gene

have been reported in rat and mouse (Okada et al., 2014; Shimada et al., 2000), and

the sequence of Clcn3 siRNA in this study may target all the isoforms of mouse Clcn3

Page 5 of 32



Draft

6

(transcript variant a, b, c, e, or X1~X8). The siRNA sequence for ClC-3 was as follows:

sense siRNA 5’-CGA GAG AAG UGU AAG GAC ATT-3’ and antisense siRNA, 5’-UGU

CCU UAC ACU UCU CUC GTT-3’. The nonsense siRNA sequence was as follows: sense

siRNA, 5'-UUC UCC GAA CGU GUC ACG UTT-3' and antisense siRNA, 5'-ACG UGA CAC

GUU CGG AGA ATT-3'. siRNAs were transfected with Lipofectamine 2000 (Invitrogen)

according to the manufacturer’s protocol.

Real-time RT-PCR assay

Total cellular RNA was extracted with TRIzol® Reagent (Invitrogen) and quantified

by ultraviolet spectroscopy at assigned time points post induction. RT-PCR was

performed using the reverse transcriptase cDNA synthesis kit (TaKaRa, Dalian, China).

Real-time RT-PCR was performed by an ABI 7500 real-time PCR system (Applied

Biosystems) using SYBR® Premix Ex Tag

TM (TaKaRa). Total cDNA (10-30 ng) was added

per 20 μl reaction. Thermo cycling conditions were set to the following: 95°C for 30 s;

45 cycles at 95°C for 5 s, 60°C for 34 s. The primers used are listed in Table 1.

Quantification of gene expression was performed using the comparative threshold

cycle (ΔΔCT) method and the relative expression levels were quantified by comparing

the ratios to the reference gene, Gapdh cycle threshold (CT).

Western blot analysis

The cells were lysed in a buffer containing 0.05 M Tris (pH 7.4), 0.15 M NaCl, 1%

Nonidet P-40, 1 mM EDTA, 1 μg/ml leupeptin, 1 μg/ml aprotinin, and 1 Mm

phenylmethylsulfonyl fluoride. The protein concentration was determined using BCA

reagent (Pierce, Rockford, IL). After this, 50 μg of the total protein lysate were

Page 6 of 32



Draft

7

separated via sodium dodecyl sulfate polyacrylamide gel electrophoresis and

transferred to a PVDF membrane (Millipore, Billerica, MA, USA). The PVDF

membranes then were subjected to western blot analysis. Briefly, the membrane was

first blocked in a Tris-buffered solution (TBS) containing 5% non-fat milk for 30 min,

and in anti-HA-tag monoclonal antibody (at a dilution of 1:300, Cell Signaling

technology, Boston, MA, USA), anti-β-actin rabbit polyclonal antibody (at a dilution of

1:300, Boster, Wuhan, China) , or CLC-3 mouse monoclonal antibody (at a dilution of

1:200, LSBio, USA) overnight. After washing, the membranes were incubated at room

temperature in a fluorophore-labeled goat-anti-mouse secondary antibody

(IRDye680, LI-COR, USA). Bands were detected and quantified on the Odyssey image

system (at a dilution of 1:5000, LI-COR, Lincoln, Nebraska, USA).

Immumofluorescence analysis

MC3T3-E1 cells were grown on glass coverslips and fixed with 4% formaldehyde

for 20 min at 4°C and permeabilized with 0.03% Triton X-100 in PBS for 30 min. The

coverslips were incubated with CLC-3 mouse monoclonal antibody (at a dilution of

1:200, LSBio, USA) overnight at 4°C after blockage of nonspecific binding with 10%

rabbit serum for 30 min at room temperature. In the next day, the coverslips were

washed with PBS for three times and then incubated with fluorescein (FITC)

affinity-pure donkey anti-mouse IgG (at a dilution of 1:300, Jackson

ImmunoResearch, West Grove, PA) or goat anti-rabbit IgG polyclone antibody Cy3

labeled (at a dilution of 1:200, Jackson ImmunoResearch) for 60 min at 37°C. Nuclear

counterstaining was performed with Hoechst 33342 (at a dilution of 1:1000, Sigma).

After rinsed with PBS, the coverslips were reviewed under a FluoView FV1000 laser

Page 7 of 32



Draft

8

confocal microscope (Olympus).

Statistical analysis

Data are presented as mean ± S.E.M. Comparative studies of means were

performed using one-way analysis of variance followed by a post-hoc test (projected

least significant difference Fisher). Student’s t-Tests were used when only two groups

were compared. Values of P less than 0.05 were considered to be statistically

significant.

Results

Time-course osteogenic gene expression profiles in MC3T3-E1 cells under persistent

static compression

To investigate the effects of compression on MC3T3-E1 cells, we have loaded the

persistent static pressure with self-designed culture chamber. The density of cells in

compression group was lower than the control group at 8 h and 24 h with 1 atm

static compression (Fig. 1). After application of static pressure of 1 atm for 8 and 24

h, the mRNA expressions of osteogenic related genes (Alp, Bsp, Ocn, Runx2) and

other cell transduction signaling molecules [β-catenin, low-density lipoprotein

receptor-related protein 6 (Lrp6)] were up regulated in compression group compared

to those in the control group, respectively. Transforming growth factor-beta 1 (Tgfb)

mRNA expression was down regulated with compression application, while Poliovirus

receptor-related 1 (Pvrl) mRNA level had no statistical change (Fig. 2).

Effects on ClC-3 expression in MC3T3-E1 cells under persistent static compression

Page 8 of 32



Draft

9

Clcn3 mRNA expression was significant increased by 7.1-fold (at 8 h) and 9.2-fold

(at 24 h) in compression group compared to the control group, respectively (Fig. 3B).

To confirm the contribution of ClC-3 under compression application, we further

examined the effects of ClC-3 overexpression and ClC-3 siRNA transfection on Clcn3

expression under mechanic stimulation by using real-time PCR, western blot and

immumofluorescence method. The gene expression of Clcn3 was significantly

reduced (76%) in the ClC-3 gene silencing cells compared to the nonsense

transfection control cells, and then increased by 4.2-fold (at 8 h) and 5.8-fold (at 24

h) in compression loaded. Western blot data showed the positive HA-tag expression

in pCMV-Clcn3-HA-transfected cells versus mock-transfected cells (Fig. 3A). The

expression of Clcn3 was induced by 3.0-fold in ClC-3 overexpressing cells compared

to the nonsense transfection control cells, and then increased by 2.8-fold (at 8 h) and

5-fold (at 24 h) in compression loaded (Fig. 3B). The changes of CLC-3 expression in

western blot results were in good accordance with the real-time PCR data (Fig. 4).

CLC-3 expression was decreased in the ClC-3 gene silencing cells compared to the

nonsense transfection control cells using the confocal laser scanning microscope

observation. Therefore, the expression of ClC-3 was enhanced after static

compression for 8 and 24 h, respectively. After analysis of intensities of fluorescence

of anti-CLC-3 antibodies among these groups, we found that expression of ClC-3 in

cells under compression application was recovered and increased after ClC-3 gene

silencing by time-course (Fig. 5).

Persistent static compression promotion osteogenetic genes expression in

MC3T3-E1 cells through ClC-3

Page 9 of 32



Draft

10

To investigate the role of ClC-3 in regulating the expression of osteogenic-related

genes under compression application in MC3T3-E1 cells, we transiently transfected a

full length Clcn3 cDNA and ClC-3 siRNA into MC3T3-E1 cells, respectively. The data

showed that compression stimulation up regulated levels of Bsp, Oc, Alp, Runx2,

β-catenin and Lrp6 mRNA compared to the control group by the time-course, and

the overexpression of ClC-3 enhanced the function of compression application in

MC3T3-E1 cells (Fig. 6 and Fig. 7). Meanwhile, Tgfb expression was decreased under

compression stimulation and ClC-3 overexpression, and Poliovirus receptor-related 1

(Pvrl) expression had no difference among the groups (Fig.7). The following data

further indicated that ClC-3 gene silencing down regulated the expression of Bsp, Oc,

Alp, Runx2, β-catenin, while the levels of these markers under compression

stimulation were less up regulated after ClC-3 gene silencing (Fig. 6 and Fig. 7). We

also found that Tgfb1 was decreased under compression stimulation, and Lrp6 mRNA

levels were increased in ClC-3 gene silencing with compression application group (Fig.

7). Therefore, all the data indicated that compression stimulation induced osteogenic

genes expression trough ClC-3.

Discussion

Bone is a dynamic tissue that responds to mechanical stimulation. Cortical as well

as trabecular bone tissue is formed and resorbed by cells known as osteoblasts and

osteoclasts, respectively. These cells are ideally located and distributed to act as

mechanosensors. In the study, we have applied the self-designed device to load

persistent static compression on MC3T3-E1 cells to explore the regulation role of

Page 10 of 32



Draft

11

ClC-3 and its relationship with force stimulation in osteogenesis. Effects of

mechanical stimulation on the expression of ClC-3 indicated that ClC-3 chloride

channel functioned as an early sensitive response gene to mechanical force. The

most dramatically increase (nearly 8-fold) in Clcn3 mRNA level appeared at force

loaded for 8 h, then stabilized around 24 h. The mRNA levels of ClC-3 was knocked

down nearly 80% using Clcn3 siRNA, thus we only found minor increase in Clcn3

mRNA level in Clcn3 siRNA group with 8 hour loading which later became no longer

evident after 24 h. In ClC-3 over-expression system, we did not see a dramatically

increase of the mRNA level of ClC-3 as we expected, which might indicate that the

endogenous ClC-3 could sufficiently responded to the early mechanical stimulation,

but after 24 h force loading, both endogenous ClC-3 and over expressed ClC-3

contributed to the great increase of Clcn3 expression responding to mechanical

stimulation. The mechanical compression or stress causes cellular volume changes,

which might be sensed by volume-sensitive ClC-3 channels. Here we believed that

ClC-3 function as a sensitive target channel to mechanical stimulus in osteoblasts.

Myocyte Enhancer Factor-2 (MEF-2C) has been reported to inhibit Clcn3 promoter

activity. The mechanical strain increased the mRNA level of MEF2C during the

cardiovascular differentiation of mouse embryonic stem cells (Schmelter et al., 2006).

Thus MEF-2C might be a key signal triggered by mechanical stress that activates Clcn3

gene expression in osteoblasts, which we will further study in the future.

MC3T3-E1 is a murine osteogenitor cell line, which is considered to be immature

osteoblast for researching osteodifferentiation. Appropriate mechanical stimulation

Page 11 of 32



Draft

12

can promote osteodifferentiation of osteoblasts to increase bone formation (Dodds

et al., 1993; Zaidi, 2007). Both mechanical force and ClC-3 have been demonstrated

to promote osteogenesis (Aronson et al., 1988a; Aronson et al., 1988b; Wang et al.,

2010b), thus we further hypothesized that ClC-3 could mediate mechanical

stimulation to regulate the osteogenic differentiation in osteoblasts. The expression

of the osteogenic genes (Alp, Oc, Bsp) was increased in compression group in

MC3T3-E1 cells, which has been found in other reports. In order to confirm the

mechanical force induced osteogenic differentiation is through ClC-3 channel, we

further tested the expression changes of osteogenic genes in Clcn3 siRNA group and

Clcn3 over expressing group. The mechanical force induced expression of osteogenic

genes (Alp, Oc, Bsp) was greatly reduced in Clcn3 silenced cells, indicating that

mechanical force signal could not be transferred to induce osteogenic differentiation

with the absence of ClC-3. On the other hand, because of accumulation of ClC-3 in

overexpression group including the contribution of the increased Clcn3 expression in

mechanical stimulation, the increase of osteogenic genes expression was

superimposed. As a early marker enzyme in osteoblasts, ALP participates in the early

osteodifferentiation of osteoblasts and the accumulation of mineralized phosphates

during the biocalcification (Havill et al., 2006). Here we found that the mRNA level of

Alp was greatly up regulated with both mechanical force and ClC-3 overexpresssing

stimulus comparing to the single stimulus of mechanical force or ClC-3

overexpresssing, which was more obvious than the increased expression of Bsp and

Oc induced by mechanical force and ClC-3 overexpresssing. These data suggest that

Page 12 of 32



Draft

13

Alp is one of the major targets of ClC-3 to regulate osteoblast differentiation under

the mechanical compression, and Bsp and Oc are also involved in this process but

with a less response to ClC-3 mediated mechanical stimulation.

Runx2 is also required for osteodifferentiation and may induce the expression of

multiple osteogenic marker genes including type I collagen, OC, BSP, and osteopotin.

Full Runx2 gene dosage has been reported in maintaining normal function of

osteoblasts in mechanical unloading (Salingcarnboriboon et al., 2006). Our data

herein demonstrated that mechanical stimulation up regulated Runx2 expression and

the increase could be inhibited or blocked by Clcn3 siRNA, suggesting that

mechanical stress has to pass through ClC-3 channel to regulate Runx2 expression,

which in turn affecting other osteogeneic markers. The results are consistent with

our previous study that the up regulation of osteogenic markers by ClC-3 in

MC3T3-E1 cells are correlated with TGF-β1 related Runx2 activation (Wang et al.,

2010b).

TGF-β is a key factor in bone formation, or remodeling (Nielsen et al., 1994;

Pfeilschifter et al., 1990; Tang et al., 2009). It may promote the synthesizing and

secreting of bone matrix protein or proteinase, including alkaline phosphatase,

collagen I, osteocalcin, osteopontin, and matrix metalloproteinase-13

(MMP-13)(Nomura et al., 2008). TGF-β also regulates osteoprogenitor cells as a

chemoattractantor in multiple ways (Pfeilschifter et al., 1990), such as simulating

osteoprogenitor proliferation (Urano et al., 1999) and recruiting osteoprogenitors to

the site of new bone formation or the site of fracture repair(Nielsen et al., 1994). On

Page 13 of 32



Draft

14

the other hand, TGF-β is also reported to inhibit terminal osteoblast differentiation

and bone matrix synthesis related with Smad3 and Runx2 pathway (Alliston et al.,

2001). TGF-β1 also regulates Runx2 expression through Smad2/3 signal, thereby

regulating the downstream genes expression and cell function (Lee et al., 2000; Lin

et al., 2011). In this study, Tgfb expression was decreased under compression

stimulation. Runx2 and TGF-β1 showed the different response to mechanical force

and ClC-3 siRNA or overexpressing, the opposite effect has also been reported in our

previous work. A complex network of Runx2 and TGF-β1 should be involved the ClC-3

mediated mechanical transduction.

Wnt pathway plays the important role in the differentiation of osteoblasts and

bone formation. Regulation of factors in Wnt pathway can impact the development

and differentiation of osteoblasts and the formation and mineralization of bone

matrix (Glass et al., 2005). Several experiments have demonstrated the involvement

of canonical Wnt signaling in mechanotransduction. Osteoblasts cultured from

transgenic mice expressing a TCF/β-catenin transcription reporter (TopGal mice)

exhibited activation of canonical Wnt signaling (β-galactosidase expression) when

subjected to mechanical strain (Hens et al., 2005). In addition, fluid shear stress and

mechanical strain both stimulate the translocation of β-catenin to the nucleus in

MC3T3-E1, UMR-106, ROS 17/2.8, and primary rodent calvarial osteoblasts

(Armstrong et al., 2007; Norvell et al., 2004). Here we showed that ClC-3 played a

positive regulatory role on Wnt related pathway on cell membrane, further regulated

the downstream Lrp6 and β-catenin. Lrp6 is an important receptor in Wnt pathway,

Page 14 of 32



Draft

15

and may activate β-catenin, which regulates the coordination of cell-cell

adhesion and gene transcription (Lin et al., 2014). PVRL1 is correlated with the

growth and development of cranial bones. The gene mutation of PVRL1 was founded

in patients with non-syndromic clefts of lip, alveolus and palate (Turhani et al., 2005).

We found obvious changes of Pvrl1 expression with ClC-3 level but mechanical

stimulation. All the results suggest that mechanical stimulation can regulate the

expression of osteogenic genes through ClC-3 associated with TGF-β/Runx2 and

Wnt/β-catenin pathway.

In conclusion, the volume sensitive chloride channel ClC-3 has a relationship with

mechanical stimulation in MC3T3-E1 cells. Static compression increased ClC-3

expression that further promoted the osteogenic genes expression. Our current

study suggests that the role of mechanical stimulation in osteodifferentiation may be

through the ClC-3 chloride channel pathway, which in turn mediates bone formation

and remodeling. ClC-3 should be the key position to participate in the regulation of

the signaling pathway associated, and further investigation will elucidate the

underlying mechanisms.

Acknowledgments

We would like to thank Dr. Sandra E. Guggino of Johns Hopkins University for

providing the ClC-3 expression plasmid, Dr. Yan Zhang of the Department of

Biochemistry and Molecular Biology at the Fourth Military Medical University for

providing MC3T3-E1 cells. This study was supported by the National Natural Science

Page 15 of 32



Draft

16

Foundation (No. 31070835, No. 81200648 and No. 31170898).

Page 16 of 32



Draft

17

Reference

Alliston, T., Choy, L., Ducy, P., Karsenty, G., Derynck, R. 2001. TGF-beta-induced repression of CBFA1

by Smad3 decreases cbfa1 and osteocalcin expression and inhibits osteoblast differentiation. EMBO

J 20(9):2254-2272.

Amagai, Y., Kasai, S. 1989. A voltage-dependent calcium current in mouse MC3T3-E1 osteogenic cells.

Jpn J Physiol 39(5):773-777.

Armstrong, VJ., Muzylak, M., Sunters, A., Zaman, G., Saxon, LK., Price, JS., Lanyon, LE. 2007.

Wnt/beta-catenin signaling is a component of osteoblastic bone cell early responses to load-bearing

and requires estrogen receptor alpha. J Biol Chem 282(28):20715-20727.

Aronson, J., Harrison, B., Boyd, CM., Cannon, DJ., Lubansky, HJ.. 1988a. Mechanical induction of

osteogenesis: the importance of pin rigidity. J Pediatr Orthop 8(4):396-401.

Aronson, J., Harrison, B., Boyd, CM., Cannon DJ, Lubansky HJ, Stewart C. 1988b. Mechanical

induction of Osteogenesis. Preliminary studies. Ann Clin Lab Sci 18(3):195-203.

Britton, FC., Hatton, WJ., Rossow, CF., Duan, D., Hume, JR., Horowitz, B. 2000. Molecular distribution

of volume-regulated chloride channels (ClC-2 and ClC-3) in cardiac tissues. Am J Physiol Heart Circ

Physiol 279(5):H2225-2233.

Cao, G., Zuo, W., Fan, A., Zhang, H., Yang, L., Zhu, L., Ye, W., Wang, L., Chen, L. 2011.

Volume-sensitive chloride channels are involved in maintenance of basal cell volume in human

acute lymphoblastic leukemia cells. J Membr Biol 240(Glass et al.):111-119.

Duan, D., Winter, C., Cowley, S., Hume, JR., Horowitz, B. 1997. Molecular identification of a

volume-regulated chloride channel. Nature 390(6658):417-421.

Glass, DA., 2nd, Bialek, P., Ahn, JD., Starbuck, M., Patel, MS., Clevers, H., Taketo, MM., Long, F.,

Page 17 of 32



Draft

18

McMahon, AP., Lang, RA., Karsenty, G. 2005. Canonical Wnt signaling in differentiated osteoblasts

controls osteoclast differentiation. Dev Cell 8(5):751-764.

Gu, Y., Preston, MR., El, Haj, AJ., Howl, JD., Publicover, SJ. 2001. Three types of K(+) currents in

murine osteocyte-like cells (MLO-Y4). Bone 28(1):29-37.

Havill, LM., Hale, LG., Newman, DE., Witte, SM., Mahaney, MC. 2006. Bone ALP and OC reference

standards in adult baboons (Papio hamadryas) by sex and age. J Med Primatol 35(Glass et

al.):97-105.

Hens, JR., Wilson, KM., Dann, P., Chen, X., Horowitz, MC., Wysolmerski JJ. 2005. TOPGAL mice show

that the canonical Wnt signaling pathway is active during bone development and growth and is

activated by mechanical loading in vitro. J Bone Miner Res 20(7):1103-1113.

Hermoso, M., Satterwhite, CM., Andrade, YN., Hidalgo, J., Wilson, SM., Horowitz, B., Hume, JR. 2002.

ClC-3 is a fundamental molecular component of volume-sensitive outwardly rectifying Cl- channels

and volume regulation in HeLa cells and Xenopus laevis oocytes. J Biol Chem 277(42):40066-40074.

Iolascon, G., Resmini, G., Tarantino, U. 2013. Mechanobiology of bone. Aging Clin Exp Res 25 Suppl

1:S3-7.

Jia, YY., Li, F., Geng, N., Gong, P., Huang, SJ., Meng, LX., Lan, J., Ban, Y. 2014. Fluid flow modulates

the expression of genes involved in the Wnt signaling pathway in osteoblasts in 3D culture

conditions. Int J Mol Med 33(5):1282-1288.

Jin, NG., Kim, JK., Yang, DK., Cho, SJ., Kim, JM., Koh, EJ., Jung, HC., So, I., Kim, KW. 2003.

Fundamental role of ClC-3 in volume-sensitive Cl- channel function and cell volume regulation in

AGS cells. Am J Physiol Gastrointest Liver Physiol 285(5):G938-948.

Lee, KS., Kim, HJ., Li, QL., Chi, XZ., Ueta, C., Komori, T., Wozney, JM., Kim, EG., Choi, JY., Ryoo, HM.,

Page 18 of 32



Draft

19

Bae, SC. 2000. Runx2 is a common target of transforming growth factor beta1 and bone

morphogenetic protein 2, and cooperation between Runx2 and Smad5 induces osteoblast-specific

gene expression in the pluripotent mesenchymal precursor cell line C2C12. Mol Cell Biol

20(23):8783-8792.

Lin, PS., Chang, MC., Chan, CP., Lee, SY., Lee, JJ., Tsai, YL., Tseng, HC., Tai, TF., Lin, HJ., Jeng, JH. 2011.

Transforming growth factor beta1 down-regulates Runx-2 and alkaline phosphatase activity of

human dental pulp cells via ALK5/Smad2/3 signaling. Oral Surg Oral Med Oral Pathol Oral Radiol

Endod 111(3):394-400.

Lin, YY., Chen, CY., Chuang, TY., Lin, Y., Liu, HY., Mersmann, HJ., Wu, SC., Ding, ST. 2014. Adiponectin

receptor 1 regulates bone formation and osteoblast differentiation by GSK-3beta/beta-catenin

signaling in mice. Bone 64(5):147-154.

Majid, A., Brown, PD., Best, L., Park, K. 2001. Expression of volume-sensitive Cl(-) channels and ClC-3

in acinar cells isolated from the rat lacrimal gland and submandibular salivary gland. J Physiol

534(Glass et al.):409-421.

Martin, TJ, Seeman, E. 2008. Bone remodelling: its local regulation and the emergence of bone

fragility. Best Pract Res Clin Endocrinol Metab 22(5):701-722.

Moreau, R., Hurst, AM., Lapointe, JY., Lajeunesse, D. 1996. Activation of maxi-K channels by

parathyroid hormone and prostaglandin E2 in human osteoblast bone cells. J Membr Biol 150(Glass

et al.):175-184.

Nielsen, HM., Andreassen, TT., Ledet, T., Oxlund, H. 1994. Local injection of TGF-beta increases the

strength of tibial fractures in the rat. Acta Orthop Scand 65(1):37-41.

Nomura, T., Ueyama, T., Ashihara, E., Tateishi, K., Asada, S., Nakajima, N., Isodono, K., Takahashi, T.,

Page 19 of 32



Draft

20

Matsubara, H., Oh, H. 2008. Skeletal muscle-derived progenitors capable of differentiating into

cardiomyocytes proliferate through myostatin-independent TGF-beta family signaling. Biochem

Biophys Res Commun 365(4):863-869.

Norvell, SM., Alvarez, M., Bidwell, JP., Pavalko, FM. 2004. Fluid shear stress induces beta-catenin

signaling in osteoblasts. Calcif Tissue Int 75(5):396-404.

Pfeilschifter, J., Wolf, O., Naumann, A., Minne HW, Mundy GR, Ziegler R. 1990. Chemotactic

response of osteoblastlike cells to transforming growth factor beta. J Bone Miner Res 5(8):825-830.

Salingcarnboriboon, R., Tsuji, K., Komori, T., Nakashima, K., Ezura, Y., Noda, M. 2006. Runx2 is a

target of mechanical unloading to alter osteoblastic activity and bone formation in vivo.

Endocrinology 147(5):2296-2305.

Tang, Y., Wu, X., Lei, W., Pang, L., Wan, C., Shi, Z., Zhao, L., Nagy, TR., Peng, X., Hu, J., Feng, X., Van

Hul, W., Wan, M., Cao, X. 2009. TGF-beta1-induced migration of bone mesenchymal stem cells

couples bone resorption with formation. Nat Med 15(7):757-765.

Turhani, D., Item, CB., Watzinger, E., Sinko, K., Watzinger, F., Lauer, G., Ewers, R. 2005. Mutation

analysis of CLPTM 1 and PVRL 1 genes in patients with non-syndromic clefts of lip, alveolus and

palate. J Craniomaxillofac Surg 33(5):301-306.

Urano, T., Yashiroda, H., Muraoka, M., Tanaka, K., Hosoi, T., Inoue, S., Ouchi, Y., Toyoshima, H. 1999.

p57(Kip2) is degraded through the proteasome in osteoblasts stimulated to proliferation by

transforming growth factor beta1. J Biol Chem 274(18):12197-12200.

Wang, H., Huo, N., Li, F., Fu, S., Xue, Y., Yang, T., Wen, X., Ding, Y., Duan, X. 2010a. Osteogenic role of

endosomal chloride channels in MC3T3-E1 cells. Mol Cell Biochem 342(1-2):191-199.

Wang, H., Mao, Y., Zhang, B., Wang, T., Li, F., Fu, S., Xue, Y., Yang, T., Wen, X., Ding, Y., Duan, X. 2010b.

Page 20 of 32



Draft

21

Chloride channel ClC-3 promotion of osteogenic differentiation through Runx2. J Cell Biochem

111(1):49-58.

Wang, J., Xu, H., Morishima, S., Tanabe, S., Jishage, K., Uchida, S., Sasaki, S., Okada, Y., Shimizu, T.

2005. Single-channel properties of volume-sensitive Cl- channel in ClC-3-deficient cardiomyocytes.

Jpn J Physiol 55(6):379-383.

Page 21 of 32



Draft

22

Figure captions

Fig 1. Morphological characteristics of MC3T3-E1 cells under static compression. The

density of spindle cells decreased under static compression. A: regular cell culture

condition for 8 h; B: static compression loading for 8 h; C: regular cell culture

condition for 24 h; D: under static compression for 24 h. Bars = 50 μm

Fig 2. Effects of static compression on osteogenic related genes expression in

MC3T3-E1 cells. Osteogenic related genes (Ocn, Alp, Bsp, Runx2, β-catenin and Lrp6)

expression increased in MC3T3-E1 cells under static compression for 8 h and 24 h.

The expression of Tgfb decreased in static compression group and the expression

levels of Pvrl has no significant changes under static compression. *P<0.05. **P <

0.01. n = 3.

Fig 3. Effects on Clcn3 expression in MC3T3-E1 cells under static compression. A:

Western blot results. MC3T3-E1 cells were grown and transiently transfected with a

pCMV-Clcn3-HA plasmid (Clcn3 O) and total cellular protein was isolated and

subjected to Western blot analysis of CLC-3 protein expression with HA-tag antibody.

B: Real-time PCR results. Clcn3 expression was increased under static compression

for 8 h and 24 h compared to the control, respectively. MC3T3-E1 cells were grown

and transiently transfected with blank plasmid-only, ClC-3 siRNA or ClC-3 cDNA, and

then the cells were cultured under static compression for 8 h or 24 h. RNA was

Page 22 of 32



Draft

23

extracted from the cells and subjected to real-time RT-PCR analysis of Clcn3 gene

expression. 8 h M: mechanical stimulation for 8 h. 24 h M: mechanical stimulation for

24 h. Clcn3 S: the cells transfected with ClC-3 siRNA group. Clcn3 O: the ClC-3

overexpression group which was transfected with pCMV-Clcn3-HA plasmid. *P<0.05.

n = 3.

Fig 4. Effects on CLC-3 in MC3T3-E1 cells under static compression. A: The changes of

protein expression of CLC-3 under static compression in western blot. B: CLC-3

expression increased under static compression for 8 h and 24 h compared to the

control, respectively. MT+siRNA: the cells transfected with ClC-3 siRNA with

mechanical treatment. siRNA: the cells tranfected with ClC-3 siRNA. *P < 0.05.

Fig 5. Effects of static compression on CLC-3 expression in MC3T3-E1 cells. MC3T3-E1

cells were transfected with plasmid-only (A) or ClC-3 siRNA (C), and then the cells

were under static compression for 8 h, respectively (B and D). All the cells were

immunostained with anti-ClC-3 followed by FITC labeled donkey anti-mouse IgG

(shown as green) and viewed under a confocal laser scanning microscope. Nuclei

(blue) werestained with Hoechst 33342. Intensities of fluorescence of anti-ClC-3

decreased in ClC-3 siRNA group (C) compared to the control group (A). After static

compression application for 8 h (D), the intensities of fluorescence of anti-ClC-3 were

increased compared to the control group (A) and the ClC-3 siRNA group (C),

respectively.

Page 23 of 32



Draft

24

Fig 6. Effects of ClC-3 on regulation the osteogenic genes expression under static

compression. ClC-3 overexpression positive regulated the genes expression of Alp (A),

Bsp (B) and Ocn (C) and ClC-3 siRNA negative regulated the genes expression under

static compression for 8 h or 24 h compared to the control group. 8 h M: mechanical

stimulation for 8 h. 24 h M: mechanical stimulation for 24 h. Clcn3 S: the cells

transfected with ClC-3 siRNA group. Clcn3 O: the ClC-3 overexpression group which

transfected with ClC-3 cDNA. *P<0.05. n = 3.

Fig 7. Effects of ClC-3 on regulation the osteogenesis-related signaling pathway under

static compression. ClC-3 overexpression up regulated and ClC-3 siRNA down

regulated the TGF-β/Runx2 and Wnt/β-catenin pathway related molecules expression

of Lrp6 (A), β-catenin (B), Runx2 (C), Tgf-β1 (D) and Pvrl (E) under static compression

for 8 h or 24 h compared to the control group. 8 h M: mechanical stimulation for 8 h.

24 h M: mechanical stimulation for 24 h. Clcn3 S: the cells transfected with ClC-3

siRNA group. Clcn3 O: the ClC-3 overexpression group which transfected with ClC-3

cDNA.*P<0.05. n = 3.

Page 24 of 32



Draft

Table 1 Primers sequences and expected size of PCR products.

Genes Forward primer(5′--3′) Reverse primer(5′--3′)

PCR

prod

uct

size

(bp)

Clcn3 CCAAGACCCCGCTTCAATAA CGAGTCCCGCAGATTAAAGA 112

Alp CCAACTCTTTTGTGCCAGAGA GGCTACATTGGTGTTGAGCTTTT 110

Bsp CAGGGAGGCAGTGACTCTTC AGTGTGGAAAGTGTGGCGTT 158

Oc CTGACCTCACAGATCCCAAGC TGGTCTGATAGCTCGTCACAAG 187

Runx2 CGCCCCTCCCTGAACTCT TGCCTGCCTGGGATCTGTA 72

Tgfb CCGCAACAACGCCATCTATG CTCTGCACGGGACAGCAAT 118

lrp6 GCTACAAATGGCAAAGAGAATGC CAGTATACAAGCCATGACCAAACA 95

Ctnnb1 CCCACTCCTAAGAGGAGGA GGGAGACCAAAGCCTTCAT 213

Pvrl CCTACGAGAAACGAGTGGAGTT CAAAACCTTGTCATCCTGTCC 230

gapdh CATGTTCCAGTATGACTCCACTC GGCCTCACCCCATTTGATGT 136

Page 25 of 32



Draft

Fig 1. Morphological characteristics of MC3T3-E1 cells under static compression. The density of spindle cells decreased under static compression. A: regular cell culture condition for 8 h; B: static compression loading

for 8 h; C: regular cell culture condition for 24 h; D: under static compression for 24 h. Bars = 50 µm 60x43mm (300 x 300 DPI)

Page 26 of 32



Draft

Fig2. Effects of static compression on osteogenic related genes expression in MC3T3-E1 cells. Osteogenic related genes (Ocn, Alp, Bsp, Runx2, β-catenin and Lrp6) expression increased in MC3T3-E1 cells under

static compression for 8 h and 24 h. The expression of Tgfb decreased in static compression group and the

expression levels of Pvrl has no significant changes under static compression. *P<0.05. **P < 0.01. n = 3. 39x18mm (600 x 600 DPI)

Page 27 of 32



Draft

Fig 3. Effects on Clcn3 expression in MC3T3-E1 cells under static compression. A: Western blot results. MC3T3-E1 cells were grown and transiently transfected with a pCMV-Clcn3-HA plasmid (Clcn3 O) and total cellular protein was isolated and subjected to Western blot analysis of CLC-3 protein expression with HA-tag

antibody. B: Real-time PCR results. Clcn3 expression was increased under static compression for 8 h and 24 h compared to the control, respectively. MC3T3-E1 cells were grown and transiently transfected with blank plasmid-only, ClC-3 siRNA or ClC-3 cDNA, and then the cells were cultured under static compression for 8 h

or 24 h. RNA was extracted from the cells and subjected to real-time RT-PCR analysis of Clcn3 gene expression. 8 h M: mechanical stimulation for 8 h. 24 h M: mechanical stimulation for 24 h. Clcn3 S: the cells transfected with ClC-3 siRNA group. Clcn3 O: the ClC-3 overexpression group which was transfected

with pCMV-Clcn3-HA plasmid. *P<0.05. n = 3. 169x67mm (300 x 300 DPI)

Page 28 of 32



Draft

Fig 4. Effects on CLC-3 in MC3T3-E1 cells under static compression. A: The changes of protein expression of CLC-3 under static compression in western blot. B: CLC-3 expression increased under static compression for 8 h and 24 h compared to the control, respectively. MT+siRNA: the cells transfected with ClC-3 siRNA with

mechanical treatment. siRNA: the cells tranfected with ClC-3 siRNA. *P < 0.05. 53x33mm (300 x 300 DPI)

Page 29 of 32



Draft

Fig 5. Effects of static compression on CLC-3 expression in MC3T3-E1 cells. MC3T3-E1 cells were transfected with plasmid-only (A) or ClC-3 siRNA (C), and then the cells were under static compression for 8 h,

respectively (B and D). All the cells were immunostained with anti-ClC-3 followed by FITC labeled donkey

anti-mouse IgG (shown as green) and viewed under a confocal laser scanning microscope. Nuclei (blue) werestained with Hoechst 33342. Intensities of fluorescence of anti-ClC-3 decreased in ClC-3 siRNA group (C) compared to the control group (A). After static compression application for 8 h (D), the intensities of

fluorescence of anti-ClC-3 were increased compared to the control group (A) and the ClC-3 siRNA group (C), respectively.

127x190mm (300 x 300 DPI)

Page 30 of 32



Draft

Fig 6. Effects of ClC-3 on regulation the osteogenic genes expression under static compression. ClC-3 overexpression positive regulated the genes expression of Alp (A), Bsp (B) and Ocn (C) and ClC-3 siRNA negative regulated the genes expression under static compression for 8 h or 24 h compared to the control group. 8 h M: mechanical stimulation for 8 h. 24 h M: mechanical stimulation for 24 h. Clcn3 S: the cells transfected with ClC-3 siRNA group. Clcn3 O: the ClC-3 overexpression group which transfected with ClC-3

cDNA. *P<0.05. n = 3. 45x12mm (600 x 600 DPI)

Page 31 of 32



Draft

Fig 7. Effects of ClC-3 on regulation the osteogenesis-related signaling pathway under static compression. ClC-3 overexpression up regulated and ClC-3 siRNA down regulated the TGF-β/Runx2 and Wnt/β-catenin

pathway related molecules expression of Lrp6 (A), β-catenin (B), Runx2 (C), Tgf-β1 (D) and Pvrl (E) under static compression for 8 h or 24 h compared to the control group. 8 h M: mechanical stimulation for 8 h. 24 h M: mechanical stimulation for 24 h. Clcn3 S: the cells transfected with ClC-3 siRNA group. Clcn3 O: the

ClC-3 overexpression group which transfected with ClC-3 cDNA.*P<0.05. n = 3. 95x53mm (300 x 300 DPI)

Page 32 of 32



Documents

ClC-3 Chloride Channel Function as a Mechanical Sensitive · ClC-3 Chloride Channel Function as a Mechanical Sensitive Channel in Osteoblast Journal: Biochemistry and Cell Biology