Chemical induction of endogenous retrovirus particl es ...jvi.asm.org/content/early/2011/05/04/JVI.00147-11.full.pdf · 145 automated Guava PCA Flow Cytometer according to the manufacturer

1

Chemical induction of endogenous retrovirus particles from the VERO 1

cell line of African green monkeys 2

3

Hailun Ma, Yunkun Ma, Wenbin Ma, Dhanya K. Williams, Teresa A. Galvin, and 4

Arifa S. Khan* 5

6

Laboratory of Retrovirus Research, Division of Viral Products, Center for Biologics 7

Evaluation and Research, U.S. Food and Drug Administration, Bethesda, Maryland 8

20892 9

10

Running Title: ERV particles induced from AGM-VERO 11

12

*Corresponding author. Mailing address: Laboratory of Retrovirus Research, Division of 13

Viral Products, Center for Biologics Evaluation and Research, U.S. Food and Drug 14

Administration, 8800 Rockville Pike, HFM-454, Bldg. 29B, Rm 4NN10, Bethesda, 15

Maryland 20892. Telephone: (301) 827-0791. Fax: 301-496-1810. E-mail: 16

[email protected]. 17

18

Present address: Division of Product Quality, Center for Biologics Evaluation and 19

Research, U.S. Food and Drug Administration, Bethesda, Maryland 20892 20

21

Word count for the abstract: 256 words. 22

Word count for the Text: 8844 words 23

Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Virol. doi:10.1128/JVI.00147-11 JVI Accepts, published online ahead of print on 4 May 2011

on April 30, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

2

24

Keywords: Simian endogenous retrovirus (SERV), Baboon endogenous virus (BaEV), 25

African green monkey (AGM) VERO cell line, Chemical induction, 5-iodo-26

2deoxyuridine (IUdR) and 5-azacytidine (AzaC). 27

28

29

30

31

32

33

34

35

36

37

38

39

40

41

42

43

44

45

46


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

3

ABSTRACT 47

48

Endogenous retroviral sequences are present in high copy number in the genomes of all 49

species and may be expressed as RNAs, however, the majority are defective for virus 50

production. Although virus has been isolated from various Old World monkey and New 51

World monkey species, there has been no report of endogenous retroviruses produced 52

from African green monkey (AGM) tissues or cell lines. We have recently developed a 53

step-wise approach for evaluating the presence of latent viruses by chemical induction 54

(Khan et al., Biologicals, 37:196-201). Based upon this strategy, optimum conditions 55

were determined for investigating the presence of inducible, endogenous retroviruses in 56

the AGM-derived VERO cell line. Low-level reverse transcriptase activity was produced 57

with 5-azacytidine (AzaC) and with 5-iodo-2deoxyuridine (IUdR); none was detected 58

with sodium butyrate. Nucleotide sequence analysis of PCR-amplified fragments from 59

the gag, pol, and env regions of RNAs, prepared from ultracentrifuged pellets of filtered 60

supernatants, indicated that endogenous retrovirus particles related to simian endogenous 61

type D, betaretrovirus sequences (SERV) and to baboon endogenous virus type C 62

gammaretrovirus sequences (BaEV) were induced by AzaC, whereas SERV was also 63

induced by IUdR. Additionally, sequence heterogeneity was seen in the RNAs of SERV- 64

and BaEV-related particles. Infectivity analysis of drug-treated AGM-VERO cells 65

showed no virus replication in cell lines known to be susceptible to type D simian 66

retroviruses (SRVs) and to BaEV. . indicated the presence of several inducible, 67

endogenous retrovirus loci in the AGM genome. The results indicated that multiple, 68


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

4

inducible endogenous retrovirus loci are present in the AGM genome that can encode 69

noninfectious, virus-like particles. 70

71

INTRODUCTION 72

73

Endogenous retroviral sequences are stably integrated, genetically-inherited, and 74

present in multiple copies in the genomes of all species. The majority of these sequences 75

are defective; however, some may produce infectious retroviruses (9, 11, 16, 71, 78). In 76

general, newly-acquired endogenous retroviral sequences are more likely to be associated 77

with an infectious virus, whereas ancient sequences may be transcriptionally active but 78

defective for virus production (86) or produce non-infectious particles (38). In rodents, 79

endogenous retroviruses can be activated in animals as a consequence of age (4) or in cell 80

lines, either spontaneously by long-term culture passage (2, 49, 63) or by treatment with a 81

variety of inducers including biological, immunological, and chemical agents (1, 13, 17, 82

25, 39, 47, 50). In humans or nonhuman primates (NHPs), spontaneous release of 83

endogenous retroviruses has been reported from tumor tissues and cell lines, as well as 84

from normal placenta (9, 12, 14, 15, 19, 20, 27, 28, 34, 43, 44, 51, 52, 58, 62, 64-66, 69, 85

72, 73). Endogenous retroviruses have also been isolated from NHP cells by extended 86

cultivation (6-8 months) of normal primary cell cultures and cell lines (67, 75, 76, 79). 87

The number of endogenous primate retroviruses isolated thus far is limited and the virus 88

isolates or the tissues from which they were recovered are not readily available for 89

characterization by current state-of-the-art methods or for the development of reagents 90

for further investigations. 91


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

5

Endogenous retroviruses have been reported from a variety of NHP species, including 92

Old World primates and New World primates but there has been no evidence of 93

endogenous retroviral particles produced from African green monkey (AGM) tissues or 94

from cell lines derived from this species. The VERO cell line, derived from the kidney of 95

a normal, adult AGM (Chlorocebus species, formerly called Cercopithecus aethiops) 96

(87), is used broadly in research and virus diagnostics as well as in vaccine development 97

due to its broad susceptibility to infection by different viruses (6). This cell line has been 98

shown to be non-tumorigenic at low passage level (7, 18, 22, 32, 48, 54, 74, 84) and 99

negative for viruses by extensive testing using a variety of assays including PCR assays 100

and standard chemical induction (29, 74). We have recently developed a step-wise 101

strategy for using chemical inducers to optimize induction conditions for investigating 102

the presence of latent viruses (37) . We have used this strategy to evaluate activation of 103

endogenous retroviral sequences in VERO cells, which, although known to contain 104

numerous copies of endogenous retroviral sequences due to their AGM species of origin 105

(5, 8, 10, 26, 31, 36, 42, 57, 68, 81), were not expected to contain an inducible virus 106

based upon its extensive testing history and broad use of the cell line (29, 74). Here we 107

report that treatment of VERO cells with 5-azacytidine (AzaC) and with 5-iodo-108

2deoxyuridine (IUdR) induced endogenous retroviral particles related to ancient simian 109

endogenous type D betaretrovirus sequences (SERV) that are present in all Old World 110

monkeys (83) and distinct from pathogenic, type D simian retroviruses (SRVs) (46). 111

Additionally, particles containing baboon endogenous virus (BaEV)-related type C 112

gammaretrovirus sequences were also induced from Aza-C treated VERO cells. 113

Infectivity analysis of drug-treated VERO cells indicated the absence of a replicating 114


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

6

virus using various target cells known to be susceptible to SRVs and BaEV. The results 115

demonstrate the use of optimized chemical induction conditions for investigating 116

infectious, endogenous retrovirus loci in the genomes of primates and other species. 117

118

MATERIALS AND METHODS 119

120

Cell lines and chemicals. Cell lines were obtained from ATCC (Manassas, VA). The 121

VERO cell line (AGM kidney cells; ATCC, cat. no. CCL-81, lot no. 3645301; passage 122

120) was grown in Eagles minimum essential medium (modified) with Earles salts 123

without L-glutamine (EMEM; Mediatech, Manassas, VA, cat. no.15-010-CV) containing 124

5% fetal bovine serum, per ATCC instructions, (heat-inactivated at 56 C for 30 mins; 125

FBS; Hyclone, Logan, UT, cat. no. SH30071.03), 2 mM L-glutamine, 250 U of penicillin 126

per ml, and 250 g of streptomycin per ml, 1x non-essential amino acids (MEM-NEAA 127

100x, Quality Biological Inc., Gaithersburg, MD), and 1 mM sodium pyruvate (Quality 128

Biological, Inc), designated as complete medium. To maximize reproducibility of results 129

in the induction assays, a cell bank was established at passage 123. A new vial was used 130

in each experiment to maintain similar passage number in the induction studies. 131

For virus-induction studies, VERO cells were treated with different concentrations of 132

IUdR (stock solution, 75 mg per ml in 1N NH4OH; Sigma, St. Louis, MO, cat. no, 133

17125), AzaC (1 mg/ml in complete VERO cell medium; Sigma, cat. no. A1287), and 134

sodium butyrate (NaB; 0.9 M in sterile H20; Sigma, cat. no. B5887). 135

Target cell lines used in infectivity studies were: A-204 (human rhabdomyosarcoma; 136

ATCC, cat. no. HTB-82), Raji (human B cell lymphoma; ATCC, cat. no. CCL-86), and 137


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

7

Cf2Th (dog thymus, ATCC, cat. no. CRL-1430). Cf2Th cells were grown in Dulbeccos 138

modified Eagles MEM (DMEM; Invitrogen, Carlsbad, CA, cat. no. 119955) 139

supplemented with 20% FBS; A-204 and Raji cells were grown in RPMI 1640 (Quality 140

Biological, cat. no. 112-024-101) supplemented with 10% FBS and 1x NEAA. 141

Additionally, the media contained 2 mM L-glutamine, 250 U of pencillin per ml, and 250 142

g of streptomycin per ml. 143

Growth curve and population doubling time (PDT). Cells were counted using an 144

automated Guava PCA Flow Cytometer according to the manufacturers protocol (Guava 145

ViaCount Assay, Hayward, CA). Cells were diluted and the number of viable cells, dead 146

cells, and apoptotic cells were counted in triplicate. The average count of the viable cell 147

numbers was used in the experiments. For cell-cycle analysis, 0.5 x 106 cells were 148

processed and stained according to the manufacturers protocol (Guava Cell Cycle 149

Assay). 150

To determine the optimum number of cells for obtaining a sigmoidal growth curve, 151

VERO cells (0.5 x 106, 0.75 x 10

6 and 1.0 x 10

6) were planted in 5 ml complete medium 152

in 25-cm2

flasks and viable cells were counted at various times using Guava PCA 153

cytometer. Cell-cycle analysis was done to determine the cell phases. Population 154

doubling time (PDT) was calculated as 1/k =T (where T= PDT) from the linear curve in 155

the log phase from the formula N=N02kt (where N = total viable cell number at end time 156

t; N0= total viable cell number at initial time t0, t= hours from A0 to A, and k = the 157

regression constant) (60). Results were confirmed in 3 independent assays. 158

Drug-dose evaluation. VERO cells (1 x 106; passages 125 131) were planted for 159

16 h in 25-cm2 flasks before replacing medium with fresh medium containing different 160


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

8

concentrations of AzaC (0.3125-40 g/ml), IUdR (50-3200 g/ml), or NaBut (1-6 mM). 161

After 48 h drug treatment, cells were washed with medium three times (designated as day 162

0), trypsinized, and counted by Guava PCA cytometer. Another set of flasks were further 163

incubated after the medium change, and the cells were trypsinized and counted at day 3. 164

Untreated cells, at confluence, were used as control to evaluate cell toxicity and cell 165

recovery based upon the cell-confluence ratio at day 0 and at day 3, which was calculated 166

by dividing the number of viable cells in the drug-treated flask from the number of viable 167

cells at confluence in the untreated control flask (2.3 x 106) and expressed as a percent. 168

Furthermore, in case of IUdR-treated cells, additional controls were included to evaluate 169

toxicity due to NH4OH used for dissolving the drug. In case the number of cells in the 170

NH4OH-treated flask were less than those the untreated control flask, the number of 171

viable cells in the IUdR-treated flasks were divided by the number of viable cells in the 172

NH4OH-treated flasks before determining the cell-confluence ratio. 173

Chemical treatment and evaluation for induced retroviruses by the single-tube 174

fluorescent PCR-enhanced reverse transcriptase (STF-PERT) assay. VERO cells 175

were drug-treated under optimized induction conditions: cells (1x106) were planted for 16 176

h and then treated with drug for 48 h (AzaC, 1.25 g/ml, IUdR, 200 g/ml, and NaBut, 3 177

mM); Untreated cells were included as control. For kinetics of virus induction, medium 178

was replaced daily and filtered supernatant collected for detection of reverse transcriptase 179

(RT) activity by the STF-PERT assay (53). Supernatants were collected and filtered 180

(Costar Spin-X Centrifuge Tube Filters, 0.45 m Pore CA Membrane; Corning, 181

Lowell, MA) on the day of drug removal (d0) prior to washing, and then daily, at each 182

medium change. Filtered supernatants were stored at -80 C in single-use, 10 l aliquots 183


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

9

for STF-PERT analysis and in 0.5 ml aliquots for additional use. Each sample was tested 184

at 1:10 dilution (per the assay protocol) and results were obtained from triplicate samples. 185

The PERT assays for testing supernatant from drug-treated cells met the acceptability 186

criteria (53): IUdR, slope = -3.96, Y-intercept = 48.06, r2 = 0.999; AzaC, slope = -3.14, 187

Y-intercept = 42.59, r2 = 0.996; NaB, slope = -3.97, Y-intercept = 48.05, r

2 = 0.996. 188

Negative controls were cells without drug (or with NH4OH in the case of IUdR cell 189

toxicity studies) and were set up in parallel. 190

RT-PCR. Total cellular RNAs were extracted using the RNeasy Plus Mini Kit 191

(Qiagen, Valencia, CA; Cat. No. 74134) in combination with the RNase-Free DNase Set 192

(Qiagen; Cat. No. 79254) according to the manufacturers instructions. Concentration 193

and purity were determined by using UV-absorbance. 194

Low concentrated (10 x) supernatant sample was prepared from normal and drug-195

treated cells by ultracentrifugation of filtered supernatant (1.5 ml) at 45,000 rpm 196

(Beckman TLA 45 rotor) for 90 min at 4 C. RNA was prepared from the pellet by 197

resuspending it in 130 l of Promega DNase buffer, and adding 10 l DNase (1U per l; 198

RNase-free DNase, Promega, Madison, WI) for incubation at 37 C for 30 min. RNA 199

was extracted from the entire sample using QIAamp Viral RNA Mini Kit (Qiagen; cat. 200

No. 52904). 201

High concentrated (1000 x) supernatant sample was prepared from normal and from 202

AzaC-treated VERO cells (1.25 g/ml for 48 h) on day 4 post drug treatment (medium 203

was changed on day 1) by ultracentrifugation of pooled (180 ml), filtered supernatant 204

(0.45 ,Corning, Corning, N.Y., cat no 430314) on a 20% sucrose cushion (25,000 rpm in 205

a Beckman SW-28 rotor for 4 h at 4 ). Pellets were pooled, resuspended in 4 ml PBS 206


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

10

(pH 7.4) and ultracentrifuged immediately at 35,000 rpm (BeckmanSW-41 rotor) for 90 207

min at 4 . The pellet was resuspend in 180 l in PBS (pH 7.4) and stored in aliquots at 208

-80 to minimize freeze-thaw of test samples. RNA was extracted from 50 l using 209

QIAamp Viral RNA Mini Kit (Qiagen; cat no 52904) after DNase I digestion (1 U per l; 210

RNase-free DNase, Promega, Madison, WI), as described above. 211

One-half of the RNA sample was used for cDNA synthesis using iScript cDNA 212

Synthesis Kit (Bio-rad, Hercules, CA, cat. no. 170-8890) according to the manufacturers 213

instructions. The other half of the RNA was used for RT-minus control. Additionally, 214

PCR amplification using human -actin primers was performed to demonstrate absence 215

of cellular DNA according to the manufacturers protocol (Clontech, Mountain View, 216

CA, cat. no. 639008). 217

Consensus PCR primers (SRV/SERV) were designed based upon sequences of SRV-1 218

type D retrovirus (M11841), SRV-2 complete genome (AF126467), simian Mason-Pfizer 219

D-type retrovirus or SRV-3 (M12349), and simian type D virus 1, complete proviral 220

genome (U85505; designated as SERVbab in this paper). The location of the SRV/SERV 221

primers is shown in table 1: an LTR-gag fragment (553 bp) was amplified using forward 222

primer F04, 5- CTGTCTTGTCTCCATTTCT-3 and reverse primer R10, 5- 223

ACSGCAGCCATKACTTGYGG-3; a pol fragment (610 bp) was amplified using 224

forward primer F41, 5-TACAAGAYCCMTAYACCTA-3 and reverse primer R46, 5-225

TTDGGTGGRTAATGGTTRTC-3, and an env fragment (548 bp) was amplified using 226

forward primer F65, 5-CAYATNTCYGATGGAGGAGG-3 and reverse primer R70, 227

5-CCYGTCCARTTTGTRGGTA-3. PCR conditions were: 95 3 min, followed by 35 228


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

11

amplification cycles of 95 for 30 seconds, 56 for 1 min and 72 for 1 min with a 229

final extension at 72 10 min. 230

Primers for amplification of BaEV sequences and PCR cycle conditions were as 231

described previously (82): RT1 and RT2 in the pol region, and ENV1/ENV4 with nested 232

primers ENV2/ ENV3 in the env region. Additional primers were made for PCR 233

amplification in the gag region: outer primer pairs were GAG1 (5-234

GAGTGGCCCACCCTTCATGT-3) and GAG2 (5-CAGTACTGGATCGTGCGGTT-235

3), at nucleotide positions 1108-1127 and 1697-1678, respectively, and inner primers 236

pairs were GAG3 (5-CCCCGGGACGGAACTTTTGA-3) and GAG4 (5- 237

GATGAGGTAGAGGGTCTTGGAAG-3) at nucleotide positions 1135-1154 and 1420-238

1398, respectively. The nucleotide positions are based upon the sequence of the BaEV by 239

Kato et al., (35) . 240

PCR reactions were done in 25 l using 2 l cDNA template, 10 x PCR buffer 241

containing 15 mM MgCl2, 1.5 U Taq DNA polymerase (Roche Molecular Biochemicals, 242

Indianapolis, IN; cat. no. 11647687001). The final concentration of deoxynucleotide 243

triphosphates were 200 M each and primers were 1M each. 244

Nucleotide sequence analysis. PCR-amplified DNA fragments were isolated from 245

agarose gels by using Zymoclean Gel DNA Recovery kit (Zymo Research Corp, 246

Orange, CA; Cat. No. D4001) and cloned into the pGEM-T Easy vector (Promega; cat no 247

A1360). Nucleotide sequences were determined with T7 and SP6 primers using an ABI 248

3130xl Genetic Analyzer according to the manufacturers standard protocol (Applied 249

BioSystems, Foster City, CA). Sequence analysis and alignment of the sequences were 250


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

12

done using nucleotide BLAST (National Center for Biotechnology Information, National 251

Library of Medicine, NIH, Bethesda, MD). 252

Transmission electron microscopy (TEM). Supernatant (160 ml) was collected 253

from VERO cells without drug treatment and from VERO cells on day 4 after drug 254

treatment for 48 h with IdUR (200 g/ml) and AzaC (1.25 g/ml) for 48 h. 255

Ultracentrifuged pellets were obtained through a 20% sucrose cushion using the 256

procedure described above for preparation of 1000x supernatant sample. The pellets 257

were fixed overnight in McDowell and Trumps Fixative and sent to Charles River 258

Pathology Associates (Durham, NC) for evaluation of virus-like particles. The volume of 259

the pellet was measured by comparison to known standards and processed for TEM 260

analysis. Thin sections were cut, stained with methanolic uranyl acetate and Reynolds 261

lead citrate and examined by TEM. Ten grid spaces were examined and evaluated for 262

numbers of particles with retrovirus-like morphology. The number of virus-like particles 263

in the entire pellet was calculated by multiplying the number of particles tabulated in the 264

examined section by the number of potential sections in the pellet (calculated by dividing 265

the volume of the entire pellet by the volume of the section examined). The limit of 266

sensitivity of the assay was calculated as the smallest detectable amount of virus in the 267

samples or one particle in the section examined by TEM. Thus to obtain the limit of 268

sensitivity the number of potential sections in the pellet is multiplied by one. 269

Cell pellets (2 - 4 x 106) for TEM analysis were prepared by trypsinizing cells from 270

normal or AzaC-treated VERO cells, as previously described (41). 271

Infectivity analysis. Combined infectivity and coculture studies were set up with 272

cells and supernatant from drug-treated cells that were prepared by planting VERO cells 273


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

13

(1x106, passage 131) in 25-cm

2 flasks for 16 h and then treating the cells with drug for 48 274

h (AzaC, 1.25 g/ml or IUdR, 200 g/ml). Cells were washed three times with plain 275

medium to remove the drug and fresh complete medium added (day 0). Medium was 276

replaced the next day (d1); on day 4, unfiltered supernatant and cells from eight 25-cm2 277

flasks were pooled and used for infection/coculture with target cells at predetermined cell 278

ratios for equivalent growth of test and target cells. Target control cells were set up 279

without coculture, and control cocultures were set up with target cells and uninduced 280

VERO cells. 281

In case of the A-204 and Cf2Th adherent target cells, 2.7 x 106 and 1.5 x 10

6 cells, 282

respectively, were set up in 10 ml medium for preincubation with 5 ml unfiltered 283

supernatant from AzaC-treated and from IUdR-treated VERO cells (passage 131) at 37 284

C for 45 min in 75-cm2

flasks, after which trypsinized, AzaC- or IUdR-treated VERO 285

cells (about 3.0 x 106 cells per flask) were added into the corresponding flasks. The 286

coculture ratio of VERO cells to target cells was 1:1 for A-204 cells and 2:1 for Cf2Th 287

cells. In case of the Raji suspension target cells, 8 x 106 cells in 10 ml per flask were 288

incubated at 37 C for 45 min with unfiltered supernatant from AzaC- or IUdR-treated 289

VERO cells (5 ml), and then all of the cells and supernatant (total volume 15 ml) were 290

added by replacing the medium in flasks containing drug-treated VERO cells (3 x 106), 291

which had been pre-incubated for 45 min in 75-cm2 flasks. The target cells were 292

demonstrated to be susceptible to SRV (A-204 and Raji) and to SMRV (Cf2Th). Medium 293

was replaced with 13 ml of target-cell medium following overnight incubation. In the 294

case of Raji cells, the supernatant was collected, spun at 1200 rpm (GS-6KR centrifuge 295

with a GH-3.8 rotor, Beckman Instruments, Columbia, MD) for 10 min at 4 C, and the 296


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

14

Raji cells were resuspended in 10 ml medium, then added back to the flask containing 297

VERO cells in fresh 10 ml medium. Upon reaching 95% confluence, all of the cells 298

were passaged the next day (day 2) into 162-cm2

flasks. Cultures were propagated in 162-299

cm2 flasks with passage every 2-3 days until termination on day 32. 300

Extended-cell culture was done on AzaC-induced VERO cells (passage 135; 1.0 x 106 301

in 25- cm2, 1.25 g/ml in 5 mls). For extended culture, cells were washed 48 h after drug 302

treatment (= day 0, the day of drug removal) and then cultured in fresh complete medium. 303

Upon reaching confluence, cells were passaged into 75-cm2 and then into 162-cm

2 flasks 304

at the same time as the cocultures and continued in 162-cm2 flasks until termination on 305

day 34. Uninduced VERO cells were included as control. 306

The cultures were regularly monitored for cytopathic effect (CPE). Filtered 307

supernatants were collected starting at the first passage at day 4 post coculture or post 308

drug treatment, until termination, and stored at -80 C for the STF-PERT assay. 309

310

RESULTS 311

312

Determination of cell-growth characteristics. Growth curves for VERO cells were 313

determined using different cell concentrations (0.5 x 106 and 1.0 x 10

6) (Fig. 1). Similar 314

kinetics were seen in both cases (as well as with 0.75 x 106, data not shown) with the log 315

phase starting at 16 h after seeding the cells. PDT was determined from 20 h 40 h in the 316

log phase of the growth curve and calculated as described in Materials and Methods, to 317

be 16.9 h and 17.5 h, for starting cell concentrations of 0.5 x 106 and 1.0 x 10

6, 318

respectively. This indicated that any of the tested cell concentrations could be used to 319


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

15

obtain a sigmoidal growth curve for determining the beginning and end of the log phase 320

for induction studies. An independent experiment was set up to evaluate the growth curve 321

with cell-cycle analysis. The results indicated a high percentage of cells in S phase 322

(28.8%) at 16 h, which corresponded to the beginning of the log phase in the growth 323

curve (data not shown). 324

Optimization of induction conditions. The drug-dose range was determined by 325

evaluating cell toxicity and cell recovery based upon the highest drug concentrations that 326

resulted in good culture recovery at 3-4 days after drug removal, since the cells without 327

drug treatment reached confluence in 2-3 days (37). Cells were planted for 16 h before 328

adding drug, since this corresponded to the beginning of the log phase and a high 329

percentage of cells in S phase. Cells were treated for 48 h [equivalent to 2.7 PDTs; (37)] 330

with different drug concentrations (IUdR, 50 3200 g/ml; AzaC, 0.3125 40 g/ml; 331

and NaBut, 1 - 6 mM). Cell viability was determined on day 0 and on day 3, and the cell-332

confluence ratio calculated. Comparison of the results at day 0 and day 3 indicated the 333

drug concentrations (dose range) at which the cells could recover from toxicity (Fig. 2). 334

To determine the relationship between RT activity and drug dose, filtered supernatants 335

were collected at day 3 from drug-treated cells and analyzed in the STF-PERT assay: 336

increased RT activity corresponded to samples with >50% cell recovery from drug 337

toxicity (Fig. 2). Differences in cell toxicity were seen with different drugs: cells were 338

fairly resistant to IUdR and relatively sensitive to AzaC and NaBut. This was in contrast 339

to the results obtained in previous induction studies with K-BALB mouse cells, where 340

cells were sensitive to IUdR and more resistant to AzaC. In those studies, 30 g/ml 341


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

16

IUdR and 2 g/ml AzaC (39, 40) or 5 g/ml AzaC (37) (Y. Ma et al., data not shown) 342

were used with 24 h drug treatment for virus induction. 343

To evaluate the kinetics of RT production with drug treatment, cell-free supernatant 344

was collected daily and tested by STF-PERT assay. Medium for testing was collected 345

from VERO cells treated with different drug concentrations for 48 h, from day 0 (the day 346

the drug was removed) up to day 5, with daily medium change. The results of the highest 347

RT activity obtained with each drug are shown in Fig. 3: a low-level PERT activity was 348

induced with 1.25 g/ml AzaC, which peaked at day 3, whereas the peak PERT activity 349

induced with 200 g/ml IUdR was seen at day 4 (Fig. 3). It was noted that a comparable 350

peak of RT activity was seen with 100 g/ml IUdR at day 3 (Fig. 2). The RT activity 351

with IUdR was lower than AzaC at all tested drug concentrations (data not shown). No 352

reproducible PERT activity (> 10 pU per l) was seen in the case of NaBut at any drug 353

concentration (1 - 6 mM) at 24 h or at 48 h drug exposure times (Fig. 2C; Fig. 3; and data 354

not shown). Additionally, in a separate experiment, if cells were treated with different 355

drug concentrations for only 24 h (equivalent to about 1.5 PDT), the PERT activity was 356

lower and seen only at higher drug concentrations as compared with 48 h drug treatment 357

(data not shown). 358

Evaluation of retroviral sequences in the RT activity produced from drug-treated 359

VERO cells. To determine whether the drug-induced PERT activity was associated with 360

endogenous retrovirus particles, cell-free supernatants containing peak RT activity from 361

drug-treated cells (Fig. 3) were ultracentrifuged and the pelleted material (10x or 1000x) 362

was analyzed by RT-PCR assays. Consensus SERV/SRV primers amplified fragments 363

from the LTR-gag, pol, and env regions in 10x pelleted material of supernatant from 364


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

17

AzaC- and IUdR-treated VERO cells (Fig. 4A, lanes 2 and 3, respectively) whereas no 365

fragments were amplified from untreated cells or from NaB-treated cells (lanes 1 and 4, 366

respectively). The results of the first round of PCR amplification are shown in Fig. 4A, 367

which indicated greater virus induction with AzaC than with IUdR and directly correlated 368

with the PERT results (Fig. 3). Expected size fragments were PCR-amplified from 369

cellular RNAs of untreated and drug-treated cells; increased band intensities were seen in 370

the gag and env regions with all three drugs as compared with untreated cells. The 371

SERV-related sequences amplified from VERO cells were designated as SERVagm-372

VERO. 373

BaEV primers amplified fragments from the gag and env regions by nested RT-PCR 374

of 1000x pelleted supernatant from AzaC-VERO cells (Fig. 4B; supernatant panel, lanes 375

2). A pol fragment was seen after the first round of PCR amplification in the pelleted 376

supernatant from AzaC-VERO cells, as well as weakly in the pellet prepared from 377

supernatant of untreated cells (supernatant panel: lanes 2 and 1, respectively). PCR-378

amplified fragments were seen at about the same intensities in cellular RNAs of untreated 379

and drug-treated cells after the 1st round of PCR amplification with gag and pol primers 380

and strongly in AzaC-treated cells with env primers (cellular panel: lane 2). The size of 381

the gag and pol PCR-amplified fragments corresponded to the expected size based upon 382

the primers used whereas the env fragment had 4 nucleotides absent (discussed below). 383

The BaEV-related sequences amplified from VERO cells were designated as BaEVagm-384

VERO 385

No fragments were amplified using -actin primers from 10x supernatant indicating 386

the absence of contamination with cellular sequences (Fig. 4C) or from 1000x 387


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

18

supernatant (data not shown). To demonstrate the absence of contaminating DNA in the 388

cellular RNA preparations, PCR amplification was done with -actin primers in the 389

absence of RT: no fragments were seen whereas expected size fragments were seen in the 390

presence of RT. 391

Nucleotide sequence anlaysis of SERVagm-VERO DNAs cloned from supernatant 392

pellets of AzaC-treated VERO cells indicated a high degree of homology (94-96%) in 393

the gag, pol, and env regions with SERVbab as compared with SRV-1, SRV-2, and SRV-394

3/MPMV (60-81%) (Table 1). Interestingly, nucleotide sequence comparison of 395

SERVagm-VERO and simian retrovirus 1 isolate SRV_Vero, a recently described 396

endogenous simian retrovirus sequence assembled from DNA fragments originating from 397

VERO cells, indicated less homology [90-92%; GenBank accession number. HM43845; 398

(85)] than that seen with SERVbab. Nucleotide sequence analysis of BaEVagm-VERO 399

DNAs cloned from pelleted supernatant of AzaC-treated cells indicated high degree of 400

identity to BaEV (95-97%) in the pol region whereas the env sequences were highly 401

related (92-94%) to those present in SERVbab (83). (Table 2). There was 83-86% 402

sequence homology in gag with BaEV and 83-90% homology was seen in the gag and 403

pol with BaEV recombinant virus, PcEV. Additionally, there was 69-87% nucleotide 404

sequence homology in the gag, pol, and env regions to RD114, an endogenous retrovirus 405

in cats that contains BaEV env (80). Further analysis of env was done by determining 406

nucleotide sequences of 5 BaEVagm-VERO cloned DNAs. The results indicated 4 407

identical clones (represented by 519); clone 524 had 4 different nucleotides. Alignment 408

of BaEVagm-VERO env sequences with the analogous region in SERV and BaEV is 409

shown in Fig. 5. The results indicated that the BaEVagm-VERO env sequences were 410


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

19

closely related to SERV than to BaEV, except in the regions of the PCR primers; 411

however, they were distinct from SERV env due to the absence of four nucleotides, as 412

well as from previously described clones 23.1 and 25.5 that were obtained from baboon 413

DNA using the same BaEV env primers (82). It should be noted that the four-nucleotide 414

deletion in BaEVagm-VERO sequences would result in the absence of env expression 415

and therefore particles encoded from these sequences should be noninfectious. Similar 416

analysis of cloned DNAs from the gag, pol, and env regions indicated genetic 417

heterogeneity in the particles produced from SERVagm and BaEVagm sequences in 418

VERO DNA. 419

To further demonstrate that the PERT activity produced from drug-treated VERO cells 420

was particle-associated, pellets from concentrated, cell-free supernatants of normal and 421

drug-treated cells were analyzed by TEM for viruses and other microbial agents (Fig. 6). 422

Only retrovirus-like particles were reported, albeit few. There were 1.7 x 106

virus-like 423

particles calculated in the AzaC-induced virus pellet prepared from 160 ml supernatant, 424

which is near the limit of detection by TEM. No viral-like particle could be seen in the 425

pellet prepared from the control sample and the IUdR-induced supernatant, which was 426

expected since this had much lower RT activity than the AzaC-sample. Additionally, no 427

particles were seen in cell pellets. 428

Infectivity analysis. To evaluate whether the RT-containing particles induced from 429

VERO cells were replication-competent, AzaC- and IUdR-induced supernatant and cells 430

were used to infect/coculture with cell lines known to be susceptible to replication of 431

different type D simian retroviruses such as Raji and A204 for SRV and Cf2Th for 432

SMRV. Additionally, A204 and Cf2Th are susceptible to replication of BaEV (45), 433


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

20

which contains an SERV env via recombination with SERVbab (83) and Raji to other 434

SERV-recombinant viruses (24, 59). To enhance the detection of infectious virus, 435

supernatant and cells were used directly upon collection, without freeze and thaw. 436

Additionally, drug-treated VERO cells were continued in an extended culture to allow for 437

amplification of any potential virus with an ecotropic host range. The results using the 438

highly-sensitive STF-PERT assay, which can detect 1-10 retrovirus particles (53) 439

demonstrated detection of only RT activity in the starting material, which was gradually 440

reduced to background or undetectable levels, but without amplification, even upon long-441

term culture. These results indicated the absence of an infectious virus that could 442

replicate in VERO cells or that was similar in its host range properties to various known 443

infectious type D simian retroviruses (Fig. 7). 444

445

DISCUSSION 446

447

About 8-10% of the genome of NHPs contains endogenous retrovirus-related 448

sequences (23). Although the majority of these sequences are defective, full-length virus 449

genomes may exist that potentially can encode infectious viruses (71). Endogenous 450

retroviruses have been isolated from Old World monkeys, such as the baboon, langur, 451

colobus monkey and macaques, and from New World monkeys, such as the woolly 452

monkey, squirrel monkey, and owl monkey, as well as from the gibbon ape and a 453

prosimian tree shrew (9, 21, 33, 62, 67, 76-79). However, there has been no report of 454

endogenous retrovirus particles of AGM origin even though endogenous retroviral 455

sequences related to type C gammaretrovirus murine leukemia virus (MLV) and type D 456


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

21

betaretrovirus SRV are present in the genome of African green monkeys and in cell lines 457

derived from this species (56, 83, 85), and MLV-related viral DNAs cloned from AGM 458

tissue were shown to contain functional long terminal repeats (LTRs) (36). Furthermore, 459

African green monkey cell lines such as VERO and CV-1 (30) have been widely used in 460

research and diagnostics without any report of spontaneous release of virus particles. 461

Additionally, VERO cells have been extensively tested for the presence of viruses, 462

including virus-induction assays for the detection of endogenous retroviruses, and were 463

found to be negative (29, 74). 464

We recently developed a step-wise approach to evaluate the presence of inducible 465

virus sequences by chemical induction that outlines a strategy for determining optimum 466

induction conditions based upon evaluation of cell growth properties, drug treatment 467

conditions and use of sensitive assays for known and novel virus detection (37). The 468

study indicated that maximum virus induction was obtained when the drug was added to 469

the cells in the early log phase, when there was a high percentage of cells in the S phase, 470

and the cells were treated for greater than one PDT before nearing the end of the log 471

phase. Additionally, the optimum drug dose was found to be the highest dose that still 472

had good cell recovery. We used this strategy to investigate whether endogenous 473

retroviral sequences present in AGMs were inducible for virus particles using the well-474

characterized VERO cell line. Inducers known to activate endogenous retroviruses such 475

as IUdR, AzaC, and NaBut (16, 17) were used in combination with sensitive broad 476

detection assays for retroviruses such STF-PERT assay (53). In contrast to previous 477

studies (74) and to our initial experiments using induction conditions that had been 478

optimized for K-BALB mouse cells (data not shown), a low-level of PERT activity was 479


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

22

detected in cell-free supernatants of IUdR- and AzaC- treated VERO cells by following 480

the step-wise virus induction strategy (37). Further characterization of the induced RT 481

activity showed that it could be pelleted by ultracentrifugation and was therefore likely to 482

be particle-associated. RT-PCR and nucleotide sequence analysis identified SERV- and 483

BaEV-related sequences in the pellets of RT-containing supernatant from VERO cells; 484

the presence of gag, pol, and env sequences further confirmed the RT activity was 485

associated with retrovirus particles. TEM analysis demonstrated induced particles in 486

AzaC-treated VERO cells. 487

A low-level of replication-defective retroviral particles were produced from VERO 488

cells under optimized conditions of drug treatment. Efforts to increase virus production 489

under various cell culture and drug conditions known to induce viruses were not 490

successful (e.g., cell synchronization by using serum-free medium for 1 and for 2 days, 491

dexamethasone + IUdR [200 g/ml] or AzaC [1.25 g/ml] (3, 16); and IUdR [200 g/ml] 492

+ AzaC [1.25 g/ml] (40). It should be noted that a high dose of IUdR (200 g/ml) has 493

also been used to activate endogenous retrovirus from culture of the prosimian tree shrew 494

(21). These results indicate a stringent control of virus gene expression in primate cells. 495

It should be noted that the results of chemical virus induction were different in cellular 496

RNA expression and in supernatant RNAs that measured virus production. For example, 497

SERV-gag and -env RNAs were induced in cells treated AzaC, IUdR, and NaBut 498

whereas particle-associated RNAs were induced in the supernatant with only AzaC and 499

IUdR. In the case of BaEV-related RNAs, induction of gag and pol RNAs was not 500

noticed in the cell but only upon analysis of the supernatant. This discordancy in the 501


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

23

results emphasizes the need to evaluate cell-free, particle-associated RNAs for 502

investigating the potential of endogenous retrovirus sequences to encode virions. 503

Analysis of the induced virus particles from VERO cells in infection/coculture studies 504

using cell lines susceptible to SRV, BaEV, and recombinant SERVs (24, 59) followed by 505

detection with the highly-sensitive STF-PERT assay demonstrated absence of replication-506

competent virus. Additionally, long-term culture of the drug-treated VERO cells alone 507

did not result in increased PERT activity. Chemical induction studies indicated the 508

presence of endogenous retrovirus sequences in VERO cells that have the potential to 509

encode noninfectious virus-like particles containing RNAs. Although copackaging of 510

defective retroviral RNAs could result in recombination to generate an infectious virus 511

genome, based upon our data and the extensive testing of VERO cells used for 512

biologicals, there has been no evidence of emergence of an infectious retrovirus. Studies 513

are ongoing to physically and genetically characterize the retroviral particles induced 514

from VERO cells for further evaluation of the potential to generate novel recombinants. 515

SERV- and BaEV-related sequences have previously been reported in the genomes of 516

baboons and other NHP species including AGM (83, 85). It should be noted that the 517

SERV sequences in baboon have been misnamed as SRV-1 in the database [GenBank 518

accession number U85505; (83)]; furthermore, the recently reported assembled, 519

endogenous retrovirus sequences originating from VERO cells, which are related to 520

SERV in baboons, have also been designated as simian retrovirus 1 isolate SRV_Vero 521

[GenBank accession number HM143845; (85)]. It is important to recognize that SERVs 522

are distinct from SRVs, which are exogenously transmitted and pathogenic in macaques. 523

Interestingly, the SERVagm-VERO sequence associated with induced virus particles had 524


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

24

greater nucleotide sequence homology to SERVbab than to SRV_Vero sequence, 525

indicating that it originated from an ERV family in the AGM-VERO genome that is 526

distinct from SRV_Vero. The presence of multiple, related but distinct families in the 527

AGM genome has been previously described (56). Furthermore, analysis of SERVagm 528

and BaEVagm cloned DNAs in this study demonstrated sequence heterogeneity in the 529

particles induced from VERO cells. 530

The study demonstrates the presence of inducible retroviral sequences in the AGM 531

genome by use of an algorithm for determining chemical induction conditions optimized 532

for VERO cells. Moreover, this step-wise strategy may be used with emerging broad 533

virus detection technologies to identify novel endogenous retroviruses that can be 534

produced from other primate cells as well as from cell of other species. This approach 535

may also enhance the sensitivities of the currently available virus detection methods for 536

evaluating new cell substrates used for production of biological products by providing a 537

virus amplification step prior to detection. 538

539

ACKNOWLEDGEMENTS AND DISCLAIMERS 540

541

We thank Robin Levis, Andrew Lewis, Keith Peden, Hana Golding, Laraine Henchal, 542

Konstantin Chumakov, and Marion Gruber for review of the manuscript. The work done 543

in CBER, FDA has been funded by DMID/NIAID/NIH Interagency Agreement no. Y1-544

A1-4893-02. The content of this publication does not necessarily reflect the views or 545

policies of the Department of Health and Human Services, nor does mention of trade 546

names, commercial products, or organizations imply endorsement by the U.S. 547


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

25

Government. The findings and conclusions in this article have not been formally 548

disseminated by the Food and Drug Administration and should not be construed to 549

represent any Agency determination or policy. 550

551

552

REFERENCES 553

1. Aaronson, S. A., G. R. Anderson, C. Y. Dunn, and K. C. Robbins. 1974. 554

Induction of type-C RNA virus by cycloheximide: increased expression of virus-555

specific RNA. Proc Natl Acad Sci U S A 71:3941-5. 556

2. Aaronson, S. A., and C. Y. Dunn. 1974. Endogenous C-type viruses of BALB-c 557

cells: frequencies of spontaneous and chemical induction. J Virol 13:181-5. 558

3. Ahmed, M., G. Schidlovsky, K. R. Harewood, M. Manousos, and S. A. 559

Mayyasi. 1977. Expression of Mason-Pfizer and simian type C viruses in the 560

presence of 5-iododeoxyuridine and dexamethasone. J Natl Cancer Inst 58:1515-561

8. 562

4. Anderson, G. W., and P. G. Plagemann. 1995. Expression of ecotropic murine 563

leukemia virus in the brains of C58/M, DBA2/J, and in utero-infected CE/J mice. 564

J Virol 69:8089-95. 565

5. Anderssen, S., E. Sjottem, G. Svineng, and T. Johansen. 1997. Comparative 566

analyses of LTRs of the ERV-H family of primate-specific retrovirus-like 567

elements isolated from marmoset, African green monkey, and man. Virology 568

234:14-30. 569

6. ATCC, posting date. CCL-81 Vero cells. [Online.] 570

7. Bather, R., B. C. Becker, G. Contreras, and J. Furesz. 1985. 571

Heterotransplantation studies with tissue culture cell lines in various animal and 572

in vitro host systems. J Biol Stand 13:13-22. 573

8. Benveniste, R. E., R. Heinemann, G. L. Wilson, R. Callahan, and G. J. 574

Todaro. 1974. Detection of baboon type C viral sequences in various primate 575

tissues by molecular hybridization. J Virol 14:56-67. 576

9. Benveniste, R. E., M. M. Lieber, D. M. Livingston, C. J. Sherr, G. J. Todaro, 577

and S. S. Kalter. 1974. Infectious C-type virus isolated from a baboon placenta. 578

Nature 248:17-20. 579

10. Benveniste, R. E., and G. J. Todaro. 1974. Evolution of type C viral genes: I. 580

Nucleic acid from baboon type C virus as a measure of divergence among primate 581

species. Proc Natl Acad Sci U S A 71:4513-8. 582

11. Boeke, J. D., Stoye, J.P. 1997. Retrotransposons, endogenous retroviruses, and 583

the evolution of retroelements. , p. 343-435. In J. M. Coffin, Hughes, S.H., 584

Varmus, H. (ed.), Retroviruses. Cold Spring Harbor Laboratory, Cold Spring 585

Harbor, New York 586


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

26

12. Boller, K., K. Schonfeld, S. Lischer, N. Fischer, A. Hoffmann, R. Kurth, and 587

R. R. Tonjes. 2008. Human endogenous retrovirus HERV-K113 is capable of 588

producing intact viral particles. J Gen Virol 89:567-72. 589

13. Boyd, A. L., J. G. Derge, and B. Hampar. 1978. Activation of endogenous type 590

C virus in BALB/c mouse cells by herpesvirus DNA. Proc Natl Acad Sci U S A 591

75:4558-62. 592

14. Christensen, T., P. Dissing Sorensen, H. Riemann, H. J. Hansen, M. Munch, 593

S. Haahr, and A. Moller-Larsen. 2000. Molecular characterization of HERV-H 594

variants associated with multiple sclerosis. Acta Neurol Scand 101:229-38. 595

15. Christensen, T., L. Pedersen, P. D. Sorensen, and A. Moller-Larsen. 2002. A 596

transmissible human endogenous retrovirus. AIDS Res Hum Retroviruses 18:861-597

6. 598

16. Coffin, J. M. 1984. Endogenous retroviruses, p. 1109-1203. In R. Weiss, Teich, 599

N., Varmus, H., Coffin, J. (ed.), RNA tumor viruses, 2nd ed, vol. 1. Cold Spring 600

Harbor Laboratory, Cold Spring Harbor. 601

17. Coffin, J. M. 1982. Endogenous retroviruses, p. 1109-1203. In R. Weiss, Teich, 602

N., Varmus, H., Coffin, J. (ed.), RNA tumor viruses: Molecular biology of tumor 603

viruses, second ed, vol. 1. Cold Spring Harbor Laboratories, Cold Spring Harbor, 604

N.Y. 605

18. Contreras, G., R. Bather, J. Furesz, and B. C. Becker. 1985. Activation of 606

metastatic potential in African green monkey kidney cell lines by prolonged in 607

vitro culture. In Vitro Cell Dev Biol 21:649-52. 608

19. Eichberg, J. W., S. S. Kalter, R. L. Heberling, D. A. Lawlor, J. D. Morrison, 609

A. K. Bandyopadhyay, C. C. Levy, S. Yoshinoya, and R. M. Pope. 1981. In 610

vivo activation of the baboon endogenous virus. Proc Soc Exp Biol Med 166:271-611

6. 612

20. Faff, O., A. B. Murray, J. Schmidt, C. Leib-Mosch, V. Erfle, and R. 613

Hehlmann. 1992. Retrovirus-like particles from the human T47D cell line are 614

related to mouse mammary tumour virus and are of human endogenous origin. J 615

Gen Virol 73 ( Pt 5):1087-97. 616

21. Flugel, R. M., H. Zentgraf, K. Munk, and G. Darai. 1978. Activation of an 617

endogenous retrovirus from Tupaia (tree shrew). Nature 271:543-5. 618

22. Furesz, J., A. Fanok, G. Contreras, and B. Becker. 1989. Tumorigenicity 619

testing of various cell substrates for production of biologicals. Dev Biol Stand 620

70:233-43. 621

23. Gibbs, R. A., J. Rogers, M. G. Katze, R. Bumgarner, G. M. Weinstock, E. R. 622

Mardis, K. A. Remington, R. L. Strausberg, J. C. Venter, R. K. Wilson, M. 623

A. Batzer, C. D. Bustamante, E. E. Eichler, M. W. Hahn, R. C. Hardison, K. 624

D. Makova, W. Miller, A. Milosavljevic, R. E. Palermo, A. Siepel, J. M. 625

Sikela, T. Attaway, S. Bell, K. E. Bernard, C. J. Buhay, M. N. Chandrabose, 626

M. Dao, C. Davis, K. D. Delehaunty, Y. Ding, H. H. Dinh, S. Dugan-Rocha, L. 627

A. Fulton, R. A. Gabisi, T. T. Garner, J. Godfrey, A. C. Hawes, J. 628

Hernandez, S. Hines, M. Holder, J. Hume, S. N. Jhangiani, V. Joshi, Z. M. 629

Khan, E. F. Kirkness, A. Cree, R. G. Fowler, S. Lee, L. R. Lewis, Z. Li, Y. S. 630

Liu, S. M. Moore, D. Muzny, L. V. Nazareth, D. N. Ngo, G. O. Okwuonu, G. 631

Pai, D. Parker, H. A. Paul, C. Pfannkoch, C. S. Pohl, Y. H. Rogers, S. J. Ruiz, 632


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

27

A. Sabo, J. Santibanez, B. W. Schneider, S. M. Smith, E. Sodergren, A. F. 633

Svatek, T. R. Utterback, S. Vattathil, W. Warren, C. S. White, A. T. 634

Chinwalla, Y. Feng, A. L. Halpern, L. W. Hillier, X. Huang, P. Minx, J. O. 635

Nelson, K. H. Pepin, X. Qin, G. G. Sutton, E. Venter, B. P. Walenz, J. W. 636

Wallis, K. C. Worley, S. P. Yang, S. M. Jones, M. A. Marra, M. Rocchi, J. E. 637

Schein, R. Baertsch, L. Clarke, M. Csuros, J. Glasscock, R. A. Harris, P. 638 Havlak, A. R. Jackson, H. Jiang, et al. 2007. Evolutionary and biomedical 639

insights from the rhesus macaque genome. Science 316:222-34. 640

24. Grant, R. F., S. K. Windsor, C. J. Malinak, C. R. Bartz, A. Sabo, R. E. 641

Benveniste, and C. C. Tsai. 1995. Characterization of infectious type D 642

retrovirus from baboons. Virology 207:292-6. 643

25. Grolle, P. F., P. Bentvelzen, and M. J. van Noord. 1973. Activation of 644

endogenous C-type on oncornavirus by 5-bromodeoxyuridine in cultured 645

embryonic rat fibroblasts. Biomedicine 19:148-51. 646

26. Haltmeier, M., W. Seifarth, J. Blusch, V. Erfle, R. Hehlmann, and C. Leib-647

Mosch. 1995. Identification of S71-related human endogenous retroviral 648

sequences with full-length pol genes. Virology 209:550-60. 649

27. Heberling, R. L., S. S. Kalter, S. T. Barker, and O. S. Weislow. 1975. Isolation 650

and biological properties of endogenous baboon (Papio cynocephalus) type C 651

viruses. Bibl Haematol:158-60. 652

28. Hefti, E., J. Ip, W. E. Giddens, Jr., and S. Panem. 1983. Isolation of a unique 653

retrovirus, MNV-1, from Macaca nemestrina. Virology 127:309-19. 654

29. Horaud, F. 1992. Absence of viral sequences in the WHO-Vero Cell Bank. A 655

collaborative study. Dev Biol Stand 76:43-6. 656

30. Hronovsky, V., V. Plaisner, and R. Benda. 1978. CV-1 monkey kidney cell line 657

-- a highly susceptible substrate for diagnosis and study of arboviruses. Acta Virol 658

22:123-9. 659

31. Johansen, T., T. Holm, and E. Bjorklid. 1989. Members of the RTVL-H family 660

of human endogenous retrovirus-like elements are expressed in placenta. Gene 661

79:259-67. 662

32. Johnson, J. B., P. D. Noguchi, W. C. Browne, and J. C. Petricciani. 1981. 663

Tumorigenicity of continuous monkey cell lines in in vivo and in vitro systems. 664

Dev Biol Stand 50:27-35. 665

33. Kalter, S. S., and R. L. Heberling. 1976. Discovery of baboon endogenous type 666

C virus. Cancer Res 36:4197. 667

34. Kalter, S. S., R. L. Heberling, A. Hellman, G. J. Todaro, and M. Panigel. 668

1975. C-type particles in baboon placenta. Proc R Soc Med 68:135-40. 669

35. Kato, S., Matsuo, K., Nishimura, N., Takahashi, N., and Takano, T. 1987. 670

The entire nucleotide sequence of baboon endogenous virus DNA: a chimeric 671

genome structure of murine type C and simian type D retroviruses. Jpn. J. Genet. 672

62:127-137. 673

36. Kessel, M., and A. S. Khan. 1985. Nucleotide sequence analysis and enhancer 674

function of long terminal repeats associated with an endogenous African green 675

monkey retroviral DNA. Mol Cell Biol 5:1335-42. 676


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

28

37. Khan, A. S., W. Ma, Y. Ma, A. Kumar, D. K. Williams, J. Muller, H. Ma, and 677

T. A. Galvin. 2009. Proposed algorithm to investigate latent and occult viruses in 678

vaccine cell substrates by chemical induction. Biolgicals 37:196-201. 679

38. Khan, A. S., T. Maudru, A. Thompson, J. Muller, J. F. Sears, and K. W. 680

Peden. 1998. The reverse transcriptase activity in cell-free medium of chicken 681

embryo fibroblast cultures is not associated with a replication-competent 682

retrovirus. J Clin Virol 11:7-18. 683

39. Khan, A. S., J. Muller, and J. F. Sears. 2001. Early detection of endogenous 684

retroviruses in chemically induced mouse cells. Virus Res 79:39-45. 685

40. Khan, A. S., and J. F. Sears. 2001. Pert analysis of endogenous retroviruses 686

induced from K-BALB mouse cells treated with 5-iododeoxyuridine: a potential 687

strategy for detection of inducible retroviruses from vaccine cell substrates. Dev 688

Biol (Basel) 106:387-92; discussion 392-3. 689

41. Khan, A. S., J. F. Sears, J. Muller, T. A. Galvin, and M. Shahabuddin. 1999. 690

Sensitive assays for isolation and detection of simian foamy retroviruses. J Clin 691

Microbiol 37:2678-86. 692

42. Kim, H. S., B. H. Hyun, and O. Takenaka. 2002. Isolation and phylogeny of 693

endogenous retrovirus HERV-F family in Old World monkeys. Brief report. Arch 694

Virol 147:393-400. 695

43. Komurian-Pradel, F., G. Paranhos-Baccala, F. Bedin, A. Ounanian-Paraz, 696

M. Sodoyer, C. Ott, A. Rajoharison, E. Garcia, F. Mallet, B. Mandrand, and 697 H. Perron. 1999. Molecular cloning and characterization of MSRV-related 698

sequences associated with retrovirus-like particles. Virology 260:1-9. 699

44. Langat, D. K., E. O. Wango, G. O. Owiti, E. O. Omollo, and J. M. Mwenda. 700

1998. Characterisation of retroviral-related antigens expressed in normal baboon 701

placental tissues. Afr J Health Sci 5:144-52. 702

45. Lavelle, G., L. Foote, R. L. Heberling, and S. S. Kalter. 1979. Expression of 703

baboon endogenous virus in exogenously infected baboon cells. J Virol 30:390-3. 704

46. Lerche, N. W., and K. G. Osborn. 2003. Simian retrovirus infections: potential 705

confounding variables in primate toxicology studies. Toxicol Pathol 31 706

Suppl:103-10. 707

47. Lerner-Tung, M. B., S. L. Doong, Y. C. Cheng, and G. D. Hsiung. 1995. 708

Characterization of conditions for the activation of endogenous guinea pig 709

retrovirus in cultured cells by 5-bromo-2'-deoxyuridine. Virus Genes 9:201-9. 710

48. Levenbook, I. S., J. C. Petricciani, and B. L. Elisberg. 1984. Tumorigenicity of 711

Vero cells. J Biol Stand 12:391-8. 712

49. Lieber, M. M., and G. J. Todaro. 1973. Spontaneous and induced production of 713

endogenous type-C RNA virus from a clonal line of spontaneously transformed 714

BALB-3T3. Int J Cancer 11:616-27. 715

50. Long, C. W., W. A. Suk, and C. Greenawalt. 1978. Activation of endogenous 716

type C virus by amino acid alcohols. Virology 88:194-6. 717

51. Lower, R., J. Lower, H. Frank, R. Harzmann, and R. Kurth. 1984. Human 718

teratocarcinomas cultured in vitro produce unique retrovirus-like viruses. J Gen 719

Virol 65 ( Pt 5):887-98. 720


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

29

52. Lyden, T. W., P. M. Johnson, J. M. Mwenda, and N. S. Rote. 1994. 721

Ultrastructural characterization of endogenous retroviral particles isolated from 722

normal human placentas. Biol Reprod 51:152-7. 723

53. Ma, Y. K., and A. S. Khan. 2009. Evaluation of different RT enzyme standards 724

for quantitation of retroviruses using the single-tube fluorescent product-enhanced 725

reverse transcriptase assay. J Virol Methods. 726

54. Manohar, M., B. Orrison, K. Peden, and A. M. Lewis, Jr. 2008. Assessing the 727

tumorigenic phenotype of VERO cells in adult and newborn nude mice. 728

Biologicals 36:65-72. 729

55. Marracci, G. H., R. D. Kelley, K. Y. Pilcher, L. Crabtree, S. M. Shiigi, N. 730

Avery, G. Leo, M. C. Webb, L. M. Hallick, M. K. Axthelm, and et al. 1995. 731

Simian AIDS type D serogroup 2 retrovirus: isolation of an infectious molecular 732

clone and sequence analyses of its envelope glycoprotein gene and 3' long 733

terminal repeat. J Virol 69:2621-8. 734

56. Martin, M. A., T. Bryan, T. F. McCutchan, and H. W. Chan. 1981. Detection 735

and cloning of murine leukemia virus-related sequences from African green 736

monkey liver DNA. J Virol 39:835-44. 737

57. Martin, M. A., T. Bryan, S. Rasheed, and A. S. Khan. 1981. Identification and 738

cloning of endogenous retroviral sequences present in human DNA. Proc Natl 739

Acad Sci U S A 78:4892-6. 740

58. Mayer, R. J., R. G. Smith, and R. C. Gallo. 1974. Reverse transcriptase in 741

normal rhesus monkey placenta. Science 185:864-7. 742

59. Nandi, J. S., S. Van Dooren, A. K. Chhangani, and S. M. Mohnot. 2006. New 743

simian beta retroviruses from rhesus monkeys (Macaca mulatta) and langurs 744

(Semnopithecus entellus) from Rajasthan, India. Virus Genes 33:107-16. 745

60. Paul, J. 1975. Cell and tissue culture, 5th ed. Churchill Livingstone, Edinburgh, 746

London and New York. 747

61. Power, M. D., P. A. Marx, M. L. Bryant, M. B. Gardner, P. J. Barr, and P. A. 748

Luciw. 1986. Nucleotide sequence of SRV-1, a type D simian acquired immune 749

deficiency syndrome retrovirus. Science 231:1567-72. 750

62. Rabin, H., C. V. Benton, M. A. Tainsky, N. R. Rice, and R. V. Gilden. 1979. 751

Isolation and characterization of an endogenous type C virus of rhesus monkeys. 752

Science 204:841-2. 753

63. Rasheed, S., J. Bruszewski, R. Rongey, P. Roy-Burman, H. P. Charman, and 754

M. B. Gardner. 1976. Spontaneous release of endogenous ecotropic type C virus 755

from rat embryo cultures. J Virol 18:799-803. 756

64. Reitz, M. S., N. R. Miller, F. Wong-Staal, R. E. Gallagher, R. C. Gallo, and 757

D. H. Gillespie. 1976. Primate type-C virus nucleic acid sequences (woolly 758

monkey and baboon types) in tissues from a patient with acute myelogenous 759

leukemia and in viruses isolated from cultured cells of the same patient. Proc Natl 760

Acad Sci U S A 73:2113-7. 761

65. Seifarth, W., H. Skladny, F. Krieg-Schneider, A. Reichert, R. Hehlmann, and 762

C. Leib-Mosch. 1995. Retrovirus-like particles released from the human breast 763

cancer cell line T47-D display type B- and C-related endogenous retroviral 764

sequences. J Virol 69:6408-16. 765


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

30

66. Serafino, A., E. Balestrieri, P. Pierimarchi, C. Matteucci, G. Moroni, E. 766

Oricchio, G. Rasi, A. Mastino, C. Spadafora, E. Garaci, and P. S. Vallebona. 767 2009. The activation of human endogenous retrovirus K (HERV-K) is implicated 768

in melanoma cell malignant transformation. Exp Cell Res 315:849-62. 769

67. Sherwin, S. A., and G. J. Todaro. 1979. A new endogenous primate type C virus 770

isolated from the Old World monkey Colobus polykomos. Proc Natl Acad Sci U 771

S A 76:5041-5. 772

68. Shih, A., E. E. Coutavas, and M. G. Rush. 1991. Evolutionary implications of 773

primate endogenous retroviruses. Virology 182:495-502. 774

69. Smith, C. A., and H. D. Moore. 1988. Expression of C-type viral particles at 775

implantation in the marmoset monkey. Hum Reprod 3:395-8. 776

70. Sonigo, P., C. Barker, E. Hunter, and S. Wain-Hobson. 1986. Nucleotide 777

sequence of Mason-Pfizer monkey virus: an immunosuppressive D-type 778

retrovirus. Cell 45:375-85. 779

71. Stoye, J. P. 2001. Endogenous retroviruses: still active after all these years? Curr 780

Biol 11:R914-6. 781

72. Stromberg, K., and R. Benveniste. 1983. Efficient isolation of endogenous 782

rhesus retrovirus from trophoblast. Virology 128:518-23. 783

73. Stromberg, K., and R. I. Huot. 1981. Preferential expression of endogenous 784

type C viral antigen in Rhesus placenta during ontogenesis. Virology 112:365-9. 785

74. Swanson, S. K., S. J. Mento, C. Weeks-Levy, B. D. Brock, K. J. Kowal, R. E. 786

Wallace, M. B. Ritchey, and F. R. Cano. 1988. Characterization of Vero cells. J 787

Biol Stand 16:311-20. 788

75. Todaro, G. J., R. E. Benveniste, C. J. Sherr, J. Schlom, G. Schidlovsky, and 789

J. R. Stephenson. 1978. Isolation and characterization of a new type D retrovirus 790

from the asian primate, Presbytis obscurus (spectacled langur). Virology 84:189-791

94. 792

76. Todaro, G. J., R. E. Benveniste, S. A. Sherwin, and C. J. Sherr. 1978. MAC-1, 793

a new genetically transmitted type C virus of primates: "low frequency" activation 794

from stumptail monkey cell cultures. Cell 13:775-82. 795

77. Todaro, G. J., M. M. Lieber, R. E. Benveniste, and C. J. Sherr. 1975. 796

Infectious primate type C viruses: Three isolates belonging to a new subgroup 797

from the brains of normal gibbons. Virology 67:335-43. 798

78. Todaro, G. J., C. J. Sherr, and R. E. Benveniste. 1976. Baboons and their close 799

relatives are unusual among primates in their ability to release nondefective 800

endogenous type C viruses. Virology 72:278-82. 801

79. Todaro, G. J., C. J. Sherr, A. Sen, N. King, M. D. Daniel, and B. 802

Fleckenstein. 1978. Endogenous New World primate type C viruses isolated 803

from owl monkey (Aotus trivirgatus) kidney cell line. Proc Natl Acad Sci U S A 804

75:1004-8. 805

80. van der Kuyl, A. C., J. T. Dekker, and J. Goudsmit. 1999. Discovery of a new 806

endogenous type C retrovirus (FcEV) in cats: evidence for RD-114 being an 807

FcEV(Gag-Pol)/baboon endogenous virus BaEV(Env) recombinant. J Virol 808

73:7994-8002. 809


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

31

81. van der Kuyl, A. C., J. T. Dekker, and J. Goudsmit. 1995. Distribution of 810

baboon endogenous virus among species of African monkeys suggests multiple 811

ancient cross-species transmissions in shared habitats. J Virol 69:7877-87. 812

82. van der Kuyl, A. C., J. T. Dekker, and J. Goudsmit. 1995. Full-length 813

proviruses of baboon endogenous virus (BaEV) and dispersed BaEV reverse 814

transcriptase retroelements in the genome of baboon species. J Virol 69:5917-24. 815

83. van der Kuyl, A. C., R. Mang, J. T. Dekker, and J. Goudsmit. 1997. Complete 816

nucleotide sequence of simian endogenous type D retrovirus with intact genome 817

organization: evidence for ancestry to simian retrovirus and baboon endogenous 818

virus. J Virol 71:3666-76. 819

84. van Steenis, G., and A. L. van Wezel. 1981. Use of the ATG-treated newborn 820

rat for in vivo tumorigenicity testing of cell substrates. Dev Biol Stand 50:37-46. 821

85. Victoria, J. G., C. Wang, M. S. Jones, C. Jaing, K. McLoughlin, S. Gardner, 822

and E. L. Delwart. Viral nucleic acids in live-attenuated vaccines: detection of 823

minority variants and an adventitious virus. J Virol 84:6033-40. 824

86. Weiss, R. A. 2000. Ancient and modern retroviruses. Acta Microbiol Immunol 825

Hung 47:403-10. 826

87. Yasumura Y, K. Y. 1963. Studies on SV40 in tissue culture - preliminary step 827

for cancer research in vitro. Nihon Rinsho 21:1201-1215. 828

829

830

831

832

833

834

835

836

837

838

839

840

841

842


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

1

FIGURE LEGENDS 1

2

FIG. 1. VERO cell growth curves. Cells were planted in 25-cm2 flasks and total viable 3

cells were counted at various times post planting: 16 h, 20 h, 24 h, 28 h, 40 h, 44 h, 48 h, 4

52 h, and 64 h post planting. The initial number of cells planted are indicated at 0 h: 0.5 x 5

106, -- ; 1 x 10

6, --. 6

7

FIG. 2. Drug dose evaluation and PERT activity. Drug dose range for IUdR (A), AzaC 8

(B), and NaBut (C) was determined by evaluating the VERO cell viability after drug 9

treatment with varying concentrations for 48 h. Cell toxicity was determined at day 0 10

(day of drug removal) (open bars) and cell recovery was determined on day 3 (closed 11

bars) and expressed as the percent cell confluence ratio (percent of the ratio of the total 12

number of viable cells in the drug treated flask and the total number of viable cells in a 13

confluent untreated 25-cm2 flask). Cells (1 x 10

6) were planted for 16 h before the drug 14

was added: IUdR: 100 800 g/ml, shown (50 3000 g/ml tested); AzaC: 0 40 15

g/ml; and NaBut: 0 5 mM (6 mM, not shown). High cell toxicity with the 800 g/ml 16

dose of IUdR was due to 0.01 N NH4OH present in the drug. Filtered supernatant from 17

day 3 was analyzed by STF-PERT and results are indicated (-o-). No RT activity was 18

detected in untreated cells. 19

20

FIG. 3. Evaluation of virus induction from drug-treated VERO cells. VERO cells were 21

treated under optimized cell culture conditions and drug concentrations and evaluated for 22

latent virus induction. Cells (1.0 x 106) were planted in 25-cm

2 flasks for 16 h at which 23


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

2

time drug was added [IUdR (200 g/ml), AzaC (1.25 g/ml) and NaBut (3 mM)]. Forty-24

eight hours later, filtered supernatant was collected (day 0) before removing the drug, 25

cells were washed, refed with fresh medium. Supernatants were collected daily with 26

medium change, and filtered for STF-PERT assay. Control cell cultures were grown in 27

medium without drug. 28

29

FIG. 4. RT-PCR analysis of drug-treated VERO cells. RNAs were prepared from cells 30

and from filtered supernatant of AzaC-treated cells for RT-PCR using SERV/SRV 31

consensus primers (A), BaEV primers (B), and -actin primers (C). RNAs from untreated 32

cells were collected on day 2 after planting the cells (lanes 1) and from drug-treated cells 33

on day 4 (medium was changed on day 1 after drug removal) using AzaC, 1.25 g/ml, 34

IUdR, 200 g/ml, and NaBut, 3 mM) (lanes 2 4, respectively). Results using 35

SERV/SRV primers from the LTR-gag, pol and env regions are shown after the 1st round 36

of PCR with cellular RNAs and with 10x filtered supernatant RNAs (A). Results using 37

BaEV primers from the gag, pol, and env regions are shown after 1st round of PCR with 38

cellular RNAs; in the case of 1000x filtered supernatant RNAs, results are shown from 1st 39

round of PCR using pol primers and from 2nd

round of PCR using gag and env primers 40

(B). Virus identity was determined by nucleotide sequence analysis. The absence of 41

contaminating cellular DNA in the cellular RNA preparation was demonstrated by RT-42

PCR with -actin primers without adding RT (-). No fragment was amplified with -43

actin primers from 10x supernatant RNAs (C) or from 1000x supernatant preparation (not 44

shown). 45


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

3

FIG. 5. Nucleotide sequence analysis of BaEVagm-VERO env. BaEV env-related 46

clones 519 and 524, isolated from VERO cells in this study, were aligned with SERVbab 47

and BaEV, as well as with SERVagm-VERO, which was also obtained in this study using 48

consensus SERV/SRV primers). Different nucleotides are shown; dashes indicate 49

identity; dots indicate missing bases. Nucleotide positions are indicated: SERVbab, based 50

upon simian type D virus 1 (accession no. U85505); BaEV, according to the published 51

BaEV sequence of Kato et al (35); 519, 524 and SERVagm-VERO, based upon start of 52

the DNA sequences shown. 53

54

FIG. 6. TEM analysis. Ultrastructural evaluation of filtered, ultracentrifuged supernatant 55

from normal (without drug treatement) VERO cells (A), and AzaC-treated VERO cells 56

(B). Arrow indicates retrovirus-like particle. Bar = 100 nm. 57

58

FIG. 7. Infectivity analysis of drug-induced retrovirus from VERO cells. VERO cells (1 59

x 106) were planted in 25 cm

2 flasks for 16 h and treated with 1.25 g/ml AzaC or 200 60

g/ml IUdR for 48h. In the case of one flask, medium was replaced daily with fresh 61

medium and filtered supernatant collected for STF-PERT assay (D). In the case of the 62

other flasks, which were used in infectivity/coculture studies, medium was changed on 63

day 0 and d 1; on day 4 cells and supernatant were collected, pooled and used for 64

coculture with target cells at predetermined ratios for equivalent growth of test and target 65

cells (see materials and methods): Cf2Th cells (A); A204 cells (B); Raji cells (C). 66

Filtered supernatant was collected from the cocultured cells starting at the first cell 67

passage on day 4 post coculture until its termination at day 32. Samples were assayed in 68


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

4

the STF-PERT assay. Results from the AzaC-treated cells and cocultures are shown. 69

Similar results were seen in the case of IUdR-treated cells, where the induced peak PERT 70

activity was 20-fold less. 71


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

1

Table 1. Comparative nucleotide sequence analysis of cloned SERVagm-VERO DNAsa.

______________________________________________________________________

Cloned DNAsb Position (nt)

c Nucleotide Sequence Identity (%)

d

SRV-1e SRV-2

f MPMV

g SERVbab

h

______________________________________________________________________

LTR-gag (4) 395 - 947 77-78 81 78-79 95-96

pol (6) 4047 - 4656 74-75 76 73 95-96

env (4) 6501 - 7048 60-61 64-65 61-62 94-95

______________________________________________________________________

aDNAs were obtained by RT-PCR from 1000x supernatant of AzaC-treated VERO

bregions of PCR amplification; number of cloned DNAs analyzed are indicated in

parenthesis

cnucleotide positions according to the published SERV sequence of van der Kuyl et al

(83)

drange of values indicate results obtained from analysis of individual clones

eaccession no. M11841; simian SRV-1 type D retrovirus (L47.1) (61)

faccession no. M16605; simian retrovirus 2 (55)

gaccession no. M12349; Simian Mason-Pfizer D-type retrovirus (MPMV/6A) (70)

haccession no. U85505; simian type D virus 1 (83)


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

2


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

1

Table 2. Comparative nucleotide sequence analysis of cloned BaEVagm-VERO DNAsa.

______________________________________________________________________

Cloned DNAsb Position (nt)

c Nucleotide Sequence Identity (%)

d

SERVbabe

PcEVf RD114

g BaEV

h

______________________________________________________________________

gag (4) 1135 - 1420 0 83-86 73-74 83-86

pol (3) 3505 - 3871 0 88-90 85-87 95-97

env (5) 6281 - 6488 92-94 0 69-71 79-81

_______________________________________________________________________

aDNAs were obtained by RT-PCR from 1000x supernatant of AzaC-treated VERO

bregions of PCR amplification with number of cloned DNAs that were analyzed

indicated in parenthesis

drange of values indicate results obtained from analysis of individual clones

dnucleotide positions according to the published BaEV sequence of Kato et al (35)

eaccession no. U85505; simian type D virus 1 (83)

faccession no. AF142988; PcEV

gaccession no. AB559882; RD114

haccession no. D10032; BaEV


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

0 20 40 60 80105

106

Time (hours)

Via

ble

ce

ll n

um

be

r


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

0 100 200 400 8000

25

50

75

100

125

150

175

200

IUdR (g/ml)

Cell

Co

nflu

en

ce R

ati

o (

%)

0

25

50

75

100

125

150

175

200

0

5

10

15

100 200 400 800

IUdR (g/ml)

Cell

Co

nflu

en

ce R

ati

o (

%) P

ER

T A

ctiv

ity (p

U/

l, -o-)

0.00

00

0.31

25

0.62

50

1.25

00

2.50

00

5.00

00

10.0

000

20.0

000

40.0

000

0

25

50

75

100

125

150

175

200

AzaC (g/ml)

Ce

ll C

on

flu

en

ce

Ra

tio

(%

)

0

25

50

75

100

125

150

175

200

0

100

200

300

400

500

0.31

25

0.62

51.25 2.

55.0

10.0

20.0

40.0

AzaC (g/ml)

Cell

Co

nflu

en

ce R

ati

o (

%) P

ER

T A

ctiv

ity (p

U/

l, -o-)

0 2 3 4 50

25

50

75

100

125

150

175

200

NaB (mM)

Cell C

on

flu

en

ce R

ati

o (

%)

A.

B.

C.

DAY O DAY 3

0

25

50

75

100

125

150

175

200

0.0

0.2

0.4

0.6

0.8

1.0

2 3 4 5

NaB (mM)

Cell

Co

nflu

en

ce R

ati

o (

%) P

ER

T A

ctiv

ity (p

U/

l, -o-)


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

0

100

200

300

400

500

AzaC

Untreated

IUdR

NaBut

0 1 2 3 4 5

Days post drug-treatment

PE

RT

Acti

vit

y (

pU

/ l)


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

425 bp

1 2 3 4

- + - + - + - +

1 2 3 4

RT + + + +

pol367 bp

1 2 3 4 1 2 3 4

A. B.

LTR-gag 553 bp

pol610 bp

env548 bp

Supernatant Cellular

gag286 bp

1 2 1 2 3 4

env203 bp

Supernatant Cellular

C. Supernatant Cellular

-actin

590 bp

367 bp


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

SERVbab CTATGCAGGTTTTGATGACCCTCGTAAAGCGAGAGAATTAATACGAAAACAATACGGCCA 6121

SERVagm --------------G---------------A----G----C------------------- 60

519 ---C--G--G-----C--------------A----G----C------------------- 60

524 ---C--G--G-----C--------------A-A--G----C----------------T-- 60

BaEV ---C-G-G-----C--------C-----C-T----C--G---A---G-G---T----G 6341

SERVbab GCCTTGTGACTGCAGCGGAGGACAAATATCTGAACCTCCGTCAGACAGAATCACCCAGGT 6181

SERVagm ---------------A--G----------------------------------------- 120

519 ---------------A--G-------------------------....------------ 116

524 ---------------A--G-------------------------....----G------- 116

BaEV A--A--C--T---------------G-G--C--G--C-----------GG---GT--A-- 6401

SERVbab GACTTGCTCGGGCAAGACAGCGTACTTAATGCCAGACCAGTCGTGGAAATGTAAGTCTAC 6241

SERVagm ------------------------------------------------------------ 180

519 ------------------------------------------------------------ 176

524 -------------------------------------T---------------------- 176

BaEV ---------A-----------T-----------C-----AAGA--------------A-T 6461

SERVbab CCCAAGAGACACCTCCCCTAGCGGGCC 6268

SERVagm ---------------G----AT----- 207

519 ------------------A-------- 203

524 ------------------A-------- 203

BaEV T----A------------A-------- 6488


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

A. B.


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

0

100

200

300

Cf2Th + untreated-VERO

Cf2Th + AzaC-VERO

Cf2Th

Days post coculture

PE

RT

Acti

vit

y (

pU

/ l)

4 6 8 11 15 20 25 32

0

100

200

300 A204 + AzaC-VERO

A204 + untreated-VEROA204

Days post coculture

PE

RT

Acti

vit

y (

pU

/ l)

4 6 8 11 15 20 25 32

0

100

200

300 Raji + Azac-VERO

Raji

Raji + untreated-VERO

Days post coculture

PE

RT

Acti

vit

y (

pU

/ l)

4 6 8 11 15 20 25 32

0

100

200

300AzaC-VERO

0 2 4 6 8 111315 182022 252729

untreated-VERO

3234

Days post drug treatment

PE

RT

Acti

vit

y (

pU

/ l)

A. B.

C. D.


http://jvi.asm.org/

Dow

nloaded from
http://jvi.asm.org/

Documents

Chemical induction of endogenous retrovirus particl es ...jvi.asm.org/content/early/2011/05/04/JVI.00147-11.full.pdf · 145 automated Guava PCA Flow Cytometer according to the manufacturer