Characterization of the Saccharomyces castellii telomeric protein Cdc13

1

Report of Applied work for Exchange Student

Characterization of the Saccharomyces castellii telomeric protein Cdc13 Mario D. Siqueira Molecular Genetics 2006

2

Applied work carried out during the Socrates-Erasmus Exchange Programme at

The Molecular genetics of telomeres and telomerase Group from

Lund University’s Faculty of Science Department of Cell and Organism Biology, Lund, Sweden

Institutionen för cell- och organismbiologi,

Lunds universitet, Sölvegatan 35, 223 62 Lund

Supervisor at Lund University

Professor Marita Cohn

Supervisor at Faculdade de Ciências e Tecnologia/UNL

Professor Isabel Spencer-Martins

Spring Term, 2006

3

Contents

Abstract................................................................................................................................ 4

Introduction ........................................................................................................................ 5

Materials and Methods ....................................................................................................... 8

Electrophoresis of Plasmid cleavage products ............................................................... 8

Expression and Purification of scasCdc13p amplicons .................................................. 8

SDS-PAGE of different purified fractions ...................................................................... 9

5’-end labelling of oligonucleotides .............................................................................. 10

Electrophoretic Mobility Shift Assay (EMSA) .............................................................. 10

Results and Discussion ....................................................................................................... 11

References ......................................................................................................................... 15

Appendix............................................................................................................................ 16

4

Abstract

he primary function of Saccharomyces cerevisiae Cdc13p (scerCdc13p) is to

recruit protein complexes for telomeric protection and replication.

Saccharomyces castellii Cdc13p (scasCdc13p) is similar in amino acid (aa)

sequence and nucleotide sequence to the S. cerevisiae counterpart. Partial scasCDC13

constructs encompassing different regions of the gene were expressed in E. coli, affinity

purified and analysed for its binding by Electrophoretic Mobility Shift Assay. The

scerCdc13p DNA Binding Domain is known and its binding features have been studied

before. Here we showed that the truncated protein scasCdc13p-(402-824) behaves

similarly to full-length scasCdc13 protein and has the ability to bind strongly to the 5’-

GTGTCTGG-3’ telomeric sequence. In contrast, scasCdc13p-(402-659), which is shorter

in its C-terminal sequence, displays a lower ability to bind this sequence. Constructs

lacking the N-terminal failed to produce any shift.

T

Introduction

5

Introduction and Objectives

he terminal regions of eukaryotic chromosomes (telomeres) have major role in

maintaining the chromosomal integrity. During nuclear division the cell needs

to replicate the exact sequence of its helix DNA for its daughter cells and the

DNA polymerase do this replication.

One problem arises in the end of this process when the last RNA primer of the

lagging strand is removed and the absence of a free 3’ terminus prevents the association

of the DNA polymerase to fill the gap left. If the cell didn’t have any mechanism to

circumvent this problem, this erosion of the chromosomes would lead to degradation of

functional genes, to instability of the whole chromosome and eventually to apoptosis in

response to critical DNA degradation.

In human it has been observed that telomere instability is frequently associated

with either cellular aging or cancer.

Telomeres maintain the integrity of the linear chromosome in various ways. The

telomeric nucleo-protein complex and conformation protects the DNA from exonuclease

degradation while also making it distinguishable from a gap in the DNA chain – the cell

responds to DNA gaps triggering its DNA damage pathways that can lead to cell cycle

arrest or ultimately to apoptosis. Also, without this protective cap, chromosome ends

could fuse with each other leading to chromosomal aberrations.

Among other proteins that associate with telomeres we have, in Saccharomyces

cerevisiae, the Cdc13p. Cdc13p is a telomere terminus factor and it has a role not only in

the maintenance of the structural integrity of the telomere but also in recruiting

telomerase. This factor binds to the G-rich, single strand DNA.1

In telomeres we can usually find repeated units of 8-26 bp each and in some

species – like in humans – there is high homogeneity between units while in others –

like in S. cerevisiae – there is high variability in each unit.

The importance for human health of studying the Saccharomyces castellii

Cdc13p (scasCdc13p) is the fact that it is very similar to scerCdc13p which in turn is a

T

Introduction

6

functional homolog of another single-stranded binding factor in humans – the POT1.2; 3

Also, if S. cerevisiae telomeres are characterized by having irregular repeats,4 the S.

castellii telomeres are composed by homogenous repeats of 5’-TCTGGGTG-3’ units.1 So,

using S. castellii as model for telomere research might yield information more relevant

to human telomere maintenance mechanisms.

S. castellii CDC13 (scasCDC13) was identified using a BLAST of its total genomic

DNA sequence against S. cerevisiae CDC13 (scerCDC13) and displayed similar structure

with a internal DNA binding domain (DBD).5; 6 The results showed a 28% of identity for

the full-length protein and 38% for the DBD while similarity goes as high as 45% and

59%, for respective sequences.1 The scerCdc13p-DBD in complex with its DNA target has

been analysed by NMR and it has been determined to form an OB-fold

(oligonucleotide/oligosaccharide binding). OB-folds are tertiary structures formed by

β1-β2 and β4-β5 loops and they are common in telomeric DNA interacting proteins.7

The DNA-contacting residues identified in the scerCdc13p classical OB-fold domain are

highly conserved in scasCdc13p (45% identity and 82% similarity), suggesting a similar

mode of DNA binding for scasCdc13p.1 Typically a OB-fold domain interacts with small

ligands of 2 to 5 nt.8 Although only one OB-fold has been demonstrated to exist in S.

cerevisiae, a second one has been predicted bioinformatically.9 Here we are beginning

to delineate the functional DBD of scasCdc13p.

Electrophoretic mobility shift assay has been long used in studies on DNA-

protein interactions. The rationale is that a protein bound to a DNA probe (radioactively

marked) will cause a shift in its mobility in a native gel electrophoresis. Thus, by

devising different DNA probes one can test the ability of binding (or not) of a given

protein to that specific probe. Common assays include: increasing amount of protein

concentration and competition with specific and non-specific sequences.

With the identification of the scasCDC13 gene and its product protein it is

important to identify the protein region that interacts with DNA itself – the DNA

Binding Domain. Six different constructs of the scasCDC13 gene – all containing the

Introduction

7

region that has the highest amino acid identity with scerCDC13 region encoding the

DBD – had previously been constructed and cloned (see Figure 1).

Here we report the findings on the binding features of 4 of those truncated

proteins. We show that amplicon I and VI cannot produce any clear shift in an EMSA

using the known minimal binding site (MBS) while amplicon IV and V do bind albeit

showing different characteristics.

Figure 1. scasCdc13p partial constructs (amplicons). The box delimits the protein region with highest similarity and identity with scerCdc13p DBD. Amplicon I gene has 1323 bp and its protein weighs 48,9kDa. Amplicon II gene has 1970 bp and its protein weighs 73,3 kDa. Amplicon III gene has 1266 bp and its protein weighs 46,9 kDa. Amplicon IV gene has 771 bp and its protein weighs 28,6 kDa. Amplicon V gene has 1269 bp and its protein weighs 46,9 kDa. Amplicon VI gene has 570 bp and its protein weighs 26 kDa. The four shortest constructs (I, IV, V and VI) were chosen for the present DBD localization.

Materials and Methods

8


ix different scasCDC13 partial gene constructs (amplicon) were conceptualized

and prepared (as briefly described in this paragraph) prior to the studies

narrated in this report. Each construct was fused with a pGEX-6p-1 (Amersham

Biosciences) plasmid upstream to the Glutathione S-transferase (GST) gene and

transformed into E. coli (DH5α strain). scasCDC13+GST fusion constructs as well as

empty vectors were transformed into E. coli (BL21 strain) for expression.

Electrophoresis of Plasmid cleavage products

Verification of the success of previous transformation into E. coli BL21 was

required. Overnight cultures prepared with one colony of each amplicon. Amplicon I

and V were cleaved with EcoRI restriction enzyme; amplicon III, IV and VI were cleaved

with BamHI; amplicon II was cleaved with BanII. All cleavage reaction contained 1,5 μL

of cleavage buffer, aprox. 500 ng of DNA and 0,5 μL of restriction enzyme. Reactions

were incubated at 37 ̊ C for 1 hour. Reaction products were loaded to a 0,8 agarose gel

(0,8g agarose and 5 μL Ethidium Bromide) immersed in 0,25xTBE buffer (diluted from

10xTBE – 108 g/L of Tris-hydroxymethylaminomethane, 55 g/L of Boric acid and 40

mL of 0,5 M EDTA pH 8,0).

Expression and Purification of scasCdc13p amplicons

Expression of each scasCdc13p amplicon was induced in previously prepared

cultures of transformed E. coli (BL21 strain) with pGEX-6p-1 plasmid fused with one

gene construct. Overnight cultures of pGEX-6p-1 were prepared by inoculating 5 mL of

LB medium (10g/L of peptone, 5g/L of yeast extract, 10g/L of NaCl) and 2,5 μL of

ampicillin (100mg/mL) with one colony. These transformants were cultured in 1 L of LB

medium with 100 μg/mL carbenicillin at 30 ̊C to A 600=0,5. At this point IPTG was

added to a final concentration of 1 mM and the culture is left to grow for another 4h at

25 ˚C. Samples are taken before adding IPTG, after 2 hours after the growth and at the

end of 4th hour, to be analysed in SDS-PAGE. The pellet resulted by centrifugation at

S


9

6000 rpm for 20 minutes (at 4 ̊ C) is kept at -20 ˚C overnight. The pellet is thawed on

ice and resuspended in 20 mL of lysis buffer (50 mM Tris–HCl (pH 7,6), 1% (v/v)

Triton-X100, 2 mM EDTA, 10% (v/v) glycerol, 0,5 M NaCl, 5 mM DTT and 1x protease

inhibitor cocktail (Roche)) and passed through French Press 3 times. The lysate is

centrifuged (at 14000 rpm for 20 minutes, at 4 ̊ C), the supernatant is passed through a

Whatman filter and a 45 μm filter (samples are taken out for raw extract analysis) and

the resulting solution is freeze overnight at -80 ˚C. The cleared lysate is mixed with the

purification slurry (2 mL GS4B slurry and 2 mL of 1xPBS) for purification in the

Glutathione Sepharose 4B column (Amersham Biosciences). Glutathion elution buffer is

added to the column and approximately 2 mL of purified GST+scasCdc13p-construct is

collected. The first EMSA tests are performed with these hybrid proteins. Later on it was

decided to cleaved-off the GST-tag by first exchanging to a cleavage buffer and then

adding 20 units/mL of PreScission protease (Amersham Biosciences). After some other

EMSA it was decided to cleave the rest of the uncleaved fraction without the buffer

exchange step, only by adding 40 units/mL of PreScission protease directly to the

solution.

SDS-PAGE of different purified fractions

Samples precipitated and the pellet solved in SDS-PAGE Sample Buffer. For each

loading reaction 3 μL of sample is mixed with 4,5 μL of TrisHCl (0,5 M pH6,8) and 7,5

μL of 2xSDS-PAGE Sample buffer. A total of 15 μL is loaded to each well on stacking gel

(1,25 mL of Acrylamide 40% 29:1, 2,52 mL of TrisHCl 0,5 M pH6,8, 10% SDS, 10% APS

and 10 μL TEMED; for a total of 10mL volume) and run at 16mA (running buffer – 3 g/L

Tris-base, 14,4 g/L of glycine and 1 g/L of SDS). The current is then switched to 22mA at

the resolving gel (6 mL of Acrylamide 40% 29:1, 7,5 mL TrisHCl 1 M pH8,8, 10% SDS,

10% APS and 8 μL TEMED) for approximately 45 minutes. The gel is then immersed in

fixing solution (25% isopropanol and 10% acetic acid) for 45 minutes, then transferred

to the staining solution for overnight, then de-stained for 1 hour in de-staining solution

(10% acetic acid). Finally, gel is dried attached to a porous paper for 2 hours at 80 ˚C.


10

5’-end labelling of oligonucleotides

For a 10 μL reaction volume, 5 pmol/μL of oligonucleotide were mixed with 2 μL

of [γ-32P]ATP, 0,5 μL of T4 Polynucleotide kinase (5 units – Promega) and enough water

and incubated in 37 ̊C for 1 hour. Enzyme was inactivated by heat at 70 ˚C for 10

minutes. Unincorporated labelled nucleotides were removed using MicroSpin™ G-25

columns (Amersham) following manufacturer protocol.

Electrophoretic Mobility Shift Assay (EMSA)

Different fractions and elutions from protein expression and purification process were

tested using different oligonucleotides (see Table 1). Probes were labelled at 5’-end with [γ-32P]ATP and all single stranded oligonucleotides were boiled for 2 minutes and snap-cooled

before use. In all reactions 10 fmol of radioactively labelled oligonucleotide was mixed with 1

μg non-specific competitor poly(dI-dC), purified protein and binding buffer (final concentration

of 50 mM Tris-HCl – pH 7,5 –, 2,5 mM MgCl2 and 8% glycerol). For competition analysis

increasing amounts of non-labelled oligonucleotides were added to the reaction. The binding

reactions were incubated at 25 ˚C and then loaded on a 4% non-denaturing polyacrylamide gel.

The electrophoresis were carried-out in 1xTBE buffer (89 mM Tris-borate, 2 mM EDTA – pH

8,0 –) at 150 V for 2 hours and the gels were dried and analysed using a phosphorimager.

Table 1. Oligonucleotides used in this study Name Sequence 5’ to 3’ Length (nt)

Scast8E GTGTCTGG 16

Scast10C GGGTGTCTGG 10

Scast11B TGTCTGGGTGT 11

Scast12A GTCTGGGTGTCT 12

Scast12C GGGTGTCTGGGT 12

Scast14C GGGTGTCTGGGTGT 14

Scast14C5 GGGTCCTCTGGGTGT 14

Scast14C9 GGGTGTCTCCGGTGT 14

Scast16B TGTCTGGGTGTCTGGG 16

Scast16B:R CCCAGACACCCAGACA 16

Scast16C GGGTGTCTGGGTGTCT 16

Scast17A GTCTGGGTGTCTGGGTG 17

Scast20iiF ACCTGGGTGTCTGGGTGTAC 20

Results and Discussion

11


efore working with the different construct, some preliminary assays were

performed while the GST-tag was still fused to each truncated protein. All

amplicons displayed a shift in their test although some more strongly than

others (data not shown). Later on we proceeded with the protocol and the GST-tag was

cleaved after a buffer exchange. Because the following EMSA showed a drastic change in

the binding of amplicon I, IV and VI, we hypothesised that the several thawing steps and

the buffer exchange step might have had an influence in the results and thus we decided

to perform the cleavage directly in the elution buffer.

Amplicon I and VI cannot induce a shift

Although in preliminary EMSA, where different fractions of the purified

amplicon I were mixed with labelled Scast20iiF (the longest probe), a slightly faint shift

could be observed, after the cleavage of the GST-tag that shift is lost (see Figure 2). Also,

in subsequent tests with Scast10C and Scast8E it also failed to produce any shift (data

not shown).

Amplicon VI, which is the equivalent to scerCdc13p DBD, also failed to produce

any shift after cleaving off the GST-tag (data not shown). Moreover, the shift produced

by amplicon VI fused to GST-tag is almost undetectable even when tested with the

longest Scast20iiF labelled probe.

B

Figure 2 Amplicon I: shift detected when protein fused to GST (arrow, +GST) but is lost when GST is cleaved off (-GST, cleavage after the buffer exchange). All lanes has labelled Scast20iiF. Black triangles indicates increasing ammount of protein in the wells


12

Amplicon V induces a shift

Amplicon V produced a clear shift in EMSA in all its different fractions of

purification. In a test where 8-mer, 10-mer and 16-mer oligonucleotides were used it

showed that amplicon V binds more stably to the longer probe (see Figure 3) (result also

in accordance to a previous test where amplicon V bound stably to labelled Scast20iiF –

data not shown). Also important to note is that even though amplicon V binds strongly

to long probe (leaving almost no noticeable free probe) when mixed with Scast20iiF and

Scast16B we get a long smear from the well to the band of probe-protein complex. This

could indicate that we have complexes with different motilities, which might suggest

that more than one protein is being attached to the same probe or proteins aggregated

together. This could be caused by high concentration of protein (concentration of

protein was not determined after expression), which promoted the aggregation.

Alternatively it could be caused by aggregation in the well, followed by subsequent

release during the run.

Amplicon IV induces a shift

Although amplicon IV couldn’t induce any shift when mixed with the minimal

binding site (MBS) of the full-length protein, Scast8E, it showed a clear shift against

longer probes such as the Scast17A (see Figure 4). Also, in competing tests with the

reverse C-rich strand of Scast16B and double stranded Scast16B it couldn’t produce any

shift even when present in higher concentration (see Figure 5). Moreover, when mixed

with mutated Scast14C5 (5th nt mutated) and Scast14C9 (9th nt permutated) amplicon VI

also failed to produce a shift (see Figure 6a). Interestingly, this same analysis was done to

Figure 3 Amplicon V binds more strongly to long probes (arrows). (-) lanes don't have protein, (+) lanes contain full-length Cdc13p. Notice that no free probe can be detected at the gel front. Also notice the long smear in the Scast16B lanes.


13

the full-length scasCdc13p and it showed that the binding was not seriously affected by

these point mutations (see Figure 6b). This finding is interesting because previously it was

described1 that both nucleotides mutated were essential for the stability of the binding

in a shorter 10-mer oligonucleotide including the MBS at the 3’-end. Now with a longer

oligonucleotide we could retain the binding which might suggest that even though the

MBS motif is crucial for a correct binding, the size of the sequence in which MBS is

included might also be relevant. Moreover, the absence of binding with the partial

scasCdc13p, amplicon IV, could suggest that for the correct binding an additional region

of the C-end sequence may be required. This statement is in agreement to the fact that

amplicon V (which is longer than IV in the C-end direction) can bind to shorter

oligonucleotides (although no mutational analysis was made with amplicon V). This

extra sequence of amplicon V might contain the predicted second OB-fold which is

increasing the affinity of the protein to its specific motif.

Figure 4 Amplicon IV binding to labelled Scast16B is challanged by a) Scast17A b) Scast11B. Competitor 10x, 100x and 1000x the concentration of Scast16B as indicated by black triangles.

Figure 5 First lane contains Amplicon IV mixed with Scast16B. Second lane full-length is mixed with the complementing oligonucleotide Scast16B:R. Next 3 lanes contain increasing amount of amplicon IV mixed with Scast16B:R while the last 3 lanes the same were mixed with double strand Scast16B:R/F.


14

Moreover, amplicon I differs from IV and V in lacking part of the N-terminal

sequence. Since amplicon I failed to show any clear binding we suggest that the gene

construct did not include (at least) the total sequence necessary for the DBD. However

we cannot exclude the possibility that the amplicon I protein was not properly folded.

These are all very preliminary findings and more conclusive statements cannot be

made before further studies with Amplicon V and eventually amplicon III, which

includes more of the N-end sequence and which could elucidate the amplicon I result.

For the next steps we would suggest the creation of an additional amplicon based

on amplicon VI but adding to it the portion of C-terminal sequence included in amplicon

V to elucidate the presence of a second OB-fold. Furthermore, and depending on results

given by studying these two amplicons (III and VI with amplicon V C-terminal) the

creation of further shorted amplicons would delimit more accurately the DBD and its

hypothetical two OB-folds.

Figure 6 a) Amplicon IV mixed (in increasing amount) with Scast14C5 (first 2 lanes) and Scast14C9 (next 4 lanes). The (+) lane is the control with amplicon IV binding to Scast14C. b) Full-length scasCdc13p (in increasing amount) mixed with Scast14C (first 4 lanes), with Scast14C5 (next 4 lanes) and Scast14C9 (last 4 lanes). Black triangles indicates increasing amount of protein.

15

References

1. Rhodin, J., Astromskas, E. & Cohn, M. (2006). Characterization of the DNA

binding features of Saccharomyces castellii Cdc13p. J Mol Biol 355, 335-46.

2. Lin, J. J. & Zakian, V. A. (1996). The Saccharomyces CDC13 protein is a single-

strand TG1-3 telomeric DNA-binding protein in vitro that affects telomere

behavior in vivo. Proc Natl Acad Sci U S A 93, 13760-5.

3. Nugent, C. I., Hughes, T. R., Lue, N. F. & Lundblad, V. (1996). Cdc13p: a single-

strand telomeric DNA-binding protein with a dual role in yeast telomere

maintenance. Science 274, 249-52.

4. Shampay, J. & Blackburn, E. H. (1988). Generation of telomere-length

heterogeneity in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 85, 534-8.

5. Cliften, P. F., Hillier, L. W., Fulton, L., Graves, T., Miner, T., Gish, W. R.,

Waterston, R. H. & Johnston, M. (2001). Surveying Saccharomyces genomes to

identify functional elements by comparative DNA sequence analysis. Genome Res

11, 1175-86.

6. Garvik, B., Carson, M. & Hartwell, L. (1995). Single-stranded DNA arising at

telomeres in cdc13 mutants may constitute a specific signal for the RAD9

checkpoint. Mol Cell Biol 15, 6128-38.

7. Mitton-Fry, R. M., Anderson, E. M., Hughes, T. R., Lundblad, V. & Wuttke, D. S.

(2002). Conserved structure for single-stranded telomeric DNA recognition.

Science 296, 145-7.

8. Theobald, D. L., Mitton-Fry, R. M. & Wuttke, D. S. (2003). Nucleic acid

recognition by OB-fold proteins. Annu Rev Biophys Biomol Struct 32, 115-33.

9. Theobald, D. L. & Wuttke, D. S. (2004). Prediction of multiple tandem OB-fold

domains in telomere end-binding proteins Pot1 and Cdc13. Structure 12, 1877-9.

16

Appendix

Documents

Characterization of the Saccharomyces castellii telomeric protein Cdc13