Characterization of the hrpZ gene from Pseudomonas syringae pv. maculicola M2

César Álvarez-Mejía1, Dalia Rodríguez-Ríos2, Gustavo Hernández-Guzmán3,Varinia López-Ramírez4, Humberto Valenzuela-Soto5, Rodolfo Marsch6

1Instituto Tecnológico Superior de Irapuato Plantel Abasolo, Guanajuato, México.2Departamento de Ingeniería Genética de Plantas, Centro de Investigación y de Estudios Avanzados del

Instituto Politécnico Nacional, Guanajuato, México.3División de Ciencias de la Vida, Universidad de Guanajuato, Guanajuato, México.

4Instituto Tecnológico Superior de Irapuato, Guanajuato, México.5Departamento de Plásticos en Agricultura, Centro de Investigación en Química Aplicada,

Coahuila, México6Departamento de Biotecnología y Bioingeniería, Centro de Investigación y de Estudios Avanzados del

Instituto Politécnico Nacional, D.F. México, México.

Submitted: August 2, 2014; Approved: November 16, 2014.

Abstract

Pseudomonas syringae pv. maculicola is a natural pathogen of members of the Brassicaceae plantfamily. Using a transposon-based mutagenesis strategy in Pseudomonas syringae pv. maculicola M2(PsmM2), we conducted a genetic screen to identify mutants that were capable of growing in M9 me-dium supplemented with a crude extract from the leaves of Arabidopsis thaliana. A mutant contain-ing a transposon insertion in the hrpZ gene (PsmMut8) was unable to infect adult plants fromArabidopsis thaliana or Brassica oleracea, suggesting a loss of pathogenicity. The promotorless cat

reporter present in the gene trap was expressed if PsmMut8 was grown in minimal medium (M9) sup-plemented with the leaf extract but not if grown in normal rich medium (KB). We conducted phylo-genetic analysis using hrpAZB genes, showing the classical 5-clade distribution, and nucleotidediversity analysis, showing the putative position for selective pressure in this operon. Our results in-dicate that the hrpAZB operon from Pseudomonas syringae pv. maculicola M2 is necessary for itspathogenicity and that its diversity would be under host-mediated diversifying selection.

Key words: hrpZ, mutant non-pathogenic, transmid, Tn5, phylogenetic.

Introduction

The majority of Gram-negative pathogenic bacteriaare endowed with the type III secretion system, which is ahighly conserved apparatus that exports proteins that areessential to induce disease (Deane et al., 2006; Tang et al.,2006; Mansfield, 2009). Exported proteins play an impor-tant role in disease development at the cellular level. Inphytopathogenic bacteria, the apparatus is called the Hrpsystem and is encoded by the hrp gene cluster (hyper-sensitivity response and pathogenicity) (Alfano and Col-lmer, 2004; Block and Alfano, 2011), which is usuallyincluded in a pathogenicity island (Gropp and Guttman,2004). The product of these genes is a structure resembling

a straight flagellum (Jin et al., 2001; Arnold et al., 2011), ofwhich the Hrp pilus contacts the plant cell surface duringinfection (Büttner, 2012). Two types of proteins are expor-ted through the Hrp pili: the avr (avirulence) gene productsand the “harpins,” which are products of the hrpZ and hrpW

genes (Reboutier and Bouteau, 2008; Schumacher et al.,2014). Avr proteins appear to be injected into plant cells(Jin et al., 2001; Fu et al., 2006), where they modulate thecell metabolism to export nutrients to the apoplast (vanDijk et al., 1999). In an incompatible interaction, the Avrprotein is recognized by the product of a gene for resis-tance, R, which triggers the hypersensitive response and re-sults in disease abortion (Mansfield, 2009). The harpins are

Brazilian Journal of Microbiology 46, 3, 929-936 (2015) Copyright © 2015, Sociedade Brasileira de MicrobiologiaISSN 1678-4405 www.sbmicrobiologia.org.brDOI: http://dx.doi.org/10.1590/S1517-838246320140655

Send correspondence to R. Marsch. Departamento de Biotecnología y Bioingeniería, Cinvestav. Avenida I.P.N 2508, Colonia San Pedro Zacatenco,07360. México, D.F. México. E-mail: rmarsch@cinvestav.mx.

Research Paper

encoded by hrp genes but are not included in the hrp pilusstructure; instead, they are secreted into the medium or theapoplast, where they perform their activity. The function ofharpins is not fully known (Choi et al., 2013). There arecontradictory reports regarding HrpZ being essential (He et

al., 1993) or not (Preston, 2000) for pathogenesis.

In this work, the function of the hrpZ gene from P.

syringae pv. maculicola strain M2 (PsmM2) was inter-rupted using a transposable element promoter probe. Themutant strain was unable to infect adult plants fromArabidopsis thaliana or Brassica oleracea, indicating acomplete loss of bacterial pathogenicity. The PsmM2 hrpZ

gene is almost identical to its homolog in Pseudomonas

syringae pv. tomato DC3000, suggesting that pathovars areconserved among distinct susceptible plant species. Our re-sults suggest that hrpZ is an essential gene that is necessaryfor bacterial infection in plants.

Materials and Methods

Bacterial strains, plants and plasmids

Pseudomonas syringae pv. maculicola strain M2(RifR) was a kind gift from Dr. Jeffrey L. Dangl (Ritter andDangl, 1995), and PsmMut8 was obtained in this work. E.

coli S17-1 �pir (thi pro hsdR hsdM �recA RP4-2traTc::MuKm::Tn7) (de Lorenzo et al., 1990) was obtained from Dr.Kate J. Wilson. E. coli DH5� competent cells (supE44

�lacU169 (f80 lacZ DM15) hsdR17 recA1 endA1 gyrA96

thi-1 relA1) (Sambrook and Russell, 2001) were used forcloning experiments. A SwaI restriction site was added intothe SmaI site on pUIRM504 (Marsch-Moreno et al., 1998)to form the plasmid pMDC505 (unpublished results); withthis change, the transposable element pTn5cat (Marsch-Moreno et al., 1998) was modified into pTn5cat1. King’s Bmedium (King et al., 1954), minimal medium M9 (Sam-brook and Russell, 2001) or M9CA (Difco) was used to cul-ture P. s. maculicola strains and in the assay to determinethe conditions for cat expression, with or without the addi-tions described below. LB medium was used to culture theE. coli strains. Chloramphenicol, rifampicin and kanamy-cin were purchased from Serva or Sigma-Aldrich Chemi-cals.

Mutagenesis and mutant selection

Mutants of PsmM2 were generated using thetransmid element pTn5cat1 according a published protocol(Marsch-Moreno et al., 1998). E. coli S17-1 (pMDC505)was used to mobilize pTn5cat1 to PsmM2 by conjugation,and the bacteria were then spread onto M9 Rif50 Km50

plates. Mutants were screened for their ability to growth onM9 Cm50 with plant extract. To obtain crude plant extract,mature rosette leaves from 3-week-old Arabidopsis

thaliana plants were frozen in liquid nitrogen and groundinto a powder, which was then centrifuged at 13,000 rpm

for 10 to 20 min. The liquid phase was recovered and addedto the growth medium as an effector of pathogenesis.

Assay for promoter strength

The promoter strength was evaluated as the cell den-sity after the bacteria were grown in a medium containingchloramphenicol (Alvarez-Mejia et al., 2013). The assayswere performed in sterile 96-well polystyrene plates. First,50 �L of a 0.04-OD620 culture of mutant PsmMut8 in KBKm50 was added to wells containing 200 �L of M9, M9Caor KB medium supplemented or not with plant extract(2 �L/mL) or sucrose (5%); all media contained kanamycin(50 �g/mL) and chloramphenicol (150 �g/mL). The plateswere incubated at 28 °C, and the cell density was measuredat 0, 24 and 48 h using a Titertek Multiskan Plus (EFLAB,Joint Venture Company of Lab System and Flow Labora-tories) with a 492-nm filter.

Pathogenesis assays

To test the ability of the mutants to induce disease inA. thaliana, 3-week-old plants were inoculated by infiltra-tion with mutant or wild type PsmM2 cell suspensions(~20 �L per leaf). The cell suspensions were prepared bygrowing PsmMut8 or PsmM2 in 5 mL KB, incubated at28 °C overnight with strong shaking to reach an 0.4 ofOD600. Then, 3 mL were centrifuged at 14,000 rpm for 2min at 4 °C (rotor: Sorvall SS34). The pellet was washedtwo times with sterile water, and the cells were resuspendedin 3 mL of sterile distilled water. Leaves were inoculatedwith the undiluted cell suspension or with a 1:10 dilution.

Cloning and sequencing

Total PsmMut8 DNA was purified using a previouslydescribed method (Chen and Kuo, 1993). First, ten �g ofDNA were completely digested using the restriction endo-nuclease EcoRI in a reaction volume of 50 �L. The enzymewas then inactivated at 65 °C for 20 min. Next, 1 �g of cutDNA was religated with T4 DNA ligase in a reaction vol-ume of 50 �L at 28 °C for 4 h. The ligated DNA was thenused to transform competent E. coli DH5� cells to becomekanamycin resistant. To sequence the cloned chromosomalfragments, oligonucleotides 1212 (5’-GTGCCTGACTGCGTTA-3’; from the mob end), 1213(5’-CCTTAGCTCCTGAAA-3’: from the cat end), 1658(5’-GTTGACCTACGTCAACGCTGGC-3’), 2176(5-GTGTCGAACACCGAAAG-3 to sequence hrpB), and2149 (5-TCTGAAGAGTGGCGTTGGAAGC-3 to se-quence hrpA) were used. Restriction endonucleases and T4DNA ligase were purchased from New England BioLabs,Inc. or Invitrogen. Enzymes were used following the sup-pliers’ recommendations.

930 Álvarez-Mejía et al.

Bioinformatics analysis and alignment

hrpAZB operons from diverse Pseudomonas strainswere retrieved from the GenBank database and used in ouranalysis (Table 1). Most of them had been used in a previ-

ous work (Inoue and Takikawa, 2006). Nucleotide poly-morphism analysis was conducted using DnaSP (Rozas et

al., 2003), and the sliding window analysis for hrpAZB

operon was conducted using 25 nt in a window of 50 nt onlyfor unique P. syringae strains. Bioinformatics analysis wasperformed using the BLASTn program (Altschul et al.,1990; Worley et al., 1998), and alignments were performedusing Clustal W and edited with BioEdit (Hall, 1999);Pseudomonas viridiflava and Pseudomonas cichorii wereincluded as outgroups.

Results

Selection of PsmMut8

A collection of PsmM2 mutants harboring thepTn5cat1 transposon-based construct was screened for theinduction of cat expression in M9 medium containing aplant extract (see the Materials and Methods section for de-tails). A total of 14 candidates were identified by their abil-ity to grow in M9 Km50 Cm150 because the reporter gene cat

was induced by the plant extract. All of these mutants weretested in pathogenesis assays by inoculating Arabidopsis

plants. Mutant number 8 (PsmMut8) was selected becauseit was unable to infect and cause disease symptoms or hy-persensitivity reaction (HR) in either A. thaliana or Bras-

sica oleracea (Figure 1).

Promoter expression detected in PsmMut8

The cat reporter gene in pTn5cat1 allows for the esti-mation of promoter expression under conditions that re-semble those in the apoplast. The cell density in liquidmedia in the presence of chloramphenicol is associatedwith the resistance level to the antibiotic, suggesting thatthe measurement of cell density in the presence of chloram-phenicol in different media (M9, M9Ca or KB) with orwithout the addition of plant extract or sucrose reflects theexpression level of the detected promoter under these con-ditions (Alvarez-Mejia et al., 2013). The cell density valuesof PsmMut8 growing in different media at 28 °C after 48 hare shown in Figure 2. The cell density was higher in M9than in KB medium, suggesting that chloramphenicol resis-tance in response to the plant extract was increased in M9but that casamino acids preclude the stimulatory effect ofthe plant extract. No different effects were observed in theassay with sucrose.

pTn5cat1 is inserted into a gene homologous to thehrpZ gene of Pseudomonas syringae

A 14-kb chromosomal fragment corresponding to thepTn5cat1 borders and their flanking genomic sequenceswere cloned, sequenced, and compared to the genomic in-formation contained in GenBank. Both flanking sequencesare homologous to the hrpZ gene from Pseudomonas

syringae pv. tomato DC3000 (PstDC3000) (99% identity,six nucleotide substitutions over 1,110 bp, Figure 3A).

hrpZ from P. syringae M2 931

Table 1 - Strains used in the phylogenetic analysis. All of the data were re-trieved from GenBank.

Bacteria Strain Accession

Pseudomonas syringae

sesami PSES-1 AB112563

lachrymans cucum-1 AB112561

? “kiwi” KW741 AB112559

eriobotryae PERB8031 AB112557

oryzae 1-1.1 AB112580

coronafaciens AVPCO8101 AB112578

aceris kaede1-1 AB112576

japonica BPST802 AB112574

striafaciens avena2 AB112579

magnoliae PMG8101 AB112570

theae tea632 AB112568

mori mori1 AB112562

morsprunorum U7805 AB112560

myricae yamamomo801 AB112558

dendropanacis kakuremino-1 AB112556

pisi Pisum-1 AB112577

phaseolicola NPS3121 AB112552

tomato DC3000 AF232004

ICMP2844 AB112567

tagetis LMG5090 DQ246442

aptata SB8601 AB112575

tabaci ATCC11528 FJ946987

lapsa NCPPB2096 AB112573

actinidiae KW11 AB112571

delphinii PDDCC529 AB112569

maculicola R1 AB112565

M2 AY325899

PMC8301 AB112566

glycinea r0 AB112554

race4 L41862

syringae 61 EF514224

LOB2-1 AB112572

ICMP3414 AB112581

Pseudomonas savastanoi

savastanoi 5 FR717896

Pseudomonas

viridiflava RMX23.1a AY597282

cichorii SPC9018 AB433910

ficuserectae L-7 AB112564

Alignment with other sequences reported in GenBank forHrpZ proteins revealed two shared regions betweenPsmM2 and PstDC3000, including genomic locations102-125, IGAGGGGGGIGGAGSGSGVGGGLS, and229-244, SGVTSGGGLGSPVSDS.

Additional sequences flanking pTn5cat1 are similarto the hrp genes of Pseudomonas syringae DC3000

To further investigate the location of the interruptedgene in PsMut8, we sequenced the regions upstream anddownstream of hrpZ. All of the generated sequences corre-sponded to previously identified genes encoding Hrp pro-teins: hrpS, hrpA, hrpZ, hrpB and hrpC (Figure 3B). Thefirst and the last open reading frames (ORFs) were only

partially sequenced. A putative hrp box (GGAACCGATTCGCAGGCTGCTGCCACCTA) was identified in the 5’region of hrpA (Zwiesler-Vollick et al., 2002), and a puta-tive ribosome binding site (RBS) was identified within thehrpA gene. The 3’-UTRs of hrpA and hrpZ are predicted tofold into hairpin structures reminiscent of bacterial tran-scription terminators (TGAGTACCAAGCAATCACGCTGGTAAATCTTA and GCCCCCTCATCAGAGGGGGC,respectively). The presence of a putative RBS within theterminator suggests that the transcription of hrpZ proceedsindependently of hrpA. To explore a possible conservationof the hrpAZB operon in different pathovars, includingPsmM2 and PstDC3000, we conducted a phylogeneticanalysis with 35 Pseudomonas syringae sequences; 2 dif-

932 Álvarez-Mejía et al.

Figure 1 - Pathogenesis and HR assays for PsmM2 and PsmMut8. A. Arabidopsis leaves were infected by PsmM2 but not by PsmMut8. B. HR assay incollard leaves; PsmM2 but not PsmMut8 was able to produce HR, similarly to hrpZ- from Pseudomonas syringae pv. glycinea (Psg) and Pseudomonas

syringae pv. tomato DC3000 (PstDC3000). Phosphate buffer was used as a control.

Figure 2 - PsmMut8 was cultured at 28 °C for 48 h in M9, M9Ca or KB medium. All of the media contained chloramphenicol (Cm, 150 �g/mL), and someof the media were supplemented with plant extract (Ext) or sucrose (Suc).

ferent Pseudomonas species were included as outgroups.Our analysis was based on maximum likelihood estima-tions and the Kimura two-parameter substitution modelwith 1000 bootstraps. Our results showed that PsmM2 be-longs to phylogroup II, as described by Inoue (Inoue andTakikawa 2006), or group 5, as described by Guttman

(Guttman et al., 2006), and is closely related to the tomato

pathovar, as well as to other maculicola strains (Figure 4).They also showed that nucleotide polymorphisms withinthe operon are particularly abundant in the hrpA gene andthe 5 region of hrpZ, whereas polymorphisms are less abun-dant in the intergenic regions (Figure 5).

hrpZ from P. syringae M2 933

Figure 3 - A. The insertion of pTn5cat1 into the hrpZ gene. IR, inverted repeated; cat, chloramphenicol acetyltransferase; neo, neomycinphosphotransferase; oriColE1, replication origin type ColE1; mob, mobilization region from RP4. The PacI, PmeI and SwaI restriction sites are shown. Theangled arrows indicate the position of the oligonucleotides for the following sequences: A. 1213, 5’-TTTCAGGAGCTAAGG-3’; B. 1212,5’-GTGCCTGACTGCGTTA-3’; and C. 1638, 5’-CGTGGTTTGCAGTCGGTTT-3’. B. The genes detected around pTn5cat1 are similar to hrpS, hrpA,hrpB and hrpC (GenBank accession number AY325899).

Figure 4 - Phylogenetic distribution of the hrpABZ operon by the maximum likelihood method. PsmM2 is located in clade V, and P. s. tagetis is basal toclades IV and V.

Discussion

The use of a Tn5 derivative carrying suitable reportergenes has allowed for the isolation of bacterial genes thatare responsive to a variety of environmental conditions(Haapalainen et al., 2012). As a means to simulate condi-tions prevalent in the apoplast (low osmotic pressure, lowpH, and the absence of amino acids, polysaccharides andphenolic compounds), we used a transposon-based elementto isolate mutants showing high expression levels of the cat

gene in the presence of plant extract or minimal medium(Marsch-Moreno et al., 1998). In selected mutants, richmedium partially blocked cat expression. Analogous to thisobservation, rich medium containing a nitrogen source hasbeen shown to negatively regulate hrpL, a transcriptionalregulator of hrpRS, indicating a possible regulatory rolemediated by operons with an hrp box in their promoter se-quence (Jovanovic et al., 2011). This regulation is antago-nistic to those mutants prevailing in minimal mediumenriched with plant extracts, which was shown to inducethe expression of gacS, a positive regulator of hrpL (Chat-terjee et al., 2003). Our conditions are similar to those thatinduce the activity of other pathogenicity genes such as avr,hrp, and argK, as well as the expression of genes involvedin the synthesis of coronatine, syringomycin and phaseo-lotoxin (Rahme et al., 1992; Palmer and Bender, 1993;Budde et al., 1998; Zwiesler-Vollick et al., 2002; Ortiz-Martin et al., 2010). The incubation of P. syringae at a lowtemperature and low pH can also induce the activity of hrp

genes, suggesting that the global activity of genes involvedin pathogenesis is correlated with the activity of genes in-volved in the stress response (Hauser, 2009). The naturalconditions that are necessary for the expression of the pro-moter detected in PsmMut8 resemble those describedabove. The expression of a detected regulatory sequencewas also stimulated in M9 medium. Casamino acids havetwo effects: on one hand, they facilitate growth and par-tially circumvent the necessity of synthesizing amino acids;

on the other, they inhibit the stimulation of transcription byplant metabolites (Schumacher et al., 2014). On the basis ofour results, the regulation of the hrpZ promoter can be pre-dicted to respond to environmental conditions and to di-verse metabolites that depend on the presence of aminoacids (Schumacher et al., 2014). Our results also show thatour assay could serve as a probe to searching for specificplant metabolites capable of inducing the expression ofgenes related to pathogenesis in P. syringae.

The transposon insertion in PsmMut8 interrupts thefunction of a gene homologous to hrpZ from P. s. tomato

DC3000. Its sequence is distinct from other reported HrpZproteins by 28 glycine-rich peptide residues that are absentin most family members; however, the percentage of simi-larity among family members is high (99.5%), and the di-vergence is small (0.5%). Figure 4 shows the phylogeneticstructure of the hrpAZB operon between Pseudomonas spe-cies. The distribution from 35 pathovars is similar to thatreported by Guttman and Inoue in five phylogroups (Inoueand Takikawa, 2006; Guttman et al., 2006). The operonhrpAZB belongs to phylogroup II, sharing features with thetomato and maculicola pathovars. The nucleotide polymor-phism analysis shows that hrpA is the most diverse gene(Figure 5), as was reported by Guttman (Guttman et al.,2006). This gene appears to be under positive selectioncompared with hrpZ and hrpB, suggesting a possible role ofthis gene during the fast co-evolution of host-pathogen in-teractions (Gropp and Guttman 2004; Mansfield 2009).Additionally, a possible interaction of the HrpZ hairpin andthe N-terminal region of HrpA could be related to the nu-cleotide sequence of the 5 hrpZ region. Regions with lownumbers of nucleotide polymorphisms include the hrp box,the RBS region, and the putative translational signal re-gions of each gene detected in this work. It is not surprisingthat PstDC3000 has been included as a member of themaculicola pathovar, and, similarly to PsmM2, PstDC3000is capable of infecting A. thaliana (Bao et al., 2014). It hasbeen previously described that hrpZ is not essential forpathogenesis in P. s. tomato or syringae. Although our re-sults indicate that PsmMut8 is non-pathogenic, based onthe location of transcription termination sequences aroundthe replication origin and the pas sites, it is possible that theinsertion of the transposable element resulted in a polar mu-tation (Balbas et al., 1986). Additional experiments will benecessary to explore the function of hrpB or the importanceof hrpZ in the control of pathogenesis (Accession numberAY325899).

Acknowledgments

We would like to acknowledge Dr. Jeff Dangl for pro-viding the PsmM2 strain, as well as Dr. Carol Bender atOklahoma State University for her support with the patho-genesis assays and plants. This work was supported bygrants from Consejo Nacional de Ciencia y Tecnología

934 Álvarez-Mejía et al.

Figure 5 - Nucleotide polymorphism analysis (pi) for the hrpAZB operon.Only sequences from Pseudomonas syringae pathovars were used. bp,base pair.

(Conacyt No. 28539-N) and Consejo de Ciencia y Tecno-logía del Estado de Guanajuato (Concyteg).

ReferencesAlvarez-Mejia C, Hernandez-Guzman G, Curiel-Quesada E et al.

(2013) The use of cell density to estimate the bacterial pro-moter strength. J Pure Appl Microbiol 7:1743-1748.

Alfano JR, Collmer A (2004) Type III secretion system effectorproteins: double agents in bacterial disease and plant de-fense. Annu Rev Phytopathol 42:385-414.

Altschul SF, Gish W, Miller W et al. (1990) Basic local alignmentsearch tool. J Mol Biol 215:403-410.

Arnold DL, Lovell HC, Jackson RW et al. (2011) Pseudomonas

syringae pv. phaseolicola: from ‘has bean’ to supermodel.Mol Plant Pathol 12:617-627.

Balbas P, Soberon X, Merino E et al. (1986) Plasmid vectorpBR322 and its special-purpose derivatives—a review.Gene 50:3-40.

Bao Z, Stodghill PV, Myers CR et al. (2014) Genomic PlasticityEnables Phenotypic Variation of Pseudomonas syringae pv.tomato DC3000. PLos One 9:e86628.

Block A, Alfano JR (2011) Plant targets for Pseudomonas

syringae type III effectors: virulence targets or guarded de-coys? Curr Opin Microbiol 14:39-46.

Büttner D (2012) Protein export according to schedule: architec-ture, assembly, and regulation of type III secretion systemsfrom plant- and animal-pathogenic bacteria. Microbiol MolBiol Rev 76:262-310.

Chatterjee A, Cui Y, Yang H et al. (2003) GacA, the response reg-ulator of a two-component system, acts as a master regulatorin Pseudomonas syringae pv. tomato DC3000 by control-ling regulatory RNA, transcriptional activators, and alter-nate sigma factors. Mol Plant Microbe Interact 16:1106-1117.

Chen WP, Kuo TT (1993) A simple and rapid method for the prep-aration of Gram-negative bacterial genomic DNA. NuclAcids Res 21:2260.

Choi MS, Kim W, Lee C et al. (2013) Harpins, multifunctionalproteins secreted by Gram-negative plant-pathogenic bacte-ria. Mol Plant Microbe Interact 26:1115-1122.

Deane JE, Roversi P, Cordes FS et al. (2006) Molecular model ofa type III secretion system needle: Implications for host-cellsensing. Proc Natl Acad Sci USA 103:12529-12533.

de Lorenzo V, Herrero M, Jakubzik U et al. (1990) Mini-Tn5

transposon derivatives for insertion mutagenesis, promoterprobing, and chromosomal insertion of cloned DNA inGram-negative eubacteria. J Bacteriol 172:6568-6572.

Gropp SJ, Guttman DS (2004) The PCR amplification and charac-terization of entire Pseudomonas syringae hrp/hrc clusters.Mol Plant Pathol 5:137-140.

Guttman DS, Gropp SJ, Morgan RL et al. (2006) Diversifying se-lection drives the evolution of the type III secretion systempilus of Pseudomonas syringae. Mol Biol Evol 23:2342-2354.

Hall TA (1999) BioEdit: a user-friendly biological sequencealignment editor and analysis program for Windows95/98/NT. Nucleic Acids Symp Ser 41:95-98.

Haapalainen M, Dauphin A, Li CM et al. (2012) HrpZ harpinsfrom different Pseudomonas syringae pathovars differ inmolecular interactions and in induction of anion channel re-sponses in Arabidopsis thaliana suspension cells. PlantPhysiol Biochem 51:168-174.

Hauser AR (2009) The type III secretion system of Pseudomonas

aeruginosa: infection by injection. Nat Rev Microbiol7:654-665.

Inoue Y, Takikawa Y (2006) The hrpZ and hrpA genes are vari-able, and useful for grouping Pseudomonas syringae bacte-ria. J Gen Plant Pathol 72:26-33.

Jin Q, Hu W, Brown I et al. (2001) Visualization of secreted Hrpand Avr proteins along the Hrp pilus during type III secre-tion in Erwinia amylovora and Pseudomonas syringae. MolMicrobiol 40:1129-1139.

Jovanovic M, James EH, Burrows PC et al. (2011) Regulation ofthe co-evolved HrpR and HrpS AAA+ proteins required forPseudomonas syringae pathogenicity. Nat Commun 2:177.

Mansfield JW (2009) From bacterial avirulence genes to effectorfunctions via the hrp delivery system: an overview of 25years of progress in our understanding of plant innate immu-nity. Mol Plant Pathol 10:721-734.

Marsch-Moreno R, Hernández-Guzmán G, Alvarez-Morales A(1998) pTn5cat: a Tn5-derived genetic element to facilitateinsertion mutagenesis, promoter probing, physical mapping,cloning, and marker exchange in phytopathogenic and otherGram-negative bacteria. Plasmid 39:205-214.

Ortiz-Martín I, Thwaites R, Macho AP et al. (2010) Positive regu-lation of the Hrp type III secretion system in Pseudomonas

syringae pv. phaseolicola. Mol Plant Microbe Interact23:665-681.

Palmer DA, Bender CL (1993) Effects of environmental and nu-tritional factors on production of the polyketide phytotoxincoronatine by Pseudomonas syringae pv. glycinea. Appl En-viron Microbiol 59: 1619-1626.

Preston GM (2000) Pseudomonas syringae pv. tomato: the rightpathogen, of the right plant, at the right time. Mol PlantPathol 1:263-275.

Rahme LG, Mindrinos MN, Panopoulos NJ (1992) Plant and en-vironmental sensory signals control the expression of hrp

genes in Pseudomonas syringae pv. phaseolicola. JBacteriol 174:3499-3507.

Reboutier D, Bouteau F (2008) Harpins and ion channels modula-tions: Many ways to die. Plant Signal Behav 3:314-316.

Ritter C, Dangl JL (1995) The avrRpm1 gene of Pseudomonas

syringae pv. maculicola is required for virulence onArabidopsis. Mol Plant Microbe Interact 8:444-453.

Rozas J, Sanchez-Del Barrio JC, Messeguer X et al. (2003)DnaSP, DNA polymorphism analyses by the coalescent andother methods. Bioinformatics 19: 2496-2497.

Sambrook J, Russell DW (2001) Molecular Cloning: A laboratorymanual. (3rd ed) Cold Spring Harbor Laboratory Press. USA.

Schumacher J, Waite CJ, Bennett MH et al. (2014) Differentialsecretome analysis of Pseudomonas syringae pv tomato us-ing gel-free MS proteomics. Front Plant Sci 5:242.

Tang X, Xiao Y, Zhou JM (2006) Regulation of the type III secre-tion system in phytopathogenic bacteria. Mol Plant MicrobeInteract 19:1159-1166.

van Dijk K, Fouts DE, Rehm AH et al. (1999) The Avr (effector)proteins HrmA (HopPsyA) and AvrPto are secreted in cul-ture from Pseudomonas syringae pathovars via the Hrp(type III) protein secretion system in a temperature- andpH-sensitive manner. J Bacteriol 181:4790-4797.

Worley KC, Culpepper P, Wiese BA et al. (1998) BEAUTY-X:enhanced BLAST searches for DNA queries. Bioinfor-matics 14:890-891.

Zwiesler-Vollick J, Plovanich-Jones AE, Nomura K et al. (2002)Identification of novel hrp-regulated genes through func-

hrpZ from P. syringae M2 935

tional genomic analysis of the Pseudomonas syringae pv. to-

mato DC3000 genome. Mol Microbiol 45:1207-1218.Associate Editor: Fernando Dini Andreote

All the content of the journal, except where otherwise noted, is licensed under aCreative Commons License CC BY-NC.

936 Álvarez-Mejía et al.