Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Characterization of a Copper Resistance and
Transport System in Streptococcus Mutans
By
Kamna Singh
A thesis submitted in conformity with the requirements for the degree of
Doctor of Philosophy
School of Graduate Studies
Faculty of Dentistry
University of Toronto
© Copyright by Kamna Singh 2015
ii
Characterization of a Copper Resistance and
Transport System in Streptococcus Mutans
Kamna Singh
Doctor of Philosophy
Faculty of Dentistry
University of Toronto
2015
I. Abstract
Proteins and enzymes require metal ions as enzymatic cofactors for optimal
biological activities. Copper metal ion is utilized by various bacterial systems in trace
amounts; however, it can be extremely toxic at higher concentrations. The copYABZ
operon, involved in copper homeostasis, has been extensively studied and
characterized in several Gram positive bacteria. CopA and CopB encode for P-type
ATPases, involved in copper translocation, whereas, CopY and CopZ regulate the
expression of the cop operon. In Streptococcus mutans, the primary etiological agent
of dental caries, copYAZ has been partially investigated for its role in copper
transport and resistance. In this study, we demonstrated the probable mechanisms by
which copper induces toxicity in S. mutans; and elucidated the role of copYAZ
operon in modulating copper transport and resistance, as well as other physiological
processes of this oral pathogen. Copper induces toxicity by generating oxidative
stress and dissipating membrane potential in S. mutans. During biofilm growth,
copper impaired S. mutans ability to adhere to a surface and produce biofilm
biomass; while significantly repressing the expression of genes involved in
iii
maintaining the functional and structural integrity of biofilm matrix. Results from
copper transport studies validated the role of copYAZ in copper efflux in S. mutans.
The knock-out strain in copYAZ (∆copYAZ) was more sensitive to copper, oxidative
and acid stress relative to its wild type. Loss of copYAZ resulted in prolonged
membrane depolarization in S. mutans. The presence of copper and/or the absence of
copYAZ significantly impaired S. mutans ability to acquire foreign DNA from the
surrounding environments; while repressing the transcription of genes involved in
competence development. The copYAZ-associated phenotypes were further validated
via genetic complementation studies. Taken collectively, we illustrated the
implications of copper-induced toxicity in S. mutans; and have provided evidence
describing the importance of copYAZ operon in copper resistance and transport,
biofilm formation, acid and oxidative stress tolerance, maintenance of membrane
potential, and genetic transformation in S. mutans.
iv
II. Acknowledgments
First and foremost, I would like to express my deepest gratitude to my supervisor Dr.
Dennis Cvitkovitch for his support, expert guidance, understanding, patience, and
encouragement over the course of my graduate program. Very special thanks to my
co-supervisor Dr. Celine Levesque, for providing me with the motivation and
encouragement to pursue this research project. I am very grateful to my advisory
committee members Dr. Trevor Moraes, Dr. Anil Kishen and Dr. Dilani Senadheera
for their aspiring guidance and invaluably constructive criticism.
I am thankful to Ms. Gursonika Binepal for her help and support. I would like to
extend my thanks to other members of Cvitovitch Lab, particularly, Mr. Andrew
Latos, Ms. Kirsten Krastel, Ms. Marie-Christine Kean and Ms. Iwona Wenderska.
Finally, I thank my family for their unconditional love and support. To Mom, Papa,
Ravi, Sahil, Jai and Tanu, I am ever grateful to you all for always being there for me.
Thank you.
v
III. Table of Contents
I. Abstract .......................................................................................................................... ii
II. Acknowledgments ........................................................................................................... iv
III. Table of Contents ............................................................................................................ v
IV. List of Tables ................................................................................................................. vii
V. List of Figures ..............................................................................................................viii
VI. List of Abbreviations ....................................................................................................... x
VII. Preface .......................................................................................................................... xii
1 Literature Review ............................................................................................................ 1
1.1 The oral cavity ................................................................................................................. 1
1.1.1 Microbial habitats of the oral cavity ................................................................. 1
1.1.2 Acquisition of oral microflora ........................................................................... 2
1.1.3 Oral biofilms ...................................................................................................... 4
1.1.4 Oral diseases...................................................................................................... 8
1.1.5 Oral streptococci ............................................................................................. 10
1.2 Streptococcus mutans .................................................................................................... 11
1.2.1 Acidogenicity and aciduricity .......................................................................... 12
1.2.2 Biofilm formation ............................................................................................. 13
1.2.3 Regulatory systems in S. mutans ...................................................................... 14
1.2.4 Genetic competence ......................................................................................... 16
1.2.5 Metal homeostasis............................................................................................ 19
2 An intimate link: two component signal transduction systems and metal transport
systems in bacteria ................................................................................................................. 25
2.1 Abstract ......................................................................................................................... 26
2.2 Introduction ................................................................................................................... 26
2.3 Copper homeostasis ...................................................................................................... 28
2.4 A link between Copper and Silver homeostasis ............................................................ 32
2.5 Manganese homeostasis ................................................................................................ 32
2.6 Cadmium Zinc Cobalt Homeostasis .............................................................................. 34
2.7 Nickel Homeostasis ....................................................................................................... 36
2.8 Future perspectives ....................................................................................................... 38
2.9 Executive summary ........................................................................................................ 39
3 Statement of the problem ............................................................................................... 41
3.1 Rationale and objectives ............................................................................................... 42
3.2 General hypothesis ........................................................................................................ 43
3.3 Objectives and aims ...................................................................................................... 43
4 The copYAZ operon functions in copper efflux, biofilm formation, genetic
transformation and stress tolerance in Streptococcus mutans ............................................... 44
4.1 Abstract ......................................................................................................................... 45
4.2 Importance .................................................................................................................... 46
vi
4.3 Introduction ................................................................................................................... 46
4.4 Material and methods .................................................................................................... 49
4.4.1 Strains and growth conditions ......................................................................... 49
4.4.2 Minimum inhibitory concentration (MIC) assays ............................................ 49
4.4.3 Mutant and complemented strain construction ............................................... 50
4.4.4 Biofilm assays .................................................................................................. 53
4.4.5 Acid tolerance response (ATR) assays............................................................. 53
4.4.6 Growth kinetic analysis ................................................................................... 54
4.4.7 Copper transport assays .................................................................................. 54
4.4.8 Quantitative real time PCR Assays .................................................................. 55
4.4.9 Membrane potential assays ............................................................................. 56
4.4.10 Genetic transformation assays......................................................................... 56
4.5 Results ......................................................................................................................... 58
4.5.1 Copper is toxic to S. mutans and copYAZ is required for copper resistance
in S. mutans ...................................................................................................... 58
4.5.2 CopYAZ has a role in copper export in S. mutans ........................................... 61
4.5.3 Copper inhibits biofilm formation and copYAZ is required to tolerate copper
stress under biofilm growth. ............................................................................ 64
4.5.4 Copper affects the transcription of gtfs and glucan binding protein (gbp)
genes. ............................................................................................................... 67
4.5.5 Copper-induces oxidative stress and CopYAZ modulates oxidative stress
tolerance. ......................................................................................................... 68
4.5.6 Copper inhibits growth under acid stress and CopYAZ modulates the acid
tolerance response of S. mutans ...................................................................... 73
4.5.7 Copper induces membrane depolarization and CopYAZ helps maintain
membrane potential. ........................................................................................ 77
4.5.8 Addition of copper and loss of copYAZ alters transformability of S. mutans .. 80
4.5.9 Copper represses the expression of genes associated with genetic
competence....................................................................................................... 83
4.6 Discussion ..................................................................................................................... 84
4.7 Acknowledgements ........................................................................................................ 89
5 Summary and Conclusions ............................................................................................ 90
5.1 Effects of copper on bacterial physiology ..................................................................... 90
5.2 Characterization of the copYAZ operon ........................................................................ 92
5.3 Effect of copper and CopYAZ in genetic competence ................................................... 95
6 Future directions and significance ................................................................................ 97
6.1 Future directions ........................................................................................................... 97
6.2 Significance ................................................................................................................... 99
VIII. References ................................................................................................................... 101
vii
IV. List of Tables
Table 2-1 Bacterial TCSTS and metal ions ................................................................ 40
Table 4-1 Bacterial strains and plasmids used in this study ....................................... 51
Table 4-2 Primer Sequences used in this study .......................................................... 52
viii
V. List of Figures
Figure 1-1 Diagram representing microbial composition of dental plaque .................. 8
Figure 1-2 Model of CSP- and XIP-induced quorum sensing in S. mutans. .............. 18
Figure 1-3 Metal homeostasis model.......................................................................... 20
Figure 1-4 The copYABZ operon of E. hirae .............................................................. 22
Figure 1-5 Genetic organization of S. mutans copYAZ operon .................................. 23
Figure 4-1 Growth analysis in the presence and absence of copper ........................... 59
Figure 4-2 Growth kinetics under copper stress ......................................................... 60
Figure 4-3 Role of CopYAZ in copper export ........................................................... 62
Figure 4-4 Growth kinetics and transport studies using E. coli strains ...................... 63
Figure 4-5 Effect of copper on biofilm formation ...................................................... 64
Figure 4-6 Cell adherence assays ............................................................................... 66
Figure 4-7 Gene expression analysis of different biofilm matrix-related genes ........ 68
Figure 4-8 Growth Kinetics in the presence and absence of glutathione ................... 69
Figure 4-9 Copper-induced oxidative stress, and involvement of CopYAZ in
protection against oxidative stress .............................................................................. 70
Figure 4-10 Growth kinetics under oxidative stressors .............................................. 72
Figure 4-11 Growth of S. mutans under acid stress with or without copper .............. 74
Figure 4-12 Doubling times under acid stress with or without copper ...................... 75
Figure 4-13 Acid tolerance response assays ............................................................... 76
Figure 4-14 Membrane potential in cells exposed to copper ...................................... 79
Figure 4-15 Transformation frequency assays ........................................................... 81
Figure 4-16 Colony forming units of viable cells at different copper concentrations 82
Figure 5-1 Summary of role of copper and copYAZ operon in S. mutans .................. 94
ix
Figure 5-2 Effect of copper and copYAZ on the competence regulon of S. mutans ... 96
x
VI. List of Abbreviations
aa amino acid
AEP acquired enamel pellicle
ATP adenosine tri-phosphate
ATR acid tolerance response
bp base pair
Ca calcium
CCCP carbonyl cyanide 3-chlorophenylhydrazone
CDM chemically-defined medium
cDNA complementary DNA
CFUs colony forming units
CSP competence-stimulating peptide
Cu copper
DNA deoxyribonucleic acid
EDTA ethylenediaminetetraacetic acid
EPS extracellular polymeric substance
Erm erythromycin
Ftf fructosyltransferase
Gbp glucan-binding protein
Gtf glucosyltransferase
h hour
H2O2 hydrogen peroxide
LB luria broth
xi
GCF gingival crevicular fluid
Ig immunoglobulin
MIC minimum inhibitory concentration
min minute
Mg magnesium
Mn manganese
OD optical density
PBS phosphate buffered saline
PCR polymerase chain reaction
ROS reactive oxygen species
s second
Spec spectinomycin
spp species
TCSTS two-component signal transduction system
THYE Todd Hewitt yeast extract
TYE Tryptone yeast extract
TE Tris-EDTA
v/v volume per volume
XIP sigX-inducing peptide
xii
VII. Preface
Format of the dissertation
The presented dissertation is written in the "Publishable Style". Chapter 1 provides
introduction to the subject and presents the background for the following chapters.
Chapter 2, the review article published in Future Microbiology, describes the link
between bacterial two component systems and their metal transporters. Chapter 3 states
the purpose and rationale of the study. Chapter 4 describes the experimental data that
have been accepted for publication in Journal of Bacteriology. Chapter 5 provides a
brief summary and conclusions drawn from this study and chapter 6 presents the future
directions and significance of this study. The thesis is presented in a format to improve
readability and avoid repetition between the chapters.
1
1 Literature Review
1.1 The oral cavity
1.1.1 Microbial habitats of the oral cavity
The oral cavity represents one of the most diverse and dynamic ecosystems in the human body
known to be colonized with over 700 identified microbial species [1-2]. It is distinct from other
body sites due to the presence of 1) specialized mucosal surfaces such as lips, tongue, cheek, and
palate; 2) hard non-shedding tooth surfaces; 3) saliva; and 4) gingival crevicular fluid (GCF),
that sustain a diverse array of microbes adapted to a biofilm lifestyle, commonly referred to as
plaque [3-4]. The mucosal and tooth surfaces provide the substratum for microbial colonization,
whereas, host oral fluids such as saliva and gingival crevicular fluid provide nutrients and assist
in bacterial adherence for community development on these surfaces [3-4]. Chronologically, in
the oral cavity of a new born baby, the only site available for microbial colonization is the
infant's oral mucosa [5]. The oral mucosa is predominately comprised of stratified squamous
epithelium, and contains specialized mucosal surfaces containing either keratinized (hard palate,
attached gingiva and dorsal surface of tongue) or non-keratinized (all other mucosa of oral
cavity) epithelial cells [3, 6]. The biomass of microbial communities in the oral mucosa in an
infant is restricted by the continuous desquamation of the epithelial cells [7]. On the mucosal
surfaces a variety of distinct habitats exists, each of which provides unique ecological and
biochemical conditions to selectively support the growth and co-existence of specific microbial
species [4, 8]. A major ecological perturbation in the infant’s oral cavity occurs following tooth
eruption around a few months after birth that provides new hard non-shedding surfaces for
microbial colonization [9-11]. While the process of primary dentition is completed by the age of
3 years, the permanent teeth start to erupt around 6 years and completed by the age of 12 years
(Source: American Academy of Pediatric Dentistry). The loss and eruption of teeth causes
perturbations in the local environment, resulting in alterations in the composition of microbial
community [3, 12]. Like the oral mucosa, teeth also provide a variety of sites for colonization
and growth of different microbial communities [9, 13-14]. Variations in the biochemical
properties depending on the anatomy of the tooth can sustain diverse microbial populations [15-
2
16]. For instance, the plaque formed in the hidden area between the teeth (approximal plaque)
and in the gingival crevice (gingival crevice plaque) are favorable habitats for facultative and
obligate anaerobes such as Streptococci and Actinomyces [17-18]. Whereas, the tooth fissures
(fissure plaque) is predominated by species such as certain aerobes and facultative anaerobes, for
e.g. Streptococci [15, 19]. Another important component of oral cavity is the saliva, which plays
an important role in maintaining the oral ecosystem and is critical for oral health by providing
antimicrobial, buffering and conditioning functions in the mouth [20]. Saliva aids the clearing of
food and buffers the oral cavity following the ingestion and metabolism of dietary carbohydrates
by the acidogenic consortia [7, 21]. Salivary components (e.g., mucins, histatins and cystatins)
can adsorb on the tooth surface to form a conditioning film known as the acquired pellicle, which
facilitates bacterial adherence on the surface [22-24]. Saliva is the primary nutrient source for the
resident oral microbes, and also contains antimicrobial factors (e.g. lysozyme and lactoferrin) to
prevent the growth of unwanted exogenous microorganisms [22, 25]. The last major component
of oral cavity is the GCF that flows through the junctional epitelium of gingiva. It is a serum-like
fluid that can act as a source of nutrients and contains components of host defence that include
lysozyme, lactoferin, peroxidases and Immunoglobulin G (IgG) antibodies [26-29].
1.1.2 Acquisition of oral microflora
The oral cavity of an infant is inoculated with microbes that are acquired from mother's milk;
these microbes can then initialize the process of acquisition of resident oral microflora. The
mode of birth delivery also appears to influence the development of oral microflora. On
comparing the oral microbiota of 3-month old infants delivered vaginally and by caesarean
section, a higher prevalence of Streptococci and Lactobacilli was found in the oral microbiota of
vaginally delivered infants [30-31]. In addition to microbial acquisition from the mother, the
infant can also acquire microbes from family members in close proximity, or external food
source such as milk or water [32-34]. This microbial acquisition is controlled by host factors
including saliva. The detailed roles of saliva in microbial acquisition and homeostasis have been
discussed under the section 1.1.3. The first colonizers are referred to as pioneer species and are
mainly streptococci belonging to the mitis-group that includes: Streptococcus salivarius,
3
Streptococcus mitis, and Streptococcus oralis [5, 35-36]. The pioneer microbial community
continue to grow and colonize until it encounters an environmental resistance, such as: shedding
of epithelial cells, shear force due to salivary flow, nutritional limitations and alterations in redox
potential or pH [15, 36]. Many of the pioneer species secrete proteases against secretory
immunoglobulin A (IgA), one of the major host immune defense factors present in the infant’s
saliva [21, 37-38]. The inhibitory activity against secretory IgA allows these pioneer organisms
to colonize the oral mucosal surfaces by overcoming key host-defenses in the early stages of
colonization [38]. Over time, the physiological activity of pioneer microbial community modifies
the surrounding environment making it conducive for the colonization and succession of other
bacterial populations [16, 39]. Some of these modifications include: exposure of new receptors
necessary for bacterial adherence to the surface or to the pre-adhered bacteria (co-aggregation),
generation of metabolic end-products by pioneer species that can be utilized by subsequent
populations, and other environmental changes [40]. The progressive development of pioneer
community also prevents the colonization of unwanted exogenous bacterial species by: 1)
competing for essential nutrients and co-factors; 2) competing for the receptors for adhesion; 3)
creating an environment not favorable for the growth of exogenous species and; 4) generating
inhibitory substances such as bacteriocins, hydrogen peroxide, etc [16, 41].
As the process of dentition progresses, new microenvironments are created that increases the
diversity of the microbial community, with the introduction of members of genera Neisseria,
Lactobacillus, Veillonella, and Actinomyces [35]. The progressive diversity in the microbial
community results to the formation of a complex dental biofilm, commonly called dental plaque.
The dental plaque is highly organized with microbes embedded in a matrix of self-composed
extracellular carbohydrate and/or nucleotide polymers [42-43]. The microbial homeostasis in the
oral cavity is constantly challenged by physical and non-physical changes, such as tooth
extractions, dental treatment, antibiotic use, variation in salivary flow or saliva pH, food habits,
and the presence of host-derived antimicrobial factors [8, 16, 44].
The microbial successions typically fall under two defined categories, namely: 1) Allogenic
succession resulting due to the environmental changes generated by the host, or 2) Autogenic
succession that is a result of the microbial interrelations [45]. During allogenic succession, the
community development is influenced by the non-microbial factors such as tooth eruption,
4
insertion or removal of dentures, and introduction of antimicrobial agents. Whereas, during
autogenic succession, factors derived from pioneer species such as growth factors, alteration in
the environmental pH and the redox potential regulate the progression of microbial community
[45]. The pioneer community continues to develop through series of microbial successions until
equilibrium is attained which results in the formation of the climax community. The climax
community exhibits a highly dynamic relationship between the host, the environment and the
resident microflora in the oral cavity. The oral microflora continues to acquire new bacterial
species over the age of the host. In adults, the composition and proportion of the resident oral
microflora remains fairly stable over time; owing to the microbial homeostasis attained from
various inter-bacterial and host-bacterial interactions [15, 46-47].
1.1.3 Oral biofilms
In natural environments bacteria primarily exist as surface-attached complex microbial
communities known as biofilms [48]. A biofilm is a surface associated four-dimensional
structure that contains mono- or multi-species bacteria co-adhered and embedded into a matrix of
extracellular polymeric substance(s) (EPS) derived from host and/or bacterial factors [43].
Biofilm formation includes three distinct steps: attachment of cells to a surface, growth of the
cells into a sessile biofilm colony, and dispersal of cells from the mature biofilm to colonize into
the surrounding environment. Environmental signals, chemical and physical forces, bacterial
communication factors, and effectors of bacterial or host origin play a significant role in each
distinct stage of biofilm formation [49-50]. Adapting to a biofilm mode of growth provides
bacteria with multiple advantages such as protection from antimicrobial factors, dynamic host
and environmental conditions, and the ability to communicate among themselves [51-52].
The formation of dental plaque occurs via specific steps, each of which determines the successful
attachment and colonization of microbes on the tooth surface. The distinct stages of plaque
formation are described below:
a) Acquired pellicle formation: Once a clean tooth surface is exposed to the oral environment,
adsorption of salivary proteins and glycoproteins to the dental enamel creates an acquired enamel
5
pellicle (AEP) [22]. The AEP is composed of bacterial components such as glucans (explained in
detail in Section 1.2.2), and host components including salivary proteins such as sialyted mucins,
α-amylase, proline-rich proteins, agglutinin, and statherin [24, 53]. An equilibrium attained
between the continuous adsorption and desorption of the salivary molecules on the tooth surface
determines the thickness of pellicle layer [7, 54]. The thickness of the pellicle layer also depends
on the site of formation and the presence of salivary shear forces [54]. The molecular
composition and the physiochemical properties of the pellicle layer play a critical role in
determining the composition and the pattern of dental plaque formation.
b) Attachment and colonization of bacteria on the tooth surface: Microbes usually are
transported passively to the tooth surface via the salivary flow; however few of them possess
specialized structures such as fimbrae or pili that assist them to attach to the surface [32, 39]. The
components of the acquired pellicle play an important role in bacterial adherence to the surface.
Initially, as the microbes approach the pellicle-coated surface, weak and long-range
physiochemical forces are generated by the negatively charged bacterial cells and hydrophobic
tooth surface, that allows reversible attachment of bacteria to the surface [42, 53]. Within a short
period of time, irreversible attachment of bacteria is mediated by strong and specific but short-
range interactions between the microbial adhesins (components of microbial cell surface) and the
complementary receptors on the pellicle layer [42, 53]. After successful attachment, the pioneer
species constituting mainly of the members of the mitis group of streptococci start to divide and
propagate on the surface. The cell walls of several oral streptococci possesses a number of
adhesins such as antigen I/II, glucosyltransferases and lipoproteins that bind to their cognate
receptors on the pellicle layer [10]. For instance, antigen I/II binds to the human salivary
glycoproteins (agglutinins) and other microbial cells; whereas, glucosyltransferases interacts
with blood-related proteins or the adsorbed dextrans and glucans in the pellicle layer [10]. In
some cases, the salivary molecules in the acquired pellicle can undergo conformational changes
leading to exposure of new bacterial receptors known as cryptitopes [20, 22]. These cryptitopes
are recognized by specific bacteria that possess cognate adhesins on their cell surfaces for plaque
formation [20, 22].
The pioneer species continue to grow and propagate in the dental plaque environment. These
species are equipped with special features that enable them to initiate plaque formation on tooth
6
surface [16]. These species secrete IgA protease that allows them to overcome the host defenses;
and they also possess a range of glycosidase activity that enables them to use salivary
glycoproteins as nutrient substrates [16, 21]. On reaching an equilibrium in their population,
these pioneer species start to make conditions conducive for the growth of secondary colonizers.
The pioneer species provides additional adhesins for the secondary colonizers that were
previously unable to adhere to the adhesins of pellicle layer [39]. Additionally, the metabolic
activity of the pioneer communities alters the local environment, thereby, generating an
improved atmosphere for the new bacteria to colonize the dental plaque [16, 50, 55]. Over time,
the diversity in the plaque microflora increases with the introduction and expansion of
Actinomyces and other Gram positive bacilli. A series of complex interactions between the
microbes in the plaque community changes the composition of plaque microflora in due course
of time [55-56]. The conditions continue to progressively change to eventually become
favourable for obligate anaerobes. The graphical demonstration of early and late colonizers of
the plaque formation has been presented in Figure 1-1, with the initial colonizers constituting the
yellow (Streptococcus gordonii, Streptococcus intermedius, S. mitis, S. oralis, and Streptococcus
sanguinis), blue (Actinomyces spp), green (Capnocytophaga plus Campylobacter concisus,
Eikenella corrodens, and Aggregatibacter actinomycetemcomitans serotype a) and purple
(Veillonella parvula and Actinomyces odontolyticus) complexes, whereas the late colonizers
forming the orange (Fusobacterium nucleatum, Prevotella intermedia, Peptostreptococcus
micros, Eubacterium nodatum, and other species) and red complexes (Treponema denticola,
Porphyromonas gingivalis and Tannerella forsythia) [3, 57-59]. F. nucleatum functions as a
bridge organism during plaque formation owing to its capability to co-aggregate with both initial
and late colonizers, while the early and late colonizers do not co-aggregate with each other [50,
60]. In oral health, the microbial composition of dental plaque is diverse and remains relatively
stable over time [14-15].
c) Biofilm maturation and detachment: On attaining maturation, the growth rate of individual
bacteria within the plaque community decreases, significantly increasing the doubling rate from
1-2 hours during early growth to 12-15 hours after 1-3 days of biofilm development [12, 61]. The
microbial diversity reaches its maximum in the mature plaque. Biofilms are embedded in the
EPS matrix composed of different types of biopolymers such as, polysaccharides (glucans,
7
fructans and hetero-polymers), proteins, deoxyribonucleic acid (DNA) and lipids, most of which
are self-produced by the microbes [43, 62]. The adhered bacteria simultaneously propagate and
synthesize EPS to facilitate their adherence together in a mass and firmly to the surface. The
constituents of the EPS matrix assist biofilms in providing protection against desiccation and in
facilitating physical interactions between bacterial cells or between bacteria and the adhered
surface, thereby, encouraging biofilm stabilization [43, 62]. The matrix critically maintains the
structural integrity of the plaque and accounts for biofilm's ability to tolerate environmental
insults. The matrix also assists in retaining water, nutrients and growth factors, while restricting
the penetration of detrimental antimicrobials and host-defence factors [43]. In addition, the EPS
immobilize the cells in the matrix, allowing them to be in close proximity for complex
interactions and cell-to-cell communication, thereby, enabling the bacteria to communicate and
to co-ordinate their metabolic and physiological activities [43, 63].
The final stage in biofilm development is the detachment of cells from the mature biofilms and
their dispersal into the surrounding environment to colonize new sites, thus, playing an important
role in transmission of bacterial infection [41, 64]. The biofilm life-style impacts the genomics
and proteomics of the plaque bacteria during distinct stages of plaque formation. For instance, in
the initial stage of plaque formation, bacterial adhesins and enzymes involved in carbohydrate
catabolism are induced; during plaque colonization and propagation, proteins involved in
biochemical functions are expressed; whereas, at the stage of biofilm maturation, enzymes that
cleave bacterial adhesins are activated, thereby, facilitating cell dispersal from one location to
another [37, 65-66]. Additionally, cell-cell signalling molecules of the plaque bacteria assist
them to communicate and coordinate their gene expression, resulting in formation of complex,
interactive, multi-species, spatially and functionally organized dental plaque [40, 50-51, 55, 67].
8
Figure 1-1 Diagram representing microbial composition of dental plaque
The base of the pyramid is comprised of species thought to colonize the tooth surface and proliferate at an
early stage. The orange complex becomes numerically more dominant later and is thought to bridge the
early colonizers and the red complex species that become numerically more dominant at late stages in
plaque development. Adapted from Socransky and Haffajee, 2000 [68] .
1.1.4 Oral diseases
The healthy oral cavity is predominantly colonized with health-associated commensals, and
some opportunistic pathogens at levels insufficient to cause a disease [47]. In the state of
ecological stability, the microbial homeostasis is achieved by numerous host-microbial
interactions in the oral cavity [47]. Perturbation in the microbial homeostasis can shift the
composition and properties of the resident microflora [19, 52]. This shift in microflora may lead
to progression of oral diseases such as gingivitis, oral candidiasis, endodontic (root canal)
9
infections, alveolar osteitis (dry socket), tonsillitis, dental caries and periodontitis [52, 69]. Oral
bacteria have also been implicated in causing systemic conditions such as infective endocarditis,
coronary heart disease, and increased risk of preterm low-birth-weight babies [70-72].
Additionally, plaque-mediated periodontal disease has been associated with other chronic
diseases, such as chronic kidney disease, diabetes and hypertension [28, 73-76].
Dental caries, one of the most common chronic biofilm infections, is considered as a major oral
health problem due to its high prevalence [77]. In most industrialized countries, dental caries
affects 60-90% of school-aged children and vast majority of adults; whereas, the global
prevalence of dental caries among adults can be nearly 100% of the population [77]. It is a multi-
factorial disease that depends on the availability of susceptible tooth surface, cariogenic
pathogens and preferred substrates (in form of dietary sugars) for sufficient period of time to
initiate the dissolution of tooth enamel [52].
Unlike most medical infections, where a specific pathogen is associated with the disease, in
plaque-mediated diseases particularly dental caries and periodontitis, the disease-associated traits
are usually not restricted to a single species. Therefore, to explain the etiology of plaque-
mediated diseases, three hypotheses have been proposed: Specific, Non-Specific and Ecological
plaque hypothesis. According to the "Specific Plaque Hypothesis", out of the diverse microbial
community present in the plaque microflora, only a few specific species are actively involved in
causing a disease [78-79]. On the contrary, the "Non-Specific Plaque Hypothesis" states that a
disease is an outcome of the overall activity of the total plaque microflora [80]. The "Ecological
Plaque Hypothesis" reconciled the key elements of the earlier two hypotheses and explained the
dynamic relationship between the resident microflora and host ecology in health and disease [15]
[14]. The hypothesis states that changes in the host environment such as: a) shifts in the overall
community metabolism, b) subsequent modification of local environment, c) host factors, and d)
the balance between potential pathogens and species associated with oral health, determines the
conditions conducive for oral health or disease [14-15]. The hypothesis suggests that the
regimens aimed for long term prevention of oral disease should control both the associated
pathogens and the underlying changes in the environment that drive the deleterious shifts in the
microflora [14-15]. For example, for the treatment of periodontal disease caused by oral
pathogens such as P. gingivalis, T. forsythia, and A. actinomycetemcomitans, special measures,
10
such as reducing the severity of inflammation and altering the redox potential of periodontal
pockets, should be considered to restrict the growth of associated microbes [14-15]. Similarly,
low pH environments encourage the growth of acid-producing, acid-tolerating bacteria such as
mutans streptococci and lactobacilli, commonly known for their involvement in dental caries.
The prevention measures against dental caries should target both the associated pathogens and
the environmental factors causing the ecological shifts in the plaque population [14-15, 81]. The
role of oral streptococci in the etiology of dental caries is described under sections 1 and 0.
1.1.5 Oral streptococci
A large population of resident oral microflora is comprised of streptococci, which have been
isolated from various sites in the mouth. Most oral streptococci are usually commensal bacteria,
while some are involved in causing dental caries, periodontitis and occasional extra-oral
infections such as infective endocarditis or brain abscesses [61, 82-84]. The most prevalent oral
streptococci are clustered within four phylogenetic groups: mutans group (prominent members
are Streptococcus mutans and Streptococcus sobrinus), salivarius group (S. salivarius, and
Streptococus vestibularis ), anginosus group (Streptococcus anginosus and S. intermedius), and
mitis group (S. mitis, S. gordonii, S. sanguinis and S. oralis) [85-86]. The pioneer colonizers on
tooth surface are members of the mitis group. These colonizers play a critical role in the
initiation and development of dental plaque (as described previously in sections 1.1.2 and 1.1.3).
Streptococci from the mutans group are commonly associated with the etiology of dental caries.
The mutans streptococci along with Lactobacillus are capable of rapidly metabolizing
carbohydrates into acid end-products and generating acidic environment, while activating their
adaptive response under low pH [87]. The microbial succession during the caries formation
implies the association of mutans streptococci with the caries initiation, whereas lactobacilli are
associated with caries progression [9, 21]. In mutans streptococci, nine serotypes (a-h and k)
have been recognized based on the specificity of carbohydrates present in their cell walls [84, 88-
89]. S. mutans is classified into serotypes c, e, f and k with approximately 70-80% of strains as
serotype c, followed by e (∼20%), f and k (less than 5% each). The isolates of S. cricetus
serotype a, and S. sobrinus serotype d and g have also been recovered from the human oral
11
cavity [84, 88-90]. Streptococcus downei serotype h and Streptococcus ratti serotype b are rarely
isolated from macaques and rats, respectively[86, 90]. The members of salivarius-group colonize
preferably on mucosal surfaces and are not considered as significant pathogens of oral diseases
[14, 91]. Species from the anginosus-group are colonizers of dental plaque and mucosal surfaces,
and are recognized as the main causative agents of maxillo-facial infections [92-93]. The oral
streptococci participate in numerous co-operative and antagonistic bacterial interactions within
the plaque community that determines the health and disease of the oral cavity [3, 12, 40].
1.2 Streptococcus mutans
S. mutans was first isolated from a caries lesion by J Clarke in 1924 [94]. However, it was
decades later that S. mutans was associated with dental caries [87, 95]. In rare cases, S. mutans
has also been shown to cause infective endocarditis, a life threatening heart valves inflammation
[82, 96-97]. In both conditions, S. mutans adapts a biofilm mode of growth to colonize specific
host sites. S. mutans can be transmitted to an infant directly from the mother, or from different
members of the family, indicating both vertical and horizontal mode of transmission [98-99].
During the course of life, most of the initially acquired S. mutans strains persist, some are lost
and other new strains are introduced [98-99]. Following the advent of complete S. mutans
genome sequence, various genomic and proteomic approaches have facilitated our understanding
on the genetics, biochemistry and physiology of this dental pathogen. The genomes of four
different strains of S. mutans have been sequenced with S. mutans UA159 being the first to be
sequenced, followed by S. mutans NN2025, S. mutans LJ23 and S. mutans GS-5 [100-103].
S. mutans harbors several virulence factors that provide the bacterium an ecological advantage
over other oral streptococci. The majority of the genome of S. mutans is dedicated towards the
metabolism of dietary sugars and their associated transport systems. The main virulence features
of S. mutans include: a) the ability to produce large quantities of organic acids (acidogenicity)
from metabolized carbohydrates; b) the ability to sustain under low pH conditions (aciduricity);
and c) the ability to synthesize extracellular polymer matrix from dietary sugars for initial
12
attachment, colonization and accumulation of biofilms on tooth surfaces [87]. The factors
influencing the survival and virulence of S. mutans in the oral biofilm are described below.
1.2.1 Acidogenicity and aciduricity
S. mutans has the ability to transport and metabolize several sugars, such as glucose, fructose,
sucrose, lactose, galactose, mannose, cellobiose, β-glucosides, trehalose, maltose, raffinose,
ribulose, mellobiose, iso-maltosaccharides, and possibly sorbose [101]. S. mutans utilizes these
dietary sugars and generates acid end products such as lactate, formate, acetate and ethanol
[104]. During periods of heavy sugar intake, excessive acid production by acidogenic bacteria
lowers the pH of the dental plaque [105]. S. mutans are capable of maintaining their glycolytic
activity under the acidified milieu, which provides them a competitive advantage over other oral
streptococci and assists them and other acidogenic/aciduric bacteria to dominate in the dental
plaque [105-107]. These acid-induced adaptation and selection processes can perturb the balance
between the demineralization and remineralization of tooth enamel, resulting in initiation and
progression of dental caries.
The ability of S. mutans to tolerate acid stress depends on the implementation of several
constitutive and inductive mechanisms, which assist in their adaptation under acidic
environments [105-106, 108]. The central constitutive mechanism involves the activity of the
F1F0 ATPase proton pump, which is functional under low pH and plays a role in: 1) expelling
protons out of the cell to normalize the intracellular pH, and 2) simultaneously generating ATP
to provide energy for the cellular functions [105-106, 108-109]. The inductive mechanisms are
collectively referred to as the Acid Tolerance Response (ATR), whereby bacteria adjust several
catabolic pathways to maintain their viability [105-106, 108]. Some of these inducible
mechanisms include: 1) alteration in the integrity and composition of the cell envelope resulting
in impaired proton permeability; 2) induction of genes encoding for molecular chaperones,
proteases, and DNA repair enzymes to maintain stability of macromolecules and to prevent
accumulation of misfolded proteins; 3) activation of metabolic pathways involved in recycling of
the carbon acids produced during sugar fermentation, thereby, assisting in alkalization of
cytoplasm; 4) and, synthesis of insoluble glucans, leading to adaptation to a biofilm mode of
13
growth, which have increased acid resistance compared with their planktonic counterparts [105-
106, 108].
1.2.2 Biofilm formation
S. mutans adapts a biofilm-dependent lifestyle to colonize the host body [95]. S. mutans utilizes
certain mechanisms to adhere to the tooth surface and under favorable conditions becomes
significantly predominant in the dental plaque community. The fermentable dietary
carbohydrates, especially sucrose, act as one of the key environmental factors in the initiation
and development of dental caries. In the absence of sucrose, the multifunctional adhesin SpaP
(antigen I/II, P1, PAc) is considered to be the primary factor required for initial adherence of S.
mutans to the tooth surface [53, 110]. S. mutans metabolizes dietary sugars to produce
extracellular polysaccharides that act as major constituent of the EPS in the biofilm matrix [105-
106]. EPS promotes bacterial adherence to the tooth surface or to adhered bacteria, thereby
enhancing the structural integrity of the dental plaque [105-106]. Sucrose, a disaccharide of
fructose and glucose, is a major component of the human diet and is strongly associated with the
initiation and progression of dental caries. In the presence of sucrose, multiple
glucosyltransferases exoenzymes mediate the adherence of S. mutans to the tooth surface, by
synthesizing D-glucose polysaccharides, known as glucans. S. mutans produces three distinct
glucosyltransferases, namely: the glucosyltransferase enzyme GtfB, which acts on sucrose to
produce water-insoluble glucans composed predominantly of α-1,3-linkages, GtfD that converts
sucrose to mostly soluble α-1,6-linked glucans and GtfC makes both α-1,3 and α-1,6 glucans
[111-113]. The high molecular weight polysaccharides produced by the Gtf enzymes have been
implicated in attachment and biofilm formation on the smooth surfaces of the tooth in S. mutans
[63]. In addition, a fructosyltransferase (FTF) enzyme acts on sucrose to produce a fructose
homopolymer that is primarily composed of β-2, 1-linked fructose (inulin) [114]. Glucans are
required for initiating and facilitating S. mutans adherence and accumulation on the tooth surface
and acting as a source of metabolizable polysaccharides outside the cell; whereas fructans are
believed to function exclusively as extracellular storage polysaccharides [10, 115-118].
14
The binding of S. mutans to glucans is mediated by cell associated Gtf enzymes and glucan
binding proteins (Gbps) [119]. S. mutans produces four different Gbps that include GbpA, GbpB,
GbpC and GbpD [120-124]. Immunologically distinct from other Gbps, GbpB affects the initial
steps of sucrose-dependent biofilm formation by modulating cell division and other
physiological processes required for planktonic to biofilm transition [125]. GbpA, GbpC and
GbpD are each transported across membrane, where only GbpA and GbpD are released;
whereas, GbpC is cell-wall bound [119, 126]. GbpA contributes to biofilm architecture by
linking glucans molecules, more or less independent of the bacteria [124-125]. GbpC is essential
in the early stages of biofilm formation and is involved in glucan-dependent aggregation of
bacteria; the loss of GbpC results in impairment in virulence, biofilm biomass, and bacterial
aggregates formation [122, 126-127]. GbpD contribute to the scaffolding of the biofilm and is
required to provide cohesiveness between bacteria and glucans in the biofilm matrix; loss of
GbpD results in extremely fragile biofilms [119].
1.2.3 Regulatory systems in S. mutans
Both Gram positive and Gram negative bacteria utilize quorum sensing signaling system to
communicate under an array of diverse physiological conditions. Quorum sensing in Gram
positive bacteria regulates a number of physiological activities, such as competence development
in Streptococccus gordonii, S. pneumoniae, and S. mutans, sporulation in Bacillus subtilus,
antibiotic synthesis in L. lactis, and induction of virulence factors in Staphylococcus aureus. The
bacterial communication via quorum sensing involves the production, release and detection of
small signaling molecules namely: the auto-inducers (e.g. acylated homoserine lactones) or by
processed oligo-peptides (e.g. competence stimulating peptide) [40, 128]. In the oral cavity auto-
inducer 2 (AI-2), produced by pioneer species, have a tendency to alter the structure and
composition of the developing dental plaque [129]. A recent research has proposed the
involvement of bacterial signaling molecules in eliciting specific responses from host cells,
thereby mounting the possibility of cross-communication between prokaryotic and eukaryotic
cells [49]. The concentration of signaling molecules increases with cell growth and on reaching a
15
threshold density; a signaling cascade is induced leading to alteration in the expression of target
genes thereby shifting the dynamics of bacterial population [40, 128].
Quorum signaling in Gram-positive bacteria can involve the activity of auto-inducers or
processed oligopeptides, also known as pheromones. The pheromones, which are initially
synthesized as inactive pro-peptides in the ribosome, are exported from the cell either by the
general secretion system or by utilizing dedicated ABC transporters [130]. During the export
event, the pro-peptides undergo proteolytic and maturation processes to generate the active and
mature pheromone. Pheromones can be imported into the cytoplasm via peptide transporter
complexes, where they can bind and directly modulate the activity of their cognate
transcriptional regulators [130-132]. Alternatively, on reaching a threshold concentrations in the
extracellular milieu, pheromones can be detected by transmembrane receptors of the two-
component system signal transduction family (TCSTS) [128, 130]. TCSTS are typically
composed of a membrane-bound histidine kinase and cytoplasmic response regulator [133-134].
On responding to a specific signal, the histidine kinase undergoes auto-phosphorylation at a
conserved histidine/serine residue and then transfers the phosphoryl group to a conserved
aspartate in the response regulator [135]. The resulting phosphorylation of the response regulator
triggers a conformational change in its domain, prompting its ability to bind specific DNA
promoter regions, thereby rendering transcriptional regulation of the target genes [135]. In S.
mutans, 14 TCSTSs and an orphan response regulator have been identified until now [101].
Cross-talk between certain histidine kinases and their non-cognate response regulators have also
been identified in this bacterium [136]. In S. mutans, the most extensively studied TCSTSs and
their associated affected phenotypes are as follows: VicKR, which is involved in biofilm
formation, sucrose-dependent adhesion, competence development, acid tolerance, oxidative and
cell envelope stress, and bacteriocin production; CiaHR, which is involved in biofilm formation,
sucrose-dependent adhesion, competence development, acid tolerance, calcium signaling, and
mutacin production; LiaSR, which is involved in cell envelope stress, acid tolerance, osmotic
stress, biofilm formation, and mutacin production; LevSR, which is involved in fructose
metabolism and sugar transport; ScnKR, which is involved in acid tolerance and oxidative stress;
orphan RR GcrR, which is involved in sucrose-dependent adhesion and acid tolerance; and
ComDE, which is involved in genetic competence, biofilm formation, bacteriocin production,
16
and quorum sensing [109, 137-140]. An extensive literature review describing the individual
properties of these TCSTSs can be found in Spatafora et al [139].
Although S. mutans produces and responds to AI-2, its significant role in quorum sensing in not
been ascribed [141]. In S. mutans, two density dependent quorum sensing systems have so far
been identified: one comprising the peptide pheromone competence stimulating peptide (CSP)
and the ComDE TCSTS; and the other one consisting the double tryptophan containing signal
peptide XIP (SigX-inducing peptide), regulated by an Rgg-like transcriptional regulator ComR
[132, 142]. Both quorum sensing pathways convey their respective signals to the activation of
the only alternative sigma factor SigX (also known as ComX) of S. mutans, which is therefore a
master regulator of quorum sensing [143-145]. The two signaling pathways differ in many ways
such as: the CSP peptide pheromone is sensed outside the cell by ComD HK, whereas XIP is
sensed inside the cell after its internalization [146-147]; CSP is active only in peptide-rich media
whereas XIP is active only in peptide-free chemically defined media (CDM) [148]; and CSP
induces the expression of sigX only in a fraction of population while the majority remains un-
induced and a small fraction undergoes cell death, while, stimulation via XIP confers 100%
compliance in sigX activation [142, 149-150]. Despite of all these differences, the ultimate
activation of sigX by either of the pathways modulates genetic competence in S. mutans [143-
144].
1.2.4 Genetic competence
Natural genetic transformation is one of the processes of horizontal gene transfer observed in
several bacteria, including streptococci. The genetic transformation has been reported to play a
role in modulating genetic diversity, cell survival, biofilm formation, bacteriocin production and
general stress response in several bacteria [151-152]. During the process of genetic
transformation, the bacteria enter into a physiological state of genetic competence facilitating the
acquisition of foreign DNA from the external environment. In some bacterial species, the
occurrence of a competent state is constitutive, whereas, in others competence is tightly
regulated and depends on specific factors or conditions, such as pheromones, nutrient availability
and stress [151]. On sensing the specific inducible conditions and/or factors, the expression of
17
master regulator(s) is stimulated which leads to activation of the genes involved in DNA uptake
and recombination [151].
All streptococcal species harbor the master regulator SigX and SigX-dependent effector genes,
usually required for natural genetic transformation [153-154]. However, not all streptococcal
species have been shown to be naturally competent [153-154]. S. mutans is a naturally competent
bacterium, which utilizes at least two quorum signaling pathways in transmitting information
from the secreted peptides CSP and XIP to the SigX, involved in development of competence for
genetic transformation (Figure 1-2) [142, 147]. As described previously, the two quorum sensing
pathways differ both in basic architecture and in mechanism of signaling. CSP, encoded by
ComC as a 46-amino-acid pro-peptide, contains a leader sequence with a double-glycine motif
[147]. During secretion through a dedicated ABC transporter, ComAB, the N-terminal leader
peptide is cleaved off by the proteolytic activity of the transporter to generate a peptide that is 21
residues long (21-CSP) [155]. 21-CSP can either be degraded by HtrA proteases in a process
affected by misfolded proteins or can undergo productive processing by SepM extracellular
protease to generate a mature 18-CSP that binds to ComD leading to phosphorylation of ComE
[156]. As described previously, on reaching a threshold density processed CSP is sensed by the
ComD HK, leading to its auto-phosphorylation and thus activation of the response regulator
ComE RR [143, 153]. In contrast, the peptide encoded by ComS is involved in comR-comS
quorum sensing [132]. ComS encodes for a 17-amino-acid polypeptide, which is secreted and
processed to mature XIP [132, 146]. Though the steps involved in XIP secretion and processing
remain entirely unknown, a predicted mature form of ComS is proposed to be of 7 amino acids in
length. Additionally, synthetic XIP consisting of the C-terminal seven amino acids of ComS
induce a significant increase in sigX transcription when added to cells grown in CDM. XIP
interacts with the Rgg-like transcriptional regulator ComR and collectively, ComR and XIP
activate the expression of sigX and comS, thus creating an auto-induction loop in the signaling
system [132]. The absence of comR or comS shuts down the competence machinery even when
cells are stimulated by CSP, whereas the absence of comE does not have any effect on XIP
induced comX activation [132, 148]. Therefore, the comRS pathway is not only necessary but
sufficient in inducing the expression of SigX, involved in competence development.
18
Figure 1-2 Model of CSP- and XIP-induced quorum sensing in S. mutans.
The ComCDE quorum signaling is mostly devoted towards the activation of bacteriocins
(antimicrobial peptides), whereas ComRS signaling system have a prominent role in competence
development. The two signalling pathways converge on transcription of sigX transcriptional
factor, where the ComRS complex acts as the proximal regulator of the sigX transcription.
Figure is reproduced from Federle et al, 2012 with permission of the copyright owner [142].
The activation of sigX by either CSP-ComDE or ComRS sensing systems also depends on the
components of the growth media: XIP is only active in CDM, devoid of any exogenous peptides,
whereas CSP is active only in nutrient-rich media such as brain heart infusion (BHI) or typtone
19
yeast extract (THYE) [148, 150]. Moreover, CDM medium facilitates a high frequency of
natural transformation without exogenoeus supplementation of CSP or XIP, whereas genetic
transformation in nutrient-rich media is strongly dependent on the addition of exogenous CSP.
Another difference in the pathways of sigX induction via the two quorum sensing system lies in
their mode of induction: the XIP heptapeptide induces sigX expression broadly across the
population in a unimodal way, on the other hand CSP induces in a bimodal way where only a
fraction of the cells acquires competence state [149-150, 157]. S. mutans growing in mixed
biofilms with Candida albicans shows interesting patterns of regulation of the competence
pathway [158], where, comS is not activated in single culture biofilms of S. mutans whereas in
mixed biofilms the dramatic induction of comS triggers the activation of quorum sensing
signaling cascade resulting in induced expression of comR and comX [158]. The study provides
a novel mechanism of competence induction in mixed biofilms and holds relevance as C.
albicans have been isolated from the dental caries lesions associated with S. mutans [158].
1.2.5 Metal homeostasis
Metals play an important role in modulating various cellular processes, thereby, ensuring optimal
cell viability. The unique properties of metals allow them to perform a multitude of tasks that
include: as structural component of bio-molecules, as signaling molecules, and as catalytic co-
factors for proper functioning of various essential metabolic enzymes [159-160]. Metal
requirement is closely monitored within the cell, as in the absence/deficiency of a particular
metal ion a stress response is induced that can lead to altered cellular metabolism [161].
Similarly, at higher concentrations metals can be extremely destructive by affecting bacterial
physiology such as: induction of oxidative stress, impairment of protein stability and function,
structural damage of bio-molecules, etc [161-162]. In order to sustain cell viability, extensive
regulatory and protein-coding machinery is devoted to maintain the metal homeostasis. Metal
homeostasis is achieved by maintaining the intracellular metal concentration at an optimal bio-
available concentration and is mediated by balancing efflux and intracellular trafficking/storage
of metal ions (Figure 1-3).
20
Figure 1-3 Metal homeostasis model
Metals play an important role in modulating various cellular processes in all living systems. The
unique properties of metals allow them to perform a multitude of tasks that include: as structural
component of bio-molecules, as signaling molecules, and as catalytic co-factors for proper
functioning of various essential metabolic enzymes. Required in trace amounts, metals can be
extremely toxic at higher concentrations, therefore there trafficking is closely monitored across
the cell membrane and within the cytoplasm.
In S. mutans divalent metal ions such as iron (Fe), manganese (Mn) and calcium (Ca) are known
be required for its growth and survival [163-165]. Of these divalent cations, role of Mn in S.
mutans physiology and its homeostasis has been well characterized. In bacteria, Mn functions as
the co-factor for superoxide dismutase involved in dis-mutation of the toxic superoxide
radicals[166], and for the enzymes required in lactic acid fermentation. S. mutans contains the
sloABCR operon, which encodes an ATP-binding protein, an integral membrane protein, a
solute-binding lipoprotein, and a metal-dependent regulator [164]. Together SloABC forms a
transport system for the transport of both Fe and Mn, whereas the SloR metallo-regulator
21
represses the operon only in response to intracellular Mn [164]. SloR homologs are found in
other bacterial species such as MntR in B. subtilis, IdeR in Mycobacterium tuberculosis, ScaR in
S. gordonii. In S. mutans, SloR has been associated with several physiological activities such as
cell adherence, biofilm formation, genetic competence, metal ion homeostasis, and oxidative
stress tolerance [167]. Moreover, SloR-Mn regulates the expression of the orphan response
regulator GcrR, which acts downstream of SloR to control ATR in S. mutans [140, 168]. GcrR
also modulates sucrose-dependent adherence and aggregation by repressing the transcription of
gbpC, gtfB and gtfC, genes critical for biofilm formation and virulence in S. mutans [122, 140].
Loss of GcrR results in reduced virulence and cariogenicity in S. mutans [140].
Another metal cation, calcium, has been shown to activate CiaHR TCSTS system involved in
ATR in S. mutans [165]. In S. mutans, CiaHR is known to modulate acidogenesis, biofilm
formation, and genetic transformation. The ciaHR is part of the ciaRHX operon, where ciaX
encodes a Ca-sensing secreted peptide, which responds to Ca levels and allows the auto-
regulation of CiaHRX system [79]. With these examples, it is clear that there is a close link
between metal homeostasis and TCSTSs in S. mutans; detailed literature review on discussing
the link between bacterial metal homeostasis and their cognate TCSTSs is presented in Chapter
2.
In this study we investigated the role of copper (Cu) on the physiology and virulence in S.
mutans. Copper homeostasis has been extensively studied in Enterococcus hirae, L. lactis, and B.
subtilis [169-172]. In all these bacterial systems, the genes involved in copper transport are
usually located on the chromosome as copper transporting operon (cop operon). The knock-out
mutants in cop operon become more prone to killing under copper induced stress, confirming
their importance in copper resistance [169-172]. The best-understood copper transport and
resistance system is that of E. hirae [173]. The copYABZ operon of E. hirae encodes two P-type
ATPases, CopA, and CopB involved in copper translocation, and CopY and CopZ, which
regulate the expression of the cop operon in response to both copper starvation and copper
excess (Figure 1-4) [169]. Under normal conditions, zinc forms complex with CopY and binds to
the inverted-repeat sequence, upstream of the copY gene and negatively regulates the expression
of the co-transcribed genes in the cop operon. At high intracellular concentrations of copper ions,
CopZ binds to copper and form Cu+- CopZ complex [174]. For the de-repression of the operon,
22
Cu+-CopZ donates copper to CopY, thereby displacing the bound Zn2+ and releasing CopY from
the DNA [169, 173, 175].
Figure 1-4 The copYABZ operon of E. hirae
Two P-type ATPases, CopA and CopB transport copper across the membrane and CopY and CopZ,
regulate the expression of the cop operon in response to both copper starvation and copper excess. CopB
was shown to catalyze the accumulation of copper and silver ions in native membrane vesicles of E. hirae
in an energy dependent manner. These vesicles accumulate copper in ATP-dependent manner and extrude
copper ions in whole cells. These ATPases are induced at high extracellular concentration of copper and
silver. The regulation of these ATPases is accomplished by a negative repressor CopY and copper
chaperone CopZ. Under normal conditions, CopY binds as a Zn(II)-CopY complex to the inverted repeat
sequence upstream of the copY gene and thereby, negatively regulates the expression of the co-transcribed
genes on the cop operon. At excessive concentrations of copper ions into the cell, CopZ binds to copper
and form Cu(I)-CopZ complex. For the induction of the operon, Cu(I)-CopZ donates copper to CopY,
thereby displacing the bound Zn(II) and releasing CopY from the DNA, resulting in the de-repression of
the operon. Adapted from Solioz et al (2003) [169]
23
In dental plaque, copper alone or in combination with other antimicrobials have been linked with
reduction in occurrence of dental caries [176-177]. Copper has an inhibitory effect on the growth
of S. mutans [176-177]. In S. mutans, the absence of any putative or known cupro-enzyme
signifies non-essentiality of copper in bacterial metabolism; however the presence of an entire
copper resistance and transport operon, copYAZ, suggests the primary function of the system in
defending against Cu stress.
Figure 1-5 Genetic organization of S. mutans copYAZ operon
The copYAZ operon has been partially investigated in S. mutans (Figure 1-5) [178]. The copYAZ
is co-transcribed as a polycistronic operon, where the knock-out mutant in the entire operon
becomes more sensitive to killing specifically under copper stress relative to the wild type strain
[178]. Moreover, copYAZ operon is specifically induced in the presence of copper and is
negatively regulated by CopY [178]. Also, copZ has been shown to de-repress the activity of cop
operon. Despite of all these findings, the function of this operon in copper transport (import
and/or export of copper) and its contribution to other virulence features in S. mutans has not yet
been established. Copper is utilized to maintain optimal cellular metabolism by several bacteria,
however at higher concentrations it can be extremely toxic. Copper induces toxicity by targeting
different processes or pathways in different bacteria. In our study we focused on investigating
the effects of copper on different physiological activities of S. mutans. Copper was demonstrated
24
to induce oxidative stress, affect the survival of the cells under copper and acid stress, inhibit
biofilm formation, disrupt membrane potential and reduce genetic transformation frequency in S.
mutans. Our results also indicate that the copYAZ operon is not only involved in copper transport
but also in protecting the cells under acid and oxidative stress, assisting in maintenance of cell
membrane potential, and in modulation of biofilm formation and genetic transformation under
copper stress.
25
2 An intimate link: two component signal
transduction systems and metal transport systems in
bacteria
Singh K, Senadheera DB, Cvitkovitch DG
Future Microbiol 9(11), 1283-1293 (2014)
26
2.1 Abstract
Bacteria have evolved various strategies to contend with high concentrations of environmental
heavy-metal ions for rapid, adaptive responses to maintain cell viability. Evidence gathered in
the past two decades suggests that bacterial two component signal transduction systems
(TCSTSs) are intimately involved in monitoring cation accumulation, and can regulate the
expression of related metabolic and virulence genes to elicit adaptive responses to changes in the
concentration of these ions. Using examples garnered from recent studies, we summarize the
cross-regulatory relationships between metal ions and TCSTSs. We present evidence of how
bacterial TCSTSs modulate metal ion homeostasis and also how metal ions, in turn, function to
control the activities of these signaling systems linked with bacterial survival and virulence.
Keywords: Transition metal ion homoeostasis; two component signal transduction systems;
gene regulation.
2.2 Introduction
Bacterial interactions with transition metal ions present a dual challenge: while many metal ions
are biologically necessary at low levels, they can also be toxic at high concentrations. Bacteria
use metal ions as co-factors for the function of several critical enzymes involved in electron
transport and/or cell metabolism [179-182]. Accumulation of metal ions can impose deleterious
effects on metabolic and cellular pathways thus compromising cell survival: different metal ions
in the cytoplasm can tend to displace the metal co-factors at the active site(s) of enzymes
ultimately leading to their inactivation [180, 183]. For instance, when cellular metal homeostasis
is disrupted, metals at the upper end of the Irving-Williams series - Mn(II) < Fe(II)
< Co(II) < Ni(II) < Cu(II) > Zn(II) - have the potential to displace enzymatic metal co-factors at
the lower end, thus rendering the proteins inactive [183-184]. In other cases, metal ions can also
affect cell growth and viability by disrupting the structure of nucleic acids, phospholipid
membranes, and enzyme function [185-186]. Therefore, bacteria have developed complex
27
mechanisms to monitor cellular metal ion levels and simultaneously maintain the homeostasis of
multiple cations within a cell [187-188]
Bacteria use various strategies to regulate heavy-metal homeostasis, which include the use of
metal efflux pumps, channels, cation-specific metallo-regulatory proteins, small non-coding
RNAs, and two component signal transduction systems (TCSTSs) [180]. The intracellular import
of metal ions is often facilitated by ATP-binding cassette transporters and Nramp transporters,
whereas their export is usually carried out by cation-diffusion facilitators (CDFs) [189], P-type
ATPases [190-191], and tripartite resistance-nodulation-cell division (RND) transporters [192].
The regulation of metal trafficking proteins or their encoding genes is usually modulated by
TCSTSs or metallo-regulatory proteins. Bacterial TCSTSs are comprised of a membrane-bound
histidine kinase (HK) and an intracellular cognate response regulator (RR) protein [133]. Upon
reaching an appropriate threshold signal, the bacterial HK undergoes auto-phosphorylation,
which in turn, transfers the phosphate to its cognate RR protein. Once phosphorylated, the RR
undergoes a conformational change which alters its binding affinity to specific sequences in the
promoter/operator regions of its target genes [135]. As a result, the RR can activate or inhibit the
transcription of target genes required for an adaptive response. Another group of regulatory
proteins include cytoplasmic metalloregulators, which unlike TCSTSs are comprised of a single
protein that can perform dual functions of sensing and responding to metal ions [18-20]. In fact,
these proteins are specialized allosteric proteins that can directly bind to a specific or a small
number of cognate metal ions [193-195]. Upon binding, the protein undergoes a conformational
change in the regulatory region allowing it to control the transcription of target genes [195]. The
products encoded by these genes can have multiple functions and may include proteins involved
in growth, stress tolerance, virulence and metal trafficking within or between cellular
compartments [18-20]. The function, mechanism and ion specificity of metallo-regulators has
been previously reviewed by others [193-195]. TCSTSs or cytoplasmic metallo-regulators can
exist together in bacteria. While they are capable of independent activation and regulation [18-
20], intracellular cross-talk between these signaling systems has been noted in some species [36-
37].
Of transition metal ions, the homeostasis of iron (Fe) has been widely investigated and
extensively reviewed [196-201]. In this review, we will focus on the relationship between the
28
activity of bacterial TCSTSs and homeostasis of Copper (Cu), Manganese (Mn), Zinc (Zn),
Nickel (Ni), Silver (Ag), Cobalt (Co) and Cadmium (Cd).
2.3 Copper homeostasis
Cu is an important transition metal required for the growth of most living organisms. Owing to
its redox properties, it has a vital role in maintaining biological processes important for cell
viability. Cu exists in two oxidation states, Cu+ and Cu2+, and is utilized by an array of metallo-
enzymes to catalyze electron transfer reactions. In bacteria, Cu functions as a cofactor for over
30 enzymes, such as superoxide dismutase, cytochrome c oxidase or lysyl oxidase [171, 202].
Although required at lower concentrations, accumulation of excess Cu within the cell under
aerobic conditions can catalyze the production of hydroxyl radicals via Fenton and Haber-Weiss
reactions. The production of reactive oxygen species (ROS) in the presence of Cu is believed to
cause cellular damage by reacting with a number of cellular macromolecules such as lipids,
proteins, and nucleic acids [203]. However, there is little or no direct evidence that shows that
Cu-induced ROS generation is the major cause of Cu toxicity. Alternative mechanisms of Cu
toxicity in E. coli have been suggested where Cu, instead of being involved in oxidative DNA
damage, was shown to suppress Fe-mediated oxidative damage [204]. In E. coli growth
inhibition due to Cu could be reversed by the addition of branched chain amino acids [204]. The
authors proposed that Cu can block the synthesis of branched chain amino acids by targeting the
Fe-S cluster containing dehydratases, where Cu replaces the Fe, rendering them inactive and
blocking their activity [204]. However, a similar mechanism was not observed in Salmonella,
where the addition of exogenous branched chain amino acids didn't revert the Cu-mediated
growth inhibition [30]. It was suggested that Cu might have different targets than Fe-S clusters or
the bacterium might have evolved multi-factorial mechanisms to contend with Cu-induced
toxicity [205]. In an another study, it was shown that the E. coli Cu efflux system CusCFBA
(described below) was induced during anaerobic amino acid limiting conditions to protect Fe-S
cluster enzymes from endogenous Cu toxicity [206]. Challenges posed by Cu necessitate the
activity of complex regulatory networks to maintain Cu homeostasis in the cell. The evolution of
29
divergent mechanisms in various bacterial systems to contend with Cu (and metal ion) toxicity
remains a topic that demands further exploration.
To contend with Cu toxicity, bacteria utilize at least one of three principal mechanisms. These
include, a) Cu export across the plasma membrane into the periplasmic space or the extracellular
environment, b) extracellular and/or intracellular Cu sequestration via Cu binding proteins, c) Cu
oxidation to a less toxic Cu2+ state [207]. The mechanisms to maintain Cu homeostasis have been
extensively studied in several bacteria including E. coli, Pseudomonas, Xanthomonas,
Enterococcus and Bacillus [208]. In Gram negative bacteria, excess Cu is either accumulated in
the periplasm or is exported out of the cells. In these organisms, the genes contributing to Cu
homeostasis are either located on the chromosome or are plasmid born. In many
Enterobacteriaceae, such as E. coli, Cu stress tolerance is modulated by chromosomal regulons
designated cue (Cu efflux) and cus (Cu sensing), as well as by plasmid-born machinery such as
the pco system [209]. E. coli utilizes cytoplasmic MerR-type regulator CueR, which in concert
with the CusRS TCSTS, regulate the expression of target genes involved in Cu homeostasis
[209-211]. Under aerobic conditions, CueR is activated by elevated intracellular Cu
concentrations, which can then directly bind the CueR box in the promoter region of copA and
cueO encoding a P-type ATPase and an oxygen-dependent multi-copper oxidase, respectively
[209, 211]. The CopA protein helps export excess Cu+ from the cytoplasm into the periplasm,
where it is oxidized to the less toxic Cu2+ form with the aid of CueO [212]. Under anaerobic
conditions, the CusRS TCSTS maintains Cu homeostasis, wherein the CusS sensor kinase is
activated by a threshold periplasmic Cu concentration, which then transfers this signal via a
phopho-relay event to its cognate responder protein CusR [211]. As a result, CusR regulates
transcription of the cusRS operon, as well as the adjacent, but divergently oriented cusCFBA
operon by directly binding to the CusR box (AAAATGACAANNTTGTCATTTT) between the
cusC and cusR promoters [213]. The CusCBA (a proton-cation antiporter) and CusF (a Cu
chaperone) proteins have also been demonstrated to aid in Cu stress tolerance [214].
Interestingly, no other sequence in the entire genome of E.coli was found to contain a CusR box
suggesting it binds specifically and only to the intergenic region between the cusRS and
cusCFBA operons [213]. In Cornybacterium glutamicum, the E.coli homologue of CusRS was
identified and characterized as copRS TCSTS. CopRS senses extra-cytoplasmic levels of Cu+
30
concentrations, and induces the set of genes involved in Cu homeostasis and resistance [215].
Like in E.coli, CopR specifically binds and regulates the expression of two divergently oriented
operons cg3286-cg3289 and copR-cg3281, which encodes for Cu resistance proteins (e.g.
putative multicopper oxidase CopO and the putative copper export ATPase CopB) and CopRS
TCSTS respectively [215].
In cyanobacterium Synechocystis sp. PCC 6803, CopRS two-component system is known to be
essential for copper resistance [216]. CopS was shown to have a high affinity to bind Cu in vitro,
moreover its localization both in the plasma and thylakoid membrane suggested that CopS can
possibly bind and respond to Cu both in the periplamic and thylakoid lumen in Synechocystis
[216]. However, further studies are warranted to completely understand the mechanism and
conditions involved in Cu binding to CopS under natural conditions. In the presence of Cu,
CopR directly binds and regulates the expression of both copBAC, the putative heavy-metal
efflux-RND copper efflux system and its own locus (copMRS operon) [216].
In E. coli two other TCSTSs, CpxAR and YedVW, were shown to be induced in the presence of
Cu [213]. CpxAR is involved in membrane stress tolerance; it activates the transcription of CpxP
protease for degradation of denatured proteins. Furthermore, a CpxR binding-site, a conserved
tandem repeat pentanucleotide sequence GTAAA(N)(4-8)GTAAA, was identified in the
promoter region of several copper-inducible genes [217]. Knockout mutants of CpxAR were
more sensitive to killing under Cu stress suggesting the role of this TCSTS in copper
homeostasis in E. coli [217]. The function of YedVW is not well characterized; however, YedV
kinase has been shown to transfer phosphate not only to YedW but also CusR. The YedVW was
not induced by Cu in a CusR-deficient mutant suggesting the induction of YedVW system in a
CusR-dependent manner [213]. Although the function of YedVW in Cu homeostasis is not yet
characterized, its induction likely results from cross-talk between the CusRS and YedVW
systems in the presence of Cu [213].
In Helicobacter pylori, a major colonizer of the human gastric mucosa, Cu is imported in a non-
specific manner [218]. Cu ions accumulated in the periplasm are detoxified via the metal export
system, crdAB and czcBA, orthologous to that of the E. coli four-component Cu export system
CusCFBA and is directly controlled by the CrdRS TCSTS [219]. The expression of crdA,
31
encoding the protein most highly expessed under copper stress is directly controlled by the
CrdRS TCSTS [219], where CrdR was shown to bind the operator region of the crdA promoter.
Despite their speculations, the authors did not demonstrate that CrdS can directly sense Cu from
the surrounding environment. H. pylori mutants' deficient in CrdS and CrdR cannot colonize the
mouse stomach, indicating a crucial role for Cu homeostasis in the adaptation to the gastric
environment [219].
In addition to the utility of chromosomal Cu resistance genes, E. coli also utilizes a conjugative
plasmid harboring the pco gene cluster comprised of pcoABCDRSE to contend with Cu stress
[220]. These encode the multi-Cu oxidase, PcoA, the outer membrane protein, PcoB, the
periplasmic proteins, PcoC and PcoE, and the inner membrane protein PcoD. The pco operon is
Cu-inducible and is regulated by a specific pCoRS TCSTS encoded by the same operon [220].
Although cusRS and pcoRS encode homologous Cu-responsive regulatory systems, they do not
substitute for one another. The CusRS and PcoRS have different sensitivities or induction
profiles to varying Cu concentrations and are comprise of independent copper-responsive
regulatory systems in this bacterium [220].
Similar plasmid-encoded regulation of Cu resistance operon, copABCDRS, is observed in
Pseudomonas syringae and is regulated by the corresponding copRS TCSTS [221]. CopABCD
functions in the binding of copper, while CopR and CopS form a TCSTS system that regulates
the expression of copABCD [221-223]. In P. syringae multi copper oxidase copA and outer
membrane protein copB are essential to fundamental copper resistance whereas periplasmic
proteins, copC and copD are required for full Cu resistance [221-223]. In vitro studies suggested
the direct binding of CopR to the cop box (a conserved CopR binding region) in the promoter
region of the Cu resistance operon [224]. In Pseudomonas fluorescens strain TSS, homologous to
plasmid encoded cop operon however chromosomally located, Cu resistance genes copRSCD but
not copAB have been identified [225]. The expression of copCD is directly regulated by the two
component responder protein CopR, which auto-regulates its expression in response to Cu [225-
226]. In addition to Cu resistance, CopRS modulates bacterial growth, biofilm formation, and
tissue dissemination, thereby suggesting its involvement in the regulation of bacterial virulence
determinants in P. fluorescens [225].
32
2.4 A link between Copper and Silver homeostasis
In the periodic table Cu and Ag both belong to Group 11, of the transition metal elements.
Similar to Cu, Ag has an antimicrobial effect on bacteria and is widely incorporated into
products in medical equipment and public environments [227]. Silver cations (Ag+) are
bactericidal at low concentrations and are used to treat burns, wounds and ulcers. In addition,
silver catheters and silver-coated catheters are used for their inhibitory role in microbial growth
and biofilm formation [227]. Silver nanoparticles are effective not only against bacterial
infections, but also are active against several types of viruses including the human immuno-
deficiency virus, hepatitis B virus, herpes simplex virus, respiratory syncytial virus, and monkey
pox virus [228]. Because of similar chemical properties of Cu and Ag, bacteria utilize a similar
set of genes to cope with their homeostasis and resistance. In E. coli, the central role of CusS has
been associated with modulating transcription of genes involved in Cu and Ag efflux [210].
CusS is activated in a metal- dependent manner and up-regulates the expression of cusCFBA that
is required for Cu and Ag resistance. In a clinically isolated Ag resistant strain of Salmonella,
metal ion resistance was conferred by the plasmid pMGH100, which has nine genes required for
Ag resistance that are arranged as three transcriptional units [227]. Genes present within these
units encode the SilRS TCSTS, a periplasmic Ag+-binding protein (SilE), an Ag+ efflux pump (a
P-type ATPase SilP), and a membrane potential-dependent three-polypeptide cation/proton
antiporter (SilCBA). The function of SilP in transporting cytoplasmic Ag directly into the
periplasm or across the outer membrane is yet not investigated. However, SilABC forms the
three polypeptide RND protein which removes Ag from the cytoplasmic region directly to the
outside of the cell without its release into the periplasmic space. The silver dependent activation
of the SilE, SilP and SilCBA is regulated by the SilRS system [227].
2.5 Manganese homeostasis
Mn has a vital function in regulation of bacterial metabolism, since it acts as a cofactor for
metabolic enzymes such as superoxide dismutase, catalase, pyruvate carboxylase, and
phosphoenolpyruvate carboxykinase[229-230]. Mn is essential for detoxification of ROS thereby
33
protecting the cells against oxidative stress, also recently, low molecular weight Mn complexes
have been shown to reduce oxidative tissue injury and ROS in in vitro and in vivo biological
systems [166, 231]. B. subtilis utilizes Mn during different stages of its developmental cycle and
particularly for efficient sporulation [232].
In Pseudomonas putida, a Mn2+-oxidizing bacterium [233], the MnxSR two-component
regulatory system is comprised of two sensor kinases, MnxS1 and MnxS2, as well as one
responder protein, MnxR. Together MnxS1, MnxS2 and MnxR have a central role in regulating
Mn2+oxidation [234]. The oxidation of Mn2+ to Mn3+ and Mn4+ is assumed thermodynamically
favorable as bacteria may derive energy from this reaction. The MnxR regulates Mn2+ oxidation;
however, in order to be activated, MnxR requires signaling from both cognate sensor kinases
since deletion of MnxS1 or MnxS2 results in complete loss of its ability to oxidize Mn2+ [234].
Mn together with Ca2+ and Cl- act as a catalytic center for the oxygen-evolving photosynthetic
machinery in higher plants and cyanobacteria [235]. Cyanobacterial cells take up Mn2+ ions
using an ABC-type transporter encoded by the mntCAB operon: mntA encodes an ATP binding
subunit, mntB encodes a gene for its hydrophobic subunit, and the mntC encodes a Mn2+ binding
subunit [236]. Two different studies in Synechocystis identified a TCSTS comprised of ManS
and ManR involved in sensing and regulating the mntCAB operon, respectively [237-238]. At
high Mn2+ concentrations, cell membrane localized ManS is speculated to bind Mn2+ and convey
the signal to its cognate responder protein, ManR. Once activated, ManR can repress the
transcription of the mntCAB operon thus inhibiting Mn uptake. On the other hand, under low
Mn2+concentrations, ManS is speculated not to bind Mn2+ ions and thus, ManR remains inactive
resulting in de-repression of the mntCAB operon, facilitating uptake of Mn [237-238].
The effect of Mn in activating and regulating the expression of two component signaling systems
has been observed in several organisms [239-242]. In Streptomyces reticuli, a soil microbe, the
SenS/SenR system modulates the expression cpeB, which encodes a Mn-dependent peroxidase
involved in protecting the cells under oxidative stress [240]. In M. tuberculosis, Mn and Ca are
known to activate the TrcRS TCSTS [243]. The TcrRS TCSTS suppresses the expression of
rv1057, which encodes the only seven-bladed β-propeller protein required for the structural
integrity of the cell envelope of M. tuberculosis and might be a component of the mycobacterial
34
envelope [242]. Though not much has been published regarding rv1057, studies suggest that the
Rv1057 protein may function similar to TolB, a β-propeller protein that interacts with
peptidoglycan-associated proteins and maintains envelope integrity in Gram negative bacteria
[244]. In E. coli, Mn-containing serine/threonine protein phosphatases, PrpA and PrpB regulate
the CpxAB TCSTS and the periplasmic protease HtrA/DegP, which help contend with
environmental stress tolerance [239, 241].
In Streptococcus mutans, which is one of the primary causative agents of human dental caries
[245], the sloABCR operon encodes components of a putative metal uptake system. These genes
encode an ATP-binding protein, an integral membrane protein, a solute-binding lipoprotein, and
a metal-dependent regulator, respectively [164]. The SloABC transport both Fe and Mn,
although the SloR represses this system only in response to Mn [164]. The SloR in S. mutans is a
one component cytoplasmic metal dependent regulator, which modulates several physiological
functions that include cell adherence, biofilm formation, genetic competence, metal ion
homeostasis, oxidative stress tolerance, and antibiotic gene regulation [167]. In this organism,
SloR-Mn regulates the expression of an orphan responder protein designated GcrR, which acts
downstream to tolerate acid stress, an important virulence factor of this cariogenic pathogen
[140, 168]. The interaction between the metalloregulatory protein SloR and RR GcrR provides
an excellent example of cross-talk between one component and two component metal regulatory
systems in bacteria. In S. mutans, acid tolerance is known to be mediated by several TCSTSs
including the CiaHR system that is activated by Ca2+ [165]. This system also regulates multiple
virulence phenotypes including the ability to produce acid, form biofilm and develop genetic
competence [165]. The ciaRH is part of the ciaRHX operon, where ciaX encodes a calcium
sensing signaling peptide that allows the CiaRH system to modulate its operon own expression in
response to this cation [165].
2.6 Cadmium Zinc Cobalt Homeostasis
Bacteria utilize Zn as an enzymatic co-factor and for the integrity of structural elements of the
cell. Like other heavy metals, at high concentrations Zn can be highly toxic to the cell.
35
Therefore, intracellular levels of Zn are often tightly regulated by an extensive network of
transporters, ligands and transcription factors. In E. coli, Zn detoxification is primarily achieved
by exporters such as ZntA, a P-type ATPase, ZntB, a cation diffusion facilitator and periplasmic
proteins such as Spy or ZraP [246].
In E.coli, the BaeSR TCSTS is one of three extra-cytoplasmic stress response (ESR) systems that
helps elicit adaptive responses to changing environmental conditions [247]. On sensing transient
environments (e.g., stresses posed by indole, tannin, flavonoids, sodium tungstate, or high levels
of metal cations), the BaeS is activated and transduces its signal by catalyzing phosphorylation
of the transcription factor BaeR [247]. In E. coli and Salmonella BaeR activates the expression
of its own operon as well as genes involved in responses to contend with envelope stress, drug
resistance, and metal resistance [248-250]. In E. coli, the BaeSR TCSTS can sense Fe and Zn in
the surrounding environment, and in turn, regulate the expression of genes involved in the
formation and modification of membrane structure and function [251]. The BaeSR together with
the CpxAR TCSTS co-regulate the ZraP and Spy periplasmic chaperones required for envelope
stress sensing [252]. Though the function of the periplasmic chaperone, Spy, in Zn detoxification
is not known, its induction in the presence of Zn and impaired growth of the knock out mutant in
spy under Zn stress suggest that it might play a role in Zn detoxification probably by facilitating
the folding of the transmembrane or periplasmic transporters involved in Zn export [248]. In S.
typhimurium, BaeSR was shown to be involved in regulating the expression of multidrug efflux
pumps and providing resistance against Cu and Zn toxicity [253].
In E. coli another Zn-responsive TCSTS, HydHG TCSTS system, when under excess Zn
concentrations, modulates the expression of the periplasmic Zn-binding protein ZraP to maintain
Zn homeostasis [254]. Similarly in S. typhimurium, ZraSR (HydHG), have been shown to
modulate the expression of periplamic protein, ZraP required for regulation of the ZntA
transporter of Zn [255]. The periplasmic protein and Zn-dependent chaperone ZraP has an
important role in maintaining envelope homeostasis and contributes to the regulation of response
regulator zraR of the ZraSR TCSTS [255]. In another study, it was shown that while ZraP and
ZraSR can be induced by indole. In the zraP knock out mutant a significant reduction in zraR
expression was observed even in the presence of indole [255]. Although it was suggested that
ZraP regulated the expression of the ZraSR TCSTS, the fact that both ZraP and ZraSR are
36
induced by indole is noteworthy; since ZraP is a periplasmic chaperone, there is a possibility that
it might act as a signal transducer for indole, wherein the absence of this protein, the signal for
ZraR activation is not conveyed resulting in its low expression levels [255]. The same group
further showed that regulatory cross-talk occurs between the ZraPSR and BaeSR systems,
wherein the loss of BaeR led to the induction of ZraPSR [255].
In P. aeruginosa, the CzcRS TCSTS regulates the expression of CzcCBA efflux system, which
confers specific resistance against Zn, Cd, and Co cations [256]. CzcA functions as a cation-
proton antiporter, and CzcB acts as a cation binding subunit. Both CzcA and CzcB proteins form
a membrane bound protein complex which can catalyze an energy-dependent efflux of Zn, Co,
and Cd ions [257]. The CzcC provides substrate specificity towards Co and Cd [257]. In the
presence of Zn, Cd or Co, the metal-inducible TCSTS, CzcRS is activated, and in turn, induces
the expression of czcCBA encoding a metal efflux pump [256]. Further, the CzcRS is involved in
cross-talk with the CopRS TCSTS, wherein the CopR regulator required for Cu homeostasis,
links Cu resistance to Zn tolerance by activating the czcRS operon [258]. In P. aeruginosa, a
putative cop box was identified between czcC and the czcR regulatory gene suggesting that CopR
can bind to this region and regulate the transcription of the czcRS and czcCBA operons [259].
2.7 Nickel Homeostasis
Ni is required as a structural component of metallo-enzymes [260-261]. It is also needed to form
a part of the active site of a number of enzymes including peptide deformylase, reductase and
ureases, as well as some superoxide dismutases and hydrogenases [260-261]. Like other
transition metal ions, at higher concentrations, Ni cations can confer harmful effects such as the
generation of free radicals, inhibition of enzyme activity, contribution to DNA damage,
developmental defects and cancer [262-263]. E. coli utilize Ni to survive under anaerobic
growth. In fact, high levels of Ni are used for the optimal activity of Ni/Fe hydrogenases,
enzymes involved in H2 oxidation [264-265]. The NikR, transcription factor has been
characterized in various bacteria, and is known to repress or activate specific genes in response
to Ni availability [266].
37
Microbial Ni uptake is either accomplished by non-specific transport systems for divalent cations
or by high affinity Ni-specific systems [267-268]. In E. coli, an ATP-binding cassette
transporter, designated as NikABCDE, serves as the main importer for Ni ions. NikABCDE is
comprised of NikA, a periplasmic Ni-binding and Ni-sensing protein; NikB and NikC integral
inner membrane proteins; as well as NikD and NikE membrane-associated ATPase proteins
[266, 269]. The nikABCDE operon responds to the presence of intracellular Ni, oxygen tension
and nitrate availability. The transcription of the nikABCDE operon is positively regulated by the
fumarate nitrate regulatory protein (FNR) transcription factor in the absence of oxygen [270] and
is negatively regulated by the NikR repressor in the presence of high concentrations of Ni ions
[271-272]. Another major transcriptional regulator identified for the nikABCDE operon is the
nitrate responsive NarLX two-component system [273]. In the presence of nitrate, NarX HK
phosphorylates the cognate RR NarL, which represses the expression of the nikABCDE operon
by binding to a distinct operator site from that of NikR [273]. The expression of the operon is
tightly regulated by the mechanisms described depending on the presence of stressors involved
[266].
In Synechocystis species, the nrsBACD operon encodes proteins required for Ni resistance [274].
NrsB and NrsA are homologues of the P. aeruginosa CzcB and CzcA proteins, respectively
[274]. Together the NrsA and NrsB, form a membrane-bound protein complex that can catalyze
Ni efflux by a proton/cation antiport system. The role of NrsC in Ni export is unknown. NrsD, a
membrane protein, confers resistance to Ni and also acts as a Ni exporter [274]. Upstream of this
operon and in reverse orientation, the NrsRS TCSTS can sense and respond to Ni. Once
activated, it modulates expression of the nrsBACD operon, whose products regulate Ni
homeostasis [274]. When Ni accumulates in the periplasm, the nrsBACD operon is activated
under the control of NrsSR TCSTS; the accumulation of Ni in the cytosol is sensed by InsR
(internal nickel-responsive sensor) [275]. InsR, a CsoR/RcnR like metallo-regulator, binds
directly at the cryptic transcription start sites within the nrs operon which enables independent
repression of nrsD (of other nrs genes) in response to cytosolic Ni ions [275]. In the mutant
deficient in inrS, as a result of Ni-dependent derepression of nrsD, an increase in export of Ni
from the cytosol to periplasm was observed resulting in enhanced Ni resistance and reduced
cytosolic Ni accumulation [275]. The regulation of the nrsBACD operon either by cytoplasmic
38
metallo regulatory protein or membrane bound TCSTS occurs depending on the surplus
accumulation of Ni within the cytosol or periplasm respectively [275]. However, whether the
regulatory pathways involve any crosstalk for efficient homeostasis remains a question [275].
2.8 Future perspectives
Despite our enhanced understanding of the role of TCSTSs in bacterial physiology, more studies
are required to dissect the direct mechanisms underlying these processes. For instance, the nature
of cation-induced activation (i.e. direct or indirect stimulation of the sensor kinases) remains an
area of research that deserves greater attention. As discussed earlier, in Synechocystis, in vitro
studies have shown direct binding and activation of the HK by Cu cations [216]. Such studies
provide groundwork for more extensive research to understand the bio-physical interactions
between the TCSTS and metal cations. Emerging research in the field of bacterial metallo-
regulation reveals the conservation and pairing of TCSTSs with corresponding cation
uptake/efflux systems. Recently, upon analyzing the phylogeny of responder proteins belonging
to TCSTSs, patterns of orthology/paralogy between Cu, Cd, Zn, and Co efflux proteins, as well
as among their regulatory proteins (e.g., CopR, CzcR, CopS, and CzcS) was discovered [276].
Further, comparative analyses of three-dimensional structures has confirmed a common
evolutionary origin for these regulatory proteins [276]. Hence, the shared mechanism of
activation or function of these systems can be exploited to develop novel therapies against
bacterial infections. Bacteria deprived of the genes involved in metal homeostasis or those tied to
their regulation tend to have diminished virulence relative to their parent strains. Since metal-ion
homeostasis and TCSTSs are closely coupled to bacterial survival and virulence mechanisms,
understanding the molecular mechanisms underlying these processes can have significant clinical
implications in curbing bacterial virulence.
39
2.9 Executive summary
� Transition metal-ion homeostasis is important for bacterial survival. While these cations
can be detrimental at high concentrations, they can sometimes serve essential functions in
maintaining optimal physiology of these organisms.
� Of cellular components that are involved in metal homeostasis, bacterial TCSTSs have
intimate and complex roles in responding, as well as in eliciting cellular responses to metal
cation stress.
� Cytoplasmic metallo-regulators differ from the TCSTSs, as the former are comprised of a
single protein that can perform dual functions of sensing and responding to metal ions
whereas latter utilizes two different proteins to perform these functions.
� Bacterial TCSTSs accomplish metal-ion homeostasis by not only regulating metal export,
but also by modulating the production of proteins associated with metal detoxification.
� Many RRs can directly bind to the promoter regions of their target genes whose products
modulate metal trafficking and homeostasis (summarized in Table 1); however sensing and
activation of their cognate HKs by metal cations is still an area which demands more
investigative work.
� Bacterial metallo-regulation reveals the conservation and pairing of TCSTSs with their
corresponding cation uptake/efflux systems.
40
Table 2-1 Bacterial TCSTS and metal ions
Metal Ion TCSTS Organism Operon regulated RR directly
binding to
operon
Cu CopRS C. glutamicum [215]
P. fluorescens [225-226]
Synechocystis [216]
cg3286-cg3289 and copR-cg3281
copRSCD
copBAC, copMRS
Yes
Yes
Yes
CusRS E.coli [36-37] cusCFBA, cusRS Yes
CpxAR E.coli[217] Specific copper-inducible genes Yes
YedVW E.coli [213] Several copper-inducible genes No
CrdRS H. pylori [219] crdAB, czcBA,crdRS Yes
Plasmid
Encoded
pCoRS
CopRS
E.coli [220]
P. syringae [221, 224]
pcoABCDRS, pcoE
copRS, copABCD
Yes
Yes
Ag CusRS E.coli [36-37] cusCFBA, cusRS Yes
SilRS Salmonella [227] silE, silP, silABC ND
Mn MnxSR P. putida [234] Involved in Mn2+ Oxidation ND
ManSR Synechocystis [237-238] mntCAB Yes
Cd, Zn, Co BaeSR
E.coli [247]
S typhimurium [249, 253]
Several metal resistance genes
Several metal resistance genes
---
---
ZraSR S. typhimurium [255] zraP ND
HydHG E.coli [254] zraP Yes
CzcRS P aeruginosa [256] czcRS, czcABC Yes
Ni NrsRS Synechocystis [275] nrsBACD Yes
NarLX E.coli [273] nikABCDE Yes
41
3 Statement of the problem
It is established that metal ions play an important role in bacterial cellular processes to ensure
optimal cell viability at all times. The unique properties of metals allow them to function as
structural component of bio-molecules, signalling molecules, and catalytic co-factors of various
essential metabolic enzymes [159-160]. Bacteria are known to have specialized mechanisms to
counter the perturbations in the intracellular metal homeostasis. The unwanted metal imbalance
can have deleterious effects on bacterial physiology such as: induction of oxidative stress,
impairment of protein stability and function, or structural damage of bio-molecules, etc [161-
162].
Most bacteria require copper as an essential co-factor for metabolic enzymes, although there are
others where copper is not required for any of their metabolic activity [277]. Copper exists in
two oxidation states: cuprous (Cu+) and cupric (Cu2+) forms; the interchange between these states
via Fenton reactions can lead to the generation of reactive oxygen species (ROS), especially
superoxide radicals which are toxic to the cells [208]. The production of ROS causes major
damage to nucleic acids, proteins or lipids, thereby compromising cell viability [203]. However,
some reports indicate the involvement of non-redox mechanisms of copper toxicity [204, 206,
278]. One such example is copper displacing the iron cation from Fe-S clusters of the
dehydratases enzymes thereby, rendering them inactive [206, 278]. Therefore, mechanisms
involved in copper homeostasis can have different cellular targets among different bacterial
species.
Copper has been linked to the inhibition of biofilm formation and detachment in S. gordonii
[279]. Previous studies have shown that in S. mutans the addition of copper modulates the
expression of gtfD both at the transcriptional and translational levels [280]. In S. mutans, in two
different microarray studies conducted in our lab showed that the expression of the copYAZ
genes was modulated in the presence of acid or CSP [109, 157]. In S. mutans strain GS-5, copper
was shown to irreversibly inhibit the activity of F-ATPases, thereby compromising the cell's
ability to carry out glycolysis in acidic environments [281].The mechanism by which copper
renders toxicity in S. mutans has yet not been fully discovered.
42
3.1 Rationale and objectives
S. mutans is known to contribute in initiation and progression of dental caries- a chronic
transmissible bacterial infection. Since its post-genome sequence era, the research on and
understanding S. mutans' physiology and identifying its virulence attributes has vastly expanded,
accredited to the recent advances in the field of genomics, proteomics and transcriptomics. The
three established virulence attributes of S. mutans include: acidogenicity, aciduricity and biofilm
formation.
S. mutans genome encodes the copYAZ operon, a copper transport and resistance system. The
structure analysis for the S. mutans CopYAZ was performed using Phyre-2 structure prediction
site (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index). The S. mutans copA encodes
for a 742 amino acids (a.a) long predicted protein belonging to the P-type ATPases class of metal
exporters. The CopA product is predicted to contain 7 trans-membrane domains with an
intracellular N- and an extracellular C-terminal. The copY encodes translated product of 147 a.a
residues and is predicted to be a negative transcriptiopnal regulator of copA, harboring winged
helix DNA-binding domain. The copZ encodes for a 67 a.a residues putative copper chaperone
and harbors a metal binding domain. Using BLASTP, the percentage sequence similarity
analysis of S. mutans copA encoded protein with other bacterial Cop proteins showed high
sequence similarity with: E. hirae CopA (96%), E. hirae CopB (86%), Staphylococcus aureus
CopB (91%), S. aureus CopA (81%), Enterococcus faecalis CopA (99%), S. thermophilus
copper P-type ATPase (100%), S. salivarius CopA (100%). Moreover, the gene expression
analysis revealed an induction of the copYAZ operon under copper stress in S. mutans. With
these preliminary results we postulated the presence of a functional copYAZ operon in S. mutans,
which resembles other functional bacterial copper transporters in copper efflux, and in protecting
the cell under copper and/or other cellular stressors.
Copper is toxic to S. mutans, however, the pathways affected by copper warrants further
investigation. S. mutans genome does not appear to have any intracellular copper requirement,
either in cupro-proteins (copper-containing proteins) or as enzymatic co-factors; therefore
implying the major function of copper homeostatic systems is protecting the cells against copper
stress [170, 277]. Although copper resistance and the transport system copYAZ have been
43
partially characterized in S. mutans, the role of this operon in bacterial virulence is not yet
characterized. Based on above observations we presented the following hypothesis.
3.2 General hypothesis
In S. mutans, an imbalance in copper homeostasis induces toxic effects on its main features such
as biofilm formation, competence and stress tolerance. The CopYAZ system is required for
copper homeostasis and for the modulation of virulence attributes in S. mutans.
3.3 Objectives and aims
Given that biofilm formation and stress tolerance are vital to the virulence of S. mutans,
understanding the contribution of copper to these processes remains the question warranting
further research. In an attempt to elucidate the physiological and molecular mechanisms
underlying copper response in S. mutans, the goal of this dissertation is to investigate the
following specific aims:
Specific Aim 1: Determine the effects of copper on biofilm formation, genetic competence
and stress response in S. mutans.
Specific Aim 2: Understand the role of the copYAZ operon in copper transport and stress
tolerance in S. mutans.
Specific Aim 3: Determine the underlying molecular mechanism by which copper
modulates genetic competence and biofilm formation in S. mutans.
44
4 The copYAZ operon functions in copper efflux,
biofilm formation, genetic transformation and stress
tolerance in Streptococcus mutans
Running Title: Streptococcus mutans copper transport system
Kamna Singh, Dilani B. Senadheera, Céline M. Lévesque, Dennis G.
Cvitkovitch*
Dental Research Institute, Faculty of Dentistry, University of Toronto
*Corresponding Author E-mail: [email protected]
J Bacteriol. 2015 Aug 1; 197(15):2545-57. doi: 10.1128/JB.02433-14.
Epub 2015 May 26
45
4.1 Abstract
In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions, while
avoiding cell damage. Most Gram positive bacteria utilize the copYABZ operon for copper
homeostasis, where copA and copB encode for copper transporting P-type ATPases, whereas
copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm
forming oral pathogen that harbours a putative copper transporting copYAZ operon. Here, we
characterized the role of copYAZ operon in the physiology of S. mutans and delineated the
mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced
toxicity in S. mutans by generating oxidative stress and disrupting its membrane potential. The
deletion mutant of the copYAZ operon in S. mutans UA159 strain, designated ΔcopYAZ, resulted
in reduced cell viability under copper-, acid- and oxidative-stress relative to the wild type.
Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was
impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total
biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and
gbpC genes, whose products have a role in maintaining the structural and/or functional integrity
of the S. mutans biofilm. Further, supplementation with copper or loss of the copYAZ resulted in
a significant reduction in transformability and transcription of competence- associated genes.
Copper transport assays revealed that the ΔcopYAZ strain accrued significantly high amounts of
intracellular copper compared with the wild-type strain, thereby, demonstrating a role for
CopYAZ in copper efflux of S. mutans. The complementation of CopYAZ system restored
copper expulsion, membrane potential, and stress tolerance in copYAZ-null mutant. Taken
collectively, we have established the function of the S. mutans CopYAZ system in copper export,
and have further expanded the importance of copper homeostasis and the CopYAZ system in
modulating streptococcal physiology including the stress tolerance, membrane potential, genetic
competence and biofilm formation.
46
4.2 Importance
S. mutans is best known for its role in initiation and progression of human dental caries, one of
the most common chronic diseases worldwide. S. mutans is also implicated in bacterial
endocarditis, a life-threatening inflammation of heart valves. S. mutans core virulence factors
include its ability to produce and sustain acidic conditions, and to form a polysaccharide-encased
biofilm that provides protection against environmental insults. Herein, we demonstrated that the
addition of copper and/or deletion of copYAZ (the copper-homeostasis system) have serious
implications in modulating biofilm formation, stress tolerance and genetic transformation in S.
mutans. Manipulating the pathways affected by copper and copYAZ system may help to develop
potential therapeutics to prevent S. mutans infection in, and beyond, the oral cavity.
4.3 Introduction
Many bacteria utilize copper as an essential co-factor for enzymes involved in electron transfer
reactions that include, superoxide dismutase, cytochrome c oxidase or NADH-dehydrogenase
[171, 202]. Although required in low concentrations, copper at higher levels can pose a threat
owing to its high reactivity. Copper can exist in cuprous (Cu+) and cupric (Cu2+) oxidative forms;
the interchange between these states via Fenton reactions can lead to the generation of reactive
oxygen species (ROS), especially superoxide radicals. The ROS are believed to cause cellular
damage by reacting with a number of cellular macromolecules such as lipids, proteins, and
nucleic acids [203, 208, 282]. However, there is little or no direct evidence that shows that
copper-induced ROS generation is the main mode of copper-toxicity in bacteria [204, 206, 278].
In Escherichia coli, copper was demonstrated to target and replace iron from the iron-sulphur
clusters of dehydratases, thereby, rendering them inactive and perturbing the biosynthesis of
branched chain amino acids [172, 204, 206, 278]. Supplementation of E. coli cultures with
branched chain amino acids was shown to reverse the copper-induced growth inhibition [278].
However, a similar mechanism was not observed in Salmonella, where the addition of exogenous
branched chain amino acids did not revert copper-mediated growth inhibition, thereby suggesting
the involvement of a different cellular target for copper-toxicity [205]. Copper-mediated
47
membrane depolarization has also been reported in E. coli [283]. Challenges posed by copper
necessitate the involvement of complex regulatory machinery to maintain copper homeostasis in
the cell. To contend with copper toxicity, bacteria utilize at least one of three principal
mechanisms that include, a) copper export across the plasma membrane into the periplasmic
space or the extracellular environment, b) extracellular and/or intracellular copper sequestration
via copper binding proteins and, c) copper oxidation to a less toxic Cu2+ state [207]. The
mechanisms involved in copper stress tolerance can vary among bacterial species and exploring
these pathways is an important step to implement the use of such metal cations as antimicrobial
therapeutics.
Streptococcus mutans is considered as the primary etiological agent of dental caries, one of the
most widespread infectious diseases worldwide [19, 77]. Numerous studies have indicated the
inhibitory effects of copper on S. mutans growth and caries formation [87, 95, 177, 284-288].
The copper concentration in saliva and dental plaque fluctuate between individuals and depend
on the age, sex, nutrient intake, etc. [289-292]. Copper concentrations in saliva can range from
0.05-61.7 µM, whereas the numbers fluctuate between 26 and 1520 ppm within the plaque
biofilm. By administering copper-containing mouth rinses, copper has been shown to
dramatically influence the growth and pathogenicity of S. mutans [291]. In S. mutans strain GS-
5, copper irreversibly inhibited the activity of F-ATPases, thereby compromising the cell's ability
to carry out glycolysis in acidic environments [281]. Further, this cation was shown to modulate
S. mutans gtfD expression whose products are associated with soluble glucan production and
biofilm formation of S. mutans [280]. Like many Gram positive bacteria, S. mutans genome
sequence does not appear to encode proteins or enzymes that require copper for their functional
activity [277]. Even though copper is not required for its cellular processes, S. mutans must still
possess a functional copper-exporting machinery to avoid cell damage under excessive copper
concentrations.
Unlike Gram negative bacteria that traffic copper through different cellular compartments from
the cytosol to the periplasm and from the periplasm to the extracellular environment, Gram
positive bacteria possess rather simple copper homeostatic systems dedicated towards extrusion
of excess copper cations from the cytosol to the extracellular milieu [170]. The CopYABZ
copper homeostasis system of Enterococcus hirae is the best understood copper homeostasis
48
model in Gram positive bacteria [169-170, 293-294]. This operon encodes four proteins that
include two copper P-type ATPases, CopA and CopB, a copper responsive repressor, CopY, and
a copper-chaperone, CopZ [169, 293-294]. The CopZ family of metallo-chaperones is conserved
within various bacterial and eukaryotic systems [169-170]. A homologous copper transport and
resistance system, encoded by copYAZ, has been partially characterized in S. mutans strain
JH1005 [178]. The sensitivity of the copYAZ knockout mutant was shown to be specific to
copper and CopY was demonstrated to act as a negative regulator of the operon [178]. Although
not tested conclusively, CopZ was speculated to de-repress the cop operon activity and the
deficiency of copYAZ was shown to result in enhanced sensitivity to cell-killing under copper
stress [178].
Here we investigated the effects of copper on the physiology of S. mutans and the role of
CopYAZ in copper homeostasis. While previous studies have implicated metal cations in biofilm
formation and genetic competence development [295-297], the role of copper and the CopYAZ
in regulating these phenotypes is poorly understood in S. mutans. The ability of this organism to
adhere to hard surfaces and form a biofilm is an important virulence factor that is critical for its
survival and persistence in the oral cavity. Within the plaque biofilm, S. mutans is capable of
natural transformation that is made possible when it accomplishes a transient physiological state
referred to as genetic competence [147, 153]. Genetic transformation is important for acquiring
novel, heritable functions that can enhance fitness and drive evolution [151]. In S. mutans,
genetic competence is induced by two signaling peptides designated the competence-stimulating
peptide (CSP encoded by comC) and the comX-inducing peptide (XIP encoded by comS) [132,
142-143, 146]. Under specific competence-inducing conditions, both CSP and XIP can activate
the transcription of the master competence regulator encoded by the comX (or sigX) alternate
sigma factor required for the transcription of genes involved in DNA uptake and recombination
[132, 142-143, 146]. Notably, the S. mutans competence development pathway activated by CSP
and XIP is closely intertwined with its biofilm pathway [142, 145, 147, 298-299]. However, it
remains to be studied how and whether copper exerts its influence to regulate these phenotypes
via the putative CopYAZ copper transport system in S. mutans.
Herein, we showed that copper instigates a compromised state in S. mutans, by dissipating
membrane potential and decreasing its ability to endure environmental oxidative and pH stress,
49
produce biofilm, and develop genetic competence. Utilizing a copYAZ deletion mutant,
designated as ∆copYAZ, we validated the function of S. mutans CopYAZ in copper efflux. We
also report that the addition of copper or the absence of copYAZ system reduces the transcription
of genes involved in biofilm matrix production and genetic competence development; loss of
copYAZ leads to impairment of stress tolerance, transformability, and membrane potential in S.
mutans.
4.4 Material and methods
4.4.1 Strains and growth conditions
All S. mutans strains were grown in Todd-Hewitt yeast extract (THYE) (Becton Dickinson,
Sparks, MD) broth as standing cultures or on THYE with 1.5% (wt/vol) agar (Bioshop,
Burlington, Ontario, Canada) at 37°C in air with 5% (vol/vol) CO2. Tryptone yeast extract
medium (TYE) (10% Tryptone, 5% yeast extract, 17.2 mM K2HPO4) was utilized for the acid
tolerance response (ATR) assays (Tryptone was obtained from Bioshop, Burlington, Ontario,
Canada). For the ATR assays, NaOH or HCl was added to TYE to adjust the pH to 7.5 or 5.5 and
3.5, respectively. E. coli strains were cultivated aerobically in Luria Bertani (LB) medium at
37°C. Chemically defined media [132, 300] was used for transformation frequency assays.
Antibiotics were added whenever required in recommended concentrations: erythromycin
(10 µg/ml), chloramphenicol (10 µg/ml), spectinomycin (1000 µg /ml) for S. mutans and
ampicillin (100 µg/ml), chloramphenicol (20 µg/ml) for E. coli.
4.4.2 Minimum inhibitory concentration (MIC) assays
MIC assays were conducted as previously described [301]. Briefly, 100 µl of mid-log phase
bacterial cells adjusted to an OD600 of ~0.01 were added to a 96-well microtiter plate containing
THYE medium supplemented with two-fold serial dilutions of CuSO4 or CuCl2 (Sigma-Aldrich)
solutions (concentrations ranging from 0 to 25 mM), AgNO3 (1 to 100 µM), CdSO4 (0 to 1.5
µM), HgNO3 (0 to 10 µM), ZnCl2 (0 to 25 mM), MnCl2 (0 to 100 mM), or CaCl2 (0 to 100 mM).
After incubation at 37°C with 5% (vol/vol) CO2 for 24 h, bacterial growth was
50
spectrophotometrically measured by using a micro-titer plate reader at an absorbance of 600 nm.
The MIC was determined as the lowest concentration that inhibited visible cell growth relative to
no copper control.
4.4.3 Mutant and complemented strain construction
A deletion mutant (designated as ∆copYAZ) of the copYAZ (NCBI database gene annotation:
SMU_424, SMU_426, SMU_427) in S. mutans UA159 wild type background was constructed
for this study. Briefly, a knockout mutant was constructed using the PCR-ligation mutagenesis
strategy as described by Lau et al [302], by deleting the operon and inserting an erythromycin
resistance cassette at the locus in the UA159 background. The deletion of copYAZ operon in the
∆copYAZ strain was confirmed by PCR amplification, DNA sequencing and quantitative Real
Time PCR (qRT-PCR) analyses. The complementation analysis was done using E. coli copA
deficient mutant (designated as DW3110, obtained from the Keio collection). Complemented
strains of E. coli copA were constructed using the Thermo Scientific CloneJET PCR Cloning Kit
as per the manufacturer's instructions. Briefly, the S. mutans copYAZ was PCR amplified using
UA159 genomic DNA as the template, and ligated into the pJET vector. The vector was first
transferred into E. coli DH5α chemically competent cells (Invitrogen Subcloning Efficiency™
DH5α™ Competent Cells). The clones were selected on LB agar plates supplemented with
ampicillin (100 µg/ml) and confirmed using nucleotide sequencing. The resulting plasmid was
then transferred into chemically competent cells of the E. coli DW3110 mutant to obtain the
complemented strain DW3110compYAZ. Similarly, to generate a complemented strain in
S. mutans, similar PCR products were utilized and ligated into plasmid pIB166 [303] harbouring
a chloramphenicol resistance marker and a constitutive promoter upstream of a multiple cloning
site. The cloned vector with the entire copYAZ was transferred into the ∆copYAZ and the
resulting strain was designated as Comp∆copYAZ. Complementation with empty vector was
utilized as control (DW3110pJET or ∆copYAZpIB) (data not shown). Bacterial strains and
primers utilized in this study are summarized in Table 4-1and Table 4-2, respectively.
51
Table 4-1 Bacterial strains and plasmids used in this study
Strain Relevant characteristics Source or reference
UA159 S. mutans Wild type Erms J. Ferretti, University of Oklahoma
∆copYAZ In-frame copYAZ deletion mutants
derived from UA159; Ermr
This study
Comp∆copYAZ ∆copYAZ transformed with pIB-YAZ
Cmr, Ermr
This study
W3110 E. coli wild type Keio Collection
DW3110 W3110 ∆copA Keio Collection
DW3110compYAZ DW3110 transformed with pJET-copYAZ
Ampr, Emr
This study
Plasmid
pIB166 Shuttle plasmid containing the P23
lactococcal promoter; Cmr
[303]
pIB-YAZ S. mutans copYAZ fragment cloned into
pIB166 Cmr, Emr
This study
pJET Plasmid containing T7 promoter; Ampr Thermoscientific CloneJET PCR
Cloning Kit
pJET-copYAZ S. mutans copYAZ fragment cloned into
pJET Ampr, Emr
This study
pDL277 E. coli-Streptococcus shuttle vector,
Spr
[304]
52
Table 4-2 Primer Sequences used in this study
Primer Name Sequence Purpose
copY-For 5' CTTATTGCTGGTCCGCTTCAAC 3' qRT-PCR
copY-Rev 5' CGACACTTGCTGCTCTAATGCCTC 3' qRT-PCR
copA-For 5' GGGTCAATCAATGGTCAGGGAAG 3' qRT-PCR
copA-For 5' CAGCAATCTTGGCAATGGGTG 3' qRT-PCR
copZ-For 5' GACAATGTCACCAAACGC 3' qRT-PCR
copZ-For 5' TGGTTCCTTTCAGTGCTCG 3' qRT-PCR
GtfB-For 5′ ACACTTTCGGGTGGCTTG 3′ qRT-PCR
GtfB-Rev 5′ GCTTAGATGTCACTTCGGTTG 3′ qRT-PCR
GtfC-For 5′ CCAAAATGGTATTATGGCTGTCG 3′ qRT-PCR
GtfC-Rev 5′ TGAGTCTCTATCAAAGTAACGCAG 3 qRT-PCR
16SrRNA- For 5′ CTTACCAGGTCTTGACATCCCG 3′ qRT-PCR
16SrRNA- Rev 5′ ACCCAACATCTCACGACACGAG 3′ qRT-PCR
GbpB-For 5′ AGCAACAGAAGCACAACCATCAG 3′ qRT-PCR
GbpB-Rev 5′ CCACCATTACCCCAGTAGTTTCC 3′ qRT-PCR
copYAZ P1 5' AGTATGTTTGTAGTCAGTTGCG 3' Gene Deletion
copYAZ P2 5' GCGCGCCTAATCGTTGAAGCGGACC 3' Gene Deletion
copYAZ P3 5' GGCCGGCCCAGGAAATCCAAGCAAGTGG 3' Gene Deletion
copYAZ P4 5' ATACCAGACTCGCATCATAAGC 3' Gene Deletion
Ermcst- F 5′ GCGCGCCCCGGGCCCAAAATTTGTTTGAT 3′ Gene Deletion
Ermcst- B 5′ GCCGGCCAGTCGGCAGCGACTCATAGAAT 3′ Gene Deletion
compForE 5' GAATTCGAATTCAATGTAGATGAAAGGAGC 3' Cloning in
pIB166
compRevX 5' CTCGAGCTCGAGGGTATATGAAGCCTACTT 3' Cloning in
pIB166
compRevX 5' CTCGAGCTCGAGGGTATATGAAGCCTACTT 3' Cloning in pJET
compForP 5' CTGCAGCTGCAGAATGTAGATGAAAGGAGC 3' Cloning in pJET
53
4.4.4 Biofilm assays
Biofilms were cultivated in 96-well polystyrene microtiter plates using ¼THYE media
supplemented with 10 mM sucrose and varying concentrations of CuSO4 or CuCl2 (0, 100 µM,
250 µM, 500 µM, 1 mM, 2 mM, 5 mM). All wells were inoculated with overnight cell
suspensions of S. mutans wild-type and mutant strains and the plates were incubated for 24 h at
37°C with 5% (vol/vol) CO2. Following incubation, broth was carefully removed and the
biofilms were stained with 0.01% (wt/vol) safranin to determine the relative biomass, as
previously described [305]. For biofilm initial adhesion studies, cells (20µl of mid-logarithmic
cells) were incubated in 12-well polystyrene microtiter plates containing 2 ml ¼-THYE media
supplemented with 10 mM sucrose and varying concentrations of CuSO4 (0, 500, 1000 µM). The
plates were incubated for different time intervals, and the planktonic cells were removed.
Attached cells were washed twice with 1× phosphate buffered saline (PBS) solution before being
scraped from plates and re-suspended in 200 µl of PBS. Cells were briefly sonicated, serially
diluted in 10-fold decrements in 1× PBS, and 20 µl of each dilution was spotted in triplicates on
THYE agar plates. After 48 h of incubation, colonies were counted for the dilutions showing
individual colonies (30-300 in number), and the percentage of cells attached/able to grow were
calculated between the presence and absence of copper.
4.4.5 Acid tolerance response (ATR) assays
ATR assays were conducted as previously described [109]. Briefly, overnight cultures grown in
THYE media were diluted 1:20 using sterile pre-warmed tryptone-yeast extract media at pH 7.5
supplemented with 1% (wt/vol) glucose (TYEG). Cultures were then grown until mid-
logarithmic phase (optical density at 600 nm [OD600], ∼0.4), divided into two equal aliquots and
pelleted via centrifugation. For non-adapted cells, one aliquot was re-suspended in TYEG at a
lethal pH value of 3.5, and for adapted cells, the other aliquot was first re-suspended in TYEG at
pH 5.5 and incubated at 37°C with 5% CO2 for 2h before exposing them to lethal pH 3.5.
Following incubation at 37°C with 5% CO2, cell fractions were removed from cultures at time
zero and after 2h. Cells were gently sonicated, serially-diluted in 10 mM potassium phosphate
54
buffer (pH 7.2) and spotted in triplicate (20 μl of each dilution) onto THYE agar plates. After
incubation for 48 h, colony forming units (CFUs) were counted and ATR was calculated as the
percentage of CFU obtained at lethal pH after 2 h relative to the number of CFU present at time
zero.
4.4.6 Growth kinetic analysis
For growth kinetic assays, S. mutans strains were grown in THYE with varying concentrations
of CuSO4 or CuCl2, paraquat (0, 5 mM, 10 mM, 25 mM, 50 mM) or hydrogen peroxide (H2O2)
(0, 0.0015%, 0.003%, 0.0045%, 0.006% (v/v)). Overnight cultures of S. mutans strains were
diluted 1:20 in fresh THYE medium, and grown till mid-logarithmic phase (O.D ~ 0.4). 20 µl of
cell inocula was added to 350 µl THYE containing varying concentrations of test reagents in
quadruplicate. Cells were incubated at 37°C for 24 h; non-inoculated wells and wells containing
THYE medium with or without reagents alone were used as controls. No antibiotics were used in
growth assays to avoid additional stress. The optical density readings were taken every 20 min
using an automated growth reader workstation (Bioscreen C, Growth Curves USA) and were
plotted over time to obtain growth curves.
4.4.7 Copper transport assays
Overnight cultures grown in THYE were diluted 1:20 and suspended in fresh media
supplemented with or without 1 mM CuSO4 or CuCl2 (suspended in milliQ water). Samples were
incubated at 37°C with 5% CO2 till they reach mid-logarithmic phase (OD600 0.4-0.6). Following
incubation, cells were harvested by centrifugation at 3800×g. To minimize the probability of
measuring membrane-associated copper cations, cells were washed twice with 0.01 M NaClO4,
an experimental electrolyte previously shown to remove residual metal from media and bacterial
surfaces [306]. Cells were re-suspended in ice cold 1× PBS and filtered through a 0.22-µm-pore-
size nitrocellulose filter. The filter was washed twice with 1 ml of ice-cold 1× Tris-EDTA buffer
and once with 1 ml of ice-cold milliQ water. The filter was digested with 4% HNO3 followed by
55
inductively coupled plasma atomic emission spectroscopic (ICP-AES) analysis using the
ANALEST facilities (Analytical Lab for Environmental Science Research and Training) at
University of Toronto. A 100 mg/ml CuSO4 or CuCl2 (suspended in 4% HNO3 in milliQ water)
stock solution was used to prepare standards ranging from 3 µg/ml to 100 µg/ml for ICP-AES
calibration. A standard curve was plotted and utilized to analyse the intracellular copper
concentrations. No detectable amounts of copper were observed in THYE or LB media alone.
The measured intracellular copper concentrations were normalized per mg dry weight of cells.
4.4.8 Quantitative real time PCR Assays
Total RNA was isolated from 18-h-old biofilms grown in the presence or absence of 500 µM
CuSO4 in ¼ THYE media supplemented with 10 mM sucrose. Due to its poor biomass
production, higher numbers of wells (three-times the number of wild type) were inoculated to
isolate RNA from 18-h-old biofilms of the ∆copYAZ grown in the presence of copper. The
planktonic cells were removed and the biofilm cells were washed with 1× PBS. The biofilm cells
were scraped from the polystyrene surface and suspended in ice-cold 1× PBS. Cells were
sonicated and collected after centrifugation at 3800×g. For expression analysis of the genes
associated with the competence regulon, cells were cultivated in chemically defined media
(CDM) [132, 300] at 37°C with 5% CO2, until they reached mid-logarithmic growth phase. Cells
were then treated with 100 µM CuSO4 for 30 min. For expression analysis of the genes
associated with acid stress, mid-logarithmic cells cultivated in THYE were treated with 500 µM
CuSO4 for 30 min. Total RNA was harvested from the cell pellets as previously described [307].
After DNAse treatment, RNA was subjected to reverse transcription using the First Strand cDNA
Synthesis Kit (Fermentas). Quantitative Real Time PCR analyses were conducted using the
Quantitect SYBR-Green PCR kit (Qiagen, Mississauga, Ontario, Canada). The fold expression
change was calculated according to the method of Pfaffl et al. [308-309] using the following
formula: Fold change = [Efftarget gene (Ct-control- Ct-experimental)]/ [Eff16S rRNA (Ct-control- Ct-experimental)].
Where E = (10-1/slope) represents the efficiency of gene amplification and Ct values are the
threshold cycle values of the target gene [301, 307]. Results were normalized against S. mutans
16S rRNA or gyrA expression; expression of these house-keeping genes was found stable under
56
the test conditions (data not shown). Statistical analysis was conducted using a Student’s t-test
and a P value of <0.05 was considered significant. Primers utilized are listed in Table S1.
4.4.9 Membrane potential assays
Overnight S. mutans cultures were diluted 1:20 in fresh THYE and cells were grown to mid-
logarithmic phase before washing and re-suspending them in minimal media [310] or in 1× PBS
supplemented with 25 mM glucose. The membrane potential assays were conducted by
measuring the florescence intensity of an anionic dye DiSBAC3- using the Five Photon kit
manufacturer’s protocol. As bis-oxonol is a lipophilic anionic molecule, the dye accumulates in
the cell upon membrane depolarization, where it binds to intracellular components and results in
an increase in cytosolic bis-oxonol fluorescence intensity. After incubating the cells with dye for
10 min, fluorescence was measured using the TECAN fluorescence plate reader (excitation
wavelength of 530 nm, emission wavelength of 560 nm) and the fluorescence intensity was
expressed as Arbitrary Units (AU). After dye stabilization 1 mM CuSO4 was added. The plate
conditions were set at 37°C with shaking for 5 sec before every read and fluorescence intensity
measurements were taken every 15 min for at least 6 h. carbonyl cyanidem-
chlorophenylhydrazone (CCCP), a known membrane depolarizer, was used as a positive control,
wherein the addition of 10 µM CCCP resulted in an immediate increase in fluorescence intensity.
Change in membrane potential (ΔΨ, expressed as AU) was taken as the difference between the
fluorescence value at a specific time point (every 15 min) of incubation (Ψf) and the initial
stabilization value (Ψi). To control for the dye’s intensity change, Ψc (culture sample) was
normalized with Ψb (blank with dye). Statistical analysis was conducted using a Student’s t-test
with a P value of <0.05 considered as significant.
4.4.10 Genetic transformation assays
Overnight cultures of S. mutans grown in THYE were pelleted, washed, diluted (1:20) and re-
suspended in chemically defined media [132, 300]. Cultures were allowed to grow at 37°C with
57
5% CO2 to mid-logarithmic growth phase (OD600 of ~ 0.4). Cultures were then divided into
three aliquots and treated with: 1) no copper; 2) 100 µM CuSO4 and 3) 250 µM CuSO4. The
copper concentrations used were based on the MICs calculated in the CDM media: S. mutans
UA159: 1000 µM and ∆copYAZ: 500 µM CuSO4. Next, 1 µg of plasmid DNA (pDL277,
containing a spectinomycin resistance marker) was added to 500 µl aliquots of cell suspensions
and incubated in 5% CO2 at 37°C for 90 min. Following incubation, samples were briefly
sonicated, serially diluted, and plated onto THYE agar, with and without spectinomycin, to
determine the number of transformants and the total number of possible viable cells,
respectively. Transformation frequency was calculated as the percentage between transformant
CFUs and total number of viable CFUs, times 100. Statistical analysis was conducted using a
Student’s t-test with a P value of <0.05 considered as significant.
58
4.5 Results
4.5.1 Copper is toxic to S. mutans and copYAZ is required for copper
resistance in S. mutans
To investigate the physiological function of the copYAZ operon in S. mutans, an isogenic mutant,
designated ∆copYAZ, was constructed and characterized in vitro. Growth kinetics and minimum
inhibitory concentration (MIC) were assessed using the wild type and mutant strain under
varying concentrations of CuSO4 solutions. A two-fold decrease in the MIC was observed in the
∆copYAZ (2 mM CuSO4) as compared with the UA159 strain (4 mM CuSO4) under copper stress
(P <0.05). At higher concentrations (≥ 6 mM for ∆copYAZ and ≥ 12 mM for UA159), copper had
a bactericidal effect on S. mutans viability. Complementation studies conducted with the
Comp∆copYAZ (∆copYAZ harboring pIB-YAZ) strain showed restoration of copper-dependent
growth inhibition to levels observed with the UA159 wild-type strain (MIC of 4 mM CuSO4; P
<0.05). Growth assays conducted with the wild-type, ∆copYAZ and Comp∆copYAZ strains
revealed that exposure to added copper resulted in growth impairment of all strains and that loss
of the copYAZ resulted in enhanced toxicity to copper, relative to wild-type and complemented
strains (Figure 4-1and Figure 4-2). To validate that effects observed in growth assays were due to
copper cations the experiments were repeated with CuCl2 which showed a similar influence on S.
mutans growth as observed with CuSO4. In addition, we performed growth inhibitory assays for
wild-type and ∆copYAZ in the presence of varying concentrations of other metal ions that
included Ag, Cd and Hg; MICs for these assays did not reveal statistically relevant differences
(MICs 100 µM, 1.5 µM, 6 µM respectively for Ag, Cd and Hg). Hence, these results highlighted
the importance and specificity of the CopYAZ system in copper-induced toxicity in S. mutans.
59
0
0.2
0.4
0.6
0.8
1
1.2
0 100 200 300 400 500 600 700 800 900 1000 1100
Abso
rban
ce (6
00
nm
)
Time (minutes)
Figure 4-1 Growth analysis in the presence and absence of copper
Growth analysis of S. mutans strains cultivated in the presence or absence of 2 mM CuSO4.
Results are representative of six independent experiments conducted with duplicates for each
strain. ■ indicate S. mutans wild type strain, ▲ indicate ∆copYAZ, and ● indicate
comp∆copYAZ; solid-filled indicate strains grown in the absence of CuSO4, and hollow icons
indicate strains grown in the presence of 2 mM CuSO4.
Time (min)
60
0
0.2
0.4
0.6
0.8
1
1.2
0 200 400 600 800 1000
Ab
sorb
an
ce (
60
0 n
m)
Time (min)
UA159 0 mM
CuSO4
UA159 0.5 mM
CuSO4
UA159 1 mM
CuSO4
∆copYAZ 0 mM
CuSO4
∆copYAZ 0.5 mM
CuSO4
∆copYAZ 1 mM
CuSO4
Figure 4-2 Growth kinetics under copper stress
S. mutans UA159 and ∆copYAZ strains cultivated under varying concentrations of CuSO4.
Results are the representative of six independent experiments conducted with duplicates for each
strain.
61
4.5.2 CopYAZ has a role in copper export in S. mutans
In several Gram positive bacteria CopA functions in copper export. Copper transport studies,
using ICP-AES analysis, revealed that S. mutans UA159 grown in the presence of 1 mM CuSO4
had a significantly high amount of intracellular copper (Figure 4-3) as compared to those grown
without copper supplementation (no detectable amount of intracellular copper). A two-fold
increase in the amount of intracellular copper was observed in the ∆copYAZ compared with the
wild type strain (Figure 4-3; P<0.05), thus suggesting the involvement of copYAZ in copper
efflux in S. mutans. In the wild type and ∆copYAZ strains, transport studies conducted with Ag
and Mn cations (using 50 µM AgNO3 or 1 mM MnCl2) showed no statistically significant
differences in the intracellular levels of these cations. This latter result support the specificity of
the CopYAZ transport system to copper cations, which was further validated using the CopYAZ
complemented Comp∆copYAZ strain whose ability to efflux copper at levels comparable to the
wild type parent (Figure 4-3). In the complementation experiments, we employed an E. coli
strain deficient in copA (DW3110), which exhibits a defect in copper efflux and its detoxification
[212]. The recombinant S. mutans copYAZ operon successfully complemented the deficiency in
DW3110, as observed by a significantly decreased sensitivity to copper-induced killing, and
reduced intracellular copper ion accumulation (Figure 4-4A and Figure 4-4B); thus supporting a
specific function for the S. mutans CopYAZ in copper transport and resistance.
62
-1
0
1
2
3
4
5
6
7
8
9
0 1000
Intr
acel
lula
r C
op
per
Co
nc(
ug
/ml)
/ D
ry w
eig
ht
(mg
)
CuSO4 treated (µM)
UA159
∆copYAZ
Comp∆copYAZ
* *
Figure 4-3 Role of CopYAZ in copper export
Intracellular copper concentration normalized to dry weight of cells of S. mutans wild type
UA159 (■ bar), ∆copYAZ (■ bar), and comp∆copYAZ ( bar). Cells were grown in the presence
or absence of 1 mM CuSO4 until the mid-logarithmic growth phase. Cells were lysed and
intracellular copper concentration was normalized with cell dry weight. Results shown here are
the mean values obtained from three independent experiments ± standard error (*P <0.05).
63
0
10
20
30
40
50
0 1000
Intr
acel
lula
r C
op
per
C
onc(
ug
/ml)
/Dry
wei
ght
(mg
)
CuSO4 treated (µM)
W3110
DW3110
DW3110compYAZ
* *
Figure 4-4 Growth kinetics and transport studies using E. coli strains
A) E. coli strains cultivated in the presence or absence of 2 mM CuSO4. Results are
representative of six independent experiments conducted with duplicates for each strain. Legend:
squares indicate wild type, triangles indicate cop mutant, circles indicate complemented strain of
E. coli strains, solid-filled indicate strains grown in the absence of CuSO4, and hollow icons
indicate strains grown in the presence of 2 mM CuSO4. B) Intracellular copper concentration
normalized to dry weight of cells of E. coli wild type W3110 (black bar), DW3110 (grey bar),
and DW3110compYAZ (white bar) was quantified using ICP-AES. No copper was detected in
cells with no copper treatment. Results shown here are the mean values obtained from three
independent experiments ± standard error (*P <0.05).
Absorbance (
600
nm)
Time (minutes)
64
4.5.3 Copper inhibits biofilm formation and copYAZ is required to
tolerate copper stress under biofilm growth.
Both the wild type and ∆copYAZ strains produced comparable biomass in 18-h biofilms grown
in the absence of copper. A significant reduction of biofilm biomass was observed in ∆copYAZ
biofilms cultivated with 500 µM CuSO4 relative to the wild type (Figure 4-5A). Biofilm biomass
was drastically reduced at 1 mM CuSO4 in both wild type and mutant strains (Figure 4-5A).
0
20
40
60
80
100
120
0 500 1000
Bio
film
Bio
mas
s (%
)
CuSO4 (µM)
UA159
ΔcopYAZ
A*
*
**
1
10
100
0 500 1000
Cel
l Ad
her
ence
Per
centa
ge
(%)
CuSO4 (µM)
UA159
∆copYAZ
B
**
*
*
*
*
Figure 4-5 Effect of copper on biofilm formation
A) Biomass of 18-h biofilms derived from wild type UA159 (■ bars) and ∆copYAZ (■ bars)
strains grown in the absence or presence of CuSO4. Results shown represent the mean values
obtained from three independent experiments with three replicates for each strain ± standard
error (*P <0.05). B) Percentage of the cells adhered to the surface after 1 h incubation using
UA159 (■ bars) and ∆copYAZ (■ bars) in the presence of varying concentrations of CuSO4
relative to no copper. Results shown represent the mean values obtained from three independent
experiments with three replicates for each strain ± standard error (*P <0.05).
65
Initial cell attachment assays were conducted to evaluate the percentage of cells attached to a
surface in the presence or absence of copper for different time intervals. At 1 h incubation, the
percentage of cells adhered in the presence of 500 µM CuSO4 was significantly reduced in both
wild type (~50 % decrease) and ∆copYAZ strains (~80 % decrease) relative to the no copper
control (Figure 4-5B). At 1 mM CuSO4, further reduction in the percentage of cells adhered was
observed in both wild type and mutant strains. After prolonged incubation of 2 h or 4 h, no
significant decrease in the number of cells adhering to surface was observed in wild type strain at
500 µM CuSO4. However, the ∆copYAZ cultivated in the presence of copper showed a
significant reduction in the number of cells attached relative to the no copper control at all time
periods (Figure 4-6). Results from these experiments showed that the addition of copper and
deletion of the copYAZ operon reduced the ability of cells to adhere likely leading to defective
biofilms.
66
0.1
1
10
100
0 500 1000
Cel
l Ad
her
ence
Per
centa
ge
at 4
h (
%)
CuSO4 (µM)
UA159
∆copYAZ
B
*
*
1
10
100
0 500 1000
Cel
l Ad
her
ence
Per
cen
tage
at 2
h (
%)
CuSO4 (µM)
UA159
∆copYAZ
A
*
*
Figure 4-6 Cell adherence assays
Percentage of the cells (log scale) adhered to the polystyrene surface after A) 2h and B) 4h
incubation using UA159 (black bars) and ∆copYAZ (grey bars) in the presence of varying
concentrations of CuSO4 relative to no copper. Results shown represent the mean values obtained
from three independent experiments with three replicates for each strain ± standard error (*P
<0.05).
67
4.5.4 Copper affects the transcription of gtfs and glucan binding
protein (gbp) genes.
To assess the underlying molecular mechanism associated with copper-mediated reduced cell
adherence and reduced biofilm biomass of S. mutans, we examined the effects of copper on the
transcription of gtfs (gtfB, gtfC, gtfD) and gbps (gbpB and gbpC) whose products are needed to
maintain the structural and functional integrity of the S. mutans biofilm [63, 116-117, 119, 124,
127]. Gene expression analysis using qRTPCR of biofilm-derived cDNAs with or without of 500
µM CuSO4 demonstrated a significant ≥ 2-fold down-regulation of all five genes (P < 0.05) in
the presence of copper relative to the no copper control (Figure 4-7). In the absence of copper,
the transcription of gtf and gbp genes was not significantly affected between ΔcopYAZ and wild
type biofilms (data not shown). Furthermore, in the presence of copper an enhanced
transcriptional repression of gtfC, gtfD, gbpB and gbpC was observed in ΔcopYAZ biofilms
relative to those of the wild-type strain. In S. mutans, the negative regulatory role of copper on
the transcription of the gbp genes- whose products facilitate biofilm cell adherence, as well as the
gtfs- whose products are responsible for glucan production that maintain the integrity of the
biofilm matrix, might explain the impaired biofilms observed under copper stress.
68
-5.00
-4.00
-3.00
-2.00
-1.00
0.00
gtfC gbpB gtfB gtfD gbpB
No
rmal
ized
Fo
ld E
xpre
ssio
n
rela
tiv
e to
no
cop
per
co
ntr
ol
UA159
∆copYAZ
Figure 4-7 Gene expression analysis of different biofilm matrix-related genes
S. mutans UA159 (■ bars) and ∆copYAZ (■ bars) treated with 500 µM CuSO4 relative to no
copper control. Results shown represent the mean values obtained from four independent
experiments with three replicates for each strain ± standard error (*P <0.05 for all the genes
shown in the graph).
4.5.5 Copper-induces oxidative stress and CopYAZ modulates oxidative
stress tolerance.
The copper-induced growth inhibition was assessed in the presence of the antioxidants,
glutathione and thiourea. Addition of 1.5 mM glutathione dramatically improved the growth of S.
mutans UA159, ΔcopYAZ, and compΔcopYAZ strains cultivated in the presence of 2 mM CuSO4
compared to no added glutathione control (Figure 4-9A). Treatment with glutathione in the
absence of copper did not alter the growth of S. mutans strains used in this study (Figure 4-8).
The reversion of copper-induced growth defects was also observed in the presence of the
antioxidant thiourea. These results emphasize that copper-induced toxicity in S. mutans is likely
dependent on copper-dependent generation of oxidative stress in S. mutans. Biofilms were also
assessed to study the effect of glutathione (or thiourea) in reversal of the copper-induced biofilm
defect by cultivating 18 h biofilms in the presence or absence of copper supplemented with or
69
without 1.5 mM glutathione. Glutathione alone did not have any effect on the biofilm biomass of
all three strains tested. Addition of 1.5 mM glutathione did not improve the biomass production
of the biofilms cultivated in the presence of 500 µM or 1 mM copper in S. mutans UA159,
ΔcopYAZ, and compΔcopYAZ strains. These results suggest that S. mutans can utilize an alternate
route to contend with copper stress during biofilm growth.
0
0.2
0.4
0.6
0.8
1
1.2
Ab
sorb
an
ce (
60
0 n
m)
Time (min)
UA159 THYE
UA159 with Glutathione
∆copYAZ THYE
∆copYAZ with Glutathione
Comp∆copYAZ THYE
Comp∆copYAZ with Glutathione
Figure 4-8 Growth Kinetics in the presence and absence of glutathione
S. mutans UA159, ∆copYAZ and comp∆copYAZ grown in the presence of the 1.5mM
glutathione. Results are the representative of six independent experiments conducted with
duplicates for each strain.
70
A
B
0.0
0.2
0.4
0.6
0.8
1.0
1.2
0 100 200 300 400 500 600 700 800
Abso
rban
ce (600nm
)
Time (mins)
0
200
400
600
800
1000
1200
Control Paraquat
Lag
tim
e (m
in)
UA159
∆copYAZ
Comp∆copYAZ
H2O2
* *
*
*
* *
Figure 4-9 Copper-induced oxidative stress, and involvement of CopYAZ in protection
against oxidative stress
A) Growth curves of wild type UA159 (■), ∆copYAZ (■), and comp∆copYAZ ( ) strains in the
presence of 2mM CuSO4 copper with (� ) or without (ο) 1.5mM glutathione. Results are
representative of six independent experiments conducted using duplicate samples for each strain.
B) Lag times of UA159 (■ bars), ∆copYAZ (■ bars), and comp∆copYAZ ( bars) to reach an
OD600 of nearly 0.1 in the presence and absence of the oxidative stressors paraquat (25 mM)
paraquat and H2O2 (0.0045%). The top two lines indicate the statistical significant results within
the strains under different stressors. Results are the mean of three independent experiments
conducted with three replicates for each strain (* P <0.001).
71
We next investigated the role of copYAZ in protecting the cells against oxidative stress. Growth
kinetics analyses were performed using wild type UA159, ΔcopYAZ and compΔcopYAZ strains
in the presence of the oxidizers methyl viologen dichloride (paraquat) or hydrogen peroxide.
Though all strains cultivated in the presence of either paraquat or hydrogen peroxide reached a
comparable final optical density after 24 h (Figure 4-10A and Figure 4-10B), the lag growth
phase of ΔcopYAZ was drastically prolonged relative to wild type (Figure 4-9B), thereby
suggesting a role of the efflux system in protecting cells under oxidative stress. In the
complementary CompΔcopYAZ strain, the lag phase in the presence of oxidative stressors was
restored to that of wild type levels.
72
0.0625
0.125
0.25
0.5
1
0 200 400 600 800 1000
Ab
sorb
an
ce (6
00
nm
)
Time (min)
UA159
∆copYAZ
Comp∆copYAZ
B
0.05
0.1
0.2
0.4
0.8
0 200 400 600 800 1000
Ab
sorb
an
ce (6
00
nm
)
Time (min)
UA159
∆copYAZ
Comp∆copYAZ
A
Figure 4-10 Growth kinetics under oxidative stressors
S. mutans UA159, ∆copYAZ and comp∆copYAZ grown in the presence of the oxidative stressors
A) paraquat (25 mM) and B) H2O2 (0.0045%). Results are the representative of six independent
experiments conducted with duplicates for each strain.
73
4.5.6 Copper inhibits growth under acid stress and CopYAZ modulates
the acid tolerance response of S. mutans
Previous reports indicate that cuprous ions added to S. mutans strain GS-5 cultures can
irreversibly inhibit the activity of F-ATPases, thereby compromising its ability to carry out
glycolysis in acidic environments [281]. Here, growth kinetic analyses were performed in the
presence and absence of copper in neutral and acidic pH using wild type UA159, ∆copYAZ, and
Comp∆copYAZ strains. Although the ∆copYAZ strain displayed similar doubling times relative to
wild type under acid (pH 5.5) or copper (1 mM CuSO4) stress, the doubling times and the yield
of the ∆copYAZ was markedly impaired in THYE at pH 5.5 supplemented with 1 mM CuSO4
(Figure 4-11 and Figure 4-12). The combined effect of acid and copper stress caused an
approximate two- and five-fold increase in the doubling times of S. mutans UA159 and ∆copYAZ
respectively, compared to their growth in the presence of either of these stressors alone (Figure
4-12).
74
0.06
0.12
0.24
0.48
0.96
0 200 400 600 800 1000 1200
Ab
sorb
an
ce (6
00
nm
)
Time (min)
Comp∆copYAZ pH 5.5 Comp∆copYAZ pH 5.5 + 1mM CuSO4
UA159 pH 5.5 UA159 pH 5.5 + 1mM CuSO4
∆copYAZ pH 5.5 ∆copYAZ pH 5.5 + 1mM CuSO4
Figure 4-11 Growth of S. mutans under acid stress with or without copper
Growth curves of S. mutans UA159, ∆copYAZ, and comp∆copYAZ strains in the presence of acid
(pH 5.5) and/or copper (1 mM CuSO4) stress.Results are representative of six independent
experiments with duplicate samples for each strain.
75
0
100
200
300
400
500
pH 7.5 pH 5.5 pH 7.5 + 1 mM
CuSO4
pH 5.5 +1 mM
CuSO4
Do
ub
lin
g T
ime
(min
s)
UA159
∆copYAZ
Comp∆copYAZ
*
CuSO4 CuSO4
*
*
Figure 4-12 Doubling times under acid stress with or without copper
Evaluation of S. mutans doubling time in the presence of various stressors using wild type
UA159 (black bars), ∆copYAZ (grey bars), and comp∆copYAZ (light grey bars). Results are the
mean of three independent experiments with duplicate samples of each strain ± standard error
(*P <0.05).
76
These results emphasize the synergistic effects of copper and acid against S. mutans growth. The
increased susceptibility of the ∆copYAZ strain under acid and copper stress can be due to 1)
surplus accumulation of copper ions, or 2) lack of cellular protection offered by the CopYAZ
copper efflux system. To examine the importance of copYAZ in the acid adaptation process, we
conducted acid tolerance response (ATR) assays. Not surprisingly, for all the three tested strains
the percentage survival of adapted cells (which were previously subjected to pH 5.5) was higher
than that for non-adapted cells (which were maintained at pH 7.5). The loss of copYAZ decreased
the ability of S. mutans to survive the pH 3.5 challenge regardless of pre-acid adaptation, relative
to wild type (Figure 4-13). No significant difference in the percentage survival at pH 3.5 was
observed between the Comp∆copYAZ and wild type strains under either non-adapted or pre-
adapted conditions, thereby demonstrating that copYAZ contributed to ATR response in
S. mutans.
0.001
0.01
0.1
1
10
100
UA159 ∆copYAZ Comp∆copYAZ
Per
cen
tag
e S
urv
ival
(%
)
Non Adapted
Adapted*
*
*
*
Figure 4-13 Acid tolerance response assays
Percentage survival (in log scale) of S. mutans cells after 2 h incubation at lethal pH 3.5. Cell
were either exposed (adapted cells- ■ bars) or not (non-adapted cells- ■ bars) for pre-adaptation
at signal pH of 5.5. Results shown are the mean values obtained from three independent
experiments ± standard error (*P <0.05).
77
Previously, copper has been shown to reduce the activity of F-ATPase in S. mutans [281]. Hence
we examined the role of copper on the transcription of acid stress-related genes that include
components of the S. mutans F0F1 ATPase (SMU.1530 (atpD), SMU.1531 (atpE), SMU.1532
(atpF), SMU. 1534 (atpH)), and uvrA, a DNA damage repair gene, which is induced under acid
stress [311]. Expression of genes was not significantly affected between the wild type strain
cultivated in the presence and absence of copper. However, in ΔcopYAZ, the transcription of
uvrA was significantly down-regulated by more than 2-fold (P <0.05) and 3.6-fold (P <0.05)
incubated with and without copper respectively, relative to the wild type strain. A significant 2.2-
fold reduction (P <0.05) in the expression of atpH was observed in ΔcopYAZ in the presence of
copper relative to control without copper. Studies are currently underway to analyze the impact
of copper and copYAZ operon on the acid-inducible regulon of S. mutans that is responsible
for the observed acid-sensitive phenotype in this oral pathogen.
4.5.7 Copper induces membrane depolarization and CopYAZ helps
maintain membrane potential.
In E. coli and Salmonella sp., contact-killing on copper surfaces involves immediate membrane
depolarization, subsequently leading to compromised cell viability [283]. To test whether copper
and CopYAZ modulate S. mutans membrane potential, we conducted fluorometric assays with
bis-oxonols dyes, which can enter depolarized cells and bind intracellular proteins or
membranes. Higher fluorescence intensity, as a result of elevated influx of the dye, indicates
increased membrane depolarization. In S. mutans, addition of copper initiated a gradual increase
in the fluorescence intensity, which was maximal after 15 min of incubation relative to the no
copper control (Figure 4-14A). The increase in fluorescence intensity suggested that copper
influx induced a dissipation of the membrane potential. The S. mutans ∆copYAZ cells exhibited a
depolarized membrane phenotype, where the cells cultivated even in the absence of copper,
showed a gradual and sustained increase in the DiSBAC3-dependent fluorescence intensity,
compared with wild type (Figure 4-14B). Furthermore, restoration of the fluorescence intensity
in the complemented Comp∆copYAZ strain to the wild type levels provided additional evidence
for the involvement of this operon in S. mutans membrane depolarization. In membrane potential
78
assays, CCCP was used as a positive control; the addition of 10 µM CCCP resulted in an
immediate increase in fluorescence intensity, as a result of instant membrane depolarization (∆ѱ
units exceeding over 2-fold compared to no CCCP control).
79
-400
-300
-200
-100
0
100
200
300
400
500
0 15 30 45
∆ѱ
(A
rbit
rary
Uni
ts F
luor
esce
nce)
Time (mins)
UA159
∆copYAZ
Comp∆copYAZ
-800
-400
0
400
800
1200
1600
UA159 ∆copYAZ Comp∆copYAZ
∆ѱ
(A
rbit
rary
Uni
ts F
luor
esce
nce)
No
1 mM CuSO4
CuSO4
A
B
* *
*
*
*
*
*
Figure 4-14 Membrane potential in cells exposed to copper
Changes in membrane potential of S. mutans strain measured using a bis-oxonol probe over
45 min. A) Fluorescence intensity of cells with 15 min incubation in the absence (■ bars) or
presence (■ bars) of 1 mM CuSO4. Statistical significance was calculated using a Student's t-test
at each time point (* P < 0.05). B) Fluorescence intensity of wild type UA159 (), ∆copYAZ
(), and comp∆copYAZ () in the absence of copper over a period of 45 min. Data shown are
the mean of four independent experiments ± standard error. Statistical significance was observed
at each time point between the ∆copYAZ and other two strains (P < 0.05).
80
4.5.8 Addition of copper and loss of copYAZ alters transformability of
S. mutans
Genetic transformation assays were conducted to investigate the effect of copper on genetic
competence development of S. mutans. These assays were conducted in two different growth
media, namely THYE and CDM, which activate separate competence induction pathways via the
CSP-activated ComDE and XIP-activated ComRS signaling pathways, respectively ([132, 148].
When supplemented with 10µM, 100 µM, 250 µM, 500 µM or 1 mM CuSO4, UA159 and
∆copYAZ strains grown in THYE, which is a peptone-abundant nutrient rich medium, a five-fold
decrease in transformation frequency was observed in the wild type strain only at the 1 mM
CuSO4 relative to controls without copper (P <0.05; data not shown). In the ∆copYAZ mutant
transformability was significantly reduced by over 10-fold relative to wild type, irrespective of
copper supplementation (data not shown). The effects of copper on transformability were
stronger when cells were grown in CDM medium. For instance, in CDM medium a 20-fold
reduction in transformation frequency was observed in both the wild type and ∆copYAZ strains in
the presence of 100 µM CuSO4 relative to the no copper control (P <0.05; Figure 4-15).
Furthermore, in the presence of copper, we noted that transformability of wild type and mutant
strains were significantly reduced in a dose-dependent manner (Figure 4-15); our comparison of
viable recipient cells between these strains, showed that total cell viability was not affected under
these copper concentrations for UA159 and ∆copYAZ strains (Figure 4-16). Also interestingly,
loss of the copper efflux system in the ∆copYAZ strain impaired its transformability by over 30-
fold relative to wild type (P<0.05), even in the absence of the copper stress (Figure 4-15). To
argue against the possibility of this transformation defect arising due to copper-mediated plasmid
DNA damage, we conducted transformation assays by utilizing cells pre-incubated with copper.
These cells were washed to remove exogenous or cell-associated copper and then supplemented
with fresh medium containing plasmid DNA. A similar decrease in genetic transformation was
observed in the presence of copper relative to the no copper control, thereby confirming that the
defect in genetic transformation was indeed due to copper present within the cells (data not
shown).
81
1.00E-06
1.00E-04
1.00E-02
1.00E+00
0 100 250
Tra
nsf
orm
atio
n f
req
uen
cy (
%)
CuSO4 (µM)
UA159
ΔcopYAZ
*
*
*
*
*
*
*
Figure 4-15 Transformation frequency assays
Transformation frequency assays were conducted using S. mutans UA159 (■ bar) and ∆copYAZ
(■ bar) strains in the presence of varying concentrations of copper. The transformation frequency
was calculated as the percentage between transformants and recipients cells (log scale). Results
are mean of three independent experiments conducted in triplicates. (* P <0.05)
82
1.0E+04
1.0E+06
1.0E+08
0 100 250
CF
Us
of
via
ble
cel
ls
CuSO4 (µM)
UA159
ΔcopYAZ
Figure 4-16 Colony forming units of viable cells at different copper concentrations
S. mutans colony forming unit of the total viable cells (during the transformation frequency
assays) in the presence of varying copper concentrations using wild type UA159 (black line),
∆copYAZ (grey line). Results are the mean of three independent experiments with duplicate
samples of each strain ± standard error (*P <0.05).
83
4.5.9 Copper represses the expression of genes associated with genetic
competence.
To determine the pathways by which copper and CopYAZ modulate transformability of S.
mutans, we compared the expression of comC, comD, comE, comR, comS, and comX
competence-related genes between the isogenic strains treated with or without copper. In S.
mutans UA159, compared with the no copper control, supplementation with 100 μM CuSO4
reduced the expression of comX and comS by 2-fold and 2.8-fold, respectively (P<0.001).
Regardless of the presence of copper, expression of the comX, which is critical for competence
development, was reduced by 2.5-fold in the ∆copYAZ, compared with the wild type strain
(P<0.001). Moreover, relative to the wild type, the expression of comS was repressed over 8-fold
and 12.5- fold in the copper transporter mutant in the absence and presence of copper,
respectively (P<0.001).
84
4.6 Discussion
Fluctuations in intracellular levels of copper can have severe implications on the physiology of
all prokaryotes. The mechanisms involved in copper-induced killing vary amongst bacterial
species. Bacteria usually initiate a global adaptive genetic response to copper, depending on their
physiological copper requirements and presence of copper in their environmental niches [312-
317]. While in some bacteria, such as Enterococcus faecalis and Pseudomonas aeruginosa, a
large portion of the genome (approximately 300 genes) is differentially expressed under copper
stress; in other bacteria such as Lactococcus lactis, only 11 genes were copper-responsive [314,
316-317]. While we did not analyze changes in entire copper-regulon of S. mutans, targeted gene
expression analysis in this work revealed that copper-responsive genes included the gtfBCD and
gbpBC associated with biofilm formation, the comS and comX genes critical for competence
development, and the uvrA and atpH genes involved in acid-stress tolerance. An important
aspect of this work was also to validate the role of the S. mutans CopYAZ in copper efflux,
which influenced its ability to tolerate environmental stressors and maintain its membrane
potential. The link between copper homeostasis via the CopYAZ and its effects on comS and
comX transcription for competence development is novel. Since the competence pathway is
closely linked with the biofilm and stress tolerance pathways of S. mutans [144-145, 147, 299],
this work adds to the current knowledge as to how these pathways can be modulated by
environmental copper stress.
The growth kinetic assays and MICs in this work indicated that higher concentrations of copper
are toxic to S. mutans and its toxicity is counteracted through CopYAZ activity. In most bacteria,
CopA has been speculated or proven to remove copper cations from the cell [170, 212, 293],
which we validated using copper transport assays. Since we observed that both the wild type and
∆copYAZ cells were able to accumulate copper cations, we suspect that in S. mutans copper
import/influx occurs passively, in a non-specific manner, as demonstrated in other bacteria such
as Helicobacter pylori and E. coli [219, 318-319].
In the oral cavity, since S. mutans is constantly exposed to fluctuating oxidative stress, its ability
to adapt to such conditions is important for its survival. Here, we demonstrated that the addition
of the glutathione dramatically reversed the copper-induced growth defect in S. mutans cultures,
85
thus suggesting that toxicity to copper is likely a result of copper-dependent generation of
oxidative stress in S. mutans. Copper can generate oxidative stress either by depleting
glutathione (due to its capability of forming a complex with glutathione) [320] or by generating
reactive oxygen species (ROS), especially superoxide radicals which are toxic to the cells [170,
208]. Copper, due to its high reactivity, is capable of replacing Fe or Mn from the active site of
proteins, thereby rendering them inactive [184]. In S. mutans, perR (peroxide regulator), sod
(superoxide dismutase) and dpr (dps-like peroxidase resistance protein) gene products are
associated with resistance to oxidative stress [163, 321-323]. The dpr-encoded protein requires
Fe, sod -encoded protein requires Mn/Fe and PerR has been speculated to require Mn or Fe for
their activity [163, 321, 323-324]. Hence, copper can be speculated to replace Fe/Mn from the
active sites of dpr, sod, and/or perR encoded products, thereby inactivating these proteins and
compromising the cell viability under oxidative stress. However, further research is warranted to
dissect the specific underlying mechanisms involved in this process. Our results also
demonstrated the importance of S. mutans copYAZ operon in resistance against oxidative stress,
thereby suggesting its involvement in stress adaptation process of this oral pathogen.
Copper and acidic pH exerted a synergistic effect against growth of S. mutans. Growth in THYE
at pH 5.5 or in THYE with 1 mM CuSO4 did not produce a discernible phenotype between the
∆copYAZ and UA159 strains. However, a significant increase in the doubling times were noted
when these strains when cultivated in THYE at pH 5.5 with 1 mM CuSO4, thus suggesting a
synergistic effect of acid and copper stress against S. mutans growth. Since cuprous ions in
S. mutans have been previously associated with impaired glycolysis under acid stress [281], our
study supports this finding by demonstrating a notable growth defect in the presence of copper
and acid stress. The impaired growth observed for the ∆copYAZ strain in the presence of copper
and acid stress can be due to accumulation of surplus copper in the cells or due to the
involvement of the copYAZ operon in protection under acid stress. S. mutans produces lactic acid
as a metabolic end-product of dietary sugars and mounts an ATR that affords it growth and
survival under pH values as low as 3.5 [105, 109]. During the ATR, S. mutans undergoes a
number of physiological changes such as increased synthesis of stress responsive proteins,
membrane fatty acid changes, and increased activity of proton translocating ATPases [105, 109].
Such adaptation requires a pre-exposure to a sub-lethal signal of pH 5.5 to activate the processes
86
to protect cells against killing pH values (pH 2.0-3.0) [105, 109]. A severe decrease in the
viability of both the adapted and non-adapted ∆copYAZ compared with the wild type at pH 3.5,
implicated the contribution of copYAZ to the ATR of S. mutans. In the presence of copper, the
transcriptional repression of the acid stress related genes, uvrA and atpH, likely contributed to
the observed acid sensitive phenotype of S. mutans. Repression in the expression of uvrA in
∆copYAZ also supported the association of the copYAZ operon in acid stress response. Although,
we did not analysed the impact of copper on influencing the acid-inducible regulon of S. mutans;
results from this study offer the foundation towards understanding the copper-mediated acid-
tolerance response in this oral pathogen. Further studies are currently underway to elucidate the
effect of copper on modulating S. mutans proteome; hence, aiming to determine the proteins
involved in acid adaptation process under copper stress.
Under normal growth conditions, bacteria maintain their membrane potential by establishing
multiple ion gradients across their intact cytoplasmic membrane. The maintenance of intact cell
membranes is crucial to maintain ATP hydrolysis and proton motive force [325-326]. A
disturbance in the amount of ions can result in hyper-polarization (higher negative intracellular
electrical potential) or depolarization (higher positive intracellular electrical potential) of the
membrane potential. A rational target for copper-induced toxicity in bacteria is their cell wall or
cell membrane, as these are the exposed parts of bacteria to external stress. Reports have
indicated that in Gram positive bacteria, the metal binding sites usually lie within the
peptidoglycan layer [327-328]. Copper also tends to accumulate on the inner side of the cell
membrane, making the inner side more positive and thus causing membrane depolarization [283,
329]. Here, we demonstrated the effect of copper on initiating an immediate membrane potential
dissipation, which was significantly higher in the ∆copYAZ strain relative to the wild type strain.
The S. mutans ∆copYAZ cells exhibited a depolarized membrane phenotype, even in the absence
of copper, compared with wild type cells. The gradual increase in membrane depolarization
observed in ∆copYAZ can be due to membrane perturbation caused by the loss of the CopA
trans-membrane protein. Our findings are in agreement with another study, where the loss of E.
coli arsenic and antimony efflux system was shown to be linked with cell membrane
depolarization [330]. Disturbances in the bacterial membrane potential can alter certain cellular
processes such as cell division and differentiation, integrity of cellular membranes, electron
87
transport across the membranes, localization of specific proteins and protein complexes, and
levels of cellular energy [325, 331-333]. In S. mutans, copper acting as a membrane potential
dissipater might contribute to the generation of copper-dependent oxidative and acid stress,
where both these stresses are likely to be affected by variations in the bacterial membrane
integrity and/or changes in the electron transport across the bacterial membrane [326, 334-336]
Copper has an inhibitory effect on biofilm formation in S. mutans. This mechanism relies on the
ability of copper to inhibit early attachment of cells to the surface and to significantly reduce
biomass production in S. mutans. The reduction in cell adherence and biomass production was
more prominent in the ∆copYAZ strain, likely due to surplus accumulation of copper within the
cells. In the presence of sucrose, cell-wall associated Gtfs mediate the synthesis of D-glucose
polysaccharides, which are glucans that promote S. mutans adherence to tooth surface and other
adhered bacteria [63, 116]. S. mutans produces three different Gtfs that include: GtfB, which
produces water-insoluble glucans composed predominantly of α-1,3-linkages; GtfD that mostly
produces soluble α-1,6-linked glucans; and GtfC that synthesizes both α-1,3 and α-1,6 glucans
[111-113]. In our work expression of gtfB, gtfC, and gtfD were significantly repressed by copper.
The transcriptional repression of these gtf genes validated the effects of copper in influencing
genes critical for glucan production and biofilm matrix formation; their downregualtion under
copper explains poor biofilm biomass observed. In addition to Gtfs, surface associated Gbps in S.
mutans promote cell-cell aggregation by mediating the binding of S. mutans to glucans [119,
125, 337]. Addition of copper significantly reduced the transcription of gbpB and gbpC further
expanding on components affected by environmental copper. The down-regulation of these gbps
distinctly emphasized the effect of copper in initial sucrose-dependent biofilm formation, where
expression of these genes is essential for the transition from planktonic to biofilm growth [37,
125]. In contrast to our gtf transcription results, previously others showed that supplementation
with 1 mM copper induced the transcription and translation of gtfD but not gtfBC [280]. In their
study, RNAs isolated from planktonic cells were used for expression analysis [31], whereas this
study utilized RNAs from 18-h biofilms cultivated with or without added copper. In the absence
of copper, we did not note a significant change in the transcriptional levels of gtfBCD, and
gbpBC between the ∆copYAZ and wild type strains; hence, it is not surprising that we obtained
comparable amounts of biofilm biomass between these strains. In addition to the repressive
88
effects of copper on gtfBCD and gbpBC transcription, loss of copper efflux in the ∆copYAZ
mutant lead to reduced gtfs and gbps expression in cop mutant biofilms with added copper in the
medium. These results provide strong evidence that copper is extremely effective in inhibiting
biofilm formation, one of the most vital virulence attributes of this oral pathogen.
The influence of copper and the CopYAZ system on genetic competence development and comX
and comS expression in S. mutans is novel. The ComDE and ComRS signaling pathways
involved in S. mutans competence development differ in their mechanism of action [132, 143,
146, 298]. The CSP-ComDE pathway is activated by CSP whose precursor peptide is encoded by
comC gene [143, 147, 149]. Upon activation of the ComD and subsequent phosho-transfer to
ComE leads to activation ComX that is a critical switch required for the competent state of S.
mutans [143, 145]. Recently, the proximal regulator of ComX was described as the ComR, an
Rgg-like transcriptional regulator in the cytosol, which in conjunction with internalized XIP is
able to activate ComX for the transcription of late competence genes required for DNA uptake
and recombination [132]. It has been shown that nutrients and peptones present in the growth
medium of S. mutans can differentially affect CSP and XIP activity needed for competence
activation [132, 146, 148, 150, 298]. CDM medium was shown to be optimal only for XIP-
mediated competence induction, whereas the peptone-rich THYE medium was optimal for
transformation in the presence of CSP [132, 146, 148, 298]. In our assays, since the effect of
copper on S. mtuans transformability is dramatically pronounced in CDM relative to that under
THYE, we speculate that its influence on genetic competence primarily occurs via the XIP-
induced signaling pathway. Moreover, the observation that of all competence-related genes
tested (e.g., comCDE, comRS, and comX), only comS and comX expression was significantly
affected under our test conditions provides additional evidence that the effects of copper on
transformation is modulated by the XIP-ComRS pathway. The effect of copper on the expression
of comS but not comR suggests that copper represses the activity of ComX by affecting the
function or secretion of ComS and/or XIP, thus causing a dramatic reduction in transformation
frequency. In the absence of copper, a significant reduction in transformation frequency of the
∆copYAZ relative to wild type implies the importance of this operon in genetic competence
development in S. mutans. Previously, in Streptococcus pneumoniae, inactivation of a putative
metal transporting operon (AdcCBA) was shown to have a competence-deficient phenotype
89
[338-339]. The operon was speculated to be involved in zinc transport and the addition of zinc
improved the transformability of the adc null mutants [338-339]. In our study, although the
mechanism involved in modulation of competence by the copYAZ is not fully understood, two
suggestions can be proposed based on the observed transcriptional repression of comS: 1) the
CopYAZ may have a role in modulating the function, processing, or export of XIP, and/or 2) the
membrane perturbation resulted due to loss of the CopA may hinder the process of DNA
acquisition resulting in defective transformation frequency.
Conclusively, results from the present study enhance our understanding about the effects
of copper on S. mutans survival under planktonic and biofilm growth conditions. We also
demonstrated the role of the copYAZ system in maintaining S. mutans physiology under stress
conditions. Insights into the mechanism of copper toxicity and its connection with biofilm
formation and genetic transformation is instrumental in understanding and devising new
strategies to utilize copper as an effective anti-biofilm agent to combat S. mutans infections.
Since, S. mutans can be considered as an ideal model organism to study the genetics and
physiology in pathogenic Gram positive bacteria [340], our study holds relevance in suggesting
the importance of copper acquisition and homeostasis in closely-related pathogens.
4.7 Acknowledgements
We acknowledge the technical assistance provided by Ms. Kirsten Krastel in performing the
MIC assays and DNA cloning for this study. This research was supported by NIH
RO1DE013230-03 and CIHR-MT15431 to DGC. CML is a recipient of a Canada Research
Chair. KS is a recipient of Cell Signaling Fellowship CIHR-STP-53877.
90
5 Summary and Conclusions
This dissertation characterizes the importance of copYAZ-mediated copper homeostasis in
modulation of stress tolerance and biofilm formation, two important virulence factors of S.
mutans. Our results show that copper-induces toxicity in S. mutans UA159 by generating
oxidative stress and dissipating its membrane potential. Furthermore, we established that copper
exposure impaired various important physiological attributes of S. mutans such as: 1) acid
tolerance, 2) genetic transformation and 3) surface adherence to initiate biofilm formation. Using
gene expression analysis we have shown that copper had a repressing effect on the transcription
of S. mutans genes involved in biofilm matrix formation, genetic competence and acid tolerance.
We have also demonstrated the importance of copYAZ in copper homeostasis by facilitating
copper expulsion from S. mutans, which otherwise can exert a detrimental effect on the survival
and stress tolerance (towards copper, acid and oxidative stress) of this bacterium. In S. mutans,
the loss of copYAZ resulted in cells having a dissipated membrane potential compared to wild
type in spite of controlled ionic environment. In conclusion, the inhibitory effects of copper, and
importance of copYAZ in affecting several virulence features in S. mutans, provides strong
evidence in associating copper homeostasis with the bacterium’s ability to adapt and survive
under fluctuating environments.
5.1 Effects of copper on bacterial physiology
The medicinal use of copper dates back to the 19th century, where a variety of copper
preparations -including metallic surfaces and coatings- were utilized to treat bacterial and viral
infections [341]. However, the application of copper was reduced with the advent of new and
efficient antibiotics in antimicrobial therapeutics. In the last few decades, the acquisition of
antibiotic resistance genes by the pathogenic bacteria via the process of natural selection has
challenged their eradication, thereby, posing a huge threat against clearance of bacterial
infections. The use of metals as antimicrobials have gained special interest in recent years due to
their ability to disrupt antibiotic-resistant biofilms, to exert synergistic bactericidal activity with
other biocides, and to inhibit metabolic pathways in a selective manner [162, 342]. The
91
conventional antimicrobial activity of metal ions allows them to participate in targeting specific
or discrete metabolic reactions, depending upon the physical and chemical properties of both the
metal atoms and the accessible donor ligands within the intracellular biomolecules [342].
One such transition metal ion, copper, induces killing of the antibiotic resistant bacterial
populations, either via direct contact killing or by copper in solutions. The direct contact with
copper surface exhibits a 7-8 log higher rate of killing than when exposed to copper in solutions
[343-345]. There are various proposed models to understand the mechanisms by which copper
renders toxicity in different bacterial species. Bacteria usually initiate a global adaptive genetic
response to copper insult, which involves induction of stress regulons [314, 316-317]. However,
the range of copper induced toxic effects can be determined from the stretch of regulatory
response it generates in particular species. The difference in the copper-responsive regulons
between bacterial species depends on their physiological copper requirements and the presence
of copper in their respective niches [172, 346-347]. In this study, we made a significant progress
in establishing the effect of copper in modulating the transcription of the vital genes involved in
stress tolerance, genetic competence development, and biofilm formation in S. mutans.
We demonstrated a novel inhibitory effect of copper on S. mutans biofilm formation. Addition of
copper reduced the ability of S. mutans to adhere to a surface, thus leading to poor biomass
production. Moreover, with copper supplementation, there was an over 2-fold repression in the
transcription of genes encoding GTFs and GBPs. We know that GTFs and GPBs are required for
sucrose-dependent bacterial adherence to the tooth surface and to pre-adhered bacteria, which
provides a link for the copper-mediated biofilm impairment in S. mutans [63, 117, 119, 127].
Herein, we demonstrated that copper induced an oxidative stress in S. mutans and instigated the
depolarization of membrane potential. The disturbance in the ion gradient across the cell
membrane can result in hyper-polarization (higher negative intracellular electrical potential) or
depolarization (higher positive intracellular electrical potential) of the membrane potential. Metal
cations, like copper, tend to accumulate on the inner side of the cell membrane making it more
positive and thus causing membrane depolarization. Addition of copper induces oxidative stress
and causes severe growth defects in S. mutans cells growing under acid stress, while suppressing
the expression of related acid stress genes. Since, both the oxidative and acid stresses can be
92
affected by variations in the bacterial membrane integrity and/or changes in the electron
transport across the bacterial membrane as shown in retrograde studies, we suggest that these
defects are the consequences from the copper affecting membrane potential in S. mutans [326,
334-335, 348]. Furthermore, it can be postulated that in S. mutans as a consequence of copper-
induced membrane depolarization, other cellular processes such as cell division, integrity of
cellular membranes and dissipation of cellular energy might also be affected, where these
processes vastly rely on maintenance of membrane potential [325, 336]. Future studies are
warranted to study the specific targets involved in copper induced toxicity in this oral pathogen.
The presence of copper in dental amalgams and drinking water has been reported to inhibit
S. mutans growth and reduce caries formation [287]. In this study, we demonstrated copper-
dependent inhibition of S. mutans biofilm formation and its effect on attenuating cell survival
under acid-stress. Residing in the highly fluctuating oral environment, the integral ability to
tolerate the stresses and proliferate and sustain life as a biofilm are considered as the two major
virulence attributes in S. mutans [349-350]. Our study provides strong evidence by which copper
affects these virulence features on physiological and molecular levels, thereby, holding strong
relevance in offering the background knowledge of copper utilization as an effective
antimicrobial against dental caries. More detailed discussion is presented in section 4.6.
5.2 Characterization of the copYAZ operon
The ability of bacteria to survive under copper stress depends on the expression of the genes
involved in copper resistance and tolerance. As described previously, the principle mechanisms
of copper tolerance include: trans-membrane copper expulsion from the cytoplasm to periplasm
or to extracellular milieu; sequestration of copper by metallo-proteins; and oxidation of toxic
cuprous ions to less toxic cupric ions by multi-copper oxidases. Bacterial copper transporting
P1B-type ATPases (a sub-class of P-type ATPases specialized for heavy metal ion transport) are
highly specific for copper (in some cases they also transport silver cations); disruption in their
function results in intracellular accumulation of copper cations (and/or silver cations) and
modulation of bacterial virulence [190, 212, 293, 351-352]. All bacteria possess at least one
93
copper exporting P1B-type ATPases to expel excess cytoplasmic copper. Mutations in the genes
encoding for copper transporters results in increased sensitivity to stresses and decreased
virulence in many bacteria such as P. aeruginosa and S. pneumoniae [315, 353]. E. coli utilizes
copper P1B-ATPases to cope with host phagosomal oxidative burst during infection [354]. More
examples are reported in the literature describing the role of the copper exporting ATPases in
modulating certain physiological features required for bacterial colonization and pathogenesis
[191, 312, 347].
S. mutans have a copYAZ system, and in this study we have demonstrated its specific role as a
copper exporter. The strain lacking copYAZ accumulated significantly higher amounts of copper
within the cell as compared with the wild type UA159 strain. The intracellular copper
accumulation in our study coincides with various published reports, which suggest the
involvement of an unidentified copper-specific uptake system, or an unknown passive non-
specific copper uptake mechanism in S. mutans [208, 347, 355]. We tested two putative
cadmium transporter ATPases, SMU_723 and SMU_2057 with high sequence similarity to the S.
mutans copA gene, which did not show difference in copper sensitivity compared with the wild
type, thereby, we dismissed the role of these putative transporters in S. mutans copper transport.
The role of copYAZ in copper efflux, was substantiated by utilizing a E. coli strain lacking copA
that was complemented with the S. mutans copYAZ operon. The presence of S. mutans copYAZ
significantly reduced the intracellular copper ion accumulation in the test E.coli mutant, thereby,
reinforcing the role of S. mutans CopYAZ in copper efflux. The S. mutans ∆copYAZ strain was
complemented with copYAZ operon, which restored copper efflux and further validated the
function of this system in S. mutans copper export. We have confirmed that the copYAZ affords a
resistance against copper-induced toxicity by specifically expelling copper; while other test
metal stressors such as silver, cadmium, mercury did not result to an increased killing in
copYAZ-null mutant.
Amongst other stress-related phenotypes of S. mutans, we observed that ∆copYAZ cells exhibited
a depolarized membrane phenotype suggesting a state of compromised cell membrane integrity
or a significantly increased accumulation of intracellular cations. The gradual increase in
membrane depolarization observed in ∆copYAZ can be due to membrane perturbation caused by
the loss of the CopA trans-membrane protein. This is in consonance with the previous reports
94
showing that the loss of the metal efflux system have a membrane depolarization phenotype
[283].
Figure 5-1 Summary of role of copper and copYAZ operon in S. mutans
The loss of copYAZ also resulted in sensitivity to killing under acid or oxidative stress, thereby,
emphasizing the involvement of this operon in general adaptive response of S. mutans. As
described previously, the involvement of copYAZ in modulating membrane potential partially
explains the sensitivity of ∆copYAZ to acid and oxidative stress. Conclusively, this is the first
study to identify and characterize the role of copYAZ as the specific copper efflux system (
95
Figure 5-1), which has significant implications on stress induced physiological adaptation in S.
mutans.
5.3 Effect of copper and CopYAZ in genetic
competence
Association of metal ions and genetic competence has been previously reported in Gram positive
bacteria; for instance, calcium in S. pneumonia [296] and either calcium or magnesium in
Azotobacter vinelandii [295, 297] are considered as important factors in competence
development. Previously, in S. mutans the development of genetic competence is shown to be
associated with the bacterium's ability to form biofilms and to tolerate stress [143-144, 147, 153].
In this study, we also established the effect of copper in modulating S. mutanss stress tolerance
response and its ability to acquire foreign DNA. We demonstrated that copper supplementation
resulted in a 20-fold repression of the natural genetic transformation frequency in S. mutans and
a simultaneous 2-fold repression in the expression of comS and comX, (involved in XIP-mediated
competence development). The deletion of copYAZ also resulted in a significant 30-fold
reduction in the transformation frequency compared with UA159 strain and repression of comX
and comS relative to wild type strain, by 2.5 fold and 8.5 fold respectively. These results clearly
signify the importance of the copYAZ system in modulation of genetic competence in S. mutans.
Taken collectively, we have demonstrated the novel activity of copper and copper transport
system in modulating genetic competence development in S. mutans (Figure 5-2). These results
imply the importance of copper and copYAZ system in circumventing the ability of S. mutans to
uptake foreign DNA that may assist bacteria in acquiring resistance against certain
antimicrobials and/or host factors. Moreover, copper and copYAZ dependent impairment in
genetic competence development might also result in compromising S. mutans ability to cause
infection in a changing environment [151]. More detailed description is provided in section 4.6.
96
comR comS
Copper
comX
Induction of late
competence genes
ComR
Outside
Inside
Opp
Processing
XIP ComS
Figure 5-2 Effect of copper and copYAZ on the competence regulon of S. mutans
97
6 Future directions and significance
6.1 Future directions
In this study, our specific objectives were to delineate the mechanism involved in copper-
mediated cell toxicity, to define the systems involved in copper transport, and to enhance our
understanding about copper homeostasis. We made significant progress towards understanding
the phenotypes associated with copper in S. mutans, which lays the foundation to several
important questions. It is predicted that CopZ functions as a copper-chaperone to translocate
copper within the cytoplasm. However, the protein machinery involved in copper exchange
between the cytoplasm and extracellular milieu still needs further exploration. Moreover, the
chemistry of copper's affinity to associate with these proteins, and their detailed role in
homeostasis awaits further exploration. Future research is also warranted to investigate the
importance of the copper transport and resistance machinery in modulating S. mutans
pathogenesis and virulence in the host. The homeostasis of other metal ions, except manganese
and iron, has not yet been defined in S. mutans, further investigation studying these homeostatic
systems and the possible cross talk between their pathways involved in homeostasis also remains
an interesting area to be explored.
Metal ions with high reactivity in the Irving–Williams series can replace less reactive metal ions
from metalloprotein complex [184]. Considering the fact that copper is a highly reactive, it can
be postulated that copper can affect the functioning of various metalloproteins in S. mutans.
Emerging research have also shown that metal sensors and transporters participate in allowing
the cell to overcome inadequate protein:metal affinities; thereby, assisting the metalloproteins to
acquire the right metal ion [356-357]. Future experiments need to be directed towards
understanding the possible role of S. mutans CopYAZ system in modulating the association of
copper with specific metalloproteins. Understanding the mechanisms of how S. mutans'
physiology is regulated by cellular copper holds a strong relevance in devising new therapeutic
measures, where metal transporters and sensors proteins can be targeted to circumvent its
pathogenicity.
98
One of the most significant contributions of this study was to provide evidence relevant to
association between copper/CopYAZ system and genetic transformation in S. mutans. While the
impact of addition of copper or absence of copYAZ on repressing the transcription of sigma-X
and comS provide an explanation for the observed genetic transformation defect, the mechanism
by which copper and copYAZ regulate the expression of these genes remains unclear. Copper can
be postulated to modulate the processing, sensing and/or uptake machinery of precursor peptide;
thereby affecting the XIP mediated genetic transformation. The impairment in the genetic
transformation can also be a result of altered membrane potential as observed in ∆copYAZ strain
relative to wild type. Future quantification of secreted XIP in presence and absence of copper
stress can be done to provide an explanation if the peptide secretion or uptake through specific
system is affected. Further, a proteome analysis in presence or absence of copper stress is
required to understand the mechanisms underlying copper related phenotypes observed in this
study.
In the past few decades, instrumental progress has been made in understanding the metal
utilization pathways and identifying metalloproteins [179, 195]. However, the computational and
systems biology analyses of the total content metallomes (entirety of metal and metalloid species
within a cell or tissue type [358]) and metalloproteome (proteome associated with the metallome
[358]) are limited. There is a direct need to understand the metal transport systems in terms of
their origin (which would identify the functional environment), how these systems were first
acquired (categorically linking the genetic exchange), and if these systems are involved only in
response to a signal or can behave as a source of a signal. Although, an advanced computational
and comparative genomics study suggested a common evolutionary origins of metal transporters
and their regulatory signal transduction in bacteria [276], further studies are warranted to
understand the functional diversification of these systems across the bacterial kingdom.
Moreover, in oral cavity, studies should also be conducted utilizing comparative genomic
approaches to decipher the importance of copper and other metal ions in the physiology and
metabolism of oral microbes. Results from such studies can help to design novel therapeutic
measures to reduce oral infections; for instance, manipulation of the metal-dependent
physiological processes in accordance to inhibit disease-associated but encourage health-
associated microbial colonization in the oral cavity.
99
6.2 Significance
Significant advances have been made over the past few decades on illustrating the importance
and homeostasis of essential transition metal ions in bacteria. These efforts have led to fruitful
information regarding the mechanisms that bacteria employ on regulation, utilization,
transportation and detoxification of metal ions. Here we described the mechanisms by which
copper renders toxicity in S. mutans. An emphasis was made on demonstrating these
mechanisms on physiological and molecular levels. S. mutans ability to form biofilms and
tolerate fluctuating environments provides it with a competitive advantage over many
commensal organisms in the oral cavity. A number of studies have reported the importance of
other metal ions in S. mutans, for instance, manganese and iron acts as a co-factor of superoxide
dismutase; while zinc have inhibitory effect on the GTF activity, acid production, and glycolysis
[359-361]. The transport and homeostasis of iron and manganese in S. mutans has been attributed
to SloABC system, and is associated with cell adherence, biofilm formation, genetic competence,
and oxidative stress tolerance [164, 167]. Another metal cation thoroughly studied for its
importance in metabolism of S. mutans is calcium. In S. mutans, calcium ions activate CiaRH
TCS, which is involved in acid tolerance and production, biofilm formation, and development of
genetic competence [165]. These studies establish the foundation towards understanding on the
importance of transition metal ions and their regulatory role in modulating the various
physiological processes in S. mutans. In our study we focused on understanding copper-induced
toxicity and the effect of copper on several virulence factors in this oral pathogen. Copper has an
inhibitory effect under both planktonic and biofilm growth conditions in S. mutans. Interestingly,
during planktonic growth copper induces toxicity by the generation of oxidative stress and
disruption of membrane potential; whereas during biofilm formation copper represses the
transcription of genes associated with matrix production resulting in poor biofilm biomass
production. Copper's effect on biofilm formation and its involvement in stress response makes it
an ideal antimicrobial candidate against S. mutans infections. In several bacteria, metal
transporters are known to play a crucial role in bacterial virulence [171, 179, 182, 338] and with
our study we demonstrated the significance of copYAZ operon in copper transport, genetic
transformation, and stress response in S. mutans. While further genetic and biochemical studies
are warranted to decipher the underlying genetic pathways that modulate these phenotypes,
100
results from our study have set a platform to understand the important role of copYAZ system in
modulating the growth and survival of S. mutans under stress and normal conditions.
Understanding the mechanisms by which copper exerts its toxicity in S. mutans can have
implications in devising novel clinical applications of copper in anti-caries therapeutics. Since S.
mutans is considered as a Gram positive paradigm, our study also provides a basic background
required to study other copper homeostatic systems in other closely related bacterial pathogens.
101
VIII. References
1. Wade WG: Characterisation of the human oral microbiome. J Oral Biosci 55(3), 143-148
(2013).
2. Dewhirst FE, Chen T, Izard J et al.: The human oral microbiome. J Bacteriol 192(19),
5002-5017 (2010).
3. Aas JA, Paster BJ, Stokes LN, Olsen I, Dewhirst FE: Defining the normal bacterial flora
of the oral cavity. J Clin Microbiol 43(11), 5721-5732 (2005).
4. Xu X, He J, Xue J et al.: Oral cavity contains distinct niches with dynamic microbial
communities. Environ Microbiol 17(3), 699-710 (2014).
5. Smith DJ, Anderson JM, King WF, van Houte J, Taubman MA: Oral streptococcal
colonization of infants. Oral Microbiol Immunol 8(1), 1-4 (1993).
6. Squier CA, Kremer MJ: Biology of oral mucosa and esophagus. J Natl Cancer Inst
Monogr 2001(29), 7-15 (2001).
7. Long SS, Swenson RM: Determinants of the developing oral flora in normal newborns.
Appl Environ Microbiol 32(4), 494-497 (1976).
8. Law V, Seow WK, Townsend G: Factors influencing oral colonization of mutans
streptococci in young children. Aust Dent J 52(2), 93-100 (2007).
9. Nyvad B: Microbial colonization of human tooth surfaces. Acta Pathol Microbiol
Immunol Scand 32, 1-45 (1993).
10. Nobbs AH, Lamont RJ, Jenkinson HF: Streptococcus adherence and colonization.
Microbiol Mol Biol Rev 73(3), 407-450 (2009).
11. Könönen E: Development of oral bacterial flora in young children. Ann Med 32(2), 107-
112 (2000).
102
12. Zijnge V, van Leeuwen MBM, Degener JE et al.: Oral biofilm architecture on natural
teeth. PLoS ONE 5(2), e9321 (2010).
13. Marsh PD: Dental plaque: biological significance of a biofilm and community life-style.
J Clin Periodontol 32(6), 7-15 (2005).
14. Marsh P: Dental plaque as a biofilm and a microbial community – implications for health
and disease. BMC Oral Health 6(1), 1-7 (2006).
15. Marsh PD: Microbial ecology of dental plaque and its significance in health and disease.
Adv Dent Res 8(2), 263-271 (1994).
16. Gibbons RJ: Microbial ecology adherent interactions which may affect microbial ecology
in the mouth. J Dent Res 63(3), 378-385 (1984).
17. Moore WEC, Moore LVH: The bacteria of periodontal diseases. Periodontology 2000
5(1), 66-77 (1994).
18. Syed SA, Loesche WJ: Bacteriology of human experimental gingivitis: effect of plaque
age. Infect Immun 21(3), 821-829 (1978).
19. Marsh PD: Are dental diseases examples of ecological catastrophes? Microbiology
149(2), 279-294 (2003).
20. Amerongen AVN, Veerman ECI: Saliva – the defender of the oral cavity. Oral Dis 8(1),
12-22 (2002).
21. Marcotte H, Lavoie MC: Oral microbial ecology and the role of salivary immunoglobulin
A. Microbiol Mol Biol Rev 62(1), 71-109 (1998).
22. Lendenmann U, Grogan J, Oppenheim FG: Saliva and dental pellicle- a review. Adv Dent
Res 14(1), 22-28 (2000).
23. Yao Y, Berg EA, Costello CE, Troxler RF, Oppenheim FG: Identification of protein
components in human acquired enamel pellicle and whole saliva using novel proteomics
approaches. J Biol Chem 278(7), 5300-5308 (2003).
103
24. Hannig C, Hannig M, Attin T: Enzymes in the acquired enamel pellicle. Eur J Oral Sci
113(1), 2-13 (2005).
25. Tenovuo J: Antimicrobial function of human saliva - how important is it for oral health?
Acta Odontol Scand 56(5), 250-256 (1998).
26. Lamster IB: Evaluation of components of gingival crevicular fluid as diagnostic tests.
Ann Periodontol 2(1), 123-137 (1997).
27. Lamster IB, Ahlo JK: Analysis of gingival crevicular fluid as applied to the diagnosis of
oral and systemic diseases. Ann NY Acad Sci 1098(1), 216-229 (2007).
28. Lamster IB, Novak MJ: Host mediators in gingival crevicular fluid: Implications for the
pathogenesis of periodontal disease. Crit Rev Oral Biol Med 3(1), 31-60 (1992).
29. Suomalainen K, Saxén L, Vilja P, Tenovuo J: Peroxidases, Iactoferrin and lysozyme in
peripheral blood neutrophils, gingival crevicular fluid and whole saliva of patients with
localized juvenile periodontitis. Oral Dis 2(2), 129-134 (1996).
30. Lif Holgerson P, Harnevik L, Hernell O, Tanner ACR, Johansson I: Mode of birth
delivery affects oral microbiota in infants. J Dent Res 90(10), 1183-1188 (2011).
31. Nelun Barfod M, Magnusson K, Lexner MO, Blomqvist S, Dahlén G, Twetman S: Oral
microflora in infants delivered vaginally and by caesarean section. Int J Paediatr Dent.
21(6), 401-406 (2011).
32. Marsh P, Martin M: Acquisition, adherence, distribution and functions of the oral
microflora. In: Oral Microbiol. Springer US, 56-97 (1992).
33. Sampaio-Maia B, Monteiro-Silva F: Acquisition and maturation of oral microbiome
throughout childhood: An update. Dent Res J 11(3), 291-301 (2014).
34. Bearfield C, Davenport ES, Sivapathasundaram V, Allaker RP: Possible association
between amniotic fluid micro-organism infection and microflora in the mouth. BJOG
109(5), 527-533 (2002).
104
35. Li J, Helmerhorst EJ, Leone CW et al.: Identification of early microbial colonizers in
human dental biofilm. J Appl Microbiol 97(6), 1311-1318 (2004).
36. Plonka KA, Pukallus ML, Barnett AG, Walsh LJ, Holcombe TH, Seow WK: Mutans
streptococci and lactobacilli colonization in predentate children from the neonatal period
to seven months of age. Caries Res 46(3), 213-220 (2012).
37. Welin J, Wilkins JC, Beighton D, Svensäter G: Protein expression by Streptococcus
mutans during initial stage of biofilm formation. Appl Environ Microbiol 70(6), 3736-
3741 (2004).
38. Feller L, Altini M, Khammissa RAG, Chandran R, Bouckaert M, Lemmer J: Oral
mucosal immunity. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 116(5), 576-583
39. Gibbons RJ, Houte JV: Bacterial adherence in oral microbial ecology. Annu Rev
Microbiol 29(1), 19-42 (1975).
40. Hojo K, Nagaoka S, Ohshima T, Maeda N: Bacterial interactions in dental biofilm
development. J Dent Res 88(11), 982-990 (2009).
41. Filoche S, Wong L, Sissons CH: Oral biofilms: emerging concepts in microbial ecology.
J Dent Res 89(1), 8-18 (2010).
42. Nobbs AH, Jenkinson HF, Jakubovics NS: Stick to your gums: mechanisms of oral
microbial adherence. J Dent Res 90(11), 1271-1278 (2011).
43. Flemming H-c, Wingender J: The biofilm matrix. Nat Rev Microbiol 8(9), 623-633
(2010).
44. Peyyala R, Ebersole JL: Multispecies biofilms and host responses: “Discriminating the
trees from the forest”. Cytokine 61(1), 15-25 (2013).
45. Marsh PD: Role of the Oral Microflora in Health. Microb Ecol Health D 12(3), 130-137
(2000).
105
46. Bowden G: The microbial ecology of dental caries. Microb Ecol Health Dis 12(3), 138-
148 (2000).
47. Marsh PD: Role of the oral microflora in health. Microb Ecol Health Dis 12(3), 130-137
(2000).
48. Wright CJ, Burns LH, Jack AA et al.: Microbial interactions in building of communities.
Mol Oral Microbiol 28(2), 83-101 (2013).
49. Cuadra-Saenz G, Rao DL, Underwood AJ et al.: Autoinducer-2 influences interactions
amongst pioneer colonizing streptococci in oral biofilms. Microbiology 158(Pt 7), 1783-
1795 (2012).
50. Kolenbrander PE: Oral Microbial Communities: Biofilms, Interactions, and Genetic
Systems. Annu Rev Microbiol 54(1), 413-437 (2000).
51. Kolenbrander PE, Palmer Jr RJ, Periasamy S, Jakubovics NS: Oral multispecies biofilm
development and the key role of cell–cell distance. Nat Rev Microbiol 8(7), 471-480
(2010).
52. Jakubovics NS, Kolenbrander PE: The road to ruin: the formation of disease-associated
oral biofilms. Oral Dis 16(8), 729-739 (2010).
53. Bowen WH, Schilling K, Giertsen E et al.: Role of a cell surface-associated protein in
adherence and dental caries. Infect Immun 59(12), 4606-4609 (1991).
54. Amaechi BT, Higham SM, Edgar WM, Milosevic A: Thickness of acquired salivary
pellicle as a determinant of the sites of dental erosion. J Dent Res 78(12), 1821-1828
(1999).
55. Kuramitsu HK, He X, Lux R, Anderson MH, Shi W: Interspecies interactions within oral
microbial communities. Microbiol Mol Biol Rev 71(4), 653-670 (2007).
56. Carlsson J: Bacterial metabolism in dental biofilms. Adv Dent Res 11(1), 75-80 (1997).
106
57. Liljemark WF, Bloomquist C: Human oral microbial ecology and dental caries and
periodontal diseases. Crit Rev Oral Biol Med 7(2), 180-198 (1996).
58. Paster BJ, Boches SK, Galvin JL et al.: Bacterial diversity in human subgingival plaque.
J Bacteriol 183(12), 3770-3783 (2001).
59. Moore WE, Holdeman LV, Cato EP, Smibert RM, Burmeister JA, Ranney RR:
Bacteriology of moderate (chronic) periodontitis in mature adult humans. Infect Immun
42(2), 510-515 (1983).
60. He X, Hu W, Kaplan CW, Guo L, Shi W, Lux R: Adherence to streptococci facilitates
Fusobacterium nucleatum integration into an oral microbial community. Microb Ecol
63(3), 532-542 (2012).
61. Rosan B, Lamont RJ: Dental plaque formation. Microbes Infect 2(13), 1599-1607 (2000).
62. Das T, Sehar S, Manefield M: The roles of extracellular DNA in the structural integrity
of extracellular polymeric substance and bacterial biofilm development. Environ
Microbiol Rep 5(6), 778-786 (2013).
63. Koo H, Xiao J, Klein MI, Jeon JG: Exopolysaccharides produced by Streptococcus
mutans glucosyltransferases modulate the establishment of microcolonies within
multispecies biofilms. J Bacteriol 192(12), 3024-3032 (2010).
64. Kaplan JB: Biofilm dispersal: mechanisms, clinical Implications, and potential
therapeutic uses. J Dent Res 89(3), 205-218 (2010).
65. de la Fuente-Núñez C, Reffuveille F, Fernández L, Hancock REW: Bacterial biofilm
development as a multicellular adaptation: antibiotic resistance and new therapeutic
strategies. Curr Opin Microbiol 16(5), 580-589 (2013).
66. Benítez-Páez A, Belda-Ferre P, Simón-Soro A, Mira A: Microbiota diversity and gene
expression dynamics in human oral biofilms. BMC Genomics 15(1), 1-13 (2014).
107
67. Kolenbrander PE, Andersen RN, Blehert DS, Egland PG, Foster JS, Palmer RJ:
Communication among oral bacteria. Microbiol Mol Biol Rev 66(3), 486-505 (2002).
68. Socransky SS, Haffajee AD: Periodontal microbial ecology. Periodontology 2000 38(1),
135-187 (2005).
69. Paju S, Scannapieco FA: Oral biofilms, periodontitis, and pulmonary infections. Oral Dis
13(6), 508-512 (2007).
70. Cabell CH, Abrutyn E, Karchmer AW: Bacterial endocarditis: the disease, treatment, and
prevention. Circulation 107(20), e185-e187 (2003).
71. McGhie D, Hutchison JG, Nye F, Ball AP: Infective endocarditis caused by
Streptococcus mutans. Br Heart J 39(4), 456-458 (1977).
72. Huck O TH, Davideau J L: Relationship between periodontal diseases and preterm birth:
recent epidemiological and biological data. J Pregnancy 2011, (2011).
73. Pucher J, Stewart J: Periodontal disease and diabetes mellitus. Curr Diab Rep 4(1), 46-50
(2004).
74. Li X, Kolltveit KM, Tronstad L, Olsen I: Systemic diseases caused by oral infection. Clin
Microbiol Rev 13(4), 547-558 (2000).
75. Shira Davenport E: Preterm low birthweight and the role of oral bacteria. J Oral
Microbiol 2, 10.3402/jom.v3402i3400.5779 (2010).
76. Fisher MA, Borgnakke WS, Taylor GW: Periodontal disease as a risk marker in coronary
heart disease and chronic kidney disease. Curr Opin Nephrol Hypertens. 19(6), 519-526
(2010).
77. Petersen PE, Bourgeois D, Ogawa H, Estupinan-Day S, Ndiaye C: The global burden of
oral diseases and risks to oral health. Bulletin of the World Health Organization 83, 661-
669 (2005).
108
78. Loesche WJ: The specific plaque hypothesis and the antimicrobial treatment of
periodontal disease. Dent Update 19(2), 68-74 (1992).
79. Emilson C-G, Krasse BO: Support for and implications of the specific plaque hypothesis.
Eur J Oral Sci 93(2), 96-104 (1985).
80. Theilade E: The non-specific theory in microbial etiology of inflammatory periodontal
diseases. J Clin Periodontol 13(10), 905-911 (1986).
81. Takahashi N, Nyvad B: The role of bacteria in the caries process: ecological perspectives.
J Dent Res 90(3), 294-303 (2011).
82. Whitmore SE, Lamont RJ: The pathogenic persona of community-associated oral
streptococci. Mol Microbiol 81(2), 305-314 (2011).
83. Knirsch W, Nadal D: Infective endocarditis in congenital heart disease. Eur J Pediatr
170(9), 1111-1127 (2011).
84. Whiley RA, Beighton D: Current classification of the oral streptococci. Oral Microbiol
Immunol 13(4), 195-216 (1998).
85. Kawamura Y, Hou X-G, Sultana F, Miura H, Ezaki T: Determination of 16S rRNA
sequences of Streptococcus mitis and Streptococcus gordonii and phylogenetic
relationships among members of the genus streptococcus. Int J Syst Bacteriol 45(2), 406-
408 (1995).
86. Hardie JM, Whiley RA: Classification and overview of the genera Streptococcus and
Enterococcus. J Appl Microbiol 83(S1), 1S-11S (1997).
87. Loesche WJ: Role of Streptococcus mutans in human dental decay. Microbiol Rev 50(4),
353-380 (1986).
88. Facklam R: What happened to the streptococci: overview of taxonomic and nomenclature
changes. Clin Microbiol Rev 15(4), 613-630 (2002).
109
89. Nakano K, Nomura R, Nemoto H et al.: Detection of novel serotype k Streptococcus
mutans in infective endocarditis patients. J Med Microbiol 56(10), 1413-1415 (2007).
90. Hung W-C, Tsai J-C, Hsueh P-R, Chia J-S, Teng L-J: Species identification of mutans
streptococci by groESL gene sequence. J Med Microbiol 54(9), 857-862 (2005).
91. Marsh PD: Role of the oral microflora in health. Microb Ecol Health Dis 12(3), (2011).
92. Whiley RA, Beighton D, Winstanley TG, Fraser HY, Hardie JM: Streptococcus
intermedius, Streptococcus constellatus, and Streptococcus anginosus (the Streptococcus
milleri group): association with different body sites and clinical infections. J Clin
Microbiol 30(1), 243-244 (1992).
93. Băncescu G, Dumitriu S, Băncescu A, Skaug N: Phenotypic characterization of some
anginosus group isolates from oral and maxillofacial infections. Roum Arch Microbiol
Immunol 57(2), 139-145 (1998).
94. Clarke JK: On the bacterial factor in the etiology of dental caries. Br J Exp Pathol 5(3),
141-147 (1924).
95. Hamada S, Slade HD: Biology, immunology, and cariogenicity of Streptococcus mutans.
Microbiol Rev 44(2), 331-384 (1980).
96. Robbins N, Szilagyi G, Tanowitz HB, Luftschein S, Baum SG: Infective endocarditis
caused by Streptococcus mutans: A complication of idiopathic hypertrophic subaortic
stenosis. Arch Intern Med 137(9), 1171-1174 (1977).
97. Schelenz S, Page AJF, Emmerson AM: Streptococcus mutans endocarditis: beware of
the‘ diphtheroid’. J R Soc Med 98(9), 420-421 (2005).
98. Lapirattanakul J, Nakano K: Mother-to-child transmission of mutans streptococci. Future
Microbiol 9(6), 807-823 (2014).
99. Berkowitz RJ: Mutans streptococci: acquisition and transmission. Pediatr Dent 28(2),
106-109 (2006).
110
100. Biswas S, Biswas I: Complete genome sequence of Streptococcus mutans GS-5, a
serotype c strain. J Bacteriol 194(17), 4787-4788 (2012).
101. Ajdić D, McShan WM, McLaughlin RE et al.: Genome sequence of Streptococcus
mutans UA159, a cariogenic dental pathogen. Proc Natl Acad Sci U S A 99(22), 14434-
14439 (2002).
102. Aikawa C, Furukawa N, Watanabe T et al.: Complete genome sequence of the serotype k
Streptococcus mutans strain LJ23. J Bacteriol 194(10), 2754-2755 (2012).
103. Maruyama F, Kobata M, Kurokawa K et al.: Comparative genomic analyses of
Streptococcus mutans provide insights into chromosomal shuffling and species-specific
content. BMC Genomics 10, 358-358 (2009).
104. Guo L, Hu W, He X, Lux R, McLean J, Shi W: Investigating acid production by
Streptococcus mutans with a surface-displayed pH-sensitive green fluorescent protein.
PLoS ONE 8(2), e57182 (2013).
105. Matsui R, Cvitkovitch D: Acid tolerance mechanisms utilized by Streptococcus mutans.
Future Microbiol 5(3), 403-417 (2010).
106. Hamilton IR, Buckley ND: Adaptation by Streptococcus mutans to acid tolerance. Oral
Microbiol Immunol 6(2), 65-71 (1991).
107. Li Y-H, Hanna MN, Svensäter G, Ellen RP, Cvitkovitch DG: Cell density modulates acid
adaptation in Streptococcus mutans: implications for survival in biofilms. J Bacteriol
183(23), 6875-6884 (2001).
108. Len ACL, Harty DWS, Jacques NA: Stress-responsive proteins are upregulated in
Streptococcus mutans during acid tolerance. Microbiology 150(5), 1339-1351 (2004).
109. Senadheera D, Krastel K, Mair R et al.: Inactivation of VicK affects acid production and
acid survival of Streptococcus mutans. J Bacteriol 191(20), 6415-6424 (2009).
111
110. Crowley PJ, Brady LJ, Michalek SM, Bleiweis AS: Virulence of a spaP mutant of
Streptococcus mutans in a gnotobiotic rat model. Infect Immun 67(3), 1201-1206 (1999).
111. Hanada N, Kuramitsu HK: Isolation and characterization of the Streptococcus mutans
gtfC gene, coding for synthesis of both soluble and insoluble glucans. Infect Immun
56(8), 1999-2005 (1988).
112. Hanada N, Kuramitsu HK: Isolation and characterization of the Streptococcus mutans
gtfD gene, coding for primer-dependent soluble glucan synthesis. Infect Immun 57(7),
2079-2085 (1989).
113. Gilpin ML, Russell RR, Morrissey P: Cloning and expression of two Streptococcus
mutans glucosyltransferases in Escherichia coli K-12. Infect Immun 49(2), 414-416
(1985).
114. Wexler DL, Hudson MC, Burne RA: Streptococcus mutans fructosyltransferase (ftf) and
glucosyltransferase (gtfBC) operon fusion strains in continuous culture. Infect Immun
61(4), 1259-1267 (1993).
115. Koo H, Falsetta ML, Klein MI: The exopolysaccharide matrix: a virulence determinant of
cariogenic biofilm. J Dent Res 92(12), 1065-1073 (2013).
116. Yamashita Y, Bowen WH, Burne RA, Kuramitsu HK: Role of the Streptococcus mutans
gtf genes in caries induction in the specific-pathogen-free rat model. Infect Immun 61(9),
3811-3817 (1993).
117. Bowen WH, Koo H: Biology of Streptococcus mutans derived glucosyltransferases: Role
in extracellular matrix formation of cariogenic biofilms. Caries Res 45(1), 69-86 (2011).
118. Decker E-M, Dietrich I, Klein C, von Ohle C: Dynamic production of soluble
extracellular polysaccharides by Streptococcus mutans. Int J Dent 2011, 6 (2011).
119. Lynch DJ, Fountain TL, Mazurkiewicz JE, Banas JA: Glucan-binding proteins are
essential for shaping Streptococcus mutans biofilm architecture. FEMS Microbiol Lett
268(2), 158-165 (2007).
112
120. Banas JA, Potvin HC, Singh RN: The regulation of Streptococcus mutans glucan-binding
protein A expression. FEMS Microbiol Lett 154(2), 289-292 (1997).
121. Matsumoto-Nakano M, Fujita K, Ooshima T: Comparison of glucan-binding proteins in
cariogenicity of Streptococcus mutans. Oral Microbiol Immunol 22(1), 30-35 (2007).
122. Biswas I, Drake L, Biswas S: Regulation of gbpC expression in Streptococcus mutans. J
Bacteriol 189(18), 6521-6531 (2007).
123. Fujita K, Matsumoto-Nakano M, Inagaki S, Ooshima T: Biological functions of glucan-
binding protein B of Streptococcus mutans. Oral Microbiol Immunol 22(5), 289-292
(2007).
124. Mattos-Graner RO, Porter KA, Smith DJ, Hosogi Y, Duncan MJ: Functional analysis of
glucan binding protein B from Streptococcus mutans. J Bacteriol 188(11), 3813-3825
(2006).
125. Duque C, Stipp RN, Wang B et al.: Downregulation of GbpB, a component of the VicRK
regulon, affects biofilm formation and cell surface characteristics of Streptococcus
mutans. Infect Immun 79(2), 786-796 (2011).
126. Matsumura M, Izumi T, Matsumoto M, Tsuji M, Fujiwara T, Ooshima T: The role of
glucan-binding proteins in the cariogenicity of Streptococcus mutans. Microbiol Immunol
47(3), 213-215 (2003).
127. Nakano K, Matsumura M, Kawaguchi M et al.: Attenuation of glucan-binding protein C
reduces the cariogenicity of Streptococcus mutans: analysis of strains isolated from
human blood. J Dent Res 81(6), 376-379 (2002).
128. Rutherford ST, Bassler BL: Bacterial quorum sensing: its role in virulence and
possibilities for its control. Cold Spring Harb Perspect Med 2(11), (2012).
129. Cuadra-Saenz G, Rao DL, Underwood AJ et al.: Autoinducer-2 influences interactions
amongst pioneer colonizing streptococci in oral biofilms. Microbiology 158(7), 1783-
1795 (2012).
113
130. Jimenez JC, Federle MJ: Quorum sensing in group A Streptococcus. Front Cell Infect
Microbiol 4, 127 (2014).
131. Fleuchot B, Gitton C, Guillot A et al.: Rgg proteins associated with internalized small
hydrophobic peptides: a new quorum-sensing mechanism in streptococci. Mol Microbiol
80(4), 1102-1119 (2011).
132. Mashburn-Warren L, Morrison DA, Federle MJ: A novel double-tryptophan peptide
pheromone controls competence in Streptococcus spp. via an Rgg regulator. Mol
Microbiol 78(3), 589-606 (2010).
133. Stock AM, Robinson VL, Goudreau PN: Two-component signal transduction. Annu Rev
Biochem 69(1), 183-215 (2000).
134. Bijlsma JJE, Groisman EA: Making informed decisions: regulatory interactions between
two-component systems. Trends Microbiol 11(8), 359-366 (2003).
135. West AH, Stock AM: Histidine kinases and response regulator proteins in two-
component signaling systems. Trends Biochem Sci 26(6), 369-376 (2001).
136. Stipp RN, Boisvert H, Smith DJ, Höfling JF, Duncan MJ, Mattos-Graner RO: CovR and
VicRK regulate cell surface biogenesis genes required for biofilm formation in
Streptococcus mutans. PLoS ONE 8(3), e58271 (2013).
137. Chen P-M, Chen H-C, Ho C-T et al.: The two-component system ScnRK of
Streptococcus mutans affects hydrogen peroxide resistance and murine macrophage
killing. Microbes Infect 10(3), 293-301 (2008).
138. Deng DM, Liu MJ, ten Cate JM, Crielaard W: The VicRK system of Streptococcus
mutans responds to oxidative stress. J Dent Res 86(7), 606-610 (2007).
139. Smith EG, Spatafora GA: Gene regulation in S. mutans : complex control in a complex
environment. J Dent Res 91(2), 133-141 (2012).
114
140. Idone V, Brendtro S, Gillespie R et al.: Effect of an orphan response regulator on
Streptococcus mutans sucrose-dependent adherence and cariogenesis. Infect Immun
71(8), 4351-4360 (2003).
141. Sztajer H, Lemme A, Vilchez R et al.: Autoinducer-2-Regulated Genes in Streptococcus
mutans UA159 and Global Metabolic Effect of the luxS Mutation. J Bacteriol 190(1),
401-415 (2008).
142. Federle MJ, Morrison DA: One if by land, two if by sea: signalling to the ranks with CSP
and XIP. Mol Microbiol 86(2), 241-245 (2012).
143. Li Y-H, Tang N, Aspiras MB et al.: A quorum-sensing signaling system essential for
genetic competence in Streptococcus mutans is involved in biofilm formation. J Bacteriol
184(10), 2699-2708 (2002).
144. Ahn S-J, Wen ZT, Burne RA: Multilevel control of competence development and stress
tolerance in Streptococcus mutans UA159. Infect Immun 74(3), 1631-1642 (2006).
145. Aspiras MB, Ellen RP, Cvitkovitch DG: ComX activity of Streptococcus mutans growing
in biofilms. FEMS Microbiol Lett 238(1), 167-174 (2004).
146. Khan R, Rukke HV, Ricomini Filho AP, Fimland G, Arntzen MT, Bernd, Petersen FC:
Extracellular identification of a processed type II ComR/ComS pheromone of
Streptococcus mutans. J Bacteriol 194(15), 3781-3788 (2012).
147. Li Y-H, Lau PCY, Lee JH, Ellen RP, Cvitkovitch DG: Natural genetic transformation of
Streptococcus mutans growing in biofilms. J Bacteriol 183(3), 897-908 (2001).
148. Desai K, Mashburn-Warren L, Federle MJ, Morrison DA: Development of competence
for genetic transformation of Streptococcus mutans in a chemically defined medium. J
Bacteriol 194(15), 3774-3780 (2012).
149. Lemme A, Gröbe L, Reck M, Tomasch J, Wagner-Döbler I: Subpopulation-specific
transcriptome analysis of competence-stimulating-peptide-induced Streptococcus mutans.
J Bacteriol 193(8), 1863-1877 (2011).
115
150. Son M, Ahn S-J, Guo Q, Burne RA, Hagen SJ: Microfluidic study of competence
regulation in Streptococcus mutans: environmental inputs modulate bimodal and
unimodal expression of comX. Mol Microbiol 86(2), 258-272 (2012).
151. Johnsborg O, Eldholm V, Håvarstein LS: Natural genetic transformation: prevalence,
mechanisms and function. Res Microbiol 158(10), 767-778 (2007).
152. van der Ploeg JR: Regulation of bacteriocin production in Streptococcus mutans by the
quorum-sensing system required for development of genetic competence. J Bacteriol
187(12), 3980-3989 (2005).
153. Cvitkovitch DG: Genetic competence and transformation in oral streptococci. Crit Rev
Oral Biol Med 12(3), 217-243 (2001).
154. Oggioni MR, Morrison DA: Cooperative Regulation of Competence Development in
Streptococcus pneumoniae: Cell-to-Cell Signaling via a Peptide Pheromone and an
Alternative Sigma Factor. In: Chemical Communication among Bacteria. American
Society of Microbiology, (2008).
155. Petersen FC, Scheie AA: Genetic transformation in Streptococcus mutans requires a
peptide secretion–like apparatus. Oral Microbiol Immunol 15(5), 329-334 (2000).
156. Hossain MS, Biswas I: An Extracelluar Protease, SepM, Generates Functional
Competence-Stimulating Peptide in Streptococcus mutans UA159. J Bacteriol 194(21),
5886-5896 (2012).
157. Perry JA, Jones MB, Peterson SN, Cvitkovitch DG, Lévesque CM: Peptide alarmone
signalling triggers an auto-active bacteriocin necessary for genetic competence. Mol
Microbiol 72(4), 905-917 (2009).
158. Sztajer H, Szafranski SP, Tomasch J et al.: Cross-feeding and interkingdom
communication in dual-species biofilms of Streptococcus mutans and Candida albicans.
ISME J 8(11), 2256-2271 (2014).
116
159. Appenroth K-J: Definition of “heavy metals” and their role in biological systems. In: Soil
heavy metals. Springer Berlin Heidelberg, 19-29 (2010).
160. Anastassopoulou J, Theophanides T: The role of metal ions in biological systems and
medicine. In: Bioinorganic Chemistry, Kessissoglou D. Springer Netherlands, 209-218
(1995).
161. Ma Z, Jacobsen FE, Giedroc DP: Metal transporters and metal sensors: how coordination
chemistry controls bacterial metal homeostasis. Chem Rev 109(10), 4644-4681 (2009).
162. Agranoff DD, Krishna S: Metal ion homeostasis and intracellular parasitism. Mol
Microbiol 28(3), 403-412 (1998).
163. Martin ME, Byers BR, Olson MO, Salin ML, Arceneaux JE, Tolbert C: A Streptococcus
mutans superoxide dismutase that is active with either manganese or iron as a cofactor. J
Biol Chem 261(20), 9361-9367 (1986).
164. Paik S, Brown A, Munro CL, Cornelissen CN, Kitten T: The sloABCR operon of
Streptococcus mutans encodes an Mn and Fe transport system required for endocarditis
virulence and its Mn-dependent repressor. J Bacteriol 185(20), 5967-5975 (2003).
165. He X, Wu C, Yarbrough D et al.: The cia operon of Streptococcus mutans encodes a
unique component required for calcium-mediated autoregulation. Mol Microbiol 70(1),
112-126 (2008).
166. Bani D BA: Developing ROS scavenging agents for pharmacological purposes: recent
advances in design of manganese-based complexes with anti-inflammatory and anti-
nociceptive activity. Curr. Med. Chem. 19(26), 4431-4444. (2012).
167. Rolerson E, Swick A, Newlon L et al.: The SloR/Dlg metalloregulator modulates
Streptococcus mutans virulence gene expression. J Bacteriol 188(14), 5033-5044 (2006).
168. Dunning DW, McCall LW, Powell WF et al.: SloR modulation of the Streptococcus
mutans acid tolerance response involves the GcrR response regulator as an essential
intermediary. Microbiology 154(4), 1132-1143 (2008).
117
169. Solioz M, Stoyanov JV: Copper homeostasis in Enterococcus hirae. FEMS Microbiol
Rev 27(2–3), 183-195 (2003).
170. Solioz M, Abicht H, Mermod M, Mancini S: Response of Gram-positive bacteria to
copper stress. J Biol Inorg Chem 15(1), 3-14 (2010).
171. Samanovic Marie I, Ding C, Thiele Dennis J, Darwin KH: Copper in microbial
pathogenesis: meddling with the metal. Cell Host Microbe 11(2), 106-115 (2012).
172. Rensing C, McDevitt S: The copper metallome in prokaryotic cells. In: Metallomics and
the Cell, Banci L. Springer Netherlands, 417-450 (2013).
173. Huat Lu Z, Dameron C, Solioz M: The Enterococcus hirae paradigm of copper
homeostasis: copper chaperone turnover, interactions, and transactions. Biometals 16(1),
137-143 (2003).
174. Cobine P, Wickramasinghe WA, Harrison MD, Weber T, Solioz M, Dameron CT: The
Enterococcus hirae copper chaperone CopZ delivers copper(I) to the CopY repressor.
FEBS Lett 445(1), 27-30 (1999).
175. Magnani D, Solioz M: Copper chaperone cycling and degradation in the regulation of the
cop operon of Enterococcus hirae. Biometals 18(4), 407-412 (2005).
176. Afseth J AS, Monell-Torrens E,, Brown WH RG, Brunelle J, et al.: Effect of copper
applied topically or in drinking water on experimental caries in rats. Caries Research 18,
434-439 (1984).
177. Drake DR, Grigsby W, Cardenzana A, Dunkerson D: Synergistic, growth-inhibitory
effects of chlorhexidine and copper combinations on Streptococcus mutans, Actinomyces
viscosus, and Actinomyces naeslundii. J Dent Res 72(2), 524-528 (1993).
178. Vats N, Lee SF: Characterization of a copper-transport operon, copYAZ, from
Streptococcus mutans. Microbiology 147(3), 653-662 (2001).
118
179. Wakeman CA, Skaar EP: Metalloregulation of Gram-positive pathogen physiology. Curr
Opin Microbiol 15(2), 169-174 (2012).
180. Ma Z, Jacobsen FE, Giedroc DP: Metal transporters and metal sensors: how coordination
chemistry controls bacterial metal homeostasis. Chem Rev 109 (10), 4644–4681 (2010).
181. Finney LA, O'Halloran TV: Transition metal speciation in the cell: Insights from the
chemistry of metal ion receptors. Science 300(5621), 931-936 (2003).
182. Honsa ES, Johnson MDL, Rosch JW: The roles of transition metals in the physiology and
pathogenesis of Streptococcus pneumoniae. Front Cell Infect Microbiol 3, (2013).
183. Waldron KJ, Robinson NJ: How do bacterial cells ensure that metalloproteins get the
correct metal? Nat Rev Microbiol 7, 25-35 (2009).
184. Irving H, Williams RJP: The stability of transition-metal complexes. J Chem Soc, 3192-
3210 (1953).
185. Hoshino N, Kimura T, Yamaji A, Ando T: Damage to the cytoplasmic membrane of
Escherichia coli by catechin-copper (II) complexes. Free Radic Biol Med 27(11–12),
1245-1250 (1999).
186. Stohs SJ, Bagchi D: Oxidative mechanisms in the toxicity of metal ions. Free Radic Biol
Med 18(2), 321-336 (1995).
187. Hood MI, Skaar EP: Nutritional immunity: transition metals at the pathogen–host
interface. Nat Rev Microbiol 10(8), 525-537 (2012).
188. Cassat J, Skaar E: Metal ion acquisition in Staphylococcus aureus: overcoming
nutritional immunity. Semin Immunopathol 34(2), 215-235 (2012).
189. Montanini B BD, Jeandroz S, Sanders D, Chalot M.: Phylogenetic and functional analysis
of the Cation Diffusion Facilitator (CDF) family: improved signature and prediction of
substrate specificity. BMC Genomics 8(107), (2007 ).
119
190. Argüello J, Eren E, González-Guerrero M: The structure and function of heavy metal
transport P1B-ATPases. Biometals 20(3-4), 233-248 (2007).
191. Klein JS, Lewinson O: Bacterial ATP-driven transporters of transition metals:
physiological roles, mechanisms of action, and roles in bacterial virulence. Metallomics
3(11), 1098-1108 (2011).
192. Murakami S: Multidrug efflux transporter, AcrB—the pumping mechanism. Curr Opin
Struct Biol 18(4), 459-465 (2008).
193. Chen PR, He C: Selective recognition of metal ions by metalloregulatory proteins. Curr
Opin Chem Biol 12(2), 214-221 (2008).
194. Merchant AT, Spatafora GA: A role for the DtxR family of metalloregulators in gram-
positive pathogenesis. Mol Oral Microbiol 29(1), 1-10 (2014).
195. Giedroc DP, Arunkumar AI: Metal sensor proteins: nature's metalloregulated allosteric
switches. Dalton Trans (29), 3107-3120 (2007).
196. Oglesby-Sherrouse AG, Murphy ER: Iron-responsive bacterial small RNAs: variations on
a theme. Metallomics 5(4), 276-286 (2013).
197. Roche B, Aussel L, Ezraty B, Mandin P, Py B, Barras F: Iron/sulfur proteins biogenesis
in prokaryotes: Formation, regulation and diversity. Biochim Biophys Acta 1827(3), 455-
469 (2013).
198. Canessa P, Larrondo L: Environmental responses and the control of iron homeostasis in
fungal systems. Appl Microbiol Biotechnol 97(3), 939-955 (2013).
199. Franza T, Expert D: Role of iron homeostasis in the virulence of phytopathogenic
bacteria: an ‘à la carte’ menu. Mol Plant Pathol 14(4), 429-438 (2013).
200. Cassat James E, Skaar Eric P: Iron in Infection and Immunity. Cell Host Microbe 13(5),
509-519 (2013).
120
201. Cornelis P, Wei Q, Andrews SC, Vinckx T: Iron homeostasis and management of
oxidative stress response in bacteria. Metallomics 3(6), 540-549 (2011).
202. Andreini C, Banci L, Bertini I, Rosato A: Occurrence of copper proteins through the
three domains of life: A bioinformatic approach. J Proteome Res 7(1), 209-216 (2007).
203. Dupont CL, Grass G, Rensing C: Copper toxicity and the origin of bacterial resistance-
new insights and applications. Metallomics 3(11), 1109-1118 (2011).
204. Macomber L, Rensing C, Imlay JA: Intracellular copper does not catalyze the formation
of oxidative DNA damage in Escherichia coli. J Bacteriol 189(5), 1616-1626 (2007).
205. Achard MES, Tree JJ, Holden JA et al.: The multi-copper-ion oxidase CueO of
Salmonella enterica serovar typhimurium is required for systemic virulence. Infect
Immun 78(5), 2312-2319 (2010).
206. Fung DKC, Lau WY, Chan WT, Yan A: Copper efflux is induced during anaerobic
amino acid limitation in Escherichia coli to protect iron-sulfur cluster enzymes and
biogenesis. J Bacteriol 195(20), 4556-4568 (2013).
207. Hodgkinson V, Petris MJ: Copper homeostasis at the host-pathogen interface. J Biol
Chem 287(17), 13549-13555 (2012).
208. Rademacher C, Masepohl B: Copper-responsive gene regulation in bacteria.
Microbiology 158(Pt 10), 2451-2464 (2012).
209. Grass G, Rensing C: Genes involved in copper homeostasis in Escherichia coli. J
Bacteriol 183(6), 2145-2147 (2001).
210. Gudipaty SA, Larsen AS, Rensing C, McEvoy MM: Regulation of Cu(I)/Ag(I) efflux
genes in Escherichia coli by the sensor kinase CusS. FEMS Microbiol Lett 330(1), 30-37
(2012).
121
211. Outten FW, Huffman DL, Hale JA, O'Halloran TV: The independent cue and cus systems
confer copper tolerance during aerobic and anaerobic growth in Escherichia coli. J Biol
Chem 276(33), 30670-30677 (2001).
212. Rensing C, Fan B, Sharma R, Mitra B, Rosen BP: CopA: An Escherichia coli Cu(I)-
translocating P-type ATPase. Proc Natl Acad Sci U S A 97(2), 652-656 (2000).
213. Yamamoto K, Ishihama A: Transcriptional response of Escherichia coli to external
copper. Mol Microbiol 56(1), 215-227 (2005).
214. Munson GP, Lam DL, Outten FW, O'Halloran TV: Identification of a copper-responsive
two-component system on the chromosome of Escherichia coli K-12. J Bacteriol
182(20), 5864-5871 (2000).
215. Schelder S, Zaade D, Litsanov B, Bott M, Brocker M: The two-component signal
transduction system CopRS of Corynebacterium glutamicum is required for adaptation to
copper-excess stress. PLoS ONE 6(7), e22143 (2011).
216. Giner-Lamia J, López-Maury L, Reyes JC, Florencio FJ: The CopRS two-component
system is responsible for resistance to copper in the cyanobacterium Synechocystis sp.
PCC 6803. Plant Physiol 159(4), 1806-1818 (2012).
217. Yamamoto K, Ishihama A: Characterization of copper-inducible promoters regulated by
CpxA/CpxR in Escherichia coli. Biosci Biotechnol Biochem 70(7), 1688-1695 (2006).
218. Ge Z, Taylor DE: Helicobacter pylori genes hpcopA and hpcopP constitute a cop operon
involved in copper export. FEMS Microbiol Lett 145(2), 181-188 (1996).
219. Waidner B, Melchers K, Stähler FN, Kist M, Bereswill S: The Helicobacter pylori
CrdRS two-component regulation system (HP1364/HP1365) is required for copper-
mediated induction of the copper resistance determinant CrdA. J Bacteriol 187(13),
4683-4688 (2005).
122
220. Rouch DA, Brown NL: Copper-inducible transcriptional regulation at two promoters in
the Escherichia coli copper resistance determinant pco. Microbiology 143(4), 1191-1202
(1997).
221. Mills SD, Jasalavich CA, Cooksey DA: A two-component regulatory system required for
copper-inducible expression of the copper resistance operon of Pseudomonas syringae. J
Bacteriol 175(6), 1656-1664 (1993).
222. Mellano MA, Cooksey DA: Induction of the copper resistance operon from Pseudomonas
syringae. J Bacteriol 170(9), 4399-4401 (1988).
223. Mellano MA, Cooksey DA: Nucleotide sequence and organization of copper resistance
genes from Pseudomonas syringae pv. tomato. J Bacteriol 170(6), 2879-2883 (1988).
224. Mills S, Lim C-K, Cooksey D: Purification and characterization of CopR, a
transcriptional activator protein that binds to a conserved domain (cop box) in copper-
inducible promoters of Pseudomonas syringae. Mol Gen Genet 244(4), 341-351 (1994).
225. Hu Y-h, Wang H-l, Zhang M, Sun L: Molecular analysis of the copper-responsive
CopRSCD of a pathogenic Pseudomonas fluorescens strain. J Microbiol 47(3), 277-286
(2009).
226. Zhang X-X, Rainey PB: Regulation of copper homeostasis in Pseudomonas fluorescens
SBW25. Environ Microbiol 10(12), 3284-3294 (2008).
227. Silver S: Bacterial silver resistance: molecular biology and uses and misuses of silver
compounds. FEMS Microbiol Rev 27(2-3), 341-353 (2003).
228. Galdiero S, Falanga A, Vitiello M, Cantisani M, Marra V, Galdiero M: Silver
Nanoparticles as Potential Antiviral Agents. Molecules 16(10), 8894-8918 (2011).
229. Borgstahl GEO, Pokross M, Chehab R, Sekher A, Snell EH: Cryo-trapping the six-
coordinate, distorted-octahedral active site of manganese superoxide dismutase. J Mol
Biol 296(4), 951-959 (2000).
123
230. Barynin VV, Whittaker MM, Antonyuk SV et al.: Crystal structure of manganese
catalase from Lactobacillus plantarum. Structure 9(8), 725-738 (2001).
231. Bencini A FP, Valtancoli B, Bani D.: Low molecular weight compounds with transition
metals as free radical scavengers and novel therapeutic agents. Cardiovasc Hematol
Agents Med Chem 8(3), 128-146 (2010 ).
232. Que Q, Helmann JD: Manganese homeostasis in Bacillus subtilis is regulated by MntR, a
bifunctional regulator related to the diphtheria toxin repressor family of proteins. Mol
Microbiol 35(6), 1454-1468 (2000).
233. Corstjens PL, de Vrind JP, Westbroek P, de Vrind-de Jong EW: Enzymatic iron oxidation
by Leptothrix discophora: identification of an iron-oxidizing protein. Appl Environ
Microbiol 58(2), 450-454 (1992).
234. Geszvain K, Tebo BM: Identification of a two-component regulatory pathway essential
for Mn(II) oxidation in Pseudomonas putida GB-1. Appl Environ Microbiol 76(4), 1224-
1231 (2010).
235. Yachandra V, DeRose V, Latimer M, Mukerji I, Sauer K, Klein M: Where plants make
oxygen: a structural model for the photosynthetic oxygen-evolving manganese cluster.
Science 260(5108), 675-679 (1993).
236. Bartsevich VV, Pakrasi HB: Manganese transport in the cyanobacterium Synechocystis
sp. PCC 6803. J Biol Chem 271(42), 26057-26061 (1996).
237. Ogawa T, Bao DH, Katoh H, Shibata M, Pakrasi HB, Bhattacharyya-Pakrasi M: A two-
component signal transduction pathway regulates manganese homeostasis in
Synechocystis 6803, a photosynthetic organism. J Biol Chem 277(32), 28981-28986
(2002).
238. Yamaguchi K, Suzuki I, Yamamoto H et al.: A two-component Mn2+-sensing system
negatively regulates expression of the mntCAB operon in Synechocystis. Plant Cell
14(11), 2901-2913 (2002).
124
239. Missiakas D, Raina S: Signal transduction pathways in response to protein misfolding in
the extracytoplasmic compartments of E. coli: role of two new phosphoprotein
phosphatases PrpA and PrpB. EMBO J 16(7), 1670-1685 (1997).
240. Lucana DOdO, Zou P, Nierhaus M, Schrempf H: Identification of a novel two-
component system SenS/SenR modulating the production of the catalase-peroxidase
CpeB and the haem-binding protein HbpS in Streptomyces reticuli. Microbiology
151(11), 3603-3614 (2005).
241. Jakubovics NS, Jenkinson HF: Out of the iron age: new insights into the critical role of
manganese homeostasis in bacteria. Microbiology 147(7), 1709-1718 (2001).
242. Pang X, Cao G, Neuenschwander PF, Haydel SE, Hou G, Howard ST: The β-propeller
gene Rv1057 of Mycobacterium tuberculosis has a complex promoter directly regulated
by both the MprAB and TrcRS two-component systems. Tuberculosis (Edinb) 91, S142-
S149 (2011).
243. Haydel SE, Dunlap NE, Benjamin Jr WH: In vitro evidence of two-component system
phosphorylation between the Mycobacterium tuberculosis TrcR/TrcS proteins. Microb
Pathog 26(4), 195-206 (1999).
244. Haydel SE, Clark-Curtiss JE: The Mycobacterium tuberculosis response regulator
represses transcription of the intracellularly expressed rv1057 gene, encoding a seven-
bladed β-propeller. J Bacteriol 188(1), 150-159 (2006).
245. Loesche WJ: Role of Streptococcus mutans in human dental decay. Microbiol. Mol. Biol.
Rev. 50(4), 353-380 (1986).
246. Rowley G, Spector M, Kormanec J, Roberts M: Pushing the envelope: extracytoplasmic
stress responses in bacterial pathogens. Nat Rev Micro 4(5), 383-394 (2006).
247. Leblanc SKD, Oates CW, Raivio TL: Characterization of theinduction and cellular role
of the BaeSR two-component envelope stress response of Escherichia coli. J Bacteriol
193(13), 3367-3375 (2011).
125
248. Wang D, Fierke CA: The BaeSR regulon is involved in defense against zinc toxicity in E.
coli. Metallomics 5(4), 372-383 (2013).
249. Appia-Ayme C, Patrick E, J. Sullivan M et al.: Novel inducers of the envelope stress
response BaeSR in Salmonella typhimurium: BaeR is critically required for tungstate
waste disposal. PLoS ONE 6(8), e23713 (2011).
250. Zoetendal EG, Smith AH, Sundset MA, Mackie RI: The BaeSR two-component
regulatory system mediates resistance to condensed tannins in Escherichia coli. Appl
Environ Microbiol 74(2), 535-539 (2008).
251. Ogasawara H, Shinohara S, Yamamoto K, Ishihama A: Novel regulation targets of the
metal-response BasS–BasR two-component system of Escherichia coli. Microbiology
158(Pt 6), 1482-1492 (2012).
252. Hagenmaier S, Stierhof YD, Henning U: A new periplasmic protein of Escherichia coli
which is synthesized in spheroplasts but not in intact cells. J Bacteriol 179(6), 2073-2076
(1997).
253. Nishino K, Nikaido E, Yamaguchi A: Regulation of multidrug efflux systems involved in
multidrug and metal resistance of Salmonella enterica serovar typhimurium. J Bacteriol
189(24), 9066-9075 (2007).
254. Leonhartsberger S, Huber A, Lottspeich F, Böck A: The hydH/G genes from Escherichia
coli code for a zinc and lead responsive two-component regulatory system. J Mol Biol
307(1), 93-105 (2001).
255. Appia Ayme C, Hall A, Patrick E, Rajadurai S, Clarke TA, Rowley G: ZraP is a
periplasmic molecular chaperone and a repressor of the zinc-responsive two-component
regulator ZraSR. Biochem J 442(1), 85-93 (2012).
256. Hassan M-e-T, van der Lelie D, Springael D, Römling U, Ahmed N, Mergeay M:
Identification of a gene cluster, czr, involved in cadmium and zinc resistance in
Pseudomonas aeruginosa. Gene 238(2), 417-425 (1999).
126
257. Rensing C, Pribyl T, Nies DH: New functions for the three subunits of the CzcCBA
cation-proton antiporter. J Bacteriol 179(22), 6871-6879 (1997).
258. Dieppois G, Ducret V, Caille O, Perron K: The transcriptional regulator CzcR modulates
antibiotic resistance and quorum sensing in Pseudomonas aeruginosa. PLoS ONE 7(5),
e38148 (2012).
259. Caille O, Rossier C, Perron K: A copper-activated two-component system interacts with
zinc and imipenem resistance in Pseudomonas aeruginosa. J Bacteriol 189(13), 4561-
4568 (2007).
260. Mulrooney SB, Hausinger RP: Nickel uptake and utilization by microorganisms. FEMS
Microbiol Rev 27(2-3), 239-261 (2003).
261. Ragsdale SW: Nickel-based enzyme systems. J Biol Chem 284(28), 18571-18575 (2009).
262. Costa M, Sutherlandurname J, Peng W, Salnikow K, Broday L, Kluz T: Molecular
biology of nickel carcinogenesis. Mol Cell Biochem 222(1-2), 205-211 (2001).
263. Von Burg R: Nickel and some nickel compounds. J Appl Toxicol 17(6), 425-431 (1997).
264. Fontecilla-Camps JC, Volbeda A, Cavazza C, Nicolet Y: Structure/function relationships
of [Ni-Fe] and [Fe-Fe] hydrogenases. Chem Rev 107(10), 4273-4303 (2007).
265. Maroney MJ: Structure/function relationships in nickel metallobiochemistry. Curr Opin
Chem Biol 3(2), 188-199 (1999).
266. Dosanjh NS, Michel SLJ: Microbial nickel metalloregulation: NikRs for nickel ions.
Curr Opin Chem Biol 10(2), 123-130 (2006).
267. Eitinger T, Mandrand-Berthelot MA: Nickel transport systems in microorganisms. Arch
Microbiol 173(1), 1-9 (2000).
268. Nies DH: Efflux-mediated heavy metal resistance in prokaryotes. FEMS Microbiol Rev
27(2-3), 313-339 (2003).
127
269. Navarro C, Wu L-F, Mandrand-Berthelot M-A: The nik operon of Escherichia coli
encodes a periplasmic binding-protein-dependent transport system for nickel. Mol
Microbiol 9(6), 1181-1191 (1993).
270. Wu LF, Mandrand-Berthelot MA, Waugh R, Edmonds CJ, Holt SE, Boxer DH: Nickel
deficiency gives rise to the defective hydrogenase phenotype of hydc and fnr mutants in
Escherichia coli. Mol Microbiol 3(12), 1709-1718 (1989).
271. Chivers PT, Sauer RT: Regulation of high affinity nickel uptake in bacteria: Ni2+-
dependent interaction of NikR with wild-type and mutant operator sites. J Biol Chem
275(26), 19735-19741 (2000).
272. De Pina K, Desjardin V, Mandrand-Berthelot M-A, Giordano G, Wu L-F: Isolation and
characterization of the nikR gene encoding a nickel-responsive regulator in Escherichia
coli. J Bacteriol 181(2), 670-674 (1999).
273. Rowe JL, Starnes GL, Chivers PT: Complex transcriptional control links NikABCDE-
dependent nickel transport with hydrogenase expression in Escherichia coli. J Bacteriol
187(18), 6317-6323 (2005).
274. López-Maury L, García-Domínguez M, Florencio FJ, Reyes JC: A two-component signal
transduction system involved in nickel sensing in the cyanobacterium Synechocystis sp.
PCC 6803. Mol Microbiol 43(1), 247-256 (2002).
275. Foster AW, Patterson CJ, Pernil R, Hess CR, Robinson NJ: Cytosolic Ni(II) Sensor in
Cyanobacterium: Nickel detection follows nickel affinity across four families of metal
sensors. J Biol Chem 287(15), 12142-12151 (2012).
276. Bouzat J, Hoostal M: Evolutionary analysis and lateral gene transfer of two-component
regulatory systems associated with heavy-metal tolerance in bacteria. J Mol Evol 76(5),
267-279 (2013).
128
277. Ridge PG, Zhang Y, Gladyshev VN: Comparative genomic analyses of copper
transporters and cuproproteomes reveal evolutionary dynamics of copper utilization and
its link to oxygen. PLoS ONE 3(1), e1378 (2008).
278. Macomber L, Imlay JA: The iron-sulfur clusters of dehydratases are primary intracellular
targets of copper toxicity. Proc Natl Acad Sci U S A 106(20), 8344-8349 (2009).
279. Mitrakul K, Loo CY, Hughes CV, Ganeshkumar N: Role of a Streptococcus gordonii
copper-transport operon, copYAZ, in biofilm detachment. Oral Microbiol Immunol 19(6),
395-402 (2004).
280. Chen P-M, Chen J-Y, Chia J-S: Differential regulation of Streptococcus mutans gtfBCD
genes in response to copper ions. Arch Microbiol 185(2), 127-135 (2006).
281. Dunning JC, Ma Y, Marquis RE: Anaerobic killing of oral streptococci by reduced,
transition metal cations. Appl Environ Microbiol 64(1), 27-33 (1998).
282. Arredondo M, Núñez MT: Iron and copper metabolism. Mol Aspects Med 26(4–5), 313-
327 (2005).
283. Warnes SL, Caves V, Keevil CW: Mechanism of copper surface toxicity in Escherichia
coli O157:H7 and Salmonella involves immediate membrane depolarization followed by
slower rate of DNA destruction which differs from that observed for Gram-positive
bacteria. Environ Microbiol 14(7), 1730-1743 (2012).
284. Dreizen S, Spies HA, Spies TD: The copper and cobalt levels of human saliva and dental
caries activity. J Dent Res 31(1), 137-142 (1952).
285. Grytten J, Tollefsen T, Afseth J: The effect of a combination of copper and hexetidine on
plaque formation and the amount of copper retained by dental plaque bacteria. Acta
Odontol Scand 45(6), 429-433 (1987).
286. Grytten J, Aamdal Scheie A, Afseth J: Effect of a combination of copper and hexetidine
on the acidogenicity and copper accumulation in dental plaque in vivo. Caries Res 22(6),
(1988 ).
129
287. Mahler DB: The high-copper dental amalgam alloys. J Dent Res 76(1), 537-541 (1997).
288. Afseth J, Amsbaugh SM, Monell-Torrens E et al.: Effect of copper applied topically or in
drinking water on experimental caries in rats. Caries Res 18(5), 434-439 (1984).
289. Afseth J: Some aspects of the dynamics of Cu and Zn retained in plaque as related to
their effect on plaque pH. Eur J Oral Sci 91(3), 169-174 (1983).
290. Bales CW, Freeland-Graves JH, Askey S et al.: Zinc, magnesium, copper, and protein
concentrations in human saliva: age- and sex-related differences. Am J Clin Nutr 51(3),
462-469 (1990).
291. Afseth J, Oppermann RV, Rølla G: Accumulation of Cu and Zn in human dental plaque
in vivo. Caries Res 17(4), 310-314 (1983).
292. Maltz M, Emilson C-G: Effect of copper fluoride and copper sulfate on dental plaque,
Streptococcus mutans and caries in hamsters. Eur J Oral Sci 96(5), 390-392 (1988).
293. Odermatt A, Suter H, Krapf R, Solioz M: Primary structure of two P-type ATPases
involved in copper homeostasis in Enterococcus hirae. J Biol Chem 268(17), 12775-
12779 (1993).
294. Lu ZH, Solioz M: Copper-induced proteolysis of the CopZ copper chaperone of
Enterococcus hirae. J Biol Chem 276(51), 47822-47827 (2001).
295. Page WJ, Sadoff HL: Physiological factors affecting transformation of Azotobacter
vinelandii. J Bacteriol 125(3), 1080-1087 (1976).
296. Trombe M-C: Characterization of a calcium porter of Streptococcus pneumoniae
involved in calcium regulation of growth and competence. J Gen Microbiol 139(3), 433-
439 (1993).
297. Page WJ, Doran JL: Recovery of competence in calcium-limited Azotobacter vinelandii.
J Bacteriol 146(1), 33-40 (1981).
130
298. Wenderska IB, Lukenda N, Cordova M, Magarvey N, Cvitkovitch DG, Senadheera DB:
A novel function for the competence inducing peptide, XIP, as a cell death effector of
Streptococcus mutans. FEMS Microbiol Lett 336(2), 104-112 (2012).
299. Petersen FC, Tao L, Scheie AA: DNA binding-uptake system: a link between cell-to-cell
communication and biofilm formation. J Bacteriol 187(13), 4392-4400 (2005).
300. van de Rijn I, Kessler RE: Growth characteristics of group A streptococci in a new
chemically defined medium. Infect Immun 27(2), 444-448 (1980).
301. Suntharalingam P, Senadheera MD, Mair RW, Lévesque CM, Cvitkovitch DG: The
LiaFSR system regulates the cell envelope stress response in Streptococcus mutans. J
Bacteriol 191(9), 2973-2984 (2009).
302. Lau PCY, Sung CK, Lee JH, Morrison DA, Cvitkovitch DG: PCR ligation mutagenesis
in transformable streptococci: application and efficiency. J Microbiol Methods 49(2),
193-205 (2002).
303. Biswas I, Jha JK, Fromm N: Shuttle expression plasmids for genetic studies in
Streptococcus mutans. Microbiology 154(8), 2275-2282 (2008).
304. LeBlanc DJ, Lee LN, Abu-Al-Jaibat A: Molecular, genetic, and functional analysis of the
basic replicon of pVA380-1, a plasmid of oral streptococcal origin. Plasmid 28(2), 130-
145 (1992).
305. Perry JA, Lévesque CM, Suntharaligam P et al.: Involvement of Streptococcus mutans
regulator RR11 in oxidative stress response during biofilm growth and in the
development of genetic competence. Lett Appl Microbiol 47(5), 439-444 (2008).
306. Navarrete JU, Borrok DM, Viveros M, Ellzey JT: Copper isotope fractionation during
surface adsorption and intracellular incorporation by bacteria. Geochim Cosmochim Acta
75(3), 784-799 (2011).
307. Senadheera MD, Lee AWC, Hung DCI, Spatafora GA, Goodman SD, Cvitkovitch DG:
The Streptococcus mutans vicX gene product modulates gtfB/C expression, biofilm
131
formation, genetic competence, and oxidative stress tolerance. J Bacteriol 189(4), 1451-
1458 (2007).
308. Pfaffl MW: A new mathematical model for relative quantification in real-time RT–PCR.
Nucleic Acids Res 29(9), e45 (2001).
309. Pfaffl MW, Horgan GW, Dempfle L: Relative expression software tool (REST©) for
group-wise comparison and statistical analysis of relative expression results in real-time
PCR. Nucleic Acids Res 30(9), e36 (2002).
310. Fujiwara S, Kobayashi S, Nakayama H: Development of a minimal medium for
Streptococcus mutans. Arch Oral Biol 23(7), 601-602 (1978).
311. Hanna MN, Ferguson RJ, Li Y-H, Cvitkovitch DG: uvrA is an acid-inducible gene
involved in the adaptive response to low pH in Streptococcus mutans. J Bacteriol
183(20), 5964-5973 (2001).
312. Baker J, Sitthisak S, Sengupta M, Johnson M, Jayaswal RK, Morrissey JA: Copper stress
induces a global stress response in Staphylococcus aureus and represses sae and agr
expression and biofilm formation. Appl Environ Microbiol 76(1), 150-160 (2010).
313. Kershaw CJ, Brown NL, Constantinidou C, Patel MD, Hobman JL: The expression
profile of Escherichia coli K-12 in response to minimal, optimal and excess copper
concentrations. Microbiology 151(4), 1187-1198 (2005).
314. Teitzel GM, Geddie A, De Long SK, Kirisits MJ, Whiteley M, Parsek MR: Survival and
growth in the presence of elevated copper: transcriptional profiling of copper-stressed
Pseudomonas aeruginosa. J Bacteriol 188(20), 7242-7256 (2006).
315. Shafeeq S, Yesilkaya H, Kloosterman TG et al.: The cop operon is required for copper
homeostasis and contributes to virulence in Streptococcus pneumoniae. Mol Microbiol
81(5), 1255-1270 (2011).
316. Magnani D, Barré O, Gerber SD, Solioz M: Characterization of the CopR regulon of
Lactococcus lactis IL1403. J Bacteriol 190(2), 536-545 (2008).
132
317. Coelho Abrantes M, Lopes MdF, Kok J: Impact of manganese, copper and zinc ions on
the transcriptome of the nosocomial pathogen Enterococcus faecalis V583. PLoS ONE
6(10), e26519 (2011).
318. Rensing C, Grass G: Escherichia coli mechanisms of copper homeostasis in a changing
environment. FEMS Microbiol Rev 27(2-3), 197-213 (2003).
319. Cooksey DA: Copper uptake and resistance in bacteria. Mol Microbiol 7(1), 1-5 (1993).
320. Helbig K, Bleuel C, Krauss GJ, Nies DH: Glutathione and transition-metal homeostasis
in Escherichia coli. J Bacteriol 190(15), 5431-5438 (2008).
321. Fujishima K, Kawada-Matsuo M, Oogai Y, Tokuda M, Torii M, Komatsuzawa H: dpr
and sod in Streptococcus mutans are involved in coexistence with S. sanguinis, and PerR
is associated with resistance to H2O2. Appl Environ Microbiol 79(5), 1436-1443 (2013).
322. Yamamoto Y, Higuchi M, Poole LB, Kamio Y: Role of the dpr product in oxygen
tolerance in Streptococcus mutans. J Bacteriol 182(13), 3740-3747 (2000).
323. Yamamoto Y, Poole LB, Hantgan RR, Kamio Y: An iron-binding protein, Dpr, from
Streptococcus mutans prevents iron-dependent hydroxyl radical formation in vitro. J
Bacteriol 184(11), 2931-2939 (2002).
324. Nakayama K: Nucleotide sequence of Streptococcus mutans superoxide dismutase gene
and isolation of insertion mutants. J Bacteriol 174(15), 4928-4934 (1992).
325. Strahl H, Hamoen LW: Membrane potential is important for bacterial cell division. Proc
Natl Acad Sci U S A 107(27), 12281-12286 (2010).
326. Bakker EP, Mangerich WE: Interconversion of components of the bacterial proton
motive force by electrogenic potassium transport. J Bacteriol 147(3), 820-826 (1981).
327. Beveridge TJ, Murray RG: Sites of metal deposition in the cell wall of Bacillus subtilis. J
Bacteriol 141(2), 876-887 (1980).
133
328. Beveridge TJ, Forsberg CW, Doyle RJ: Major sites of metal binding in Bacillus
licheniformis walls. J Bacteriol 150(3), 1438-1448 (1982).
329. Li F, Feterl M, Warner JM, Keene FR, Collins JG: Dinuclear polypyridylruthenium(II)
complexes: flow cytometry studies of their accumulation in bacteria and the effect on the
bacterial membrane. J Antimicrob Chemother 68(12), 2825-2833 (2013).
330. Meng Y-L, Liu Z, Rosen BP: As(III) and Sb(III) uptake by GlpF and efflux by ArsB in
Escherichia coli. J Biol Chem 279(18), 18334-18341 (2004).
331. Barak I, Muchova K: The role of lipid domains in bacterial cell processes. Int J Mol Sci
14(2), 4050-4065 (2013).
332. Busch KB, Deckers-Hebestreit G, Hanke GT, Mulkidjanian AY: Dynamics of
bioenergetic microcompartments. Biol Chem 394(2), 163-188 (2013).
333. Ramamurthi KS, Losick R: Negative membrane curvature as a cue for subcellular
localization of a bacterial protein. Proc Natl Acad Sci U S A 106(32), 13541-13545
(2009).
334. Marquis RE: Oxygen metabolism, oxidative stress and acid-base physiology of dental
plaque biofilms. J Ind Microbiol 15(3), 198-207 (1995).
335. Imlay JA: Pathways of oxidative damage. Annu Rev Microbiol 57(1), 395-418 (2003).
336. Dimroth P, Kaim G, Matthey U: Crucial role of the membrane potential for ATP
synthesis by F(1)F(o) ATP synthases. J Exp Biol 203(1), 51-59 (2000).
337. Schilling KM, Bowen WH: Glucans synthesized in situ in experimental salivary pellicle
function as specific binding sites for Streptococcus mutans. Infect Immun 60(1), 284-295
(1992).
338. Dintilhac A, Alloing G, Granadel C, Claverys J-P: Competence and virulence of
Streptococcus pneumoniae: Adc and PsaA mutants exhibit a requirement for Zn and Mn
134
resulting from inactivation of putative ABC metal permeases. Mol Microbiol 25(4), 727-
739 (1997).
339. Dintilhac A, Claverys JP: The adc locus, which affects competence for genetic
transformation in Streptococcus pneumoniae, encodes an ABC transporter with a putative
lipoprotein homologous to a family of streptococcal adhesins. Res Microbiol 148(2), 119-
131 (1997).
340. Lemos JA, Quivey RG, Koo H, Abranches J: Streptococcus mutans: a new Gram-positive
paradigm? Microbiology 159(Pt 3), 436-445 (2013).
341. Dollwet HHA, Sorenson JRJ: Historic uses of copper compounds in medicine. Trace
Elem Med 2, 80-87 (1985).
342. Lemire JA, Harrison JJ, Turner RJ: Antimicrobial activity of metals: mechanisms,
molecular targets and applications. Nat Rev Microbiol 11(6), 371-384 (2013).
343. Santo CE, Lam EW, Elowsky CG et al.: Bacterial killing by dry metallic copper surfaces.
Appl Environ Microbiol 77(3), 794-802 (2011).
344. Santo CE, Taudte N, Nies DH, Grass G: Contribution of copper ion resistance to survival
of Escherichia coli on metallic copper surfaces. Appl Environ Microbiol 74(4), 977-986
(2008).
345. Grass G, Rensing C, Solioz M: Metallic copper as an antimicrobial surface. Appl Environ
Microbiol 77(5), 1541-1547 (2011).
346. Andreini C, Banci L, Bertini I, Rosato A: Occurrence of copper proteins through the
three domains of life: a bioinformatic approach. J Proteome Res 7(1), 209-216 (2008).
347. Argüello JM, Raimunda D, Padilla-Benavides T: Mechanisms of copper homeostasis in
bacteria. Front Cell Infect Microbiol 3, 73 (2013).
135
348. McAuliffe O, Ryan MP, Ross RP, Hill C, Breeuwer P, Abee T: Lacticin 3147, a broad-
spectrum bacteriocin which selectively dissipates the membrane potential. Appl Environ
Microbiol 64(2), 439-445 (1998).
349. Lemos JA, Burne RA: A model of efficiency: stress tolerance by Streptococcus mutans.
Microbiology 154(11), 3247-3255 (2008).
350. JA B: Virulence properties of Streptococcus mutans. Front Biosci 9, 1267-1277 (2004).
351. Argüello JM: Identification of ion-selectivity determinants in heavy-metal transport P1B-
type ATPases. J Membr Biol 195(2), 93-108 (2003).
352. Tottey S, Rich PR, Rondet SAM, Robinson NJ: Two Menkes-type ATPases supply
copper for photosynthesis in Synechocystis PCC 6803. J Biol Chem 276(23), 19999-
20004 (2001).
353. Schwan WR, Warrener P, Keunz E, Kendall Stover C, Folger KR: Mutations in the cueA
gene encoding a copper homeostasis P-type ATPase reduce the pathogenicity of
Pseudomonas aeruginosa in mice. Int J Med Microbiol 295(4), 237-242 (2005).
354. White C, Lee J, Kambe T, Fritsche K, Petris MJ: A Role for the ATP7A copper-
transporting ATPase in macrophage bactericidal activity. J Biol Chem 284(49), 33949-
33956 (2009).
355. Fu Y, Chang F-MJ, Giedroc DP: Copper transport and trafficking at the host–bacterial
pathogen interface. Acc Chem Res 47(12), 3605-3613 (2014).
356. Waldron KJ, Robinson NJ: How do bacterial cells ensure that metalloproteins get the
correct metal? Nat Rev Micro 7(1), 25-35 (2009).
357. Foster AW, Osman D, Robinson NJ: Metal preferences and metallation. J Biol Chem
289(41), 28095-28103 (2014).
136
358. Szpunar J: Advances in analytical methodology for bioinorganic speciation analysis:
metallomics, metalloproteomics and heteroatom-tagged proteomics and metabolomics.
Analyst 130(4), 442-465 (2005).
359. P D Bauer CT, D Drake, K G Taylor, and R J Doyle: Acquisition of manganous ions by
mutans group streptococci. J Bacteriol 175(3): 819–825, (1993 February).
360. Phan TN, Buckner T, Sheng J, Baldeck JD, Marquis RE: Physiologic actions of zinc
related to inhibition of acid and alkali production by oral streptococci in suspensions and
biofilms. Oral Microbiol Immunol 19(1), 31-38 (2004).
361. Wunder D, Bowen WH: Action of agents on glucosyltransferases from Streptococcus
mutans in solution and adsorbed to experimental pellicle. Arch Oral Biol 44(3), 203-214