INFECTION AND IMMUNITY, Aug. 2006, p. 4778–4792 Vol. 74, No. 80019-9567/06/$08.00�0 doi:10.1128/IAI.00067-06Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Adherent and Invasive Escherichia coli Is Associatedwith Granulomatous Colitis in Boxer Dogs

Kenneth W. Simpson,1* Belgin Dogan,1 Mark Rishniw,2 Richard E. Goldstein,1 Suzanne Klaessig,3Patrick L. McDonough,3 Alex J. German,5 Robin M. Yates,4 David G. Russell,4

Susan E. Johnson,6 Douglas E. Berg,7 Josee Harel,8 Guillaume Bruant,8Sean P. McDonough,2 and Ynte H. Schukken3

Departments of Clinical Sciences,1 Biomedical Sciences,2 Population and Diagnostic Sciences,3 and Microbiology andImmunology,4 College of Veterinary Medicine, Cornell University, Ithaca, New York; the University of Liverpool,

Liverpool, United Kingdom5; the Ohio State University, Columbus, Ohio6; Washington University,St. Louis, Missouri7; and the University of Montreal, Montreal, Canada8

Received 12 January 2006/Returned for modification 16 February 2006/Accepted 5 May 2006

The mucosa-associated microflora is increasingly considered to play a pivotal role in the pathogenesis ofinflammatory bowel disease. This study explored the possibility that an abnormal mucosal flora is involved inthe etiopathogenesis of granulomatous colitis of Boxer dogs (GCB). Colonic biopsy samples from affected dogs(n � 13) and controls (n � 38) were examined by fluorescent in situ hybridization (FISH) with a eubacterial16S rRNA probe. Culture, 16S ribosomal DNA sequencing, and histochemistry were used to guide subsequentFISH. GCB-associated Escherichia coli isolates were evaluated for their ability to invade and persist in culturedepithelial cells and macrophages as well as for serotype, phylogenetic group, genome size, overall genotype, andpresence of virulence genes. Intramucosal gram-negative coccobacilli were present in 100% of GCB samples butnot controls. Invasive bacteria hybridized with FISH probes to E. coli. Three of four GCB-associated E. coliisolates adhered to, invaded, and replicated within cultured epithelial cells. Invasion triggered a “splash”-typeresponse, was decreased by cytochalasin D, genistein, colchicine, and wortmannin, and paralleled the behaviorof the Crohn’s disease-associated strain E. coli LF 82. GCB E. coli and LF 82 were diverse in serotype andoverall genotype but similar in phylogeny (B2 and D), in virulence gene profiles (fyuA, irp1, irp2, chuA, fepC,ibeA, kpsMII, iss), in having a larger genome size than commensal E. coli, and in the presence of novelmultilocus sequence types. We conclude that GCB is associated with selective intramucosal colonization by E.coli. E. coli strains associated with GCB and Crohn’s disease have an adherent and invasive phenotype andnovel multilocus sequence types and resemble E. coli associated with extraintestinal disease in phylogeny andvirulence gene profile.

There is mounting evidence that inflammatory bowel disease(IBD) is a consequence of an overly aggressive immune re-sponse to luminal commensal bacteria in genetically suscepti-ble individuals (63, 70). Mechanistic studies of the interplaybetween the intestinal mucosa and bacteria in rodents withengineered susceptibility, e.g., interleukin 10-negative (IL-10�/�) and IL-2�/� mice and HLA-B27 �2-microglobulintransgenic rats, indicate that the enteric microflora is requiredfor inflammation, with inflammation being observed in con-ventional housing but not under germfree conditions (59, 72,73). In these models, bacterial species regarded as part of thenormal intestinal flora, such as Bacteroides and members of thefamily Enterobacteriaceae, including E. coli, have been associ-ated with inflammation (39, 59, 70, 72).

Evidence implicating the resident enteric microflora in thepathogenesis of spontaneous IBD in people is provided by theincreased immune responses to enteric commensal bacteriaobserved in both Crohn’s disease (CD) and ulcerative colitis(UC) (1, 24, 45, 52, 54), the clinical responses of CD and UCto antimicrobials (9, 10, 48, 58, 70) and the response of CD to

fecal stream diversion (68). The discovery of genetic defects inthe microflora-sensing ability of patients with CD and UC,such as NOD2/CARD15 and TLR-4, respectively, providesmechanisms to explain individual susceptibility to the residentmicroflora (33, 46). Insights into the bacterial factors that maydrive the inflammatory response are provided by 16S ribo-somal DNA (rDNA) sequencing and fluorescent in situ hybrid-ization (FISH), which reveal increased numbers, but decreaseddiversity, of the mucosa-associated bacteria in patients withIBD (40, 60, 76). Disease-specific increases in colonization andinvasion by the gamma subdivision of Proteobacteria, Entero-bacteriaceae, and Bacteroides/Prevotella were found in CD, andthese bacteria plus Clostridium spp., high-G�C gram-positivebacteria, and sulfate-reducing bacteria were found in UC (40).These observations are complemented by culture-based re-ports documenting a higher prevalence of mucosa-associatedE. coli, which adheres to and invades cultured cells but lacksthe invasive virulence genes of diarrheagenic strains, in CDthan in UC and normal tissue (17, 18, 49). These findings helpto link experimental and clinical observations and support abroad hypothesis that idiopathic inflammatory bowel disease iscaused by an overly aggressive immune response to luminalcommensal bacteria in genetically susceptible individuals (63,70). However, this hypothesis has to be reconciled with studiesreporting the association of a diverse spectrum of pathogenic

* Corresponding author. Mailing address: VMC2001, Departmentof Clinical Sciences, College of Veterinary Medicine, Cornell Univer-sity, Ithaca, NY 14853. Phone: (607) 253-3251. Fax: (607) 253-3497.E-mail: kws5@cornell.edu.

4778

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

bacteria, including Mycobacterium avium subsp. paratuberculo-sis, Listeria, Streptococcus, Enterococcus, Enterobacteriaceae,Bacteroides, Clostridium, and Yersinia spp., with IBD andshould be rigorously tested in spontaneous idiopathic IBD (8,11, 16, 43, 44, 48).

It is against this background that we sought to examine therole of the mucosa-associated flora in granulomatous colitis ofBoxer dogs (GCB: also known as histiocytic ulcerative colitis),a severe disease of unknown etiology that typically affectsBoxer dogs under four years of age and is characterized byfrequent bloody mucoid stools, thickening and ulceration ofthe colon, anemia, hypoalbuminemia, and weight loss (80).The dominant histological features are loss of colonic epithe-lium and goblet cells and the accumulation of large numbers ofperiodic acid-Schiff stain (PAS)-positive macrophages (20, 25,77, 80). Immunopathological studies describe an increase inimmunoglobulin G3 (IgG3) and IgG4 plasma cells, CD3 Tcells, and L1- and major histocompatibility complex II-positivecells (25). Several studies have described bacteria within themucosa of affected dogs, but known enteropathogens such asSalmonella, Campylobacter Yersinia, and Shigella have not beenisolated (28, 32, 78, 80). Ultrastructural studies suggest activephagocytosis of bacteria that in some instances resemble Chla-mydia (78). An attempt to reproduce colitis in Boxer dogs withMycoplasma isolated from the colon and regional lymph nodesof four affected dogs was unsuccessful (6). The predilection forBoxer dogs, with only sporadic cases of this type of colitisreported in non-Boxer dogs, and the absence of a causal in-fectious agent have led to GCB being considered a breed-specific, immune-mediated disease of unknown etiology (25,75). However, a favorable outcome has been described in dogsreceiving antibiotics such as chloramphenicol (80), and recentreports describe clinical responses to antibiotic regimens con-taining fluoroquinolones (19, 32) that have also been effectivein some patients with Crohn’s colitis and ileocolitis (10, 70).Thus, GCB represents a spontaneous idiopathic inflammatorybowel disease with features in common with ulcerative colitis(macroscopic appearance, regional distribution, immunopa-thology), Crohn’s disease (granulomatous inflammation, bac-teria within macrophages, response to fluoroquinolones) andWhipple’s disease (PAS-positive macrophages, bacteria withinmacrophages), but it is not identical to any one of these dis-eases (20, 25, 77, 80).

The present study directly explored the possibility that anuncharacterized infectious agent such as Trophyrema whipplei(20, 66) or an abnormal mucosa-associated flora is involved inthe etiopathogenesis of granulomatous colitis of Boxer dogs(GCB). A combination of 16S rDNA sequencing and fluores-cence in situ hybridization revealed selective intramucosal col-onization of GCB biopsy samples by Escherichia coli. E. coliisolated from the colonic mucosa of affected dogs adhered to,invaded, and persisted in cultured epithelial cells to the samedegree as the Crohn’s disease-associated strain E. coli LF 82.Invasion of cultured epithelial cells by GCB isolates and LF 82is consistent with triggered endocytosis and involves the hostcytoskeleton and signaling pathways. We determined thatGCB-associated E. coli and LF 82 are more similar in phylog-eny and virulence gene profiles to extraintestinal pathogenic E.coli than diarrheagenic E. coli. Our findings support the thesisthat IBD is a consequence of mucosal colonization by a re-

stricted subset of the luminal microflora in a susceptible indi-vidual and point to the association of E. coli that resemblesextraintestinal pathogenic strains in genotype with chronic in-testinal inflammation.

MATERIALS AND METHODS

Patients, controls, and histopathology. Formalin-fixed paraffin-embedded co-lonic biopsy samples from 13 Boxer dogs with a diagnosis of granulomatouscolitis (age, 1 to 5 years [median, 1.5 years]; 10 females, 3 males) and controltissues from 27 dogs with other forms of colitis (non-GCB; 7 months to 13 years[median, 5 years]; 10 females, 17 males; 5 Boxers, 4 mongrels, 2 German Shep-herd Dogs, 2 Border Collies, 2 Doberman Pinschers, and 12 other breeds), and11 dogs without colonic inflammation (6 months to 11 years [median, approxi-mately 5 years]; 3 females, 8 males: 5 mongrels, 2 German Shepherd Dogs, and4 other breeds) were sectioned (5 �m), stained with hematoxylin and eosin(H&E) and PAS, and examined by a pathologist (S.P.M.) who was blinded to theorigin of the section.

All GCB sections were characterized by the loss of colonic glands, mucosalerosion and ulceration, and the presence of PAS� macrophages (Fig. 1). In thenon-GCB group, colitis was predominantly lymphoplasmacytic (26/27 dogs; 1Irish Setter had eosinophilic colitis), and nonulcerative (24/27 dogs), with PAS-positive macrophages absent or rarely detected. The severity of colitis in thenon-GCB group, determined by the presence of ulcers or erosions, architecturalchanges such as glandular atrophy or dysplasia, alterations in goblet cells, andincreases in cellularity, ranged from severe (n � 2) through moderate (n � 13)to mild (n � 12) (67). Aphthous ulcers were observed in two dogs with mildcolitis (one rough Collie, one German Shepherd Dog). Mucosal ulceration wasonly observed in biopsy samples of a 13-year-old Cocker Spaniel with severecolitis.

Fresh colonic tissue was obtained from an additional two Boxer dogs (12- to13-month-old spayed females with a 9- to 10-month history of bloody diarrheaand tenesmus) during diagnostic endoscopy. Fecal analysis was negative forendoparasites, Giardia, Campylobacter, Salmonella, Yersinia, and Shigella. Thediarrhea was unresponsive to dietary modification and metronidazole in bothdogs. Additional treatment with sulfasalazine and tylosin in one dog and enro-floxacin in the other produced no response. Both dogs had mild microcyticanemia (hematocrit, 36 and 37%; normal, 40 to 48%) and a mean corpuscularvolume of 57 and 61fl (normal, 63 to 73 fl), and one dog had a low serum ironand iron saturation suggestive of iron deficiency anemia. Abdominal ultrasoundrevealed mesenteric lymphadenopathy in one dog and a thickened colon in theother. Colonoscopy (Fig. 1A) showed irregular thickened ulcerated mucosa inboth dogs. Colonic biopsy samples were collected into sterile tubes for microbialculture and DNA extraction and into formal saline for histopathology and in situhybridization. Histopathological findings in both dogs were consistent with GCB.

One dog showed a dramatic clinical response to enrofloxacin (9 mg/kg of bodyweight orally [p.o.] once daily [SID] for 30 days and then 6 mg/kg p.o. SID for 14days and 3 mg/kg p.o. SID for 7 days), with resolution of diarrhea and clinico-pathological abnormalities and with an increase in body weight (�2 kg). Afollow-up colonoscopy was performed 5 months after the initial procedure, 3months after the end of antibiotic treatment.

FISH and immunohistochemistry. Formalin-fixed paraffin-embedded histo-logical sections (4 �m) (15 GCB, 27 non-GCB colitis, and 11 normal samples)were mounted on Probe-On Plus slides (Fisher Scientific, Pittsburgh, Pa.) andevaluated by FISH with a eubacterial probe (EUB-338; GCTGCCTCCCGTAGGAGT) as previously described (65). Briefly, paraffin-embedded biopsy speci-mens were deparaffinized by passage through xylene (three times, 20 min each),100% alcohol (20 min), 95% ethanol (20 min) and finally 70% ethanol (20 min).The slides were air-dried. FISH probes 5� labeled with Cy3 or 6-FAM (Inte-grated DNA Technologies, Coralville, IA) were reconstituted with sterile waterand then diluted to a working concentration of 5 ng �l�1 with hybridizationbuffer (20 mM Tris-HCl, 0.1% sodium dodecyl sulfate [SDS], 0.9% NaCl [pH7.2]). The sections were allowed to hybridize with 30 �l of DNA probe mix in ahybridization chamber at 46°C for 4 h. Slides were washed in wash buffer (hy-bridization buffer without SDS) at 48°C for 30 min. Hybridized samples werewashed in phosphate-buffered saline (PBS), allowed to air dry, and mounted witha ProLong antifade kit (Molecular Probes Inc., Eugene, OR). Sections wereexamined on an Axioskop 2 (Carl Zeiss Inc., Thornwood, NY) or a BX51(Olympus America, Melville, NY) epifluorescence microscope, and images werecaptured with a Zeiss Axiocam or Olympus DP-7 camera, respectively.

Slides spotted with suspensions of cultured E. coli DH5�, Shigella sonnei(ATCC 25931), Salmonella enterica serovar Typhimurium (ATCC 14028), and

VOL. 74, 2006 E. COLI AND GRANULOMATOUS COLITIS 4779

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

clinical isolates of Yersinia enterocolitica, Proteus vulgaris, Klebsiella pneumoniae,Bacteroides fragilis, Pseudomonas aeruginosa, Enterococcus faecium, Streptococcusequi, Streptococcus bovis, Clostridium perfringens, Clostridium difficile, Lactobacil-lus plantarum, Listeria monocytogenes, and Helicobacter pylori were used to con-trol probe specificity. Probe specificity was additionally evaluated using tissuesections and bacteria treated with RNase and using the irrelevant probe non-EUB-338 (ACTCCTACGGGAGGCAGC).

Colonic sections with evidence of bacterial invasion on eubacterial FISH weresubsequently evaluated by Gram, Ziehl-Nielsen, and Steiner stains and FISHprobes directed against a subset of the Enterobacteriaceae (E. coli, Shigella,Salmonella, and Klebsiella; E. coli 1531 23S rRNA, CATGAATCACAAAGTGGTAAGCGCC) (64) and E. coli/Shigella (E. coli 16S rRNA, GCAAAGGTATTAACTTTACTCCC) (34).

To aid localization of bacteria within the mucosa, representative sections werestained with a monoclonal antibody to vimentin (clone-V9 [Sigma], 1:50 with2.5% bovine serum albumin [BSA] in PBS, 1 h) after the fluorescent in situhybridization procedure. Incubation with the primary antibody was followed bywashing (three times, 10 min each, in PBS), incubation with secondary antibodies(chicken anti-mouse immunoglobulin, Alexafluor488 [Molecular Probes]; 1:50 in2.5% BSA in PBS for 1 h), washing (three times, 10 min each, in PBS), andmounting with antifade.

Construction of 16S rRNA libraries from GCB mucosa. DNA was extractedfrom mucosal biopsy samples of two Boxer dogs with GC and from one of thesedogs after remission induced by enrofloxacin (see patient details above) using aQIAamp DNA minikit (QIAGEN Inc., Valencia, CA) according to the manu-facturer’s instructions. A 320-bp fragment of the bacterial 16S gene was ampli-fied from 5 �l of this extract using the primers 16SFa (5� GCTCAGATTGAACGCTGG), 16SFb (5� CTCAGGAYGAACGCTGG), and 16SR (5�TACTGCTGCCTCCCGTA) (30). Cycling parameters were 94°C for 3 minfollowed by 26 cycles of 94°C for 30s, 63°C for 1 min, and 72°C for 1 min. A finalextension was carried out at 72°C for 5 min. To remove potential contaminatingDNA, sterile distilled PCR water was filtered through Micron YM-100 filters(Millipore, Bedford, MA) and exposed to UV irradiation for 10 min. Gel-purified PCR amplicons were extracted using a Perfectprep gel cleanup kit(Eppendorf, Westbury, NY) according to the manufacturer’s instructions. Rep-resentative 16S rDNA libraries were established on the basis of the 16S rDNAfragments amplified from nucleic acid extracts. PCR products were cloned intoa TA cloning vector (pGEM-T Easy; Promega Corp., Madison, WI) according tothe manufacturer’s instructions. Candidate clones were screened by restrictiondigestion, with clones containing the correct-sized fragments further screened byPCR. Clones with positive PCR results were sequenced at the Cornell UniversityBioResource Center using M13 primers and an ABI 3700 automated DNAsequencer and ABI Prism BigDye terminator sequencing kits with AmpliTaqDNA polymerase (Applied Biosystems, Foster City, CA). DNA sequences ob-tained with both forward and reverse primers were proofread and then assem-bled in Editseq (DNAStar, Madison, WI). Partial 16S rDNA sequences werecompared to the sequence databases at NCBI (BLAST-n) and the RibosomalDatabase Project (RDPII: http://rdp.cme.msu.edu/), with representative se-quences of high homology imported into our database. Sequences were alignedusing the Clustal-W algorithm in MegAlign (DNAStar, Madison, WI), and datafor each biopsy were summarized as a phylogenetic tree.

Isolation of mucosa-associated bacteria. Colonic biopsy samples from 2 Boxerdogs with GC were ground in sterile saline with a sterile pestle. Half of thehomogenate was incubated in GN broth (BBL, Becton Dickinson, FranklinLakes, NJ) at 35°C overnight and then subcultured onto Levine EMB (BBL),while the remainder was directly plated onto Trypticase soy agar (5% sheepblood) (BBL), Levine EMB agar (BBL), and Columbia CNA agar (5% sheepblood) (BBL). All plates were incubated at 35°C in 6% CO2 for 18 to 24 h.Suspect bacterial colonies were then identified using a Sensititre system (Trek,Westlake, OH). Bacterial isolates were stored in glycerol broth at �70°C. DNAwas extracted from all isolates, PCR amplified with 16S primers, cloned, andsequenced, with sequences incorporated into the phylogenetic analysis of eachbiopsy.

FIG. 1. Clinical and pathological features of granulomatous colitisof Boxer dogs. A. Colonoscopy shows a diffusely thickened and ulcer-ated mucosa (arrow). B. Histologically, there is severe loss of glandularstructure and cellular infiltration (H&E; magnification, �200). C. Mu-cosal infiltration with PAS-staining foamy macrophages (inset) is adominant feature (magnification, �200).

4780 SIMPSON ET AL. INFECT. IMMUN.

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

Evaluation of adhesion and invasion by GCB-associated E. coli in culturedcells. (i) Bacterial strains and culture. E. coli strains isolated from GCB mucosawere evaluated for their ability to adhere to, invade, and persist within culturedepithelial cells. E. coli strain LF 82, isolated from a chronic ileal lesion of apatient with CD (kindly provided by A. Darfeuille-Michaud) (17), and Salmo-nella enterica serovar Typhimurium (ATCC 14028) were used as positive con-trols. E. coli DH5�, a nonpathogenic strain, was used as a negative control.Bacterial isolates were stored at �80°C, and fresh nonpassaged bacteria wereused for all investigations. E. coli and S. enterica serovar Typhimurium werestreaked on Luria-Bertani (LB) agar, and a single colony was inoculated into LBbroth. Cells were grown overnight at 37°C without shaking. Type 1 pilus expres-sion was confirmed by mannose-sensitive agglutination of 1% commercial bak-er’s yeast (Saccharomyces cerevisiae) suspended in phosphate-buffered saline(PBS).

(ii) Cell culture. It has been shown previously that human CD-associated E.coli strains are able to efficiently invade a wide variety of epithelial cell lines,including Caco-2, Intestine-407, HCT-8, and HEp-2 (5, 16). Preliminary studiesin our laboratory with strain LF 82 and Salmonella enterica serovar Typhimuriumconfirmed adhesion and invasion of cultured Caco-2 (kindly provided by AndreaQuaroni) and Hep2 (ATCC CCL-23) cells. Strain LF 82 and Salmonella entericaserovar Typhimurium also displayed adherent and invasive behavior with cells ofthe bovine mammary epithelial cell line MAC-T (Nexia Biotechnologies Inc.,Montreal, QC, Canada).

Monolayers of all cell lines were kept at 37°C in 5% CO2–95% air (vol/vol)using Dulbecco’s modified Eagle’s medium (DMEM; Sigma-Aldrich, St. Louis,MO) supplemented with 10% fetal bovine serum (FBS; Gemini Bio Products,Woodland, CA) for MAC-T and Caco-2 cells. HEp-2 cells were grown in RPMI1640 (Gibco-Invitrogen, Grand Island, NY) supplemented with 10% FBS. TheFBS concentration was dropped to 5% before infection assays.

(iii) Adhesion assay. Stationary-phase bacteria were pelleted, washed withexcess phosphate-buffered saline (PBS, pH 7.4), and resuspended in PBS. Initialbacterial numbers were determined simultaneously by plate count. Confluentmonolayers of cells grown in 24-well plates (3 � 105 cells/well) were washed twicewith 1 ml/well of growth medium, and then 1 ml of fresh medium was added toeach well. Epithelial cells were infected with a multiplicity of infection (MOI) of10 bacteria per epithelial cell. After 1 h of incubation at 37C with 5% CO2, cellswere washed three times in PBS and lysed in 0.1% Triton X-100 in PBS for 10min. Lysates were serially diluted and plated on LB agar plates, and colonieswere enumerated following overnight incubation. The levels of adhesion wereexpressed as the total number of CFU recovered per well. Each assay was run induplicate and repeated at least three times.

(iv) Invasion. Invasion of MAC-T cells was evaluated by the gentamicin pro-tection assay, differential immunostaining of intra- and extra-cellular bacteria,and electron microscopy.

For the gentamicin protection assay, cells were grown in six-well plates for 2days (1.5 � 106) and infected with E. coli strains at an MOI of 10 for 1 h. Afterthe initial 1-h infection period, cells were washed three times in PBS and thenincubated for another 2 h in medium containing 100 �g/ml gentamicin to killextracellular bacteria. The MIC of gentamicin for all strains was 0.5 �g/ml. Cellswere then washed three times with PBS, lysed, and plated as described above.The levels of invasion are expressed as the total number of CFU recovered perwell. The viability of epithelial cells before and after infection was assessed bytrypan blue exclusion.

Invasion of epithelial cells was also examined using the Caco-2 and HEp-2 celllines. Caco-2 and HEp-2 cells were grown in six-well plates for 2 days (1.2 �106) and infected with E. coli strains at an MOI of 100 for 3 h. Cells were thenwashed three times with PBS and incubated for an additional 1 h in mediumcontaining 100 �g/ml gentamicin to kill extracellular bacteria. Numbers of in-tracellular bacteria and the levels of invasion were determined as describedabove.

The involvement of host cytoskeletal and signaling molecules in the invasionprocess was examined using the microfilament inhibitor cytochalasin D, themicrotubule inhibitor colchicine, the tyrosine protein kinase inhibitor genistein,and phosphoinositide 3-kinase (PI 3-kinase) inhibitor wortmannin. Stock solu-tions were prepared in dimethyl sulfoxide (DMSO), except for colchicine, whichwas prepared in distilled H2O: cytochalasin D, 1 mg/ml; colchicine, 1 mg/ml;genistein, 100 mM, and wortmannin, 0.1 mM. Prior to use, the inhibitors werediluted in DMEM supplemented with 10% fetal bovine serum. Cytochalasin D (1�g/ml) and colchicine (5 �g/ml) were added 1 h prior to addition of bacteria.Genistein (100 �M) and wortmannin (100 nM) were added 30 and 10 min beforeinfection, respectively. DMSO (0.1% final concentration) was used as a control.Cells were infected at an MOI of 100. The inhibitors and DMSO were main-tained throughout the 1-h invasion period. After the 1-h infection and a 2-h

gentamicin killing period, the numbers of intracellular bacteria were determinedas described above. Results are reported as the percentage of the number ofbacteria that were internalized in control cells with no inhibitor. The viability ofepithelial cells was determined in uninfected and infected epithelial cells in thepresence and absence of inhibitors.

(v) Differential immunostaining of extra- and intracellular E. coli. MAC-Tcells seeded and grown overnight on glass eight-well chamber slides were in-fected with E. coli at an MOI of 100. After 3 h of incubation, the cells werewashed three times in PBS and fixed with 3.7% formaldehyde for 15 min. PBScontaining 10% fetal bovine serum (FBS) was used as blocking buffer and fordilution of immunoreagents. Polyclonal rabbit anti-E. coli antibody (B65001R[Biodesign, Saco, ME]; 1:50 in PBS with 10% FBS) was used as the primaryantibody. All incubations were carried out at room temperature. For differentialimmunostaining of extra- and intracellular E. coli, the fixed cells were incubatedwith blocking buffer for 15 min to reduce nonspecific binding of antibodies.Thereafter, the monolayer was incubated with primary antibody for 1 h at roomtemperature. After washing three times for 10 min each in PBS, monolayers wereincubated in the dark with fluorescein isothiocyanate (FITC)-conjugated goatanti-rabbit IgG antibodies (F0382 [Sigma-Aldrich, St. Louis, MO]; 1:100 in PBSwith 10% FBS) for 45 min. Unbound secondary antibody was removed bywashing three times for 10 min each in PBS. Cells were permeabilized with PBScontaining 0.1% Triton X-100 for 15 min. After permeabilization, the monolay-ers were incubated with blocking buffer for 15 min and then with primaryantibody for 1 h. After washing three times for 10 min each in PBS, treatedmonolayers were incubated in the dark with tetramethyl rhodamine isothiocya-nate (TRITC)-conjugated goat anti-rabbit IgG antibodies (T677 [Sigma-Al-drich]; 1:100 in PBS with 10% FBS) for 45 min. Unbound secondary antibodywas removed by washing three times for 10 min each in PBS. Slides weremounted with ProLong antifade (Molecular Probes Inc., Eugene, OR) mixedwith DAPI (4�,6�-diamidino-2-phenylindole) and examined with an OlympusBX51 epifluorescence microscope.

(vi) Transmission electron microscopy. MAC-T cells grown on 24-mm colla-gen Transwell inserts (Costar, Corning Inc., Corning, NY) and infected at anMOI of 100 were maintained in culture for 3 h. Culture supernatants wereremoved, and cells were washed three times in culture media before being fixedin 2% glutaraldehyde in PBS, postfixed in 1% osmium tetroxide, dehydratedthrough ethanol, and embedded in Spurr’s resin. Thin sections were cut, stainedwith uranyl acetate and Reynolds’ lead, and examined in a Technai electronmicroscope.

Persistence within epithelial cells and macrophages. (i) Epithelial cells. Theinvasion assay was modified by incubating infected monolayers up to 48 h. Afterthe 1-h invasion and 2-h incubation with 100 �g/ml of gentamicin, cells werewashed once in PBS, and fresh medium containing 15 �g of gentamicin/ml wasadded to the cells. This concentration of gentamicin was used to prevent extra-cellular bacterial growth while reducing the chances of gentamicin leaching intothe host cells during longer incubation times. Numbers of intracellular bacteriawere determined at 2, 24, and 48 h as described above.

(ii) Macrophages. Macrophages derived from the bone marrow of C57BL/6mice were maintained in Dulbecco’s modified Eagle’s medium (DMEM) sup-plemented with 10% FCS, 5% horse serum, 2 mM L-glutamine, 1 mM sodiumpyruvate, and 20% L-cell conditioned media. Fully differentiated macrophageswere transferred to coverslips in 24-well plates and incubated for 12 h to allow aconfluent monolayer to establish (cell density of 4.2 � 105, in 1 ml of medium).Before infection, the cell monolayers were washed twice with PBS, and themedium was replaced with 1 ml of infection media. Macrophages were infectedat a multiplicity of infection (MOI) of 10 bacteria per macrophage, and the plateswere centrifuged at 500 � g for 5 min. After a 30-min incubation at 37°C with 5%CO2, infected macrophages were washed twice with PBS, and fresh cell culturemedium containing 100 �g of gentamicin/ml was added to kill extracellularbacteria. After incubation for an additional 2 h, the medium was removed andfresh medium containing 15 �g of gentamicin/ml was added for longer postin-fection periods. To measure intracellular survival beyond 48 h postinfection,fresh cell culture medium containing gentamicin (15 �g/ml) was added to theinfected cells. At specified time points, coverslips were washed three times withPBS, and cells were lysed in 2 ml of 0.1% Triton X-100 (Sigma-Aldrich) in PBS.Samples were removed, diluted, and plated onto LB agar plates to determine thenumber of CFU/well. The number of bacteria surviving gentamicin was deter-mined at 2, 4, 8, 24, 48, and 72 h. Survival was expressed as CFU per well, andthe mean percentage of the number of bacteria recovered after 2 h postinfectionwas defined as 100%. Each experiment was performed in triplicate and repeatedat least three times.

Molecular characterization of GCB-associated E. coli. The genetic diversity ofE. coli isolated from GCB mucosa and the Crohn’s disease isolate LF82 was

VOL. 74, 2006 E. COLI AND GRANULOMATOUS COLITIS 4781

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

evaluated by randomly amplified polymorphic DNA (RAPD)-PCR with infor-mative primers 1254, 1281, and 1283 as previously described (82).

The triplex PCR described by Clermont et al. (12) was performed to determinethe phylogenetic group (A, B1, B2, or D) of these strains, with E. coli strainsECOR-03, -25, -26, -34, -48, -50, -62 and -64 (ECOR collection: http:foodsafe.msu.edu/whittam/ecor/index.html) used as controls.

Multilocus sequence typing (MLST) for seven loci (aspC, clpX, fadD, icdA,lysP, mdh, and uidA) was performed according to the protocol established byWhittam et al. (http://www.shigatox.net/stec/mlst-new/mlst_pcr.html). Gel-puri-fied PCR amplicons were sequenced at the Cornell University BioResourceCenter using M13 primers and an ABI 3700 automated DNA sequencer and ABIPRISM BigDye terminator sequencing kits with AmpliTaq DNA polymerase(Applied Biosystems, Foster City, CA). DNA sequences obtained with bothforward and reverse primers were proofread and then assembled in Editseq(DNAStar, Madison, WI). Sequences were aligned using the Clustal-W algo-rithm in MegAlign (DNAStar, Madison WI), and the allele and the st7 andclonal groups were determined using web-based software (http://www.shigatox.net/cgi-bin/mlst7/dbquery).

Serotyping and a PCR-based screen for virulence genes of diarrheagenic E.coli (heat-labile toxin [LT], heat stable toxins [STa and STb], Shiga-like toxins[SLT-I and SLT-II], cytotoxic necrotizing factors [CNF-1 and CNF-2], and thegamma variant of the intimin-encoding gene [eae]) were performed at the Gas-troenteric Disease Center, Pennsylvania State University (College Station, PA).The presence of the ipaH gene (a marker for Shigella and enteroinvasive E. coli)in cultured isolates and colonic DNA was also determined by PCR as previouslydescribed (49).

The possibility that GCB- and CD-associated E. coli contain common andpotentially pathoadaptive alleles of the polymorphic adhesin FimH, which isassociated with invasion in uropathogenic E. coli (50, 74), was determined byPCR and sequencing. Briefly, bacterial lysates were prepared with a DNeasytissue kit according to the manufacturer’s instructions. Oligonucleotide primers(fimH-F [5�-CAG GGA ACC ATT CAG GCA GTG ATT AGC ATC-3�] andfimH-R [5�-AAT ATT GCG TAC CAG CAT TAG C-3�]) were designed fromthe published sequence for the fimH gene in E. coli K-12 strain MG1655(GenBank accession number NC_000913) using the Primer Select softwareprogram (DNAStar). PCR was performed in a Bio-Rad MyCycler automaticthermal cycler with denaturation at 96°C for 1 min, annealing at 55°C for 1 min,and extension at 72°C for 2 min, for a total of 40 cycles. PCR products werecloned, sequenced, and aligned as described above.

The genome sizes of E. coli isolated from GCB mucosa and the Crohn’sdisease isolate LF 82 were determined by pulsed-field gel electrophoresis(PFGE). Genomic DNA for PFGE was prepared in agarose plugs and cleavedwith the restriction enzyme I-CeuI. PFGE was performed with a Chef Mapper(Bio-Rad Laboratories, Hercules, CA) in 0.5� Tris-borate-EDTA buffer at 6V/cm and 14°C. Electrophoresis was carried out with switch times of 2.16 s to54.17 s for 20 h. Images were acquired with a Bio-Rad Gel Doc (Bio-RadLaboratories), and chromosomal sizes were determined with KODAK 1D imageanalysis software.

Microarray analysis of virulence determinants. A comprehensive screening ofa complete set of virulence genes of diarrheagenic and extraintestinal pathogenicE. coli strains was performed with the DNA microarray recently developed byBruant et al. (7a). This microarray was modified from a previous virulencemicroarray (2) and contains 251 oligonucleotide probes specific for 183 virulencegenes or markers representative of all known E. coli pathotypes. These probesare specific for various virulence genes, including genes encoding adhesins,toxins, hemolysins, invasins, autotransporters, capsular, flagellar, and somaticantigens, iron acquisition system or transport proteins, and outer membraneproteins, as well as genes recently shown to be associated with virulence in E. coli.Microarray experiments were performed in the laboratory of Josee Harel at theUniversity of Montreal, as described previously (7a). Briefly, DNA from E. coliisolated from GCB mucosa and E. coli strain LF-82 were fluorescently labeledwith a Cy5 dye and with a random-priming protocol derived from the InvitrogenBioprime DNA labeling system (Invitrogen Life Technologies). Microarrayswere then hybridized overnight with 500 ng of labeled DNA, in a slide hybrid-ization chamber (Corning Canada) and in the dark. After hybridization, themicroarrays were scanned with a ScanArray Lite fluorescent microarray analysissystem (Canberra-Packard Canada). All microarray hybridizations were per-formed in duplicate, with DNA obtained from two separate bacterial cultures.

Statistical analysis. The mean of duplicate wells from at least three separateexperiments was used as the input. Data from adhesion, invasion, and persistenceassays were initially examined for equal variance by Bartlett’s test. Adhesion andinvasion assays with equal variance were analyzed by one-way analysis of variance(one-way ANOVA), where the strain type was used as the ‘treatment’ variable.

Multiple pairwise comparisons were performed with Tukey’s honestly significantdifference test. Data for persistence in epithelial cells was logarithmically trans-formed prior to evaluation by a one-way ANOVA for analysis of strain. Statis-tical significance was defined at a P value of �0.05. All analyses were done withthe statistical program Statistix (Analytical Software, Tallahassee, FL).

RESULTS

Granulomatous colitis of Boxer dogs is characterized by amucosally invasive microflora. The EUB-338 FISH probe hy-bridized to all reference strains of bacteria. Sections of histo-logically normal colon had a readily staining bacterial flora thatwas restricted to the surface mucus layer and colonic glands(Fig. 2A). Bacteria were not detected within the mucosa. Con-trol slides spotted with bacteria and histological sectionstreated with RNase and the probe non-EUB-338 were negative(data not shown).

In contrast to normal colonic tissue, bacteria in GCB sam-ples were scattered throughout the upper third of the mucosa(Fig. 2B). Clumps of small coccobacilli (1 to 3 �m) were mostcommonly observed in areas where goblet cells and glandswere replaced by a cellular infiltrate. In many sections bacteriaappeared to be localized within cells (Fig. 2C). Histochemicalanalysis of GCB sections revealed intramucosal gram-negative,non-acid-fast, argyrophilic coccobacilli, mainly within histio-cytes (Fig. 2D), concurring with mucosal localization by FISH.Invasive bacteria were not visible with eubacterial FISH orGram staining in biopsy samples taken from a GCB-affecteddog 3 months after the completion of antibiotic therapy.

To determine if bacterial colonization is a general feature ofcanine colitis, we examined sections from 27 dogs with non-GCB colitis. Bacterial invasion of the mucosa was observed inonly two non-GCB samples, and in these sections the flora waspleomorphic, mixed gram positive and negative, and not cellassociated.

Culture and 16S sequencing of GCB mucosa yields predom-inantly Enterobacteriaceae. Culture of GCB mucosa from twoaffected dogs yielded Klebsiella pneumoniae, Proteus mirabilis,and E. coli. Two E. coli strains were isolated from each dog andwere identified as KD-1, KD-2, KD-3 and KD-4. Streptococcusfaecalis and Chryseobacterium meningosepticum were isolatedfrom separate individuals. Shigella, Salmonella, Campylobacter,and Yersinia were not isolated.

PCR amplification of DNA from GCB mucosa with 16Sprimers yielded amplicons of the expected size (320 bp) frompre- and posttreatment samples. Analysis of bacterial se-quences yielded a predominance of Enterobacteriaceae, partic-ularly E. coli/Shigella, in both affected dogs (Fig. 3). The post-treatment 16S rDNA library, 3 months after antibiotic-inducedremission, contained a much more diverse flora, with only 4/34clones belonging to Enterobacteriaceae (Fig. 3).

Fluorescence in situ hybridization identifies the intramuco-sal flora as E. coli or Shigella. On the basis of the results ofculture, 16S sequencing, and presence of intramucosal gram-negative bacteria, we employed FISH probes designed to hy-bridize to a subset of the Enterobacteriaceae (E. coli 1531, 23SrRNA) and E. coli/Shigella (16S rRNA). The specificity ofthese probes was confirmed with cultured bacteria, with the E.coli 1531 probe hybridizing to E. coli, Shigella, Klebsiella andSalmonella, and with the E. coli/Shigella probe to only thesespecies. Both probes hybridized with the invasive flora of GCB

4782 SIMPSON ET AL. INFECT. IMMUN.

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

specimens (Fig. 4). Culture of feces and mucosa for Shigellaand PCR of colonic mucosal DNA with primers against theipaH gene found in Shigella and enteroinvasive E. coli werenegative.

GCB-associated E. coli adheres to and invades culturedepithelial cells. Four E. coli strains (KD1 to -4) were isolatedfrom GCB mucosa from two affected dogs. All of these strainsadhered to cultured epithelial cells (Fig. 5A). Strains KD2 to -4displayed levels of adherence similar to those of the Crohn’s

disease isolate LF 82. KD-1, DH5�, and Salmonella were lessadherent than LF 82 (P � 0.05).

In gentamicin protection assays, GCB-associated E. colistrains KD1 to -4 and LF-82 were significantly more invasivethan DH5� but less invasive than Salmonella enterica serovarTyphimurium (P � 0.05) on both Caco-2 and MAC-T cells(Fig. 5B and C). GCB strains differed in their invasiveness:strain KD-2 invaded Caco-2 and MAC-T cells to a greaterextent than KD-3 and KD-4 and similarly to LF-82. All E. coli

FIG. 2. Mucosa-associated flora in Boxer dogs with granulomatous colitis. A. Fluorescence in situ hybridization with probe Cy3-EUB-338 (red)shows that the bacterial flora (arrows) in the normal colon is confined to superficial mucus and glands. DAPI-stained nuclei are blue (magnification,�400). B. In granulomatous colitis of Boxer dogs, clusters of bacteria that hybridize with Cy3-EUB-338 (red) are located within the mucosa(magnification, �400). C. Intracellular bacteria visualized with Cy3-EUB-338 (red) and FITC-antivimentin (green). DAPI stained DNA (blue). n,nucleus (magnification, �600). D. Gram staining reveals that invasive bacteria are gram-negative coccobacilli within macrophages (arrows)(magnification, �1,000).

VOL. 74, 2006 E. COLI AND GRANULOMATOUS COLITIS 4783

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

strains were more invasive on Caco-2 than MAC-T cells, butthe differences between strains were greater on MAC-T thanCaco-2 cells. For example, KD-2 invaded Caco-2 cells 25 timesmore than DH5� and MAC-T cells 100 times more thanDH5�.

The invasive behavior of GCB-associated E. coli was inde-pendently confirmed using differential immunostaining of ex-tra- and intracellular bacteria and transmission electron mi-croscopy (Fig. 6). Electron microscopy also revealed thatGCB-associated E. coli induces alterations in the cell mem-brane characterized by elongations and actin condensation thatare consistent with induced endocytosis by a “trigger” process(14). Internalized E. coli appeared to be in a close vacuole, butits exact location within the endosomal lysosomal continuumremains to be determined.

Invasion by GCB-associated E. coli is dependent on an in-tact host cell cytoskeleton and signaling pathways. The inva-sion of epithelial cells by GCB-associated E. coli KD-1 andKD-2 was markedly reduced (P � 0.05) by cytochalasin D,colchicine, genistein and wortmannin, indicating involvementof microtubules, microfilaments, tyrosine kinase, and PI 3-ki-nase, respectively (Fig. 7). This pattern of inhibition wassimilar to that of E. coli LF 82. In contrast, invasion by the

Salmonella enterica serovar Typhimurium control was inhib-ited by cytochalasin D and genistein, but not colchicine orwortmannin.

GCB-associated E. coli persists in epithelial cells but notprimary bone marrow-derived macrophages. GCB strainsKD1 to -3 and LF-82 were able to persist and replicate inepithelial cells over a 48-h period more effectively than strainKD4 and commensal DH5� (P � 0.05) (Fig. 8A).

In contrast to their behavior in epithelial cells, GCB-associ-ated E. coli and LF-82 were unable to survive longer thanDH5� in cultured primary bone marrow-derived macrophages(P � 0.05) (Fig. 8B).

GCB-associated E. coli resembles Crohn’s disease-associ-ated E. coli LF 82 in phylogeny. Serotyping revealed a differentO:H serotype for each GCB isolate and LF-82 (Table 1). Eval-uation of genotype by RAPD-PCR (Fig. 9) showed a uniquebanding pattern for each strain, indicative of diversity in over-all genotype. Phylogenetic grouping of E. coli strains by triplexPCR (Table 1) indicated that GCB strains KD-1 and KD-3 andCD strain LF-82 are part of the B2 phylogenetic group. Theother two canine strains belonged to groups D and A. Phylo-genetic triplex PCR performed on mucosal DNA samples fromtwo affected Boxers gave a triple band pattern consistent with

FIG. 3. 16S rDNA libraries constructed from colonic biopsy samples of a Boxer dog with granulomatous colitis before (A) and after (B) clinicalremission induced by enrofloxacin. The sequences of bacteria cultured from the biopsy sample are indicated by the suffix KD or GCB. Databasesequences with the highest nucleotide homology are indicated by accession numbers.

4784 SIMPSON ET AL. INFECT. IMMUN.

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

type B2. No bands were detected in the posttreatment mucosalDNA sample.

Multilocus sequence typing revealed that GCB strains KD1to -3 and LF82 have novel st7 sequence types and clonal groups(Table 1). In contrast, GCB strain KD4 belonged to clonalgroup 23 that harbors predominantly E. coli isolated fromhealthy people (Selander strains) and a healthy dog (http://www.shigatox.net/cgi-bin/mlst7/strainquery?).

The genome sizes of LF-82 and KD1 to -3, strains thatinvade and persist within cultured cells, were between 188 and

FIG. 4. Fluorescence in situ hybridization of GCB mucosa withprobes against Enterobacteriaceae and E. coli/Shigella. A. Multifocalclusters of bacteria (long arrow) that hybridize with probes E. coli 1531(red; Enterobacteriaceae) and EUB-338 (green) are evident within themucosa. A mixed population of Enterobacteriaceae (orange) and otherbacteria (green) is visible on the luminal surface (small arrow). DAPIstained DNA (blue) (magnification, �400). B. Selective mucosal inva-sion by clusters of bacteria (long arrow) that hybridize with a probeagainst E. coli/Shigella (red) but not probe non-EUB-338 (green).DAPI stained DNA (blue) (magnification, �400). C. The mucosallyinvasive flora is composed of coccobacilli 1 to 3 �m long that hybridizewith a Cy3-E. coli/Shigella-specific probe but not non-EUB-338(green). DAPI stained DNA (blue) (magnification, �600).

FIG. 5. Adhesion and invasion of cultured epithelial cells by E. coliassociated with GCB (KD1 to -4) and Crohn’s disease (LF 82), com-mensal E. coli (DH5�), and Salmonella enterica serovar Typhimurium.The results of statistical analysis are indicated by the letters A throughD. Strains with different letters are significantly different from eachother (P � 0.05). A. Adhesion to MAC-T epithelial cells. B. Invasionof MAC-T epithelial cells. C. Invasion of Caco-2 epithelial cells.

VOL. 74, 2006 E. COLI AND GRANULOMATOUS COLITIS 4785

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

FIG. 6. Microscopic examination of cultured epithelial cells infected with canine GCB-associated E. coli strain KD-2. A. Invasion of E. coli wasconfirmed by differential staining of intracellular and extracellular bacteria with differently labeled secondary antibodies before (FITC, green) and

4786 SIMPSON ET AL. INFECT. IMMUN.

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

276 kbp larger than that of MG1655, whereas the genome sizeof KD-4 (4.37 Mbp), a strain that invades but does not persist,was similar to that of MG1655 (4.47 Mbp) (Table 1).

GCB-associated E. coli resembles Crohn’s disease-associ-ated E. coli LF82 and extraintestinal pathogenic E. coli invirulence genes. PCR-based screening for virulence genes ofdiarrheagenic E. coli (LT, STa, STb, SLT-I, SLT-II, CNF-1,CNF-2, and the gamma variant of eae) and an invasion plasmid(ipaH) was negative for all GCB-associated strains (Table 1).All strains, including DH5�, were positive for fimH, the adhe-sin-encoding gene associated with epithelial cell invasion inuropathogenic E. coli (50). Sequencing to detect potentiallypathoadaptive fimH alleles yielded polymorphisms at residues27, 70, 78, 163, and 184 (Table 1). The translated sequences ofthe GCB isolate KD-1 and the Crohn’s disease isolate LF-82were identical. Strains KD1, KD-3, and LF82 had the N70S orS78N mutation, reported to be lineage specific for the B2phylogenetic group (31, 74).

A more comprehensive screening of virulence factors fromdiarrheagenic and extraintestinal pathogenic E. coli using mi-croarray analysis showed that GCB-associated and LF 82 E.coli strains lacked invasion plasmids, the attaching and effacingE. coli type III secretion system-related genes, and toxin-en-coding genes associated with virulence in intestinal or extrain-testinal pathogenic E. coli (Table 2). GCB-associated and LF82 strains shared a variety of genes implicated in iron acquisi-tion and metabolism, notably irp1, irp2, fyuA (yersiniabactin),chuA (hemoglobin utilization), fepC (ferric enterobactin trans-port ATP-binding protein), and iroN (siderophore receptor),

though aerobactin-related genes (iutA and iucD) were not de-tected. The malX gene, which is a marker for the pathogenicityisland of UPEC CFT073, and the iss gene, encoding a proteinresponsible for serum resistance, were present in most strains.The overall virulence gene pattern was most similar for theGCB-associated isolate KD-1 and the CD isolate LF 82, andboth of these strains contained the ibeA gene, encoding aninvasin of meningitis-associated E. coli (3). Strain LF 82 alsopossessed the usp gene, which encodes a uropathogenesis-specific protein, but not any other UPEC-associated genes,such as papA, papC, papGII (pilus P-encoding genes), cnf1(cytotoxic necrotizing factor 1), or afa genes (afimbrial adhe-sin-encoding genes).

after (TRITC, red) permeabilization. Extracellular bacteria are yellow (red plus green); intracellular bacteria are red. DAPI stained DNA (blue).B. Transmission electron microscopy of cultured epithelial cells infected with GCB-associated strain KD-2 reveals bacteria adhering to the cellsurface. Note the filopodia formed close to the bacterium (arrows). C. Filopodia (arrows) persist during entry into the cell. D. An oblique sectionshows a dense patch, possibly polymerized actin, subtending the bacterium during entry (arrow). E. The membrane “ruffle” (arrow) persists evenafter the bacterium has entered the epithelial cell. These findings are consistent with a trigger type of endocytosis.

FIG. 7. Effects of inhibitors of microfilaments (cytochalasin D),microtubules (colchicine), tyrosine kinase (genistein), and PI 3-kinase(wortmannin) on invasion by IBD-associated E. coli and Salmonellaenterica serovar Typhimurium. Invasion (percent of invasion in theabsence of inhibitors) by GCB-associated E. coli (KD1 and KD2) wasreduced by all inhibitors (P � 0.05). The results for LF 82 and theselective inhibition of Salmonella invasion by cytochalasin D and ge-nistein but not colchicine or wortmannin are consistent with the liter-ature. Results are expressed as means plus standard deviations.

FIG. 8. Survival of GCB-associated (KD1 to -4) and Crohn’s dis-ease-associated (LF 82) E. coli in cultured epithelial cells and primarybone marrow-derived macrophages. A. Survival of E. coli over a 48-hperiod in cultured MAC-T epithelial cells, expressed as a percentage ofthe CFU recovered at 2 h. Strains KD1 to -3 and LF 82 replicate (**,P � 0.05), while DH5� and KD-4 decline. B. Survival of E. coli over a72-h period in cultured primary bone marrow-derived macrophages.GCB- and CD-associated and commensal (DH5�) E. coli strains arenot significantly different from each other and survive less well thanSalmonella (P � 0.05).

VOL. 74, 2006 E. COLI AND GRANULOMATOUS COLITIS 4787

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

DISCUSSION

This study directly explored the possibility that an unchar-acterized infectious agent or an abnormal mucosal flora isinvolved in the etiopathogenesis of granulomatous colitis ofBoxer dogs. Eubacterial FISH provided clear evidence thatlarge numbers of coccobacilli are present within the colonicmucosa of Boxer dogs with granulomatous colitis, but notother types of canine colitis, and histologically normal tissues.Culture of the mucosas from two affected dogs yielded E. coli,Klebsiella Streptococcus, Proteus and Chryseobacterium, consid-ered normal fecal flora in dogs (38). To create a more com-prehensive inventory of the bacterial species inhabiting thecolonic mucosa, including uncultivable bacteria, we generated16S rDNA libraries from colonic biopsy samples of two GCBpatients. These libraries were dominated by sequences for En-terobacteriaceae, predominantly E. coli and Shigella, concurredwith the presence of intramucosal gram-negative coccobacilli,and guided the selection of 16 and 23S rRNA FISH probesthat hybridized with the invasive flora. The 16S E. coli/Shigellaprobe employed in the present study is specific for these spe-cies but cannot distinguish between them, so PCR for ipaH, amarker for the invasion plasmid of Shigella and enteroinvasiveE. coli, and culture were performed to detect Shigella. As bothPCR and culture were negative for Shigella we concluded thatthe invasive flora was E. coli.

Interestingly, E. coli was isolated previously from the re-

gional lymph nodes of two Boxer dogs with granulomatouscolitis at necropsy, but an association with disease was notdetermined (80). Another study, published while the presentarticle was in preparation, describes the immunolocalization ofE. coli, Lawsonia intracellularis, Campylobacter, and Salmonellato macrophages in the colons of 10, 3, 2, and 1 of 10 Boxer dogswith granulomatous colitis, respectively (79). While these find-ings lend independent support to our observations, their spec-ificity is questionable because the antibody they used to local-ize E. coli (Dako B0357) is polyclonal, recognizes at least 80different E. coli antigens in crossed immunoelectrophoresisand a multitude of E. coli antigens in immunoblotting fromSDS-polyacrylamide gel electrophoresis, and is dilution depen-dent in its specificity (44, 81).

The association of E. coli with the intestinal mucosa of Boxerdogs with granulomatous colitis is similar to findings in peoplewith inflammatory bowel disease, particularly Crohn’s disease,and rodents with engineered susceptibility to IBD (17, 49, 55,72, 73, 76). However, the mucosal localization of E. coli inGCB, with multifocal clusters of E. coli consistently observedin the upper two-thirds of the mucosa, is more uniform thanreported in human IBD, where some investigators describeintact bacteria, E. coli antigens, or DNA within granulomasand the lamina propria (11, 44, 55, 69) but others indicate thatbacteria are restricted to the mucosal surface (40, 76). Thevariable localization of mucosa-associated E. coli in people

FIG. 9. Genetic diversity of GCB- and CD-associated E. coli strains. RAPD-PCR of genomic DNA extracted from E. coli strains associated withCrohn’s disease (LF 82, lanes 1), and GCB (KD1 to -4, lanes 2 to 5) with RAPD primers 1254, 1281, and 1283.

TABLE 1. Characterization of GCB-associated E. coli strainsa

Strain Serotype Phylogroup MLST(st7:cg) Virulenceb

FimH sequence polymorphism at positioncGenome size

(kbp)27 70 78 163 184

KD1 O8:H10 B2 N:N � A S N V T 4,726KD2 O1:H� D N:N � A N S V T 4,656KD3 O1:H4 B2 N:N � A N N V T 4,744KD4 O145:H11 A 171:23 A N S V N 4,369LF82 O83:H1 B2 N:N ND A S N V T 4,715K-12 MG1655 OR:H48 A 173:0 ND V N S V T 4,468UPEC CFT073 O6:H1 B2 27:38 ND A S N A T 5,231

a MLST, multilocus sequence type; st7, sequence type based on seven housekeeping genes; cg, clonal group; ND, not determined in this study.b PCR was performed for virulence genes, as follows: E. coli LT, STa, STb, SLT-I, SLT-II, CNF-1, CNF-2, the gamma variant of eae, and an invasion plasmid (ipaH).c AE014075.

4788 SIMPSON ET AL. INFECT. IMMUN.

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

with IBD may be attributable to differences in disease pheno-typing between studies (15), biopsy site (ileal, colonic, or rec-tal), biopsy type (surgical versus endoscopic) (52), and methodused, e.g., FISH (the 23S E. coli 1531 probe employed byprevious studies [55, 72] is not E. coli specific). It could alsoreflect the presence of E. coli strains that differ in their abilityto invade and persist within the mucosa. The latter possibilityis supported by observations that strains with an ability toadhere to and invade cultured epithelial cells, hallmarks ofpathogenic E. coli, are more commonly isolated from patientswith Crohn’s disease than those with ulcerative colitis orhealthy controls (17, 49): i.e., such strains are found in 36% ofearly CD lesions in the ileum, compared with 3.7% of colonicCD, 0% of UC, and 1.9% of control samples. In the presentstudy we found that GCB-associated E. coli was able effectivelyto adhere to and invade cultured epithelial cells in numberssimilar to those of the well-characterized ileal CD-associatedE. coli strain, LF 82 (16). GCB E. coli, like LF 82, was also ableto invade a diverse spectrum of cultured epithelial cell lines(5). Transmission electron microscopy of canine GCB E. coliinfecting an epithelial cell monolayer show a trigger, or“splash,” type of endocytosis, similar to that induced by patho-genic bacteria such as Salmonella and Shigella spp. (14). Thistype of behavior, also displayed by E. coli LF82 (5), usuallyrequires the translocation of effector molecules from the bac-terium into the host cell via a type III secretion system and fre-quently involves the activation of the Rho family of GTPasesand cytoskeletal reorganization (14, 61). Invasion by canineGCB isolates and LF 82 was markedly decreased by cytocha-lasin D, colchicine, genistein, and wortmannin, indicating in-volvement of microfilaments, microtubules, tyrosine kinase,

and PI 3-kinase, and is consistent with previous studies withLF-82 in Hep2 and Int 407 epithelial cells (5). Microtubulesand microfilaments are also utilized by enteroinvasive andmeningitis-associated E. coli and invasive Klebsiella andCampylobacter but not Salmonella (22, 53, 57, 61).

Invasive GCB-associated E. coli was able to persist in cul-tured epithelial cells for 48 h and appeared to reside in a tightvacuole within the cytoplasm, suggesting a location in the en-dosomal lysosomal continuum. E. coli LF 82 has also beenshown to reside and replicate in the cytoplasm of epithelialcells (5). Intracellular persistence and replication suggest anability to escape from the endosomal and lysosomal networkand parallel the situation with the pathogens Shigella and Lis-teria (14). Intracellular persistence of IBD-associated E. colimay directly contribute to the proinflammatory mucosal envi-ronment in IBD, and this is supported by studies demonstrat-ing translocation of NF- B and release of IL-8 in epithelialcells infected with IBD-associated E. coli (27, 42).

Our findings that GCB E. coli isolates and LF 82 did notoutlive commensal E. coli (DH5�) in primary bone marrow-derived macrophages contrast with previous reports describingsurvival and replication of LF 82 relative to harmless commen-sal E. coli in cultured J774-A1 macrophages and a survivaladvantage in human-derived mononuclear macrophages andmouse peritoneal cells (7, 27). Those observations appear con-tradictory, but they can be reconciled by considering the rela-tively weak killing ability of the J774-A1 cell line relative tothat of primary macrophages (27). In the light of recent studiesshowing impaired innate immunity in the form of an abnormalacute inflammatory response to E. coli in people with Crohn’sdisease (47), different outcomes based on phagocytic ability

TABLE 2. Microarray analysis for the detection of virulence genes from various diarrheagenic and extraintestinal pathogenic E. coli strains

Genea Gene functionMicroarray analysis result for strainb

UPEC KD1 KD2 KD3 KD4 LF82

iss Increased serum survival and surface exclusion protein � � � � � �kpsMII Protein involved in polysialic acid transport, group II � � � � � �ibeA Protein of invasion � � � � � �pic Serine protease involved in colonization, � � � � � �malX Maltose- and glucose-specific IIABC component,

pathogenicity island associated� � � � � �

irp1 Yersiniabactin biosynthetic protein � � � � � �fepC Ferric enterobactin transport ATP-binding protein � � � � � �lpfA (O113) Major subunit of long polar fimbriae LPF (variant O113) � � � � � �flmA54 Flagellin (fliC variant) � � � � � �iroN Siderophore receptor � � � � � �focA Major fimbrial subunit of F1C fimbriae � � � � � �lpfA Major subunit of long polar fimbriae LPF � � � � � �irp2 Yersiniabactin biosynthetic protein (putative ligase) � � � � � �fyuA Pesticin/yersiniabactin receptor protein � � � � � �colY Colicin Y structural protein � � � � � �mchB Microcin H47 structural protein � � � � � �ccdB Cytotoxic protein � � � � � �cia Colicin Ia structural protein � � � � � �traT Complement resistance protein � � � � � �rtx Putative RTX family exoprotein � � � � � �chuA Outer membrane receptor protein, heme utilization/transport

protein heme utilization/transport protein� � � � � �

usp Uropathogenesis-specific protein � � � � � �

a For all information about the oligonucleotide probes and the genes targeted by the DNA microarray, see reference 7a.b � and �, positive and negative microarray hybridization results, respectively. Oligonucleotide probes which gave positive results for at least one of the tested strains

and also for the reference strain K-12 are not shown in this table. For all strains, positive results were obtained with ompT- and fimH-specific probes.

VOL. 74, 2006 E. COLI AND GRANULOMATOUS COLITIS 4789

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

may be analogous to differences between healthy and suscep-tible individuals, with host susceptibility (e.g., predisposition ofBoxer breed for GCB, polymorphisms in NOD-2) and disease-associated luminal bacteria (e.g., IBD-associated E. coli) actingas joint determinants of disease.

The combination of phylogenetic analysis and virulencegene profiling provided insights into the lineage and geneticarmory of GCB and Cohn’s associated E. coli. The presence ofchuA, determined by PCR and microarray analysis, placedthree of four GCB strains and LF 82 into group B2 or D. Thepresence of yjaA indicated that E. coli KD-1, KD-3 and LF 82are B2, while its absence placed KD-2 into group D (12). Thedetection of the fimH polymorphisms associated with B2 lin-eage, N70S and S78N, further supported these results (31, 74).The serotypes (O1, O8, and O83) and gene profiles (fyuA, irp1,irp2, malX, ompT, ibeA and kpsMII) of these B2 and D strainsare consistent with those of extraintestinal pathogenic E. coli(ExPEC), which causes cystitis, pyelonephritis, prostatitis, sep-sis, and meningitis, and avian pathogenic E. coli (4, 21, 26, 36,37). In contrast, strain KD-4, our least invasive and persistentGCB isolate, belonged to group A, which contains most of thecommensal strains of E. coli (62). The mucosal association ofB2 E. coli in GCB was confirmed by phylogenetic triplex PCRof colonic DNA that yielded amplicons for chuA, yjaA, andTSPE4.C2 in samples from two GCB-affected dogs but not thepostremission sample. These observations suggest that GCB-and CD-associated E. coli strains are genetically more similarto ExPEC than diarrheagenic E. coli strains.

Precise placement of GCB-associated E. coli strains and LF82 within the ExPEC group is difficult. For example, the geneprofiles of KD1 to -3 and LF 82 are broadly similar to that ofUPEC CFT073: all contain malX, a marker of a pathogenicityisland in CFT073, and strain LF 82 also hybridizes with auropathogenesis-specific gene (usp), but these strains lackgenes, such as papA, papC, papGII, cnf1, afa, hlyA, and iucD,that are commonly associated with UPEC and other ExPECstrains (3, 21, 35, 36). The presence of ibeA, the gene encodinginvasin for brain endothelium, in KD-1 and LF 82 suggeststhese strains may belong to the meningitis-associated group(3). However, ibeA is not restricted to meningitis-causingstrains, and KD-1 and LF 82 lack genes, such as sfa, cdtB,neuA, and neuC, that are present in many B2 meningitisstrains (26, 36). Moreover, GCB-associated E. coli and LF82 are able to invade and persist in epithelial cells, whereasinvasion by meningitis-associated E. coli is restricted to en-dothelial cells (53).

The pathogen-like behavior displayed by GCB and CD E.coli isolates in cultured cells strongly suggests that these strainsharbor genes encoding virulence, but an extensive PCR- andmicroarray-based screen of GCB-associated and LF 82 E. colistrains failed to detect genes involved with the pathogenicbehavior of E. coli strains associated with intestinal disease,such as invasion plasmids, type III secretion systems, or toxins,and concurs with previous studies of CD-associated E. coli inpeople (16, 17, 42, 49). The few virulence genes we found inGCB-associated E. coli and LF 82 were largely part of a clusterof genes, irp1, irp2, fyuA (yersiniabactin), chuA (hemoglobinutilization), fepC (ferric enterobactin transport ATP-bindingprotein), and iroN (siderophore receptor), involved in ironacquisition and metabolism (13, 41). These genes are consid-

ered important for iron acquisition by ExPEC within an in-fected host, and bacterial siderophores may also impact thecellular immune response (23).

The paucity of virulence genes detected in GCB and CD E.coli strains suggests that these strains may harbor as-yet-un-characterized genes to account for their disease associationand pathogenic behavior in cultured cells. This seems feasibleconsidering the high degree of diversity in E. coli as a species(only 39% of core proteins are conserved in UPEC, EHEC,and K-12) and its propensity for acquiring DNA from distantlyrelated organisms (56, 83). The B2 lineage is also a particularlyappropriate genetic background for acquiring virulence traits:B2 strains are associated with lethality in mice (21, 31, 62) andoften have larger genome sizes than the commensals in groupA, reflecting the presence of virulence-associated genes such aspathogenicity islands (29, 35, 62). Our findings that GCBstrains KD1 to -3 and LF 82 have larger genomes than E. coliMG1655, belong to undefined MLST clonal groups, and con-tain genes that are thought to be acquired by horizontal trans-fer (e.g., the yersiniabactin gene and malX) (71) further sup-port this possibility and the notion that this group of E. colistrains represents a new pathotype, adherent and invasive E.coli (AIEC), as proposed by Darfeuille-Michaud et al. (16)Strains with an AIEC pathotype could potentially belong to aclonal group associated with chronic intestinal inflammation,comparable to the association of O157:H7 with hemorrhagicgastroenteritis and hemolytic uremic syndrome. However, se-rotyping and genotyping (with random amplified polymorphicDNA PCR) showed marked heterogeneity between strains anddoes not support the presence of a unique E. coli strain asso-ciated with GCB and Crohn’s disease. These observations aresimilar to the results of ribotype analysis of E. coli strains frompatients with CD showing that no single strain is found in everypatient (51).

In conclusion, we have determined that granulomatous co-litis of Boxer dogs, a disease that has features in common withidiopathic IBD in people, is associated with selective intramu-cosal colonization by Escherichia coli. E. coli strains isolatedfrom the mucosas of two affected dogs adhere to, invade,persist in, and replicate in cultured epithelial cells to the samedegree as Crohn’s disease-associated E. coli LF-82. The inva-sion process, which resembles triggered endocytosis, requiresintact microtubules, microfilaments, PI 3-kinase, and tyrosinekinase. The similar phylogeny and virulence gene profiles ofGCB strains and LF 82 hint at the possibility of lineage-specificpathoadaptation and point to the association of E. coli strainsresembling extraintestinal pathogenic strains in genotype withchronic intestinal inflammation in dogs and people. The role ofthese E. coli strains in the etiopathogenesis of GCB and CDremains to be determined.

ACKNOWLEDGMENTS

K. Simpson is supported by a grant from the U.S. Public HealthService (DK002938). This study was funded in part by the IndirectVitamins Purchasers Antitrust Litigation Settlement administered bythe New York State Attorney General.

We thank J. Chaitman, D. J. Chew, M. J. Day, E. J. Hall, R. A.Hostutler, and D. F. Kelly for providing patient information and tissuesections, A. Darfeuille-Michaud and T. S. Whittam for E. coli strains,and A. Quaroni for the Caco-2 cell line. We thank Francis Davis fortechnical support.

4790 SIMPSON ET AL. INFECT. IMMUN.

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

REFERENCES

1. Arnott, I. D., C. J. Landers, E. J. Nimmo, H. E. Drummond, B. K. Smith,S. R. Targan, and J. Satsangi. 2004. Sero-reactivity to microbial componentsin Crohn’s disease is associated with disease severity and progression, but notNOD2/CARD15 genotype. Am. J. Gastroenterol. 99:2376–2384.

2. Bekal, S., R. Brousseau, L. Masson, G. Prefontaine, J. Fairbrother, and J.Harel. 2003. Rapid identification of Escherichia coli pathotypes by virulencegene detection with DNA microarrays. J. Clin. Microbiol. 41:2113–2125.

3. Bingen, E., B. Picard, N. Brahimi, S. Mathy, P. Desjardins, J. Elion, and E.Denamur. 1998. Phylogenetic analysis of Escherichia coli strains causingneonatal meningitis suggests horizontal gene transfer from a predominantpool of highly virulent B2 group strains. J. Infect. Dis. 177:642–650.

4. Blanco, M., J. E. Blanco, M. P. Alonso, and J. Blanco. 1994. Virulencefactors and O groups of Escherichia coli strains isolated from cultures ofblood specimens from urosepsis and non-urosepsis patients. Microbiologia10:249–256.

5. Boudeau, J., A. L. Glasser, E. Masseret, B. Joly, and A. Darfeuille-Michaud.1999. Invasive ability of an Escherichia coli strain isolated from the ilealmucosa of a patient with Crohn’s disease. Infect. Immun. 67:4499–4509.

6. Bowe, P. S., H. J. Van Kruiningen, and S. Rosendal. 1982. Attempts toproduce granulomatous colitis in Boxer dogs with a mycoplasma. Can.J. Comp. Med. 46:430–433.

7. Bringer, M. A., N. Barnich, A. L. Glasser, O. Bardot, and A. Darfeuille-Michaud. 2005. HtrA stress protein is involved in intramacrophagic replica-tion of adherent and invasive Escherichia coli strain LF82 isolated from apatient with Crohn’s disease. Infect. Immun. 73:712–721.

7a.Bruant, G., C. Maynard, S. Bekal, I. Gaucher, L. Masson, R. Brousseau, andJ. Harel. 2006. Development and validation of an oligonucleotide microarrayfor detection of multiple virulence and antimicrobial resistance genes inEscherichia coli. Appl. Environ. Microbiol. 72:3780–3784.

8. Bulois, P., P. Desreumaux, C. Neut, A. Darfeuille-Michaud, A. Cortot, andJ. F. Colombel. 1999. Infectious agents and Crohn’s disease. Clin. Microbiol.Infect. 5:601–604.

9. Burke, D. A., A. T. Axon, S. A. Clayden, M. F. Dixon, D. Johnston, and R. W.Lacey. 1990. The efficacy of tobramycin in the treatment of ulcerative colitis.Aliment. Pharmacol. Ther. 4:123–129.

10. Campieri, M., and P. Gionchetti. 2001. Bacteria as the cause of ulcerativecolitis. Gut 48:132–135.

11. Cartun, R. W., H. J. Van Kruiningen, C. A. Pedersen, and M. M. Berman.1993. An immunocytochemical search for infectious agents in Crohn’s dis-ease. Mod. Pathol. 6:212–219.

12. Clermont, O., S. Bonacorsi, and E. Bingen. 2000. Rapid and simple deter-mination of the Escherichia coli phylogenetic group. Appl. Environ. Micro-biol. 66:4555–4558.

13. Clermont, O., S. Bonacorsi, and E. Bingen. 2001. The Yersinia high-patho-genicity island is highly predominant in virulence-associated phylogeneticgroups of Escherichia coli. FEMS Microbiol. Lett. 196:153–157.

14. Cossart, P., and P. J. Sansonetti. 2004. Bacterial invasion: the paradigms ofenteroinvasive pathogens. Science 304:242–248.

15. Cummings, J. R., and D. P. Jewell. 2005. Clinical implications of inflamma-tory bowel disease genetics on phenotype. Inflamm. Bowel Dis. 11:56–61.

16. Darfeuille-Michaud, A. 2002. Adherent-invasive Escherichia coli: a putativenew E. coli pathotype associated with Crohn’s disease. Int. J. Med. Micro-biol. 292:185–193.

17. Darfeuille-Michaud, A., J. Boudeau, P. Bulois, C. Neut, A. L. Glasser, N.Barnich, M. A. Bringer, A. Swidsinski, L. Beaugerie, and J. F. Colombel.2004. High prevalence of adherent-invasive Escherichia coli associated withileal mucosa in Crohn’s disease. Gastroenterology 127:412–421.

18. Darfeuille-Michaud, A., C. Neut, N. Barnich, E. Lederman, P. Di Martino,P. Desreumaux, L. Gambiez, B. Joly, A. Cortot, and J. F. Colombel. 1998.Presence of adherent Escherichia coli strains in ileal mucosa of patients withCrohn’s disease. Gastroenterology 115:1405–1413.

19. Davies, D. R., A. J. O’Hara, P. J. Irwin, and W. G. Guilford. 2004. Successfulmanagement of histiocytic ulcerative colitis with enrofloxacin in two Boxerdogs. Aust. Vet. J. 82:58–61.

20. Dutly, F., and M. Altwegg. 2001. Whipple’s disease and “Tropheryma whip-pelii.” Clin. Microbiol. Rev. 14:561–583.

21. Escobar-Paramo, P., O. Clermont, A. B. Blanc-Potard, H. Bui, C. LeBouguenec, and E. Denamur. 2004. A specific genetic background is re-quired for acquisition and expression of virulence factors in Escherichia coli.Mol. Biol. Evol. 21:1085–1094.

22. Finlay, B. B., and S. Falkow. 1997. Common themes in microbial pathoge-nicity revisited. Microbiol. Mol. Biol. Rev. 61:136–169.

23. Flo, T. H., K. D. Smith, S. Sato, D. J. Rodriguez, M. A. Holmes, R. K. Strong,S. Akira, and A. Aderem. 2004. Lipocalin 2 mediates an innate immuneresponse to bacterial infection by sequestrating iron. Nature 432:917–921.

24. Furrie, E., S. Macfarlane, J. H. Cummings, and G. T. Macfarlane. 2004.Systemic antibodies towards mucosal bacteria in ulcerative colitis andCrohn’s disease differentially activate the innate immune response. Gut53:91–98.

25. German, A. J., E. J. Hall, D. F. Kelly, A. D. Watson, and M. J. Day. 2000. An

immunohistochemical study of histiocytic ulcerative colitis in boxer dogs.J. Comp. Pathol. 122:163–175.

26. Germon, P., Y. H. Chen, L. He, J. E. Blanco, A. Bree, C. Schouler, S. H.Huang, and M. Moulin-Schouleur. 2005. ibeA, a virulence factor of avianpathogenic Escherichia coli. Microbiology 151:1179–1186.

27. Glasser, A. L., J. Boudeau, N. Barnich, M. H. Perruchot, J. F. Colombel, andA. Darfeuille-Michaud. 2001. Adherent invasive Escherichia coli strains frompatients with Crohn’s disease survive and replicate within macrophages with-out inducing host cell death. Infect. Immun. 69:5529–5537.

28. Gomez, J. A., S. W. Russell, J. O. Trowbridge, and J. Lee. 1977. Caninehistiocytic ulcerative colitis. An ultrastructural study of the early mucosallesion. Am. J. Dig. Dis. 22:485–496.

29. Gordon, D. M., S. E. Stern, and P. J. Collignon. 2005. Influence of the ageand sex of human hosts on the distribution of Escherichia coli ECOR groupsand virulence traits. Microbiology 151:15–23.

30. Harris, K. A., K. J. Fidler, J. C. Hartley, J. Vogt, N. J. Klein, F. Monsell, andV. M. Novelli. 2002. Unique case of Helicobacter sp. osteomyelitis in animmunocompetent child diagnosed by broad-range 16S PCR. J. Clin. Mi-crobiol. 40:3100–3103.

31. Hommais, F., S. Gouriou, C. Amorin, H. Bui, M. C. Rahimy, B. Picard, andE. Denamur. 2003. The FimH A27V mutation is pathoadaptive for uroviru-lence in Escherichia coli B2 phylogenetic group isolates. Infect. Immun.71:3619–3622.

32. Hostutler, R. A., B. J. Luria, S. E. Johnson, S. E. Weisbrode, R. G. Sherding,J. Q. Jaeger, and W. G. Guilford. 2004. Antibiotic-responsive histiocyticulcerative colitis in 9 dogs. J. Vet. Intern. Med. 18:499–504.

33. Inohara, N., Y. Ogura, A. Fontalba, O. Gutierrez, F. Pons, J. Crespo, K.Fukase, S. Inamura, S. Kusumoto, M. Hashimoto, S. J. Foster, A. P. Moran,J. L. Fernandez-Luna, and G. Nunez. 2003. Host recognition of bacterialmuramyl dipeptide mediated through NOD2. Implications for Crohn’s dis-ease. J. Biol. Chem. 278:5509–5512.

34. Jansen, G. J., M. Mooibroek, J. Idema, H. J. Harmsen, G. W. Welling, andJ. E. Degener. 2000. Rapid identification of bacteria in blood cultures byusing fluorescently labeled oligonucleotide probes. J. Clin. Microbiol. 38:814–817.

35. Johnson, J. R., P. Delavari, M. Kuskowski, and A. L. Stell. 2001. Phyloge-netic distribution of extraintestinal virulence-associated traits in Escherichiacoli. J. Infect. Dis. 183:78–88.

36. Johnson, J. R., M. A. Kuskowski, A. Gajewski, S. Soto, J. P. Horcajada, M. T.Jimenez de Anta, and J. Vila. 2005. Extended virulence genotypes andphylogenetic background of Escherichia coli isolates from patients withcystitis, pyelonephritis, or prostatitis. J. Infect. Dis. 191:46–50.

37. Johnson, J. R., E. Oswald, T. T. O’Bryan, M. A. Kuskowski, and L. Spanjaard.2002. Phylogenetic distribution of virulence-associated genes among Esche-richia coli isolates associated with neonatal bacterial meningitis in the Neth-erlands. J. Infect. Dis. 185:774–784.

38. Johnson, J. R., A. L. Stell, and P. Delavari. 2001. Canine feces as a reservoirof extraintestinal pathogenic Escherichia coli. Infect. Immun. 69:1306–1314.

39. Kim, S. C., S. L. Tonkonogy, C. A. Albright, J. Tsang, E. J. Balish, J. Braun,M. M. Huycke, and R. B. Sartor. 2005. Variable phenotypes of enterocolitisin interleukin 10-deficient mice monoassociated with two different commen-sal bacteria. Gastroenterology 128:891–906.

40. Kleessen, B., A. J. Kroesen, H. J. Buhr, and M. Blaut. 2002. Mucosal andinvading bacteria in patients with inflammatory bowel disease compared withcontrols. Scand. J. Gastroenterol. 37:1034–1041.

41. Koczura, R., and A. Kaznowski. 2003. The Yersinia high-pathogenicity islandand iron-uptake systems in clinical isolates of Escherichia coli. J. Med.Microbiol. 52:637–642.

42. La Ferla, K., D. Seegert, and S. Schreiber. 2004. Activation of NF- B inintestinal epithelial cells by E. coli strains isolated from the colonic mucosaof IBD patients. Int. J. Colorectal Dis. 19:334–342.

43. Lamps, L. W., K. T. Madhusudhan, J. M. Havens, J. K. Greenson, M. P.Bronner, M. C. Chiles, P. J. Dean, and M. A. Scott. 2003. PathogenicYersinia DNA is detected in bowel and mesenteric lymph nodes from pa-tients with Crohn’s disease. Am. J. Surg. Pathol. 27:220–227.

44. Liu, Y., H. J. van Kruiningen, A. B. West, R. W. Cartun, A. Cortot, and J. F.Colombel. 1995. Immunocytochemical evidence of Listeria, Escherichia coli,and Streptococcus antigens in Crohn’s disease. Gastroenterology 108:1396–1404.

45. Lodes, M. J., Y. Cong, C. O. Elson, R. Mohamath, C. J. Landers, S. R.Targan, M. Fort, and R. M. Hershberg. 2004. Bacterial flagellin is a domi-nant antigen in Crohn disease. J. Clin. Investig. 113:1296–1306.

46. Maeda, S., L. C. Hsu, H. Liu, L. A. Bankston, M. Iimura, M. F. Kagnoff, L.Eckmann, and M. Karin. 2005. Nod2 mutation in Crohn’s disease potenti-ates NF- B activity and IL-1� processing. Science 307:734–738.

47. Marks, D. J., M. W. Harbord, R. MacAllister, F. Z. Rahman, J. Young, B.Al-Lazikani, W. Lees, M. Novelli, S. Bloom, and A. W. Segal. 2006. Defectiveacute inflammation in Crohn’s disease: a clinical investigation. Lancet 367:668–678.

48. Marteau, P., P. Lepage, I. Mangin, A. Suau, J. Dore, P. Pochart, and P.Seksik. 2004. Review article: gut flora and inflammatory bowel disease.Aliment. Pharmacol. Ther. 20(Suppl. 4):18–23.

VOL. 74, 2006 E. COLI AND GRANULOMATOUS COLITIS 4791

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

49. Martin, H. M., B. J. Campbell, C. A. Hart, C. Mpofu, M. Nayar, R. Singh, H.Englyst, H. F. Williams, and J. M. Rhodes. 2004. Enhanced Escherichia coliadherence and invasion in Crohn’s disease and colon cancer. Gastroentero-logy 127:80–93.

50. Martinez, J. J., M. A. Mulvey, J. D. Schilling, J. S. Pinkner, and S. J.Hultgren. 2000. Type 1 pilus-mediated bacterial invasion of bladder epithe-lial cells. EMBO J. 19:2803–2812.

51. Masseret, E., J. Boudeau, J. F. Colombel, C. Neut, P. Desreumaux, B. Joly,A. Cortot, and A. Darfeuille-Michaud. 2001. Genetically related Escherichiacoli strains associated with Crohn’s disease. Gut 48:320–325.

52. Matsuda, H., Y. Fujiyama, A. Andoh, T. Ushijima, T. Kajinami, and T.Bamba. 2000. Characterization of antibody responses against rectal mucosa-associated bacterial flora in patients with ulcerative colitis. J. Gastroenterol.Hepatol. 15:61–68.

53. Meier, C., T. A. Oelschlaeger, H. Merkert, T. K. Korhonen, and J. Hacker.1996. Ability of Escherichia coli isolates that cause meningitis in newborns toinvade epithelial and endothelial cells. Infect. Immun. 64:2391–2399.

54. Mow, W. S., E. A. Vasiliauskas, Y. C. Lin, P. R. Fleshner, K. A. Papadakis,K. D. Taylor, C. J. Landers, M. T. Abreu-Martin, J. I. Rotter, H. Yang, andS. R. Targan. 2004. Association of antibody responses to microbial antigensand complications of small bowel Crohn’s disease. Gastroenterology 126:414–424.

55. Mylonaki, M., N. B. Rayment, D. S. Rampton, B. N. Hudspith, and J.Brostoff. 2005. Molecular characterization of rectal mucosa-associated bac-terial flora in inflammatory bowel disease. Inflamm. Bowel Dis. 11:481–487.

56. Ochman, H. 2001. Lateral and oblique gene transfer. Curr. Opin. Genet.Dev. 11:616–619.

57. Oelschlaeger, T. A., and B. D. Tall. 1997. Invasion of cultured human epi-thelial cells by Klebsiella pneumoniae isolated from the urinary tract. Infect.Immun. 65:2950–2958.

58. Ohkusa, T., T. Nomura, T. Terai, H. Miwa, O. Kobayashi, M. Hojo, Y. Takei,T. Ogihara, S. Hirai, I. Okayasu, and N. Sato. 2005. Effectiveness of anti-biotic combination therapy in patients with active ulcerative colitis: a ran-domized, controlled pilot trial with long-term follow-up. Scand. J. Gastro-enterol. 40:1334–1342.

59. Onderdonk, A. B., J. A. Richardson, R. E. Hammer, and J. D. Taurog. 1998.Correlation of cecal microflora of HLA-B27 transgenic rats with inflamma-tory bowel disease. Infect. Immun. 66:6022–6023.

60. Ott, S. J., M. Musfeldt, D. F. Wenderoth, J. Hampe, O. Brant, U. R. Folsch,K. N. Timmis, and S. Schreiber. 2004. Reduction in diversity of the colonicmucosa associated bacterial microflora in patients with active inflammatorybowel disease. Gut 53:685–693.

61. Patel, J. C., and J. E. Galan. 2005. Manipulation of the host actin cytoskel-eton by Salmonella—all in the name of entry. Curr. Opin. Microbiol. 8:10–15.

62. Picard, B., J. S. Garcia, S. Gouriou, P. Duriez, N. Brahimi, E. Bingen, J.Elion, and E. Denamur. 1999. The link between phylogeny and virulence inEscherichia coli extraintestinal infection. Infect. Immun. 67:546–553.

63. Podolsky, D. K. 2002. Inflammatory bowel disease. N. Engl. J. Med. 347:417–429.

64. Poulsen, L. K., F. Lan, C. S. Kristensen, P. Hobolth, S. Molin, and K. A.Krogfelt. 1994. Spatial distribution of Escherichia coli in the mouse largeintestine inferred from rRNA in situ hybridization. Infect. Immun. 62:5191–5194.

65. Priestnall, S. L., B. Wiinberg, A. Spohr, B. Neuhaus, M. Kuffer, M. Wiedmann,and K. W. Simpson. 2004. Evaluation of “Helicobacter heilmannii” subtypesin the gastric mucosas of cats and dogs. J. Clin. Microbiol. 42:2144–2151.

66. Relman, D. A., T. M. Schmidt, R. P. MacDermott, and S. Falkow. 1992.Identification of the uncultured bacillus of Whipple’s disease. N. Engl.J. Med. 327:293–301.

67. Roth, L., A. M. Walton, M. S. Leib, and C. F. Burrows. 1990. A gradingsystem for lymphocytic plasmacytic colitis in dogs. J. Vet. Diagn. Investig.2:257–262.

68. Rutgeerts, P., K. Goboes, M. Peeters, M. Hiele, F. Penninckx, R. Aerts, R.Kerremans, and G. Vantrappen. 1991. Effect of faecal stream diversion onrecurrence of Crohn’s disease in the neoterminal ileum. Lancet 338:771–774.

69. Ryan, P., R. G. Kelly, G. Lee, J. K. Collins, G. C. O’Sullivan, J. O’Connell,and F. Shanahan. 2004. Bacterial DNA within granulomas of patients withCrohn’s disease—detection by laser capture microdissection and PCR.Am. J. Gastroenterol. 99:1539–1543.

70. Sartor, R. B. 2004. Therapeutic manipulation of the enteric microflora ininflammatory bowel diseases: antibiotics, probiotics, and prebiotics. Gastro-enterology 126:1620–1633.

71. Schubert, S., A. Rakin, H. Karch, E. Carniel, and J. Heesemann. 1998.Prevalence of the “high-pathogenicity island” of Yersinia species amongEscherichia coli strains that are pathogenic to humans. Infect. Immun. 66:480–485.

72. Schuppler, M., K. Lotzsch, M. Waidmann, and I. B. Autenrieth. 2004. Anabundance of Escherichia coli is harbored by the mucosa-associated bacterialflora of interleukin-2-deficient mice. Infect. Immun. 72:1983–1990.

73. Sellon, R. K., S. Tonkonogy, M. Schultz, L. A. Dieleman, W. Grenther, E.Balish, D. M. Rennick, and R. B. Sartor. 1998. Resident enteric bacteria arenecessary for development of spontaneous colitis and immune system acti-vation in interleukin-10-deficient mice. Infect. Immun. 66:5224–5231.

74. Sokurenko, E. V., V. Chesnokova, D. E. Dykhuizen, I. Ofek, X. R. Wu, K. A.Krogfelt, C. Struve, M. A. Schembri, and D. L. Hasty. 1998. Pathogenicadaptation of Escherichia coli by natural variation of the FimH adhesin. Proc.Natl. Acad. Sci. USA 95:8922–8926.

75. Stokes, J. E., J. M. Kruger, T. Mullaney, K. Holan, and W. Schall. 2001.Histiocytic ulcerative colitis in three non-boxer dogs. J. Am. Anim. Hosp.Assoc. 37:461–465.

76. Swidsinski, A., A. Ladhoff, A. Pernthaler, S. Swidsinski, V. Loening-Baucke,M. Ortner, J. Weber, U. Hoffmann, S. Schreiber, M. Dietel, and H. Lochs.2002. Mucosal flora in inflammatory bowel disease. Gastroenterology 122:44–54.

77. Van Kruiningen, H. J. 1967. Granulomatous colitis of boxer dogs: compar-ative aspects. Gastroenterology 53:114–122.

78. Van Kruiningen, H. J. 1975. The ultrastructure of macrophages in granulo-matous colitis of Boxer dogs. Vet. Pathol. 12:446–459.

79. Van Kruiningen, H. J., I. C. Civco, and R. W. Cartun. 2005. The comparativeimportance of E. coli antigen in granulomatous colitis of Boxer dogs. APMIS113:420–425.

80. Van Kruiningen, H. J., R. J. Montali, J. D. Strandberg, and R. W. Kirk.1965. A granulomatous colitis of dogs with histologic resemblance to Whip-ple’s disease. Pathol. Vet. 2:521–544.

81. Walmsley, R. S., A. Anthony, R. Sim, R. E. Pounder, and A. J. Wakefield.1998. Absence of Escherichia coli, Listeria monocytogenes, and Klebsiellapneumoniae antigens within inflammatory bowel disease tissues. J. Clin.Pathol. 51:657–661.

82. Wang, G., T. S. Whittam, C. M. Berg, and D. E. Berg. 1993. RAPD (arbitraryprimer) PCR is more sensitive than multilocus enzyme electrophoresis fordistinguishing related bacterial strains. Nucleic Acids Res. 21:5930–5933.

83. Welch, R. A., V. Burland, G. Plunkett III, P. Redford, P. Roesch, D. Rasko,E. L. Buckles, S. R. Liou, A. Boutin, J. Hackett, D. Stroud, G. F. Mayhew,D. J. Rose, S. Zhou, D. C. Schwartz, N. T. Perna, H. L. Mobley, M. S.Donnenberg, and F. R. Blattner. 2002. Extensive mosaic structure revealedby the complete genome sequence of uropathogenic Escherichia coli. Proc.Natl. Acad. Sci. USA 99:17020–17024.

Editor: F. C. Fang

4792 SIMPSON ET AL. INFECT. IMMUN.

on April 14, 2021 by guest

http://iai.asm.org/

Dow

nloaded from