CHAPTER 20 Expression and Introduction of Macromolecules ...sun-lab.med.nyu.edu/files/sun-lab/attachments/CPCB.ch20.Macromo… · Expression and Introduction of Macromolecules into

CHAPTER 20Expression and Introduction ofMacromolecules into Cells

INTRODUCTION

C ells are fundamentally insular, isolated and protected from their surroundings bytheir plasma membranes. However, it is frequently necessary for cell biologist to

overcome the isolation of the cell’s interior in order to probe its workings at a molecularlevel. As a result, many experimental strategies employed by cell biologists rely uponthe introduction or expression of particular macromolecules within cells of interest. Thegoals of such techniques include the expression or introduction of fluorescently-taggedproteins, allowing the examination of the subcellular localization and behavior of theprotein within living cells. Similarly, these techniques can be used to perturb the functionof particular proteins through the addition of antibodies, inhibitors or mutant forms of theprotein or through inappropriate expression with altered abundance or timing of proteinaccumulation. Additionally, techniques for introduction of macromolecules into cells arefrequently utilized to load cells with impermeant dyes that can be used to monitor variousaspects of cellular physiology, including changes in ion concentrations. This chapter willcover methods that have been developed for such experimental strategies. The first twounits of this chapter discuss simple and inexpensive methods for the introduction of avariety of macromolecules (UNIT 20.1) or specific fusion proteins (UNIT 20.2) into cells. UNITS

20.3, 20.4, 20.5, 20.6 & 20.7 discuss the introduction of nucleic acids into cells for the purposeof altering gene expression.

UNIT 20.1 provides a variety of flexible protocols that can be inexpensively used to load abroad range of macromolecules into cells. Methods covered in UNIT 20.1 include scrapeloading, scratch loading, bead loading and syringe loading. These techniques all relyupon the physical disruption of the plasma membrane to promote the uptake of targetmolecules, and upon the capacity of cell to re-seal the plasma membrane after damage.The techniques discussed in UNIT 20.1 have a number of advantages, including the factthat their implementation does not require specialized equipment and that they can beutilized to simultaneously load a large number of cells. They are also useful because alarge range of macromolecules can be introduced in this manner. These techniques wouldnot be preferred under conditions where the macromolecule being loaded is particularlyprecious, since each of the techniques require a relatively large amount of such material.

UNIT 20.2 describes the introduction of proteins into cells using an eleven amino acidsequence from the HIV-TAT transduction domain. This amino acid sequence has theremarkable property of allowing the HIV-TAT protein to pass through the intact plasmamembrane and enter the cytoplasm of cells. It has also been shown to confer this propertyto a number of other proteins when expressed as a fusion moiety. Thus, investigatorscan express this sequence as a tag to their proteins of interest in bacteria, purify theresultant fusion peptide using standard biochemical means, and introduce the fusionprotein into cells by simply introducing the fusion protein to the cell culture medium.Like the methods discussed in UNIT 20.1, these techniques have considerable advantagesbecause of their simplicity and because of the fact that they are economical and haveminimal requirements for specialized equipment.

Contributed by Mary DassoCurrent Protocols in Cell Biology (2005) 20.0.1-20.0.2Copyright C© 2005 by John Wiley & Sons, Inc.

Expression andIntroduction ofMacromoleculesinto Cells

20.0.1

Supplement 27

Introduction

20.0.2

Supplement 27 Current Protocols in Cell Biology

While UNITS 20.1 & 20.2 offer the possibility of direct introduction of proteins into cells,expression of cloned genes from transfected plasmids is more commonly used to probeprotein function. UNITS 20.3, 20.4, 20.5, 20.6 & 20.7 discuss transfection protocols to introduceDNA into cells for this purpose. These protocols include calcium phosphate transfec-tion (UNIT 20.3), DEAE dextran transfection (UNIT 20.4), electroporation (UNIT 20.5) andlipid-mediated transfection (UNIT 20.6). Calcium phosphate (UNIT 20.3) and DEAE dextran(UNIT 20.4) chemically induce the association of plasmid DNA to the cell surface, resultingin its uptake through endocytosis. Cationic lipids spontaneously associate with nucleicacids through charge interactions. In the case of plasmids, the resulting DNA-lipid struc-tures are also capable of transducing genes into cells through endocytosis (UNIT 20.6). In allcases, the pathway through which DNA eventually enters the nucleus after endocytosisis poorly defined. By contrast, electroporation uses an electric field to open pores in thecell to allow the entry of DNA through diffusion. Electroporation is less dependent uponspecial characteristics of the cell than other transfection techniques and can therefore beused for introduction of plasmid DNA into a very broad spectrum of cell types. Calciumphosphate, DEAE dextran, and lipid-mediated transfection are typically employed in thetransfection of adherent cell lines. Lipid-mediated transfection and electroporation aretypically used for non-adherent cells. Since the successful use of all transfection methodsdepends heavily on the cell line under study and conditions of the particular experiment,UNIT 20.7 discusses strategies for optimization of transfection efficiency using reportersystems.

It is frequently desirable to control the expression of mRNA from plasmids after theirintroduction into cells, particularly those that encode toxic protein products. UNIT 20.8

describes the use of tetracycline-regulated gene expression systems for this purpose.This system is based upon an artificial transcriptional transactivator (tTA), derived fromthe fusion of the tetracycline repressor of E. coli to the transcriptional activation of theherpes simplex VP16 protein. In the absence of tetracycline, this fusion protein binds toand activates transcription of plasmids bearing tetracycline-resistance operator elementsfrom the Tn10 operator. UNIT 20.8 further discusses selection of stable cell lines bearingsuch plasmids, which provides a mechanism for quick and synchronous expression oftarget proteins in a population of cultured cells.

Together, these techniques comprise some of the most basic tools available to cell biol-ogists. In each case, they are designed to overcome the challenges posed by the insularnature of cells and to help us to manipulate and understand the machinery of the intactcell.

Mary Dasso

UNIT 20.1Direct Introduction of Molecules into Cells

Techniques for introducing normally impermeant macromolecules into the living cell—referred to as “cell-loading techniques”—open up many possibilities for the cell biologist.Examples of the investigations that can be carried out using such methods includemeasuring cytosolic ion concentrations accurately by means of a large, highly membrane-impermeant fluorescent probe; defining the native location of a protein (fluorescently tagged)dynamically in time and space; perturbing the normal functioning of a cellular protein (forexample, by introducing antibodies or other specific inhibitors); or altering the genome (byintroducing antisense or expression-vector nucleotide sequences). Microinjection is probablythe most commonly used technique for introducing fluorescent probes, fluorescently taggedproteins, and antibodies into living cells for short-term studies of cell physiology and proteinlocation and function. It is, however, not the only technique available, nor the easiest or leastexpensive to implement. Among the alternatives are several closely related techniques that,like microinjection, rely on the cell’s ability to reseal a mechanically induced plasmamembrane disruption (see McNeil, 2002, for a review) created in order to gain temporaryaccess to cell cytosol. Four such techniques are described here: scrape loading (see BasicProtocol), scratch loading (see Alternate Protocol 1), bead loading (see Alternate Protocol 2),and syringe loading (see Alternate Protocol 3). Although these techniques may not becompetitive with microinjection in terms of economy of use of the macromolecule to beloaded, or as efficient at loading very large macromolecules (>100,000 mol. wt.), theirimplementation does not require the acquisition of a specialized skill or expensive equipment.Additionally, unlike microinjection, they allow one to rapidly load (in a matter of minutes)thousands or even many millions of many types of mammalian cells with normally imper-meant molecules, and so to facilitate quantitative analyses of the effect of loading (Dobersteinet al., 1993).

STRATEGIC PLANNING

An excellent probe for testing the effectiveness of each of the loading techniques below,and for working out the critical parameter of imposed mechanical load (see CriticalParameters), is fluorescein-labeled dextran (available from Sigma or Molecular Probes).It is inexpensive and can be purchased in a range of molecular weights (from ∼3 × 103 to5 × 106), allowing one to approximately match it in terms of size to the protein or otherprobe ultimately to be loaded. Fluorescein-labeled dextran is available in a fixable form(conjugated with lysine residues), allowing it to be used initially with fixed rather thanliving cell specimens.

Because the loading techniques described in this unit, like microinjection, damage cells,it is important to compare control populations of loaded cells, such as those loaded withfluorescein dextran only, with experimental cells loaded with both fluorescein dextranand the molecule of interest, before concluding that an effect of loading is specific to themolecule loaded. Mixing the molecule of interest with fluorescein dextran creates a“loading solution” that will provide this experimental population. It is important also tocompare the relevant behavior of the fluorescein dextran–loaded “control” populationwith that of undisturbed (nonfluorescent) cells, which are always present in the popula-tions generated by these techniques. In this way, those effects on cell behavior that arecaused by the loading procedure alone can be detected. In this regard, the authors of thisunit have noticed that cells suffering plasma membrane disruptions often contain moreintracellular vesicles than undisturbed neighbors (this is probably related to the mem-brane-membrane fusion process that mediates resealing; Terasaki et al., 1997), but, in thecell types that have been studied in the authors’ laboratory, there has been no evidence

Supplement 18

Contributed by Paul L. McNeilCurrent Protocols in Cell Biology (2003) 20.1.1-20.1.7Copyright © 2003 by John Wiley & Sons, Inc.

20.1.1


that apoptosis is induced among loaded cells. Indeed, one can observe fibroblasts thathave been scratch-loaded with fluorescein dextran locomoting into adjacent denudedzones of the coverslip within 60 min post-wounding, and then undergoing cell divisionthere 12 to 24 hr later (Swanson and McNeil, 1987). Cytosolic levels of Ca2+ are rapidly(within seconds to minutes) restored to normal levels after wounding (by microinjectionor other, more radical means of making cell-surface disruptions)—another indication ofthe remarkable, and biologically essential, capacity of cells to rapidly reseal and hencesurvive plasma membrane disruptions (McNeil, 2002).

One or more of these techniques should be applicable to any type of mammalian cell, andalso to other eukaryotic cells that lack an external cell wall. For cells that must be loadedor are most conveniently loaded as a suspension, syringe loading is the technique ofchoice. For adherent cells, any of the additional techniques described below could be used.

A final question is what quantity of one’s, often precious molecule is needed? The answerto this question will depend, of course, on the experimenter’s goal. If it is simply to producea fluorescent signal readily visualized or measured microscopically or via a flow cyto-fluorometer, then initial tests with a fluorescent dextran of appropriate size and concentration(e.g., the size and concentration of the molecule of interest) should provide a usefulpreliminary answer. The authors find that 0.5 to 1.0 mg/ml solutions of fluorescein dextran(mol. wt., 10 to 70 kDa) result in a readily assayed or measured fluorescent signal from cellsloaded by any of these techniques. Sample volume is another important issue. Some of thesetechniques require that only a very small volume of loading solution be employed. Forexample, using syringe loading, an ultramicropipettor (1- to 10-µl range), and ultramicropipet tips, no more than 1 µl is needed. In general, the minimum usable volume is thatwhich prevents the cells from being damaged by drying during the ∼1 to 2 min requiredto execute the crucial plasma membrane–disrupting step of each of these techniques.

BASICPROTOCOL

SCRAPE LOADING

Transient, survivable plasma membrane disruptions are produced in the presence of themolecule to be loaded by tearing the cells off of their culture substratum (McNeil et al., 1984).

Materials

Adherent cells of interest, growing in tissue culture (also see UNIT 1.1)Dulbecco’s phosphate-buffered saline (DPBS; APPENDIX 2A) or equivalent

physiological saline containing 1 to 1.5 mM CaCl2 at physiological temperature(37°C for mammalian cells)

Loading solution: DPBS (with 1 to 1.5 mM calcium) containing molecule to beloaded, at physiological temperature (37°C for mammalian cells)

Rubber policemanCircular tissue culture dishes

Additional reagents and equipment for cell culture (UNIT 1.1)

1. Culture cells on a substratum to which they adhere strongly and which allows anunobstructed approach with a rubber policeman (see step 4).

Circular-profile tissue-culture-grade dishes are usually a good choice for mammalian cells,as unimpeded access is available after the lid has been removed.

Basic techniques for culturing mammalian cells are presented in UNIT 1.1.

2. Wash the cells twice with 37°C DPBS (or other physiological saline compatible withthe macromolecule to be loaded and with cell viability).

This and all saline solutions used in subsequent steps should be maintained as closely aspossible to 37°C, the optimum resealing temperature.


20.1.2

DirectIntroduction ofMolecules into

Cells

3. Remove the second DPBS wash. Add the loading solution and swirl to mix itthoroughly with any plain saline that might still be present on top of the cell layer.

The minimal volume required is that which will prevent cell-drying damage during theminute or two of the scraping procedure.

4. Scrape the cells off of their substratum using a rubber policeman. Leave the cells 5to 10 min in the loading solution before proceeding with the next step. Check forcompleteness of cell removal by examining with a phase-contrast microscope.

5. Mix the now suspended and loaded cell population with a 10-fold or larger volumeof plain DPBS, and wash the cells several times by centrifuging for 10 to 20 min at5000 × g, at a temperature appropriate for the cell type, removing the supernatant,resuspending the cells in ≥10 volumes of DPBS, and repeating the centrifugation.

6. Replate the cells and return them to normal culturing conditions if the goal is to studyadherent, loaded cells, e.g., for microscopic analysis, or use them immediately after washingif the goal is to study suspended, loaded cells, e.g., for flow cytofluorometric analysis.

ALTERNATEPROTOCOL 1

SCRATCH LOADING

Partial, rather than total, cell removal (as in Basic Protocol), as well as severing of cellprocesses, is used to create plasma disruptions (Swanson and McNeil, 1987).

Additional Materials (also see Basic Protocol)

30-G syringe needle or similar sharp implement (e.g., Fisher)Glass coverslips

1. Culture cells on any substratum to which they adhere strongly and which allowsapproach with a syringe needle tip (see step 4).

A glass coverslip is a good choice, especially if the goal is to observe loaded cells underthe microscope. Basic techniques for culturing mammalian cells are presented in UNIT 1.1.

2. Wash the cells twice with DPBS (or other physiological saline compatible with themacromolecule to be loaded and with cell viablility).

If using a coverslip, the washings are easily accomplished by grasping the coverslip withforceps and then transferring it from one beaker containing saline wash to another.

This and all saline solutions used in subsequent steps should be maintained as closely aspossible to 37°C, the optimum resealing temperature.

3. Cover the monolayer with loading solution and mix well to ensure that the loadingsolution combines thoroughly with any plain saline still present on top of the layer.

If a coverslip is being used, pipetting the loading solution onto and off of the cells severaltimers will accomplish this.

4. Scratch the monolayer surface one or more times with a 30-G syringe needle.

This will denude small (two- to four-cell-wide) strips of the monolayer. Loaded cells willbe present along these denuded zones but not elsewhere in the culture. Increasing thenumber of scratches will increase the proportion of loaded cells.

5. Wash the monolayer three to four times thoroughly with plain DPBS or otherappropriate physiological saline.

6. Examine or experiment with the cells.

The cells are ready for immediate microscopic analysis. Many of the successfully loadedcells along the denudation sites will have morphologies quite normal in appearance; otherswill be slightly rounded. Within ∼30 min, loaded cells will display obvious signs ofviability—locomotion into the denuded zone and division there ∼12 to 24 hr later.

Current Protocols in Cell Biology Supplement 18

20.1.3


ALTERNATEPROTOCOL 2

BEAD LOADING

Survivable plasma membrane disruptions are produced in the presence of the moleculeto be loaded by the impact of glass beads falling onto and rolling across cells, whichremain adherent to the culturing substratum (McNeil and Warder, 1987).

Additional Materials (also see Basic Protocol and Alternate Protocol 1)

Glass beads, 50- to 500-µM diameter (Sigma)Glass coverslips

1. Culture cells on any substratum to which they adhere strongly and which will allowglass beads to be added and removed (see steps 3 and 4).

A glass coverslip is convenient for this purpose. Basic techniques for culturing mammaliancells are presented in UNIT 1.1.

2. Wash cells twice with DPBS and immerse them in loading solution (see AlternateProtocol 1, steps 2 and 3). Mix the loading solution well with any residual DPBS.

3. Sprinkle glass beads (50- to 500-µm diameter) onto the cell monolayer evenly, until∼75% of the monolayer surface appears, by eye, to be covered by them.

To increase the frequency of loading, cause the beads to roll around on the monolayer byrocking it to and fro several times. The glass beads can be used “off the shelf,” or sterilizedby autoclaving if desired in experiments where sterility must be maintained.

4. Wash monolayer thoroughly with plain DPBS to remove beads and loading solution(see Alternate Protocol 1 for technique).

5. Examine or experiment with cells.

As with Alternate Protocol 1, many cells will have apparently normal morphologiesimmediately after this loading procedure.

ALTERNATEPROTOCOL 3

SYRINGE LOADING

Survivable plasma membrane disruptions are created in the presence of the molecule tobe loaded by shear forces generated by aspirating and expelling cells repeatedly through anarrow orifice, such as that of a syringe needle or micropipettor tip (Clarke and McNeil, 1992).


Adherent or suspension cells of interest, growing in tissue culture (UNIT 1.1)30-G syringe needle and 1-ml syringe or micro- or ultramicropipettor (1- to 10-µl

range) and appropriate pipet tips (e.g., Fisher)

1. Trypsinize or otherwise harvest cells (UNIT 1.1), and wash twice, each time bycentrifuging for 10 to 20 min at 5000 × g, at a temperature appropriate for the cells,removing the supernatant, resuspending the cells in ≥10 volumes of PBS, andrepeating the centrifugation.

Basic techniques for mammalian cell culture, including trypsinization, are presented inUNIT 1.1.

2. Resuspend the pellet from the final wash in the loading solution.

3. Draw the cell suspension up into a 1-ml syringe fitted with a 30-G needle, or into amicro- or ultramicropipet tip and then expel it (five to ten times is a good startingpoint). Repeat this maneuver as many times as necessary in order to achieve thedesired compromise of loading level in comparison to cell viability (see CriticalParameters).


20.1.4


Cells

4. Wash the cells (see Basic Protocol, step 5).

5. Replate the cells and return them to normal culturing conditions if the goal is to studyadherent, loaded cells, e.g., for microscopic analysis, or use them immediately afterwashing if the goal is to study suspended, loaded cells, e.g., for flow cytofluorometricanalysis.

COMMENTARY

Background InformationThe capacity to seal a plasma membrane

disruption is critical to the survival of manycells (McNeil, 2002). This is because manynormal, mechanically active cell environments,including many tissues of the body, promotemembrane disruption injury. Resealing, inother words, is not merely Nature’s gift to theexperimental biologist. Knowledge of this ca-pacity did, however, lead to the development ofeach of the techniques described in this unit.Conditions that promote resealingphysiologi-cal temperature and calcium levelsmust bemaintained during each procedure.

How does one choose among the variousmethods presented—scrape loading, scratchloading, bead loading, and syringe loading? Ifanalysis post-loading is best done on a suspen-sion of cells, e.g., flow cytofluometry, thenscrape or syringe loading should be used; if itis best done on adherent cells, e.g., microscopy,then scratch or bead loading should be used.However, scrape, scratch, and bead loadingrequire adherent cells as starting material.

Microinjection is the most obvious alterna-tive method. In cases where there is a minimal,limited amount of reagent for loading, microin-jection is unrivaled in its economy of reagent:one needs only enough of the reagent to load amicroneedle, e.g., less than a microliter. How-ever, mictoinjection requires special equipmentand is labor intensive. The loading techniquesdescribed in this unit are by comparison, farless costly to implement and easier to learn.Moreover, they can produce virtually unlimitednumbers of loaded cells in minutes.

Critical ParametersThe common feature of all of these tech-

niques is that they bring mechanical force tobear on cells in order to create transient plasmamembrane disruptions. Normally impermeantmolecules can then enter into the cytosol, untilresealing prevents further access. Therefore, toincrease loading efficiency by these mechanicallybased techniques, one simply increases the forceapplied and hence the number and size of thedisruptions. On the other hand, as the extent of

plasma membrane disruption increases, viabil-ity decreases. Hence, when first attempting toload a particular cell by these techniques, it willusually be advisable to vary the mechanicalforce imposed over a wide range, and then toselect the loading conditions that provide anacceptable level of both loading and viability.

The following provides some guidelines formanipulating the level of mechanical force im-posed by each technique.

In scrape loading (see Basic Protocol), theextent of plasma membrane disruption is mainlya function of the strength of cell-substratum at-tachment. Agents such as poly-L-lysine can, formany cells, be used to increase adhesion andtherefore loading efficiency. Conversely, a washor two with Ca2+-free saline decreases adhesionfor many cultured cells, and therefore decreasesthe level of loading. These same considerationsapply also to the closely related technique ofscratch loading (Alternative Protocol 1).

In bead loading (see Alternate Protocol 2),the extent of plasma membrane disruption de-pends on the size of the beads employed (theauthors have used beads ranging from 50 to 500µm in diameter), the number of beads sprinkledonto the cells, and the degree to which the beadsare caused to roll around on the monolayer.

In syringe loading (see Alternate Protocol3), the size of the orifice and probably otherhydrodynamic factors related to barrel lengthand shape are important. Certainly, smaller ori-fices, which produce greater shear forces, resultin increased loading. Additionally, higher ejectionpressures increase loading efficiency. The authorsof this unit have described an automated devicethat allows one to precisely control pressure, butthis is not necessary unless one desires a high levelof reproducibility between one loading procedureand the next (Clarke and McNeil, 1994). Anynarrow-bore orifice can be used, and the authorsoften find it convenient in minimizing loadingsolution volume to employ a micropipettor andpipet tips instead of a syringe and needle.

Resealing does not occur in the cold or inthe absence of Ca2+, so these conditions mustbe avoided during the step when plasma mem-


20.1.5


brane disruptions are being created, and for ∼1min thereafter (McNeil and Steinhardt, 1997).

TroubleshootingSuccessful loading by the techniques de-

scribed in this unit requires: (1) that sufficientmechanical force be brought to bear on the cellplasma membrane for tearing or disrupting it;and (2) that the cell then be able to reseal thedisruption thus created. Poor efficiency in load-ing can be explained by a problem in either orboth of these two areas.

One or more, though not necessarily all, ofthe techniques described above will result inthe imposition of sufficient force for the loadingof most mammalian cells. For example, cellssmaller than a typical cultured mammalian cellkept in suspension (∼10 µm diameter orgreater) may not be amenable to syringe load-ing with a 30-G needle; a needle of this boremay not impose sufficient shear stress, andanother technique must be utilized. As a casein point, the authors have found that mammal-ian red blood cells (∼5 µm diameter) are notsusceptible to wounding by syringe loading (P.McNeil, unpub. observ.). Red blood cells can,however, be wounded by scraping after theyhave been stuck to a plastic substratum coatedwith poly-L-lysine.

On the other hand, too much force can createdisruptions too large or too numerous to beresealed. Low (<50%) recovery of viable cellsis a key indicator of this problem, which can besolved by reducing the amount of mechanicalforce applied. For example, this can be accom-plished by using smaller beads in the bead-loading technique, by using a larger-gauge nee-dle or fewer intake and expulsion strokes in thesyringe-loading technique, or by treatmentsthat loosen cell substratum adherence (such asprescraping rinses with low-calcium mediumfor mammalian cells) in the scrape-loadingtechnique. Moreover, it is essential for cellviability when applying these membrane-dis-rupting techniques that resealing occur. For thisto happen, cells need physiological levels ofextracellular Ca2+ and a near-physiologicaltemperature. Thus, if loading fails, with a heavyloss of cell viability, one should check to ensurethat these two requirements have been met—both during the loading procedure, when dis-ruptions are being created, and for the 1- to5-min period after membrane disruption is in-itiated, when resealing is taking place.

A few cell types, notably echinoderm eggs,reseal extremely rapidly (even with disruptions>1000 µm2 in extent), and so provide the ex-

perimenter much less temporal access to cy-tosol. Indeed, it is the authors’ experience thatthese cells are difficult to load by the techniquesdescribed, but easy to microinject since they arerarely killed by this membrane-disrupting tech-nique. In theory, this rapid resealing capacitycould be countered by reducing extracellularCa2+ below physiological levels or by chillingthe cells that rapidly reseal.

Anticipated ResultsThe authors and others have successfully

loaded fibroblasts, endothelial cells, smoothmuscle cells, epithelial cell lines, neurons, andfree-living amebas with these techniques. It isexpected that they will work on almost any celltype lacking a cell wall.

The extent of loading is a direct function ofthe concentration of the macromolecule and aninverse exponential function of its molecularweight. Both of these observations are similarto what would be predicted for a process de-pendent on diffusion down a concentration gra-dient through a hole in an otherwise imperme-able barrier. Therefore smaller molecules aremore effectively loaded than larger ones, andthe highest possible concentration of the mole-cule to be loaded should be employed in theloading solution. One can expect from all ofthese techniques that the extent of loading willvary over a large range (three-log scale as as-sessed by flow cytofluorometry). This can beof advantage if one wishes to conduct, forexample, a dose-response type of experiment.If, on the other hand, a homogeneous popula-tion of, say, heavily loaded cells is desired, thensome selection process must be employed, suchas flow sorting or microscopic discrimination,based on whole-cell fluorescence derived fromthe macromolecule loaded.

Time ConsiderationsThese techniques are very rapid, generally

taking <30 min.

Literature CitedClarke, M.S.F. and McNeil, P.L. 1992. Syringe load-

ing introduces macromolecules into living mam-malian cell cytosol. J. Cell Sci. 102:535-541.

Clarke, M.S.F. and McNeil, P.L. 1994. Syringe load-ing: A method for inserting macromolecules intocells in suspension. In Cell Biology: A Labora-tory Handbook, vol. 3. (J.E. Celis, ed.) pp. 30-36.Academic Press, San Diego, Calif.

Doberstein, S.K., Baines, I.C., Wiegand, G., Korn,E.D., and Pollard, T.D. 1993. Inhibition of con-tractile vacuole function in vivo by antibodies


20.1.6


Cells

against myosin-I [see comments]. Nature.365:841-843.

McNeil, P.L. 2002. Repairing a torn cell surface:Make way, lysosomes to the rescue. J. Cell Sci.115:873-879.

McNeil, P.L. and Steinhardt, R.A. 1997. Loss, res-toration and maintenance of plasma membraneintegrity. J. Cell Biol. 137:1-4.

McNeil, P.L. and Warder, E. 1987. Glass beads loadmacromolecules into living cells. J. Cell Sci.88:669-678.

McNeil, P.L., Murphy, R.F., Lanni, F., and Taylor,D.L. 1984. A method for incorporating macro-molecules into adherent cells. J. Cell Biol.98:1556-1564.

Swanson, J.A. and McNeil, P.L. 1987. Nuclear re-assembly excludes large macromolecules. Sci-ence 238:548-550.

Terasaki, M., Miyake, K., and McNeil, P.L. 1997.Large plasma membrane disruptions are rapidlyresealed by Ca2+-dependent vesicle-vesicle fu-sion events. J. Cell Biol. 139:63-74.

Contributed by Paul L. McNeilMedical College of GeorgiaAugusta, Georgia


20.1.7


UNIT 20.2Protein Transduction: Generation ofFull-Length Transducible Proteins Using theTAT System

Described here is the technology that allows an investigator to transduce full-lengthproteins by utilizing a minimal, eleven–amino acid, HIV-TAT transduction domain thatcan be fused to a protein of choice using the pTAT or pTAT-HA protein expressionplasmids. Bacterial expression (see Basic Protocol 1), followed by solubilization ofprotein aggregates with a denaturing agent, affords high yields of transducible fusionprotein. The fusion protein, once added to the culture medium, can cross the cellmembrane and then be degraded or refolded by the cellular machinery. Correct targetingand function of the fusion protein can be easily examined by fluorescent microscopy orimmunohistochemistry.

This strategy was established and improved to its current state by the purification andtransduction of a multitude of fusion proteins. Because the pool of fusion proteins spanmany different functions including sequestering proteins (i.e., p16, p27, and CDK2DN),proenzymes (caspase-3), viral proteins (HPV E6, E7, and E1A), enzymes (HIV protease,β-galactosidase), GTPases (rac, rho and cdc-42), and transcriptional regulators (E2F-1-5,pRb), the protocols cover a wide variety of commonly used protein isolation andcharacterization methods. Table 20.2.1 lists a few examples of some of TAT fusions anddetails the size, optimal isolation method, dose required to yield a phenotypic result,biological result obtained, and time in which the result was observed.

No special equipment is necessary to generate or transduce fusion proteins, althoughBasic Protocol 2 does recommend the use of fast protein liquid chromatography (FPLC)to reproducibly bind and elute denatured fusion proteins. FPLC, although recommended,is not required. Bulk ion-exchange resins are available and have been successfully usedin place of the Mono Q/Mono S resins that Basic Protocol 2 describes. Another frequentlyused column is the PD-10 column (Amersham Pharmacia Biotech). This is a disposablecolumn, packed with a gel-filtration resin, which is ideal for the removal of smallmolecules such as salt, urea, or unconjugated fluorescent molecules.

The unit illustrates the steps of the basic procedure with various fusions, to give theinvestigator a broader base of information upon which to begin specific isolations.

CAUTION: TAT-protein fusions have been shown to cross most lipid bilayers, includingall tissues in a mouse. Therefore, when designing and using TAT-fusion proteins, precau-tions regarding safe handling and disposal are necessary. It is very important to analyzethe health effects of each fusion protein individually and to observe appropriate biosafetyprocedures for disposal and decontamination. The authors suggest using a 0.1% (w/v)trypsin solution to decontaminate any large spills of fusion proteins. NIH Biosafety Level2/3 containment should be used at all times. Also, refer to Backus et al. (2001), whichprovides further guidelines for the safe handling of TAT-transducing proteins.

STRATEGIC PLANNING

This unit is broken down into two sections: (1) isolation, optimization, and large-scaleproduction of the fusion protein (see Basic Protocols 1 and 2 and Alternate Protocols 1to 4) and (2) analysis of the transduction of the fusion proteins into target cells (see BasicProtocol 3 and Alternate Protocol 5). This unit contains a compilation of different

Supplement 18

Contributed by Michelle Becker-Hapak and Steven F. DowdyCurrent Protocols in Cell Biology (2003) 20.2.1-20.2.25Copyright © 2003 by John Wiley & Sons, Inc.

20.2.1

Expression andIntroduction ofMacromoleculesin Cells

techniques that have been used to successfully isolate many different fusion proteins. Onerule of thumb that must be remembered is that every TAT fusion protein is unique, and,while the method described in this unit can cover many fusions, every fusion is different.Therefore the following describes a starting point to begin one’s isolations. Figure 20.2.1,outlines the overall strategy.

Isolation and Purification of Fusion Protein

In general, first identify bacterial clones expressing the cDNA of interest using the pTATor pTAT-HA expression vector (Fig. 20.2.2). The plasmid containing the appropriate insertis then transformed into an E. coli strain that is specifically designed for the expressionof recombinant proteins. Then, clones expressing the desired fusion may need to beboosted with inducer molecules such as IPTG to yield sufficient quantities of fusionprotein for the desired study. The pTAT/TAT-HA vector utilizes a 6-His domain for theconvenient isolation of recombinant protein by Ni-NTA chromatography resin. The 6-Hisdomain can lead to fusions that are generally insoluble and compartmentalized intoinclusion bodies within E. coli. Therefore, buffered urea is routinely used as a denaturingagent to obtain large quantities of unfolded recombinant protein that can bind to the nickelaffinity resin. Once the protein is bound and the resin washed, imidazole is used as acompetitor to elute the fusion protein from the nickel resin.

Table 20.2.1 Detailed Description of Selected TAT-Fusions

Fusion protein Apparentsize (kDa)

Isolationmethod

In vitrodose (nM)

Biological effect

Time biological effect was examined References

TAT-p16 WT 24 Denaturing/PD-10

200-1000 Inhibitor ofCDK4/6, andinduces G1arrest

30 hr after addition, toG1-arrested,synchronized cells

Ezhevsky etal., 1997

TAT-HA-p27 WT 35 Denaturing/Mono Sion-exchange

100-200 Inhibitor ofCDK2/4/6complexes, andinduces cellscattering

30 min Nagahara etal., 1998

TAT-E1A WT 60 Denaturing/rapiddialysis

100 Sequesters pRb 15 min Unpub.observ.

TAT-HA-E7 Wt 20 Denaturing/PD-10

100 Sequesters pRb 3 hr Lissy et al.,1998

TAT-HA-CDK2 DN 40 Soluble/PD-10

200 Inactivatescyclin E:CDK2complexes,resulting in G1arrest

30 hr after addition tosynchronized cells

Nagahara etal., 1998

TAT-HA-Caspase 3 WT 39 Denaturing/Mono Qion-exchange

100 Processed forminducesapoptosis

1-6 hr Vocero-Akbaniet al., 1999

TAT-HA-HIV protease 20 Denaturing/Mono Sion-exchange

100 Cleaves HIVproteaseRecognitionsequence

1-6 hr Vocero-Akbaniet al., 1999

TAT-HA-β-galactosidase 120 Soluble/PD-10

100 Cleaves ONPGand Xgal

30 min Schwarze etal., 1999

TAT-HA-cdc42 21 Denaturing/PD-10

25 Filopodiaformation

5 min Becker-Hapak et al., 2001


20.2.2

TAT-mediatedProtein

Transduction

To remove the urea from the peak nickel affinity protein fraction, one of three differentapproaches can be used: ion-exchange, gel filtration, or rapid dialysis. The most reliablemethod for producing transducible recombinant proteins from inclusion bodies is throughthe use of strong ion-exchange resins to capture the unfolded protein by its ionic chargeon an anion (Mono Q) or cation (Mono S) exchange resin using an FPLC platform. Oncethe unfolded protein is captured, the environment in the column is immediately changedto an aqueous one. The protein is quickly released from the resin using a salt bump, whichtheoretically leads to a pool of correctly folded and misfolded proteins. The pool ofproteins is then desalted and ready for use or storage. The routine method of urea removalfrom bacterially expressed proteins involves the removal of the denaturant by slowdialysis. While this method works when preparing small quantities of soluble, properlyfolded proteins, dialysis of high concentrations of the TAT-fusion proteins usually leadsto dramatic protein precipitation. Another method of urea removal utilizes a disposablegel-filtration column (PD-10) to exchange the buffer environment around the protein. Thisprocedure has afforded somewhat better success than dialysis, but it is not routinelyadvisable. Note that the PD-10 column is used in this unit for more than one purpose.While it is not recommended to routinely remove urea from the nickel chromatographypurification portion of the procedure, it is ideal for buffer exchange and removal of smallmolecules such as unconjugated FITC.

In some cases, the 6-His TAT-fusion proteins are maintained in the bacterium in a solubleconformation. In these rarer cases, the fusion protein can be isolated after simplysuspending the bacteria in an aqueous buffer, sonicating then clarifying the suspension,and finally performing nickel affinity chromatography.

identify high-expressing clones

(1-2 days)

large-scale culture

(1 day)

purify protein

*denaturing conditions

*ionexchange

PD-10 rapiddialysis

PD-10

PD-10

soluble conditions

(2-3 days)

(1-2 days)

visualize transduction

determine biological function

clone and confirm construct

Figure 20.2.1 Flow diagram outlining the overall strategy and time frame required to performprotein transduction using the TAT system. Asterisks (*) denote the preferred methods thatconsistently lead to fusions that are biologically active.


20.2.3


Tranduction and DetectionTwo general methods are given for monitoring of full-length TAT-fusion transduction intotarget cells. The first method detects the intracellular location of the fusion protein, byfluorescently labeling the protein using fluorescein isothiocyanate (FITC), adding thelabeled protein to the target cells, washing, fixing, and then observing the resultanttransduction by fluorescence microscopy. This standard method for protein labelingcovalently attaches the fluorescein molecule to basic residues such as lysine and arginine.Eight out of the eleven amino acids in the TAT-transduction domain are comprised ofthese basic residues and over-labeling in this functional domain can lead to artificialinhibition of transduction.

The second method given to detect protein transduction is indirect immunofluorescence.This method uses commercially available, fluorescent antibodies to detect transducedprotein within cells that have been subjected to the fusion protein over various amountsof time, washed, and then fixed. It is the method of choice when detecting transductionon adherent cells.

Both of these methods focus solely on detection of the fusion protein inside the cell andprovide no evidence of fusion protein function. Phenotypic results of fusion-targeted

Nco

IK

pnI

Age

IX

hoI

Sph

IE

coR

IB

stB

I

ATG-6His-TAT-MCS-Ts term.T7

pTAT/pTAT-HA~3 kbAmpr

T7 promoter

ATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGATAATTTTGTTTAACTTTAAGAAGGAGATATACAT

ATG CGG GGT TCT CAT CAT CAT CAT CAT CAT GGT ATG GCT AGC ATG ACT GGT M R G S H H H H H H G M A S M T G

GGA CAG CAA ATG GGT CGG GAT CTG TAC GAC GAT GAC GAT AAG GAT CGA TGG G Q Q M G R D L Y D D D D K D R W

TAT-domainEagI BamHI

GGA GGC TAC GGC CGC AAG AAA CGC CGC CAG CGC CGC CGC GGT GGA TCC G G Y G R K K R R Q R R R G G S

KpnI AgeI XhoI SphI EcoRI BstBi

ACC ATG GCC GGT ACC GGT CTC GAG GTG CAT GCG GTG AAT TCG AAG CTT T M A G T G L E V H A V N S K L

originalNcoI - (inactive) AatII

NEWNcoI

HA insertion

NcoI

CC ATG TCC GGC TAT CCA TAT GAC GTC CCA GAC TAT GCT GGC TCC ATG......insertM S G Y P Y D V P D Y A G S M

HA-tag

...GAT CCG GCT GCT AAC AAA GCC CGA AAG GAA GCT GAG TTG GCT GCT GCC ACC GAG CAA TAA D P A A N K A R K E A E L A A A T E Q ***

pRSET reverse priming sequence

BamHI

Figure 20.2.2 Vector map of pTAT/pTAT-HA. The functional domains are in boldface. Convenientforward and reverse priming sequences are noted, as well as the peptide sequence of the TAT-HAleader. The pTAT vector does not contain the HA insert. Insertion of desired cDNA using any of therestriction enzymes noted in the multiple cloning site (MCS) will yield an in-frame fusion.


20.2.4

TAT-mediatedProtein

Transduction

events are clearly the ultimate detection of protein transduction however, these methodsare fusion specific and will not be covered in this unit.

ControlsDepending on the goal of the study, one may choose to use one of two negative controls.The first control to consider is the preparation of a 6-His-fusion of the protein of interestwithout the transduction domain. This control would be advantageous in cases whereproof of the transduction is required. If this is necessary, simply digest the pTAT/pTAT-HAvector containing the cDNA of interest with BamHI, purify, and re-ligate. This will “popout” the TAT domain of the protein while maintaining the expression of the 6-His-HAtagged protein of interest. Removal of the TAT transducing domain can be verified bydigestion of the re-ligated plasmid with the restriction enzyme EagI (Fig. 20.2.2). If thetransducing domain has been removed, it will no longer be possible to linearize theplasmid with this restriction enzyme. The purification of this species is generally the sameas for the TAT-fused protein.

The second control to consider is the creation of a site-specific mutant within the proteinof interest. These fusions are highly recommended when doing in vitro studies in orderto prove the specificity of the TAT-fusion protein. Generally, no major deviations fromthe already optimized protocol for the wild-type fusion will be necessary.

BASICPROTOCOL 1

EXPRESSION, VERIFICATION, AND YIELD OPTIMIZATION OFTAT-FUSION PROTEINS

This protocol assumes that the investigator has already confirmed the insertion of thecDNA of interest into the TAT expression vector, as well as the identity of the cDNA. Itis important that the DNA sequence be confirmed and that the possibility of frame shiftsor point mutations be eliminated. The verified plasmid should be stored as a glycerol stockin E. coli, DHSα. Storage of the plasmid in bacteria used for protein expression is notgenerally recommended because of possible plasmid instability. If the investigator needsfurther background into creating fusion cDNA, see APPENDIX 3A, which provides referencesfor procedures that are not described in detail in this unit.

Materials

Pure pTAT/pTAT-HA expression vectors (Nagahara et al., 1998) with and withoutthe gene of interest inserted (available from Dr. S. Dowdy, [email protected])

E. coli strains BL-2 (DE3) pLysS (Novagen) and DH5α (Invitrogen, LifeTechnologies)

LB medium and plates both containing 50 µg/ml ampicillin (see recipe)2× SDS-PAGE sample buffer (APPENDIX 2A)Antibody specific for target protein or anti-HA mAb (Berkeley Antibody

Company) if using pTAT-HA vectorGlycerol, ultrapure, 50% (v/v), sterile filtered

Additional reagents and equipment for SDS-PAGE (UNIT 6.1), immunoblotting (UNIT

6.2), Coomassie blue staining (UNIT 6.6), and basic molecular biology procedures(including transformation of bacteria and IPTG induction; see APPENDIX 3A)

1. Transform the verified, pure plasmid, into competent E. coli strain BL-21(DE3)pLysS(APPENDIX 3A). Select transformants on LB plates containing 50 µg/ml ampicillin. Alsotransform the original vector (without the gene of interest) in the same E. coli strainfor later use as a whole bacterial protein control (empty-vector control).

This bacteria will not produce any detectable 6-His fusion protein if using the pTAT vector,or will express the hemagglutinin antigen (HA-tag) if using the pTAT-HA vector (6 to 9kDa).


20.2.5


2. Incubate the agar plate overnight. Pick 6 to 10 colonies from the fusion-positive plateand grow in 3 ml of liquid LB medium containing 50 µg/ml ampicillin, overnight at37°C with shaking at 220 rpm. Pick one colony from the empty-vector control plateand grow in the same fashion.

3. Vortex the overnight cultures. Remove 50 µl of each culture and place into anindividual microcentrifuge tube containing 50 µl of 2× SDS-PAGE sample buffer.

4. Vortex briefly and heat samples 5 min in a boiling water bath.

5. Microcentrifuge the lysate 3 min at maximum speed, room temperature, to bringdown any particulates.

6. Load 20 µl of each supernatant from step 5 (including that from the negative control)on two separate SDS-PAGE gels of the appropriate percentage (UNIT 6.1).

One gel will be stained with Coomassie Brilliant Blue (UNIT 6.6) and the other will betransferred to nitrocellulose for immunoblotting (UNIT 6.2).

7. Place one of the two gels in Coomassie Brilliant Blue staining solution for 1 hr withgentle agitation, then remove staining solution and replace with destain solution.Change the destaining solution every 15 min until desired background is achieved.

The procedures and solutions used here are described in UNIT 6.6.

8. In the lanes containing the clones of interest, determine if there is an overexpressedband at the appropriate size when compared to the lane loaded with lysed bacteriatransformed with pTAT or pTAT-HA alone (the empty-vector control). If no cleardifferences are evident, rely on the immunoblot for confirmation of the expressionof the fusion protein.

9. Perform immunoblotting and detection procedures (UNIT 6.2). Use the anti-HA mAbat a 1:5000 dilution for the primary antibody if using the HA tag as a marker to followfusion protein expression. For an antibody against a specific protein, use the dilutionrecommended by the manufacturer. Use the secondary antibody (UNIT 6.2) at aconcentration of 1:1000.

The authors typically use extended-life chemiluminescent development reagents such asSuperSignal (Pierce).

10. Using the results from the immunoblot, determine the size of the fusion protein.

The TAT/TAT-HA fusion proteins run 6 to 9 kDa larger than the untagged gene of interest.

11. Optional: If a sufficient level of overexpression of the desired fusion is not observedby immunoblotting, induce the system using IPTG (APPENDIX 3A).

See Troubleshooting for other possible solutions to poor fusion expression.

12. Determine the clone or clones that express the protein of interest at the highest levels.Prepare glycerol stocks by adding 700 µl of overnight culture into 300 µl of sterile50% glycerol, and freeze at −80°C.

As mentioned earlier, not all fusions are stable in BL-21(DE3)pLysS bacteria. If this isdiscovered, transform into the expression bacteria, let the cells recover for 1 hr withoutantibiotic selection, and then prepare a 100-ml overnight inoculum in LB medium contain-ing 5 �g/ml ampicillin. Use this culture to inoculate a large-scale culture as described inthe next section.

Also, for permanent storage of the unstable plasmid, transform the plasmid into DH5α andstore as glycerol stock at −80°C as mentioned earlier.


20.2.6

TAT-mediatedProtein

Transduction

BASICPROTOCOL 2

LARGE-SCALE ISOLATION OF THE TAT-FUSION PROTEIN

This protocol describes the large-scale isolation of the TAT-fusion protein from thehigh-expressing clones identified in the previous steps. See Key References for moreinformation on these approaches. To perform ion exchange, it is necessary first todetermine the isoelectric point (pI) of the purified protein. This can be done easily onvarious molecular biology Web sites (see Internet Resources for one of these). It is thennecessary to determine which ion-exchange resin will best suit the protein. The pI of thefusion protein will, in large measure, determine whether to use a Mono Q column (forbasic proteins) or a Mono S column (for acidic proteins). Although the TAT leader is abasic entity (8 of 11 residues are basic), it has been the experience of the authors that∼50% of all TAT fusion proteins will bind to the Mono S resin regardless of pI predictions.Following the successful elution of the protein, pool the appropriate fractions andexchange the buffer using a PD-10 column. The columns are provided as prepackeddisposable columns of 30 per box and should be stored at 4°C.

In general, when isolating proteins from crude extracts, the preparation should be kept inthe cold or on ice. However, in this procedure, it is not necessary to keep the preparationon ice until the urea has been removed from the sample, except when sonicating thebacteria. In fact, if the Ni-NTA purified fractions are kept on ice after elution from thecolumn, crystallization of the eluate will be observed. Therefore, during this phase, avoidcold conditions unless it is necessary to freeze the partially purified protein for storageand later purification.

Materials

LB medium containing 50 µg/ml ampicillin (see recipe)Glycerol stock of clone with high expression of TAT fusion protein (see Basic

Protocol 1)Phosphate-buffered saline (PBS; APPENDIX 2A)Buffer Z (see recipe) containing 1× protease inhibitors (see recipe)5 M (340 g/liter) imidazole (store in foil-wrapped bottle at 4°C)50% (w/v) stock suspension of Ni-NTA agarose (Qiagen)100 mM, 250 mM, 500 mM, and 1 M imidazole in buffer Z (see recipe for buffer

Z), prepared fresh dailyPBS (APPENDIX 2A) containing 0.1% (w/v) sodium azide20 mM HEPES, pH 8 (for Mono Q resin) or pH 6.5 (for Mono S resin)Buffer A (binding): 20 mM HEPES, pH 8.0, for Mono Q; pH 6.5 for Mono SBuffer B (elution): 20 mM HEPES/1 M NaCl, pH 8.0, for Mono Q; pH 6.5 for

Mono SPBS (APPENDIX 2A) containing 1× protease inhibitors (see recipe)Bovine serum albumin (BSA)Glycerol (ultrapure), 50% (v/v) sterile filtered

Sorvall refrigerated centrifuge with GSA rotor, or equivalentSonicator with microprobe (Branson)Disposable 50-ml Econo columns (Bio-Rad)Mono Q or Mono S 5/5 or 10/10 ion-exchange FPLC columns or bulk resin

(Resource Q or S), all products of Amersham Pharmacia BiotechFPLC apparatusPD-10 gel filtration columns (Amersham Pharmacia Biotech)

Additional reagents and equipment for SDS-PAGE (UNIT 6.1) and Coomassie bluestaining (UNIT 6.6)


20.2.7


Prepare fusion-protein-containing lysate1. Inoculate 200 ml of LB medium containing 50 µg/ml ampicillin with a sterile loop

or scraping of the high-expressing clone glycerol stock (see Basic Protocol 1).Incubate overnight at 37°C with shaking at 220 rpm.

2. Pour the entire contents of the overnight culture into 1 liter of LB medium containing50 µg/ml ampicillin. Incubate 5 to 6 hr at 37°C with shaking at 220 rpm.

Protein production usually decreases after stationary phase has begun in E. coli.

If it has been determined that IPTG is required to obtain large quantities of the protein, besure to add it at this step.

3. Centrifuge the cell suspension 5 min at 5000 × g, 4°C, in a Sorvall GSA or equivalentrotor. Discard supernatant.

4. Resuspend pellet in PBS. Centrifuge the suspension again as in step 3.

The washed pellet can be stored at −20°C for one month if necessary.

5. Decant supernatant and add 10 ml buffer Z with protease inhibitors to the pellet. Makea homogenous suspension by pipetting up and down using a wide-bore pipet, or byvortexing.

A homogenous suspension is critical for efficient lysis of the bacteria by sonication in thenext step.

6. Sonicate the suspension using four 15-sec on/off cycles at 60% (microtip limit), at4°C or on ice.

The cold temperatures are required to keep the proteins from being irreversibly denaturedby the heat generated during the sonication process.

7. Centrifuge the suspension 10 min at 12,000 × g, 4°C. Carefully decant the supernatantinto a clean tube and measure its volume, then add sufficient 5 M imidazole to a finalconcentration of 20 mM imidazole.

The concentration of imidazole to add at this point must be determined experimentally. Inmost cases the fusion protein binds specifically at 20 mM imidazole; however, some proteinswill require lower concentrations (from 5 to 15 mM). At lower imidazole concentrations,the background (non-6-His labeled proteins) can also bind to the nickel resin. Usually, thisis not a problem because the desired protein is in vast excess with respect to the contami-nating proteins. Additionally, the contaminating bacterial proteins do not contain thetransduction domain and therefore will not transduce.

Purify fusion protein on Ni-NTA agarose8. Prepare a 5-ml bed volume Ni-NTA affinity column by adding 10 ml of the 50% stock

suspension of Ni-NTA agarose to a 50-ml Bio-Rad Econo-Column with the Luer lockin place to control the flow of buffers or extract to be added.

9. Wash the resin twice, each time with 10 bed volumes (50 ml) of Milli-Q water, toremove the resin storage buffer.

10. Equilibrate the resin with 10 bed volumes of buffer Z containing 20 mM imidazole(or whatever concentration of imidazole was added as in step 7).

Remember to save a small portion of each purification step so that it will be possible tofollow the protein purification by SDS-PAGE.

11. Apply the clarified sonicated bacterial lysate (from step 7) to the resin.


20.2.8

TAT-mediatedProtein

Transduction

Some lysates can be very viscous. If this is observed, dilute the lysate with more buffer Zor apply the lysate directly and use slight pressure on the column to gently force the lysatethrough the resin. If the lysate is not very viscous and clears the resin too quickly, reducethe flow rate and apply the lysate over the resin again.

Remember to maintain the imidazole concentration (20 mM or other concentration addedat step 7) throughout the column application and wash steps.

12. Wash the resin with 10 ml of buffer Z containing 20 mM imidazole, then with anadditional 40 ml of buffer Z containing 20 mM imidazole (ten bed volumes total).

The first 10 ml of wash will contain flow through proteins. The subsequent 40 ml is thewash that removes weakly bound proteins.

13. Elute the protein stepwise by sequential addition of 5 ml each of 100 mM, 250 mM,500 mM, and 1 M imidazole in buffer Z, and collect fractions. Finally, strip the resinwith 5 ml of 5 M imidazole.

A

B

mol

. wt.

mar

ker

star

t

flow

thro

ugh

was

h

100

mM

250

mM

500

mM

1000

mM

5000

mM

210116

77

43

32

kDa

TAT-HA-GFP

43

kDa

32 TAT-HA-p27

star

t

flow

thro

ugh

was

h

7.5

8 8.5

9 9.5

10 10.5

11Figure 20.2.3 (A) Typical elution profile of TAT-fusion protein (TAT-HA-GFP) from a Ni-NTA agaroseresin. BL-21(DE3)pLysS bacteria were transformed with pTAT-HA-GFP plasmid and cultured in 200ml of LB medium containing 50 µg/ml ampicillin, overnight. This inoculum was then added to 1 literof LB-ampicillin and cultured for another 5 hr with shaking at 220 rpm, 37°C. The bacteria werelysed in buffer Z with protease inhibitor cocktail (see Reagents and Solutions), clarified, and theimidazole concentration was brought up to 20 mM. The crude lysate was applied to a 5-ml-bed-vol-ume Ni-NTA column and washed with 50 ml of buffer Z containing 20 mM imidazole. The fusionprotein was then eluted with 5 ml aliquots of buffer Z containing 100, 250, 500, 1000, and 5000 mMimidazole. The 12.5% SDS-PAGE gel was loaded with 5 µl of each fraction noted. The gel wasstained for 60 min with Coomassie Blue and destained as necessary. (B) Ion-exchange profile ofTAT-p27 WT on a Mono S (5/5) column, equilibrated in buffer A and loaded with a 1:1 dilution of aNi-NTA elution fraction. The column was washed with 40 ml of buffer A. TAT-HA-p27 WT fusionprotein consistently eluted after 8 through 11 ml of buffer B. 10 µl of each elution fraction wasseparated on a 15% SDS-PAGE gel and stained with Coomassie Blue for 1 hr, then destained asnecessary. The numbers above each band denote the volume of elution buffer (buffer B) that hadpassed through the Mono S (5/5) column.


20.2.9


14. Wash the resin with 20 bed volumes of PBS. Store the column at 4°C in PBScontaining 0.1% sodium azide.

15. Load 10 µl of each purification fraction (from step 13) on an appropriate-percentageSDS-PAGE gel (UNIT 6.1). Perform electrophoresis, then stain the gel with CoomassieBrilliant Blue for 1 hr and destain appropriately (UNIT 6.6).

Note that purified protein can be readily observed as early as 2 min after placing the gelin the staining solution.

16. Determine the fraction(s) that contain the desired protein.

See Fig. 20.2.3A for an example of a typical urea elution profile.

The procedure can be suspended at this step if necessary. The imidazole-eluted fractionsmay be stored at −20°C until the SDS-PAGE is completed and one is ready to do theurea-removal steps (no more than one month).

Purify by ion-exchange chromatography17. Pool the Ni-NTA fractions containing the peak protein concentration determined by

SDS-PAGE.

18. Dilute the pooled fractions 1:1 with 20 mM HEPES, pH 8.0 (for Mono Q), or pH 6.5(for Mono S).

This dilutes the protein pool to a low-enough salt and denaturant concentration to allowbinding to the ion-exchange resin.

19. Inject the sample into a 10/10 (preferably) Mono Q or S column attached to an FPLCapparatus and equilibrated in buffer A.

A gravity column may be used in place of FPLC (see Alternate Protocol 1).

20. Wash with ∼50 ml buffer A and elute with 10 ml buffer B, collecting 0.5-ml fractions.

Switching from the non-urea-containing buffer A to buffer B results in elution via a single1 M NaCl step.

21. Analyze the fractions by SDS-PAGE (UNIT 6.1) and stain with Coomassie BrilliantBlue (UNIT 6.6).

Figure 20.2.3B shows an example of an elution profile from ion-exchange chromatography.The sample is ready at this point for desalting on a PD-10 column equilibrated in PBS,followed by collection and final analysis by SDS-PAGE (steps 22 to 26). The only decisionthat must be made by the investigator at this point is the equilibration buffer to be used.The authors recommend desalting into PBS and adding sterile glycerol to a minimumconcentration of 10% (v/v). For further discussion on the use of this column see Becker-Hapak (2001).

IMPORTANT NOTE: If the protein fails to bind to the predicted resin, or weak binding ofprotein is observed, try the other column type (Mono Q or Mono S) regardless of predictedpI. If strong binding is observed with weak elution, decrease (for Q resin) or increase (forS resin) the pH of buffer A by steps of 0.5 pH units, until a small amount of protein is detectedin the flowthrough fraction. Also see Troubleshooting for problems associated with theion-exchange step.

Perform buffer exchange using PD-10 column22. Drain the storage buffer from the PD-10 column and equilibrate the column with 25

ml of PBS with 1× protease inhibitors.

Culture medium such as RPMI-1640 (e.g., Life Technologies), without serum and antibi-otics, but containing 1× protease inhibitors, can be used in place of the PBS.


20.2.10

TAT-mediatedProtein

Transduction

23. Apply the pooled protein fraction to the column (do not exceed 2.4 ml), and allowthe solution to absorb into the resin. Apply 4 ml PBS with 1× protease inhibitors tothe column and collect fourteen 0.5-ml fractions.

The protein will begin eluting in the sixth or seventh fraction. If 2.4 ml of protein was appliedto the resin, then the protein will stop eluting in the thirteenth or fourteenth fraction.

The column can be reused once by applying another 25 ml of buffer with protease inhibitorsonto the column; however, it is not wise to reuse the column if working with different fusionproteins, because it is always possible to carry over contaminants from a previouspreparation.

24. Analyze the fractions by SDS-PAGE (UNIT 6.1) using BSA as a standard. Load 0.1 to2 µg protein standard per lane and a known volume of the purified fusion protein onthe same gel.

25. Stain the gel with Coomassie Blue and destain as desired (UNIT 6.6).

26. Pool the appropriate fractions and add glycerol to a final concentration of 10% (v/v).Divide into 0.25-ml aliquots and flash freeze on dry ice. Store fractions at −80°C.

Fusions have been stored for over 2 years in this manner and still maintained activity.

ALTERNATEPROTOCOL 1

USE OF ION-EXCHANGE GRAVITY COLUMNS INSTEAD OF FPLC

If an FPLC system is not available, bulk ion-exchange resin can be used to pack agravity-flow column.

Additional Materials (also see Basic Protocol 2)

30-µm Resource Q or S ion-exchange resin (Amersham Pharmacia Biotech; seeBasic Protocol 2 for choice of resin)

50-ml Econo columns (Bio-Rad)

NOTE: Perform all steps at 4°C and add 1× protease inhibitors (see recipe) to all solutions.

Replace steps 19 to 21 of Basic Protocol 2 with the following:

1. Pack a 10-ml bed-volume ion exchange column using 30-µm Resource Q or S resin.

2. Wash the resin with 20 bed volumes of Milli-Q water to remove the storage bufferand rehydrate the resin.

3. Wash the column with 10 bed volumes of buffer A.

4. Apply the diluted sample (see Basic Protocol 2, step 18) onto the resin and allow theprotein to enter the gel bed slowly.

5. When the protein has completely entered the gel, wash with 10 bed volumes of bufferA.

6. Elute with two bed volumes of ml buffer B, collecting 0.5-ml fractions. Analyze thefractions by SDS-PAGE (UNIT 6.1) and pool the fractions containing the protein ofinterest.

IMPORTANT NOTE: At this point the fusion protein is very pure. It is absolutely necessaryto maintain the protein on ice from this point on. Failure to do so will yield degraded protein.

7. Perform buffer exchange and analyze the final fractions (see Basic Protocol 2, steps22 to 26).


20.2.11


ALTERNATEPROTOCOL 2

DIRECT BUFFER EXCHANGE OF UREA-DENATURED PROTEIN

In theory, rapid desalting of a denatured protein from 8 M urea through an aqueousinterface of PBS or culture medium without serum forces the protein to rapidly hide itshydrophobic residues and become soluble in an aqueous environment. The PD-10desalting column has a 1:1.4 dilution factor; therefore denatured proteins are rapidlyseparated from each other, helping to avoid aggregation of the proteins and subsequentprecipitation on the column. In this procedure, 1 to 1.5 ml of the Ni-NTA affinity-purifiedTAT fusion protein in 8 M urea (i.e., in buffer Z) is applied to the PD-10 columnequilibrated in PBS/HEPES buffer or serum-free culture medium. Column fractions of0.5 ml are isolated and analyzed by SDS-PAGE as in Basic Protocol 2. Reasonable successhas been achieved by this rapid and inexpensive procedure, however, use of this methodroutinely leads to dramatic protein precipitation. While some soluble protein can beobtained using this protocol, more soluble (and therefore, transducible) protein can beobtained by working out the ion-exchange conditions.


Serum-free culture medium (e.g., RPMI-1640) without antibiotics, containing 1×protease inhibitor cocktail (see recipe) or PBS plus 1× protease inhibitorcocktail


1. Equilibrate PD-10 column with 25 ml of culture medium without serum or antibioticsbut with 1× protease inhibitors.

Alternatively, the fusion can be buffer exchanged into PBS plus 1× protease inhibitorcocktail.

2. Load a maximum of 1.5 ml of the peak protein fraction from the Ni-NTA affinitycolumn (see Basic Protocol 2, steps 16 and 17) on to the gel bed.

3. After the sample has completely entered the gel bed, apply more of the culturemedium with protease inhibitors to the column and collect 0.5-ml fractions.

Protein can precipitate as it is eluted from this column. Microcentrifuging the fractionsimmediately for 5 min at maximum speed, 4°C, can minimize this precipitation. Transferthe supernatant fractions in separate microcentrifuge tubes.

4. Keeping the fractions on ice at all times, determine which fractions contain the desiredprotein by SDS-PAGE (UNIT 6.1).

5. Pool the fractions containing the protein of interest and and add glycerol to a finalconcentration of 10% (v/v). Store the protein in 0.2-ml aliquots at −80°C.

Some proteins may require the additional 0.1% (w/v) BSA to stabilize the pure protein. Thismust be determined experimentally. In general, storing the protein in the 10% glycerol willbe sufficient. Also, keep in mind that if the fusion protein is an enzyme, it may not be activeif frozen at any point.

ALTERNATEPROTOCOL 3

DIALYSIS OF THE UREA-DENATURED PROTEIN

One may choose to rapidly dialyze the Ni-NTA affinity-purified protein into the desiredbuffer, replacing the ion-exchange and gel-filtration steps (Basic Protocol 2, steps 17 to23). However, 6-His fusion proteins are highly susceptible to precipitation when usingthis method to remove urea. Also, some proteins are not biologically active after dialysis,whereas ion-exchange chromatography will routinely yield proteins with higher biologi-cal specific activity. For example, TAT-p27 WT, if prepared by rapid dialysis, will not


20.2.12

TAT-mediatedProtein

Transduction

cause G1 arrest, whereas if it is subjected to ion-exchange chromatography, it does(Nagahara et al., 1998). Conversely, other proteins such as TAT-E1A and TAT-E7 arebiologically active when desalted by rapid dialysis (Beker-Hapak, unpub. observ.).


Slide-A-Lyzer dialysis cassettes (Pierce) with membrane of MWCO appropriatefor protein of interest


1. If the protein in the purified fraction is > 5 µg/µl, dilute at least 1:1 in buffer Z.

2. Apply the sample to the dialysis cassette. Be sure to remove all air bubbles.

In the authors’ laboratory, use of the Slide-A-Lyzer cassettes with large surface-to-volumeratio provided by Pierce has proven to yield more soluble protein than regular dialysistubing.

3. Dialyze the protein at 4°C against 4 liters of pre-chilled buffer appropriate for thedownstream application. Change the buffer after 1 hr, then again 2 hr later, and letstir overnight. After the overnight incubation period, remove the protein from thedialysis cassette and remove any solids by centrifuging 10 min at 5000 × g , 4°C,prior to use or storage.

For example, if using the protein for orthophosophate labeling, use 20 mM HEPES/137 mMNaCl, pH 7.2, but if simply adding the protein to tissue culture cells, use 1× PBS at 4°C.

4. Analyze the protein concentration with BSA standards on a SDS-PAGE gel and storethe protein in aliquots (see Basic Protocol 2, steps 24 to 26).

ALTERNATEPROTOCOL 4

ISOLATION OF SOLUBLE TAT-FUSION PROTEINS

Some proteins can or must be isolated under soluble (nondenaturing) conditions. Forexample TAT-β-galactosidase is not active if purified in the presence of any urea. Use ofnondenaturing conditions can reduce yield as well as transduction efficiency; therefore,use of this protocol is not generally recommended. However, several reports successfullyutilized the isolation of TAT fusions under nondenaturing conditions. According to theauthors’ experience, the yield can be much lower than proteins prepared under denaturingconditions and the transduction efficiency may be lower. Exact effects must be determinedexperimentally.

For materials, see Basic Protocol 2.

1. Prepare pellet of cells from 5- to 6-hr culture (see Basic Protocol 2, steps 1 to 4).

2. Resuspend the pellet fraction in 10 ml of PBS containing 1× protease inhibitors.Perform Ni-NTA purification (see Basic Protocol 2, steps 5 to 14), replacing thebuffer Z with PBS with protease inhibitors. Identify the fractions containing theprotein of interest by SDS-PAGE (see Basic Protocol 2, steps 15 and 16).

Sonication of cells in PBS is more difficult than when done in buffer Z. One may need tomodify the sonication procedure to optimally lyse the bacteria without damaging the fusionprotein.

The ion-exchange steps (Basic Protocol 2, steps 17 to 21) are not performed.

3. After Ni-NTA chromatography, remove the imidazole and exchange the buffer usingPD-10 column, and store the protein in 10% (v/v) glycerol at −80°C (see BasicProtocol 2, steps 22 to 26).


20.2.13


BASICPROTOCOL 3

TRANSDUCTION AND DETECTION WITH FLUOROPHORE-LABELEDFUSION PROTEIN

TAT-mediated protein transduction occurs without the use of specialty reagents orinstrumentation. A TAT-fusion protein can be simply added to cultured cells along withthe culture medium. The process is concentration dependent but seemingly temperatureindependent (see Commentary for a detailed discussion of all of the parameters affectingtransduction). This unit will not detail a regimen for transduction because the procedurewill be different for every fusion, cell type, and cell culture system. To optimize, theresearcher should consider trying several different doses of the transducing protein (10to 200 nM) in culture medium, varying incubation times with the target cell populationto achieve the lowest concentration of protein in shortest time frame required to achievethe phenotypic effect. Suspension (e.g., Jurkat T-cell) and adherent (e.g., NIH 3T3) celllines, are used in this section to illustrate two different and routinely used methods forvisualizing transduced proteins in tissue culture cells. This protocol describes transduc-tion of a fusion protein labeled with fluorescein. Alternatively, other fluorescent moleculessuch as Alexa (Molecular Probes) can be used to label the fusion. These molecules arereported to have a higher half-life when compared to FITC. The authors recommend usingthe manufacturer’s labeling protocol whenever using an alternative fluorophore.

Materials

Fluorescein isothiocyanate (FITC; Molecular Probes)DMSOPurified fusion protein (see Basic Protocol 2 and Alternate Protocols 1 to 4)10× FITC conjugation buffer (see recipe)PBS (APPENDIX 2A) containing 1× protease inhibitors (see recipe)Glycerol, ultrapureCell line of interest for transduction or Jurkat T cell cultureParaformaldehyde fix solution (see recipe)Antifade mounting medium (Molecular Probes)

control TAT-p16-FITC

Figure 20.2.4 Confocal microscopy analysis of Jurkat T cells transduced with p16 WT-FITC,control (left panel) or TAT-p16WT-FITC protein (right panel). Jurkat T cells were transduced for 1 hrwith the FITC-labeled pure protein. Cells were washed in PBS and fixed with 4% paraformaldehyde,washed again, and then mounted on slides with antifade mounting medium. Note the generalizedfluorescence of TAT-p16WT-FITC protein in the cell. Higher-intensity staining can be observed inthe nucleoli, typical of nuclear targeted TAT-fusions. The cells treated with non-TAT-fused FITC-la-beled p16 show little to no fluorescence.


20.2.14

TAT-mediatedProtein

Transduction

Clear nail polish

PD-10 gel-filtration columns (Amersham Pharmacia Biotech)Microscope slides and coverslips

Label TAT fusion protein1. Prepare a FITC stock solution by dissolving 1 mg FITC per 0.5 ml DMSO. Keep in

the dark.

The FITC stock solution should be prepared fresh daily.

2. Prepare the labeling reaction by combining:

540 µl (0.1 to 0.5 µg) purified fusion protein60 µl 10× conjugation buffer1 µl FITC stock solution (see step 1).

anti-Cre DAPI

control

10 min

60 min

Figure 20.2.5 Detection of TAT-HA-Cre transduced into NIH-3T3 cells containing a phloxedβ-galactosidase gene. Cells were transduced for 0 (no TAT-HA-Cre), 10, and 60 min in 8-chamberLab-Tek slides. The cells were washed and fixed as described in Alternate Protocol 5. Rabbitanti-Cre polyclonal antibody was used at a 1:3000 dilution and a TRITC-labeled goat anti-rabbitsecondary antibody was used at a 1:1000 dilution. TAT-HA-Cre is detected as early as 10 min afterintroduction of the protein into the cells. The panel showing the cells treated for 10 min clearly showsthat many of the cells have detectable protein in the cytoplasm. Accumulation of the fusion proteinin most cell nuclei is evident at 60 min.


20.2.15


It is wise to set up at least three separate labeling reactions of high, medium, and lowprotein concentration to be conjugated to FITC. Overlabeling can cause inhibition of thetransduction, presumably due to blockage of the basic groups in the transduction domain.Therefore, it is a good idea to label and purify the reactions prepared at all three proteinconcentrations; one of them will provide the best visualization of the transduction.

3. Incubate at room temperature in the dark for 2 hr.

Purify the fluorophore-labeled fusion protein4. Equilibrate a PD-10 column with 25 ml of PBS with 1× protease inhibitors.

5. Apply the entire labeling reaction from step 3 to the column.

6. After the volume enters the gel bed, apply more PBS with protease inhibitors andcollect twelve 0.5-ml fractions.

The unconjugated FITC will remain in the gel bead because of its small size. Do not reusethe column.

7. Pool fractions 6 to 8 containing the labeled protein (which will be slightly yellow),add glycerol to 10% (v/v), and store at −80°C.

Transduce labeled fusion protein8. Incubate various volumes of FITC-labeled TAT fusion protein with 5 × 105 suspension

cells (e.g., Jurkat T cells) in 200 µl culture medium (i.e., RPMI/10% FBS) for 30 minat 37°C.

Equilibration is reached in as little as 5 to 15 min.

9. Microcentrifuge 5 min at 5000 rpm, 4°C. Remove the supernatant, add 0.5 ml ofice-cold PBS and immediately microcentrifuge again. Remove the supernatant tocomplete the wash.

Fix and visualize cells10. Resuspend the pellet in 500 µl paraformaldehyde fix solution and incubate cells for

15 min at room temperature on an end-over-end rotator.

11. Gently pellet the cells by microcentrifuging 5 min at 5000 × g. Resuspend the cellpellet in 200 µl of PBS and mount onto slides (using antifade mounting medium ifslides are to be stored overnight prior to examination). Seal the coverslips with clearnail polish.

12. Examine slides by fluorescence microscopy using excitation and emission wave-lengths appropriate to the fluorophore (APPENDIX 1E).

See Figure 20.2.4 for an example of FITC-labeled TAT-p16 WT transduced into Jurkat T cells.

ALTERNATEPROTOCOL 5

TRANSDUCTION AND DETECTION BY INDIRECTIMMUNOFLUORESCENCE

When the necessity of colocalization of transduced protein to cellular organelles orsubstructure is required, use of indirect immunofluorescence is highly desirable. Themethod described below will allow the researcher to make direct observations of wherethe TAT fusion protein is located within an individual cell. Use of the Lab-Tek 8-chamberslides makes it easy to examine and manipulate many conditions (i.e., antibody concen-tration) at the same time. Be sure to include a secondary antibody control to ensure lownonspecific binding of the fluorescent secondary antibody. An example of immunofluo-rescence completed on NIH 3T3 cells transduced with TAT-Cre is shown in Figure 20.2.5.


20.2.16

TAT-mediatedProtein

Transduction

Materials

Adherent cells of interest for transduction, e.g. NIH 3T3 cellsCulture medium for NIH 3T3 cells (i.e., DMEM/10% FBS)Purified fusion protein (see Basic Protocol 2 and Alternate Protocols 1 to 4)Phosphate-buffered saline (PBS; APPENDIX 2A), ice-cold and room temperatureParaformaldehyde fix solution (see recipe)100% ethanol, ice-cold1% and 0.1% (w/v) bovine serum albumin (BSA) in PBS (prepare from 10% w/v

BSA stock)Primary antibody: antibody of choice to fusion protein or mAb to the HA epitope

(Berkeley Antibody Company)TRITC- or PE-labeled secondary antibody0.2 µg/ml DAPI (prepare fresh from 1 mg/ml DAPI stock; store stock in dark at

4°C)Slowfade mounting medium (Molecular Probes)Clear nail polish

Lab-Tek 8-chamber glass slides with lids (Nalge Nunc International)40°C heat block50 × 24–mm coverslips (Fisher)

Prepare cells in chamber slides1. Culture 1000 NIH 3T3 cells/chamber on a Lab-Tek 8-chamber slide overnight in a

minimum volume of 0.5 ml of culture medium.

2. Wash the cells by flooding the chambers with fresh medium followed by removal ofthe medium by gentle aspiration.

It is a good idea to aspirate from the same position in the well for each wash to minimizeloss of cells during the wash steps.

Transduce fusion protein3. Transduce fusion protein into cells as desired for specific time points.

The useful concentration of the protein will vary from 10 to 200 nM and the times fortransduction will also vary depending on the investigator. The minimum volume to coverthe cells is 200 �l per chamber. Transduction can be detected in as early as 5 min andusually maximizes between 2 and 6 hr after protein addition (this is fusion dependent).

4. Remove medium and wash once with ice-cold PBS using the technique described instep 2.

5. Fix cells by adding 400 µl of ice-cold paraformaldehyde fix solution per chamberand incubating on ice for 15 min.

It is critical that the fixation buffer be prepared fresh daily; its pH must be verified priorto use.

Expose transduced cells to antibody reagents6. Wash three times with ice-cold PBS using the technique described in step 2.

7. Permeabilize the cells by adding 400 µl of ice-cold 100% ethanol and incubating onice for 10 min.

8. Wash three times with ice-cold with PBS using the technique described in step 2.

9. Block with 1% BSA and incubate 10 min on top of a 40°C heat block.

10. Wash five times with PBS at room temperature using the technique described in step 2.


20.2.17


11. Dilute the primary antibody in PBS containing 0.1% BSA according to the manufac-turer’s recommendation. Add 400 µl of the diluted antibody to each chamber andincubate 15 min at 40°C.

For anti-HA, a 1000- to 3000-fold dilution is optimal.

12. Wash five times with with PBS at room temperature.

13. Dilute TRITC- or PE-labeled secondary antibody 1000- to 5000-fold in PBS con-taining 0.1% BSA. Add 400 µl of the diluted antibody to each chamber and incubate15 min at 40°C.

If the background (i.e., cells stained with secondary antibody alone) is high, increase thedilution of this antibody.

14. Wash five times with PBS at room temperature.

Counterstain cells with DAPI15. Counterstain with DAPI by adding 200 µl of 0.2 µg/ml DAPI to each chamber and

incubating 15 min at room temperature.

16. Rinse chambers with water, remove the attached chambers and seal, then dry in the dark.

Visualize the results17. After drying is complete, add 5 drops of Slowfade to mount, add 50 × 24–mm

coverslip then seal coverslip with nail polish. Keep in dark until ready to view.

REAGENTS AND SOLUTIONS

Use deionized or distilled water in all recipes and protocol steps. For common stock solutions, seeAPPENDIX 2A; for suppliers, see SUPPLIERS APPENDIX.

Buffer Z480.0 g urea8.0 g NaCl4.8 g HEPESAdjust the pH to 8.0 with NaOHAdd H2O to 1 literStore up to 1 month at room temperature

FITC conjugation buffer, 10×Dissolve 0.84 g NaHCO3 in 9 ml of H2O. Adjust to pH 9.0 with NaOH, then addH2O to a final volume of 10 ml. Store at room temperature; prepare fresh solutionevery week.

LB medium and platesLB liquid medium: Add 25.0 g LB broth mix (Sigma) per liter of water. Autoclavefor 30 min on liquid cycle. Let cool to 50°C and add ampicillin to final concentrationof 50 µg/ml.LB plates: Prepare as above, but include 5 g/liter agar and pour plates.

Paraformaldehyde fix solution 4% (w/v)4 g paraformaldehyde100 ml of PBS (without calcium or magnesium; APPENDIX 2A)Heat gently with constant stirring (do not boil).Adjust pH to exactly 7.2 after solution has cooled to room temperatureChill on ice prior to useStore up to one week at 4°C


20.2.18

TAT-mediatedProtein

Transduction

Protease inhibitor stock solutionsPrepare stocks:1 mg/ml aprotinin in H2O (1000× stock; store up to 1 year at 4°C)1 mg/ml leupeptin in H2O (1000× stock; store up to 1 year at 4°C)10 mg/ml phenylmethylsufonyl fluoride (PMSF) in 100% ethanol (200× stock;

store up to 1 year at −20°C)Add each inhibitor to desired solution for a final concentration of 1×

COMMENTARY

Background InformationThere are many methods that can be used to

introduce biologically interesting moleculesinto live cells. Most of these methods such aselectroporation, microinjection, and lipofec-tion can be inefficient or laborious. Other meth-ods, such as the use of small peptides, whichcan essentially diffuse into a live cell, are notdesirable because of the high concentrations ofthe peptides required to achieve the biologicaleffect. Therefore, a method which can deliverfull-length, target-specific, concentration-de-pendent, and biologically active molecules intoa live cell in the absence of harsh conditions ormechanical disruption would be highly advan-tageous.

Domains that have the ability to transport(transduce) heterologous molecules have beenidentified in many different biological systems(Wadia and Dowdy, 2002). Briefly, four differ-ent biological systems have been exploited astools for the exogenous delivery of heterolo-gous proteins: the Antennapedia protein fromDrosophila (Derossi et al., 1998),VP22 proteinfrom HSV (Elliot and O’Hare, 1997), MPGdomain (synthetic fusion peptide of HIV-1gp41and the NLS of SV40 large T-antigen;Morris et al., 1997), and TAT from HIV (Fawellet al., 1994). The focus of the method describedhere, is the transduction domain that originatedfrom the 87 amino acid HIV-Tat protein. Thetransduction phenomenon was first identifiedin 1988 when full-length, exogenously addedHIV-Tat protein was shown to trans-activate areporter gene when added to cultured cells atconcentrations as low as 1 nM. Fawell et al.(1994) expanded on this observation by dem-onstrating that proteins chemically cross-linked to a 36 amino acid peptide (residues37-72) of HIV-Tat were able to transduce intocells. Vives et al. (1997) using a FITC-labeledTat-peptide showed that residues 37-60 wereimportant for transduction ability. This regionwas shown to adopt an α-helical structure withamphipathic characteristics from residues 38-49 but a cluster of basic amino acids from

residues 49-58 appeared to be unstructured dueto charge repulsions (Loret et al., 1991). Theeleven amino acids used in the pTAT/pTAT-HAvectors encompass residues 47-57 of the HIV-Tat molecule. Residues 53-57 (QRRR) seem tobe essential for the transduction since FITC-la-beled peptides devoid of this region failed totransduce into HeLa cells (Vives et al., 1997).Various mutations in this minimal domain havebeen completed and certain substitutions havebeen shown to enhance transduction of peptides(Ho et al., 2001). Translation of these transduc-tion domains (PTDs) into expression vectors isthe subject of ongoing investigation, and use ofthese domains could provide even greatertransduction potential (S.F. Dowdy, unpub. ob-serv.).

To date, the exact mechanism of HIV Tat-mediated transduction across cellular mem-branes remains unclear. An attempt at definingthis mechanism was reported in 1997 (Vives etal., 1997) using various versions of residues37-72. They determined that internalization ofTAT peptides did not involve endocytosis (tem-perature sensitive), potocytosis (caveolae ornon-coated plasmalemmal vesical–mediated),or membrane destabilization. Another pro-posed mechanism is analogous to the Peni-tratin-1 transduction system. In this case, inter-nalization could be caused by local reorganiza-tion of the lipid bilayer, resulting in invertedmicelles and eventual delivery of the protein inthe cytoplasm (Vives et al., 1997). Alterna-tively, the Tat transduction domain could utilizeheparan sulfate proteoglycans as a means ofgaining entry into the cell (Tyangi et al., 2001).Clearly differences in mechnisms of transduc-tion between peptides using protein transduc-tion domains (PTDs) and full-length fusionscould vary, and this may explain the differencesobserved in these studies. Although the mecha-nism by which full-length TAT-fusion proteinsgain entry into cells is not concrete, phenotypiceffects of these proteins are being observed inmany biological systems (Table 20.2.2), and


20.2.19


new reports of novel applications of this tech-nique are rapidly growing.

A TAT fusion protein can be easily con-structed using the pTAT/pTAT-HA vectors. ThepTAT-HA vector has several features that makeit ideal for use as an expression vector. The HAtag can be used to follow the fusion proteinthroughout purification and transduction in aspecific system. A 6-His domain in the N-ter-minus of the fusion protein affords a simplemethod of affinity purifying the protein on anickel affinity resin pre- or post-transduction.The vector contains a multiple cloning regionthat yields an in-frame fusion protein. A 3′transcriptional terminator is also present if trun-cations of the fusion proteins are desired. Otherfusion vectors have recently been described inwhich the HIV-Tat transduction domain hasbeen used for C-terminal fusions (Darbiniah etal., 2001) instead of N-terminal fusions thatpTAT/pTAT-HA would yield (see Table 20.2.2).

Many bacterially expressed recombinantproteins are stored as insoluble inclusion bodiesbecause the bacteria lack the machinery to cor-

rectly fold the eukaryotic protein they areforced to produce. The bodies are insolubleaggregates that cannot be resolublized withoutthe use of detergents or denaturing agents suchas guanidine⋅HCl or urea. The system describedin this unit makes use of 8 M urea to denature theaggregates, allowing binding to an ion-exchangeresin, and immediate exchange of the protein intoan aqueous environment. This yields protein thatis stable enough to be added to tissue culturemedia where it can be correctly refolded or de-graded once inside the cell. Fluorescently labeledfusion proteins have been shown to distributeuniformly in the nucleus and cytoplasm of all cellstested, including: peripheral blood lymphocytes(PBLs), diploid human fibroblasts, keratinocytes,bone marrow stem cells, osteoclasts, fibrosar-coma cells, leukemic T cells, osteosarcoma,glioma, hepatocellular carcinoma, renal carci-noma, NIH 3T3 cells, and all cells present inwhole blood, in a concentration-dependent man-ner (Nagahara et al., 1998). A TAT-β-galactosi-dase fusion has been shown to penetrate every celltype in an intact live mouse and remain enzymati-

Table 20.2.2 Selected TAT-Fusions and the Various Cell Types Transduced

TAT fusion Function Cell type/line transduced Reference

Filamin A Actin bindingScaffolding protein of caveoliMAPK signaling cascade

HEK-293Parathyroid cells

Hjalm et al., 2001

Ovalbumin Used to sensitize dendritic cells(DC) in a solid tumor model

EL-4 thymoma cellsMouse dendritic cells

Shibagaki and Udey,2002

HPC-1/syntaxin 1A Binds to SNAP-25 or VAMP2forming stable SNARE complexes

PC-12 neuronal Cells Fujiwara et al., 2002

Rac/Rho GTPases EosinophilsLeukocytes

Alblas et al., 2001

Pur alphaa Multifunctional DNA and RNAbinding protein

T98G (human glioblastoma)U-87 MG (human astrocytoma)J3671 and Daoy (humanmedulloblastoma)

Darbinian et al., 2001

Merlin/NF2 Neurofibromatosis Type 2 tumorsuppressor

Schwannoma tumorsNormal Schwann cells

Bashour et al., 2002

ApolipoproteinB Lipid metabolism Rat primary hepatocytesMcArdle RH7777

Yang et al., 2001

Bcl XL PEA-15 Apoptosis inhibitors BTC-3 (insulinoma cells)Rat islet cells

Embury et al., 2001

eGFP Fluorescent protein NIH 3T3Myoblasts

Caron et al., 2001

CRIB Inhibitor of Cdc42-GTP Peripheral blood mononuclear cells Haddad et al., 2001C3 (exoenzyme ofC. botulinum)

Inhibitor of Rho Rat vascular smooth muscle cells Sauzeau et al., 2001

aA C-terminal TAT-fusion molecule.


20.2.20

TAT-mediatedProtein

Transduction

cally active after traversing all of the cellularlayers in various organs, including the brain(Schwarze et al., 1999). Fusion proteins of up to120 kDa have been successfully transduced andshown to be biologically active; therefore the sizeof the fusion protein does not appear to retardtransduction or function, unlike other transductiondomains (Wadia et al., 2002). The concentration ofthe transduced protein required to achieve a bio-logical function is very low when compared topeptide mimetics. This feature of TAT transductiontechnology makes it ideal when targeting therapeu-tic strategies.

The method has already been applied tomany biological questions. For example, fu-sions of TAT-p16 were used to define the phos-phorylation events of the retinoblastoma pro-tein (pRb) in cell cycle progression (Ezhevskyet al., 1997); TAT-E7 has been shown to seques-tor pRb and rescue T-cells from T-cell Recep-tor-Activated Induced Cell Death (TCR-AID;Lissy et al., 1998); and the role of p27 ininducing hepatocellular carcinoma cell scatter-ing was elucidated using TAT-p27 (Nagahara etal., 1998). This technology has been exploitedto “trick” an HIV-infected cell into committingsuicide by inducing caspase-3 cleavage (Vo-cero-Akbani et al., 1999). The implications ofthis idea are broadly applicable to any diseasethat depends upon protease-specific cleavageof pro-molecules. Many more applicationshave been and continue to be reported (Table20.2.2).

The limitations for the use of this strategy seemto be three-fold. First, mammalian systems haveevolved to defend against foreign proteins.Clearly, proteolytic degradation of exogenouslyadded fusion proteins found in serum reduces theeffective half-life of the protein in vitro and canbe amplified in vivo. Similarly, inhibitors withinserum can interfere with function of transducedmolecules. For example, TAT–thymidine kinaseprepared by the soluble method described in thisunit (see Alternate Protocol 4) is fully functionaland rapidly transduces into cells; however, thefusion protein showed no enzymatic activity afterlysis of the transduced cells (S.R. Schwarze, un-pub. observ.) because of a serum-derived enzy-matic inhibitor. Culture systems can minimize theserum effects by using protease inhibitors or byincreasing the dosage of the fusion proteins. Ad-ditionally, one can use agents such as TNF/cyclo-hexamide in vitro (Embary et al., 2001) to slowthe cellular machinery and allow the cell torefold the transduced proteins more rapidly. Thesecond limitation to this technology may be easilyaddressed. Since some eukaryotic proteins are

modified post-translationally (i.e., phosphory-lation and glycosylation), and bacteria do nothave the ability to make such modifications, aeukaryotic fusion protein expression systemmust be designed in order to achieve fullyfunctional protein. Lastly, localization of mem-brane fusion proteins is probably impossible.Studies with fluorescinated TAT-PTEN (whichcontains a C2 domain that is known to bind tophospholipid membranes; Lee et al., 1999)showed aggregation of the fusion protein atLnCaP cell membranes (S.R. Schwarze, unpub.observ.).

Critical Parameters

Maintaining protein solublilitySince many TAT-fusion proteins will be iso-

lated in 8 M buffered urea and then quicklyexchanged into an aqueous buffer, it is impor-tant to determine if the protein maintains sta-bility after freeze/thaws and addition into theculture medium. Centrifuging the proteins at5000 × g for 10 min at 4°C will ensure that onlysoluble protein will be added to the cells. If apellet is evident after centrifugation, anotherSDS-PAGE gel comparing protein concentra-tions should be completed.

If precipitation of the fusion protein is no-ticed on the cells during the transduction pro-cedure, the buffer in which the fusion is storedshould be changed. Use of the PD-10 columnto exchange the buffer for cell-specific culturemedia without serum or any other additivesusually solves the problem. If the protein isstored in the culture medium, the authors sug-gest using 0.1% (w/v) BSA to stabilize theprotein. Also, when freezing the protein, al-ways add at least 10% (v/v) glycerol, prior toflash freezing and storage at –80°C.

When thawing the proteins, quick thawingat 37°C is recommended to decrease thechances of precipitation and shearing from icecrystals. Immediately after the quick thaw, keepthe proteins on ice until they are added to themedium. The thawed protein can be kept on iceat 4°C for up to 1 week with no significant lossof transducibility. Continual storage of the pro-tein at 4°C will eventually result in proteinprecipitation, and is therefore not recom-mended for long-term storage.

Addition of the fusion proteins to tissueculture system

Because of the efficiency of this transduc-tion system, it may be important to add thefusion protein to the culture medium prior to


20.2.21


addition of the medium to the cells. Therefore,after plating the cells at the appropriate densityfor the experimental procedure, wash the cellsonce in fresh medium. Add the appropriatevolume of fusion protein to the required volumeof tissue culture medium—i.e., 0.2 ml to 1.8 mlof DMEM containing 10% fetal bovine serumand 1× penicillin/streptomycin per well of 6-well dish—and then add this volume to thecells. It is important that the volume of fusionprotein not exceed 10% of the tissue culturevolume. Toxic effects and slowing of the cellcycle have been observed in some cases whengreater volumes were used.

Dose and toxicity of the fusion proteinsIt is virtually impossible to predict possible

toxicity of the fusion protein in certain cellculture systems. If toxicity is noticed, severaloptions are available. First, one can decreasethe molar concentration of the fusion protein tothe cells. In general, concentrations of >200 nMfusion protein are not necessary. The workingrange of these proteins vary from 50 to 200 nM.In a rare case, 1 µM was necessary (Ezhevskyet al., 1997). Therefore, the range in which aprotein can be used must be decided on afusion-to-fusion basis. Second, changing thebuffer in which the protein is stored may benecessary (see Alternate Protocols 2 and 3).

The final concentration of cells used in atransduction experiment is critical. The con-centration of transducing protein that is re-quired to observe an effect is dependent uponthe starting cell population. The smaller thetarget cell population, the greater the intracel-lular concentration will be. Studies using FITC-labeled TAT-p16 in normal diploid fibroblastshave showed greater fluoresecence intensity ofthe fusion when fewer cells were plated (M.Becker-Hapak, unpub. observ.). Therefore, insuspension cultures or adherent cells, it is gen-erally recommended that the lowest possibleconcentration of cells be used when fusionprotein concentrations are limited.

Half-life of fusion proteinsThe authors have observed dramatic differ-

ences in the half-lives of fusion proteins. Deg-radation of the fusion protein can be determinedby immunoblotting extracts of the trypsinizedand washed cells. Generally, if the transducingprotein is to be incubated for longer than 24 hr,addition of supplemental protein is suggested.The necessity for supplementary additions ofany protein of interest must also be experimen-tally determined.

Troubleshooting

Established clone is no longer expressingfusion protein

In some cases, the bacteria may stop express-ing the fusion protein. If this occurs, simply go toanother one of the backup clones or retransformthe plasmid into fresh BL-21 (DE3)pLysS andrescreen for high-expressing clones.

Poor expression of the fusion proteinIt may be necessary to induce the fusion

protein of interest. Bl-21 cells, carry an IPTG-inducible, T7 polymerase (DE3) and a T7 po-lymerase specific protease (pLysS) under achloramphenicol resistance marker. The pLysSkeeps the T7 polymerase at a negligible con-centration until the organism goes into logphase (during IPTG induction). If the expres-sion of the specific fusion protein is low, inducethe T7 polymerase by adding 2 µg/ml IPTGwhen the 200 ml overnight culture is added to1 liter of LB-ampicillin medium. Culture asdescribed in the protocols above.

Another factor affecting the protein expres-sion levels is the choice of supplier for the LBmedium. In the authors’ experience, LB me-dium purchased from certain vendors have pro-duced more recombinant protein than others,so it is recommended that various vendors andlots be tested for maximal yield of any proteinof interest. One may, at the same time, culturethe fusion in a richer medium such as TerrificBroth (TB). However, the routine use of thismedium is not recommended because somefusions have proven to express more robustlyin LB than TB.

Many T7 promotor–driven fusions can beexpressed in a multitude of BL-21(DE3) de-rivatives. The authors have found a singlesource of many of these hosts. Novagen pro-vides a reasonably priced set of competent DE3derivatives (cat. no. 71032-3) which are veryhelpful in expression of various eukaryotic pro-teins that cannot be efficiently expressed inBL-21 (DE3) pLysS. Transformation of thepure plasmid into a panel of these hosts andside-by-side detection via immunoblotting canshow dramatic differences in host-to-host dif-ferences in fusion expression.

Ion-exchange chromatographyDifficulties encountered during any standard

ion-exchange procedure are also observed withTAT-fusion proteins. The authors highly recom-mend the batch test tube procedure outlined inAmersham Pharmacia Biotech’s ion-exchange


20.2.22

TAT-mediatedProtein

Transduction

handbook (Amersham Biosciences, 2002) torapidly identify binding and elution protocols.

Protein seems to be degrading during thepurification procedure

Be sure to use the protease inhibitor cocktaildescribed in Reagents and Solutions. Thiscocktail should be added at every step of thepurification when a new buffer is used. If theprotein was sonicated in PBS maintain thesonicate at 4°C at all times and perform thechromatographic steps in the cold.

Protein precipitates after dialysisThe concentration of the protein may be too

high. Dilute the protein in buffer Z to a concen-tration of <1 mg/ml before applying it to thedialysis cassette.

Try using the PD-10 column to remove theurea. However, the authors have noticed that ifthe protein precipitates during dialysis, it islikely to precipitate during the PD-10 step aswell. Therefore, the only way to ensure solubleprotein is to use the ion-exchange method ofachieving soluble proteins.

No biological effect with wild-type proteinThe transduced protein, may require a con-

centration higher than 200 nM (working con-centrations with in cell culture varies from 50to 200 nM, but can require upwards of 1 µM)to obtain the specific effect. For example, theauthors have observed that in wild-type cells(i.e., SiFTs) that have an already high concen-tration of p16 (later passage), less TAT-p16 wtis required to achieve a G1 arrest, than in thoseexpressing low concentrations of the protein.

Another factor that can affect function of theTAT-fusion protein is the position of the TAT-leader. The authors have observed that the TAT-leader inhibits the ability of p16 to bind to TAT-CDK4, but the leader has no effect on TAT-CDK2.In such cases, Cé terminal fusions should help.

Check if the protein is active after freeze-thaw.Some proteins cannot be frozen at any step of thepurification from bacterial harvesting to storage.If this is the case, store the protein on ice at 4°C.BSA may also be required to help keep theprotein from precipitating or degrading.

Unknown serum factors can inhibit, inacti-vate, or degrade exogenously added fusion pro-teins causing negative results. To examine ifthis is occurring with the fusion, simply dilutethe pure protein into cell-free culture medium(usually in the presence of 10% v/v fetal bovineserum) at 37°C for varying amounts of time,then immunoblot for the pure protein. Nonspe-

cific proteolytic degradation can be minimizedby the addition of specific protease inhibitors.However, solutions to these types of problemsare most likely found by the preparation ofpoint-specific mutants.

Choice of tagsWhile the pTAT-HA vector utilizes the he-

magglutinin tag to allow one to detect the fu-sion, other popular tags used concomitantly caninhibit transduction of the purified protein. It ispresumed that the very acidic nature of tagssuch as FLAG can associate with the TATdomain and very effectively negate thetransducibility of the fusion (M. Becker-Ha-pak, unpub. observ.).

Anticipated Results

Protein yieldThe quantity of protein yielded by a 1-liter

LB-ampicillin culture will vary dependingupon the construct. For example, TAT-β-galac-tosidase will yield 4 to 6 mg of total protein,whereas TAT-caspase 3 only yields 500 µg. Ingeneral non-cytotoxic constructs, such as TAT-p27, yield 1 to 2 mg of protein per liter ofLB-ampicillin medium.

Fluorescein-labeled fusion proteinsThe efficiency of fluorescein labeling will

vary from day to day and protein to protein. Onecan quantitate the fluorescence intensity using afluorometer prior to addition of the label to thecell culture. When comparing fluorescently la-beled TAT-fusion versus the nontransducing pureprotein by confocal microscopy, TAT-fusion pro-teins will show an even fluorescence intensitythroughout the cell, with some punctate stainingin the nucleoli (Fig. 20.2.4). The nontransducingprotein will show a lower intensity “rim” fluores-cence due to nonspecific sticking of the labeledprotein to the cell membrane. If examiningtransduction by immunohistochemistry, typicalresults show detection of the transducing proteinafter as little as 5 min and peaking between 4 and6 hr after transduction, when incubated at 37°C.Early time points will show the protein nonspe-cifically distributed throughout the whole cell,while the later time points will show a morespecific staining pattern. The putative nuclearlocalization sequence will not prevent the fusionfrom going in and out of the nucleus. For example,TAT-p27 WT shows a ubiquitous distribution whentransduced into HepG2 cells in the first 12 hr, thenconcentrates in the nucleus 24 hr after introductionof the fusion protein. However, if HepG2 cells are


20.2.23


cultured in the presence of HGF, TAT-p27 isshuttled out of the nucleus and into the cyto-plasm over a 24 hr period (S.S. McAllister andS.F. Dowdy, unpub. observ.).

Biological activities of transducedTAT-fusion proteins

The activities expected of the TAT-fusion pro-teins vary with application. Consequently, phe-notypic readouts vary as well. In general, the timeframe in which the phenotype can be recordedcan vary from 5 min (enzymatic assays) to days(morphological changes). Table 20.2.1 showssome results obtained from various classes ofTAT-fusion molecules. The table details the doseof fusion that was required, biological effect ob-served, and time frame in which the result wasmeasured. To expand on examples of the utiliza-tion of TAT-full length fusion technology, exam-ples of selected fusions are shown in Table 20.2.2.The table not only lists the TAT-fusion created andthe function, but it also summarizes some othercell types that were not used in transductionexperiments listed in Table 20.2.1.

Time Considerations

Total time requiredIdentification of protein and determining

necessity of IPTG induction requires 2 daysIsolation of protein requires 1 to 2 days.Detection of protein transduction requires 1

to 2 days.For biological readouts the time required is

pathway/protein–dependent.

Stopping pointsIn general, one should consider any protein

left at room temperature as being susceptible todegredation. Therefore, if one wishes to stop atany point during the protein purification, oneshould consider freezing the preparation if theduration will be longer than overnight. Alter-natively, store the protein at 4°C on ice over-night, if the protein of interest is sensitive tofreeze/thaw. For example; TAT-β-gal, whoseenzymatic activity is abolished if frozen at anypoint but it retains transducibility, must bestored at 4°C in the presence of 0.1% BSA toremain active for up to one month on ice at 4°C.

Literature CitedAlblas, J., Ulfman, L., Hordijk, P., and Koenderman,

L. 2001. Activation of PhoA and ROCK areessential for detachment of migrating leuko-cytes. Molec. Biol. Cell. 12:2137-2145.

Amersham Biosciences. 2002. Ion Exchange Chro-matography, Principles and Methods. AmershamBiosciences, Piscataway, N.J.

Backus, B.D., Dowdy, S., Boschert, K., Richards, T.,and Becker-Hapak, M. 2001. Safety guidance forlaboratory personnel working with trans-activat-ing transduction (TAT) protein transduction do-mains. Am. Chem. Soc. J. Chem. Health Safety8:March/April 2001.

Bashour, A.M., Meng, J.J., Ip, W., MacCollin, M.,and Ratner, N. 2002. The neurofibromatosis type2 gene product, merlin, reverses the F-actin cy-toskeletal defects in primary human Schwan-noma cells. Mol. Cell Biol. 22:1150-1157.

Becker-Hapak, M., McAllister, S.S., and Dowdy,S.F. 2001. TAT-mediated protein transductioninto mammalian cells. Methods 24:247-256.

Caron, N.J., Torrente, Y., Camirand, G., Bujold, M.,Chapdelain P., Leriche, K., Bresolin, N., andTremblay, J.P. 2001. Intracellular delivery of aTat-eGFP fusion protein into muscle cells. Mol.Ther. 3:310-318.

Darbinian, N., Gallia, G.L., King, J., DelValle, L.,Johnson, E.M., and Khalili, K., 2001. Growthinhibition of glioblastoma cells by human Puralpha. J. Cellular Physiol. 189:334-340.

Derossi, D., Chyassaing, G., and Prochiantz, A.1998. Trojan peptides: The Penetratin system forintracellular delivery. Trends Cell Biol. 8:84-87.

Elliot, G. and O’Hare, P. 1997. Intracellular traffick-ing and protein delivery by a herpesvirus struc-tural protein. Cell 88:223-233.

Embury, J., Klein, D., Pileggi, A., Ribeiro, M.,Jayaraman, S., Molano, R.D., Fraker, C., Ken-yon, N., Ricordia, C., Inveradrdi, L., and Pastori,R.L. 2001. Proteins linked to a protein transduc-tion domain efficiently transduce pancreatic is-lets. Diabetes 50:1706-1713.

Ezhevsky, S.A., Nagahara, H., Vocero-Akbani,A.M., Gius, D.R., Wei, M.C. and Dowdy, S.F.1997. Hypo-phosphorylation of the retinoblas-toma protein (pRb) by cyclin D: Cdk4/6 com-plexes results in active pRb. Proc. Natl. Acad.Sci. U.S.A. 94:10699-10704.

Fawell, S., Seery, J., Daikh, Y., Moore, C., Chen,L.L., Pepinsky, B., and Barsoum, J. 1994. Tat-mediated delivery of heterologous proteins intocells. Proc. Natl. Acad. Sci.U.S.A. 91:664-668.

Fujiwara, T., Yamamori, T., and Akagawa, K. 2001.Suppression of transmitter release by Tat HPC-1syntaxin 1A fusion protein. Biochim. Biophys.Acta. 1539:225-232.

Haddad, E., Zugaza, J.L., Louache, F., Debili, N.,Crouin, C. , Schwarz, K. , Fischer, A. ,Vainchenker, W., and Bertoglio, J. 2001. Theinteraction between Cdc42 and WASP is re-quired for SDF-1-induced T-lymphocyte chemo-taxis. Blood 97:33-38.

Hall, D.J., Cui, J., Bates, M.E., Stout, B.A., Koen-derman, L., Coffer, P.J., and Bertics, P.J. 2001.Transduction of a dominant-negative H-Ras intohuman eosinophils attenuates extracellular sig-


20.2.24

TAT-mediatedProtein

Transduction

nal-regulated kinase activation and interleukin-5-mediated cell viability. Blood 98:2014-2021.

Hjalm, F., MacLeod, J.R. Kifor, O., Chattopadhyay,N., and Brown, E.M. 2001. Filamin-A binds tothe carboxyl-terminal tail of the calcium-sensingreceptor, an interaction that participates in CaR-mediated activation of mitogen-activated proteinkinase. J. Biol. Chem. 276:34880-34887.

Ho, A., Schwarze, S.R., Mermelstein, S.J.,Waksman, G., and Dowdy, S.F. 2001. Syntheticprotein transduction domains: Enhancedtransduction potential in vitro and in vivo. Can-cer Res. 61:474-477.

Lee, J.O., Yang, H., Georgescu, M.M., Di Cristo-fano, A., Maehama, T., Shi, Y., Dixon, J.E., Pan-dolfi, P., and Pavletich, N.P. 1999. Crystal struc-ture of the PTEN tumor suppressor: Implicationsfor its phosphoinositide phosphatase activity andmembrane association. Cell 99:323-334.

Lissy, N.A., Van Dyk, L.F., Becker-Hapak, M., Vo-cero-Akbani, A., Mendler, J.H., and Dowdy, S.F.1998. TCR antigen-induced cell death occursfrom a late G1 phase cell cycle check point.Immunity 8:57-65.

Loret, E.P., Vives, E., Ho, P.S., Rochat, H., VanRietschoten, J., and Johnson, W.C., Jr. 1991.Activating region of HIV-1 Tat protein: VacuumUV circular dichroism and energy minimization.Biochemistry 30:6013-6023.

Morris, M.C., Vidal, P., Chaloin, L., Heitz, F., andDivita G. 1997. A new peptide vector for efficientdelivery of oligonucleotides into mammaliancells. Nucleic Acids Res. 25:2730-2736.

Nagahara, H., Vocero-Akbani, A.M., Snyder, E.L.,Ho, A., Latham, D.G., Lissy, N.A., Becker-Ha-pak, M., Ezhevsky, S.A., and Dowdy, S.F. 1998.Transduction of full-length TAT fusion proteinsinto mammalian cells: TAT-p27kip1 induces cellmigration. Naure Med. 4:1449-1452.

Sauzeau, V., Le Mellionnec, E., Bertoglio, J, Scalbert,E., Acaud, P., and Lorirand, G. 2001. Human urten-sin II–induced contraction and arterial smoothmuscle cell proliferation are mediated by RhoAand Rho-Kinase. Circ. Res. 88:1102-1104.

Schwarze, S.R., Ho, A., Vocero-Akbani, A., andDowdy, S.F. 1999. In vivo protein transduction:Delivery of a biologically active protein into themouse. Science 285:1569-1572.

Shibagaki, N. and Udey, M.C. 2002. Dendritic cellstransduced with protein antigens induce cyto-toxic lymphocytes and elicit antitumor immu-nity. J. Immunol. 168:2393-2401.

Tyagi, M., Rusnati, M., Presta, M., and Giacca, M.2001. Internalization of HIV-1 TAT requires cellsurface heparan sulfate proteoglycans. J. Biol.Chem. 276:3254-3261.

Vives, E., Brodin, P., and Lebleu, B. 1997. A trun-cated HIV-1 Tat protein basic domain rapidlytranslocates through the plasma membrane andaccumulates in the cell nucleus. J. Biol. Chem.272:16010-16017.

Vocero-Akbani, A., Vander Heyden, N., Lissy, N.A.,Ratner, L., and Dowdy, S.F. 1999. Killing HIV-infected cells by transduction with an HIV-pro-tease-activated Caspase-3 protein. Nature Med.5:29-33.

Wadia, J.S. and Dowdy, S.F. 2002. Protein transduc-tion technology. Cur. Opin. Biotech. 13:52-56.

Yang, Y., Ballatori, N., and Smith H.C., 2001.Apolipoprotein B mRNA editing and the reduc-tion in synthesis and secretion of he athrerogenicrisk factor, apolipoprotein B100 can be effec-tively targeted through TAT-Mediated proteintransduction. Molec. Pharmacol. 61:269-276.

Key ReferencesAmersham Biosciences, 2002. See above.

Excellent resource for the theory of ion-exchangechromatography and troubleshooting measures fordifficulties associated with using strong ion-ex-change resins.

Backus et al., 2001. See above.

Addresses all safety issues regarding the safe han-dling procedures for individuals working with TATfusion proteins.

Nagahara et al., 1998. See above.

First description of the utility of TAT-fused full-length fusion proteins.

Schwarze et al., 1999. See above.

First demonstration in vivo delivery of a biologicallyactive TAT-fusion protein and showed that TAT-fu-sions as large as 120 kDa could be delivered tovirtually every cell type of a live mouse.

Qiagen. 1997. The QIAexpressionist: A Handbookfor high level expression of 6× His-tagged pro-teins. Qiagen, Chatsworth, Calif.

Contains general procedures and considerations forthe expression and purification of b-His-tagged pro-teins.

Wadia and Dowdy, 2002. See above.

Recent review on protein transduction methodolo-gies.

Internet Resourceshttp://www.expasy.ch/tools/pi_tool.html

Tools for rapid calculation of pI of a protein.

Contributed by Michelle Becker-HapakWashington University School of MedicineSaint Louis, Missouri

Steven F. DowdyUniversity of California, San DiegoLa Jolla, California


20.2.25


UNIT 20.3Calcium Phosphate Transfection

This unit presents two methods of calcium phosphate–based eukaryotic cell transfectionthat can be used for both transient and stable transfections. In these protocols, plasmidDNA is introduced to monolayer cell cultures via a precipitate that adheres to the cellsurface. A HEPES-buffered solution is used to form a calcium phosphate precipitate thatis directly layered onto the cells (see Basic Protocol). For some cells, shocking the cellswith glycerol or DMSO (see Support Protocol) improves transfection efficiency. In thealternate high-efficiency method, a BES-buffered system is used that allows the precipi-tate to form gradually in the medium and then drop onto the cells (see Alternate Protocol).The alternate method is particularly efficient for stable transformation of cells withcircular plasmid DNA. For transformation with linear plasmid or genomic DNA, or fortransient expression, however, the Alternate Protocol is comparable to the Basic Protocol.Both methods of transfection require very high-quality plasmid DNA. Factors that can beoptimized for calcium phosphate transfections are presented in UNIT 20.7. Additional detailsof mammalian cell culture are given in UNIT 1.1.

BASICPROTOCOL

TRANSFECTION USING CALCIUM PHOSPHATE–DNAPRECIPITATE FORMED IN HEPES

A precipitate containing calcium phosphate and DNA is formed by slowly mixing aHEPES-buffered saline solution with a solution containing calcium chloride and DNA.This precipitate adheres to the surface of cells and should be visible in the phase contrastmicroscope the day after transfection. Depending on the cell type, up to 10% of the cellson a dish will take up the DNA precipitate through an as yet undetermined mechanism.Glycerol or dimethyl sulfoxide shock increases the amount of DNA absorbed in somecell types (see Support Protocol).

Materials

Exponentially growing eukaryotic cells (e.g., HeLa, BALB/c 3T3, NIH 3T3, CHO,or rat embryo fibroblasts)

Complete medium (depending on cell line used)CsCl-purified plasmid DNA (10 to 50 µg per transfection)2.5 M CaCl2 (see recipe)2× HEPES-buffered saline (HeBS; see recipe)PBS (APPENDIX 2A)

10-cm tissue culture dishes15-ml conical tube

Additional reagents and equipment for ethanol precipitation (APPENDIX 3A) andmammalian cell tissue culture (UNIT 1.1)

NOTE: All solutions and equipment coming into contact with cells must be sterile, andproper sterile technique should be used accordingly.

NOTE: All culture incubations are performed in a humidified 37°C, 5% CO2 incubatorunless otherwise specified.

1. Split exponentially growing eukaryotic cells into 10-cm tissue culture dishes the daybefore transfection. Feed cells with 9.0 ml complete medium 2 to 4 hr prior toprecipitation.

When transfecting adherent cells that double every 18 to 24 hr, a 1:15 split from a confluentdish generally works well. On the day of the transfection, it is important that cells arethoroughly separated on the dish, as the ability to take up DNA is related to the surface

Supplement 19

Contributed by Robert E. Kingston, Claudia A. Chen, and Hiroto OkayamaCurrent Protocols in Cell Biology (2003) 20.3.1-20.3.8Copyright © 2003 by John Wiley & Sons, Inc.

20.3.1

Introduction andExpression ofForeignMacromoleculesin Cells

area of the cell exposed to the medium. Cells should be split in a manner that accomplishesthis.

The desired density of cells on dishes to be transfected will vary with cell type and thereason for doing the transfection. The optimal density is that which produces a nearconfluent dish when the cells are harvested or split into selective medium.

2. Ethanol precipitate the DNA to be transfected and air dry the pellet by inverting themicrocentrifuge tube on a fresh Kimwipe inside a tissue culture hood. Resuspend thepellet in 450 µl sterile water and add 50 µl of 2.5 M CaCl2.

The amount of DNA that is optimal for transfection varies from 10 to 50 �g per 10-cm plate,depending on the cell line to be transfected.

DNA to be transfected should be purified twice by CsCl gradient centrifugation. DNA canalso be prepared using column procedures. Some column procedures produce DNA thatdoes not transfect well, so column-purified DNA should be tested and compared toCsCl-purified DNA for transfection efficiency. Supercoiled DNA works well in transfec-tions. Impurities in the DNA preparation can be deleterious to transfection efficiency. Adescription of how to optimize the amount of DNA to transfect and other parameters ofcalcium phosphate–mediated transfection is provided in the discussion of optimization oftransfection (UNIT 20.7).

Ethanol precipitation sterilizes the DNA to be transfected. For transfections that will beharvested within 3 to 4 days (transient analysis), this is not necessary. For transientexperiments, many researchers make a 450-�l aqueous solution containing the DNAdirectly, without ethanol precipitation. If this is done, care should be taken to keep theamount of Tris in the solution to a minimum, as Tris may alter the pH of the precipitate andtherefore reduce transfection efficiency.

Figure 20.3.1 Formation of calcium phosphate precipitate.


20.3.2

CalciumPhosphate

Transfection

3. Place 500 µl of 2× HeBS in a sterile 15-ml conical tube. Use a mechanical pipettorattached to a plugged 1- or 2-ml pipet to bubble the 2× HeBS and add the DNA/CaCl2

solution dropwise with a Pasteur pipet (see Fig. 20.3.1). Immediately vortex thesolution for 5 sec.

If no mechanical pipettor is available, the solution can be bubbled by blowing throughrubber tubing that is attached to a pipet via a filter. The filter is necessary to maintainsterility. This does not give as reproducible results as the mechanical pipettor.

4. Allow precipitate to sit 20 min at room temperature.

5. Use a Pasteur pipet to distribute the precipitate evenly over a 10-cm plate of cells andgently agitate to mix precipitate and medium.

6. Incubate the cells 4 to 16 hr under standard growth conditions. Remove the medium.Wash cells twice with 5 ml PBS and feed cells with 10 ml complete medium.

The amount of time that the precipitate should be left on the cells will vary with cell type.For hardy cells such as HeLa, NIH 3T3, and BALB/c 3T3, the precipitate can be left on for16 hr. Other cell types will not survive this amount of exposure to the precipitate. Seediscussion of optimization of transfection (UNIT 20.7) for optimization of this step as wellas for a discussion of how to determine whether glycerol shock is useful.

7. For transient analysis, harvest the cells at the desired time point. For stable transfor-mation, allow the cells to double twice before plating in selective medium.

SUPPORTPROTOCOL

GLYCEROL/DMSO SHOCK OF MAMMALIAN CELLS

The Basic Protocol works well for cell lines such as HeLa, BALB/c 3T3, NIH 3T3, andrat embryo fibroblasts. Transfection efficiency in some cell lines, such as CHO DUKX,is dramatically increased by “shocking” the cells with either glycerol or DMSO. Precipi-tates are left on the cell for only 4 to 6 hr, and the cells are shocked immediately afterremoval of the precipitate.


10% (v/v) glycerol solution or DMSO in complete medium, sterilePBS (APPENDIX 2A), sterile

Replace step 6 of the Basic Protocol with the following:

6a. Incubate the cells 4 to 6 hr and remove the medium. Add 2.0 ml of a sterile 10%glycerol solution. Let the cells sit 3 min at room temperature.

Alternatively, 10% or 20% DMSO can be used. DMSO tends to be somewhat less harmfulto the cells, but also may not work as well.

6b. Add 5 ml of PBS to the glycerol solution on the cells, agitate to mix, and remove thesolution. Wash twice with 5 ml of PBS. Feed the cells with complete medium.

It is important to dilute the glycerol solution on the cells with PBS before removing theglycerol solution so the cells do not stay in glycerol too long. Excessive exposure to glycerolwill kill cells.


20.3.3


ALTERNATEPROTOCOL

HIGH-EFFICIENCY TRANSFECTION USING CALCIUMPHOSPHATE–DNA PRECIPITATE FORMED IN BES

A solution of calcium chloride, plasmid DNA, and N,N-bis(2-hydroxyethyl)-2-amino-ethanesulfonic acid (BES) buffer, pH 6.95, is added to a plate of cells containing culturemedium. The plates are incubated overnight while a calcium phosphate–DNA complexforms gradually in the medium under an atmosphere of 3% CO2. With this method, 10%to 50% of the cells on a plate stably integrate and express the transfected DNA. Transientexpression under these conditions is comparable to that obtained with the Basic Protocol.Glycerol or DMSO shock does not increase the number of cells transformed.

Materials

Exponentially growing mammalian cells (see Critical Parameters)Complete medium: Dulbecco modified Eagle medium containing 10% (v/v) fetal

bovine serum (FBS)CsCl-purified plasmid DNATE buffer, pH 7.4 (APPENDIX 2A)2.5 M CaCl2 (see recipe)2× BES-buffered solution (BBS; see recipe)PBS (APPENDIX 2A)Selection medium (APPENDIX 3A; optional)

10-cm tissue culture dishes35°C, 3% CO2 humidified incubator35° to 37°C, 5% CO2 humidified incubatorFyrite gas analyzer (optional; Fisher Scientific or Curtin Matheson)

NOTE: All solutions and equipment coming into contact with cells must be sterile, andproper sterile technique should be used accordingly.

1. Seed exponentially growing mammalian cells at 5 × 105 cells/10-cm tissue culturedish in 10 ml complete medium the day prior to transfection.

There should be <106 cells/dish just prior to infection. Enough surface area should remainon the plate for at least two more doublings.

2. Dilute CsCl-purified plasmid DNA with TE buffer to 1 µg/µl. Store the DNA solutionat 4°C.

Purity of the plasmid DNA is critical.

The optimum amount of plasmid to use can be determined by transfecting three dishes ofcells with 10, 20, and 30 �g of plasmid DNA and incubating overnight. The dishes shouldthen be examined with a microscope at 100×. A coarse, clumpy precipitate will form atDNA concentrations that are too low, a fine (almost invisible) precipitate will form atconcentrations that are higher than optimal, and an even, granular precipitate will formwith optimal DNA concentrations.

3. Prepare 0.25 M CaCl2 from 2.5 M stock. Mix 20 to 30 µg plasmid DNA with 500 µlof 0.25 M CaCl2. Add 500 µl of 2× BBS, mix well, and incubate 10 to 20 min at roomtemperature.

4. Add the calcium phosphate–DNA solution dropwise onto the medium-containingplate while swirling the plate. Incubate 15 to 24 hr in a 35°C, 3% CO2 incubator.

Level of carbon dioxide is critical. Use a Fyrite gas analyzer to measure percent CO2 priorto incubation.


20.3.4

CalciumPhosphate

Transfection

5. Wash the cells twice with 5 ml PBS, and add 10 ml complete medium. For stabletransformation, incubate overnight in a 35° to 37°C, 5% CO2 incubator. For studiesinvolving transient expression, incubate the cells for 48 to 72 hr after adding the DNA.

6. Split the cells 1:10 to 1:30, depending on the growth rate of the host cell, beforebeginning to select stable transformants. Incubate overnight in a 35° to 37°C, 5%CO2 incubator.

7. Start selection by changing the medium to selection medium or by incubating cellsunder appropriate selection conditions.


Use deionized, distilled water or equivalent for all recipes and protocol steps. For common stocksolutions, see APPENDIX 2A; for suppliers, see SUPPLIERS APPENDIX.

BES-buffered solution (BBS), 2×50 mM N,N-bis(2-hydroxyethyl)-2-aminoethanesulfonic acid (BES;

Calbiochem-Novabiochem)280 mM NaCl1.5 mM Na2HPO4, pH 6.95800 ml H2OAdjust to pH 6.95 with 1 N NaOH, room temperatureAdd H2O to 1 literFilter sterilize through a 0.45-µm nitrocellulose filter (Nalgene)Store in aliquots at −20°C

As discussed in the Commentary, the pH of this solution is critical (pH 6.95 to 6.98). Whena new batch of 2× BES buffer is prepared, its pH should be checked against a reference stockprepared (and tested) earlier.

This solution can be frozen and thawed repeatedly.

CaCl2, 2.5 M183.7 g CaCl2⋅2H2O (Sigma; tissue culture grade)H2O to 500 mlFilter sterilize through a 0.45-µm nitrocellulose filter (Nalgene)Store at −20°C in 10-ml aliquots

This solution can be frozen and thawed repeatedly.

HEPES-buffered saline (HeBS) solution, 2×16.4 g NaCl (0.28 M final)11.9 g HEPES (N-2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid; 0.05 M final)0.21 g Na2HPO4 (1.5 mM final)800 ml H2OTitrate to pH 7.05 with 5 N NaOHAdd H2O to 1 literFilter sterilize through a 0.45-µm nitrocellulose filterTest for transfection efficiencyStore at −20°C in 50-ml aliquots

An exact pH is extremely important for efficient transfection. The optimal pH range is 7.05 to 7.12.

There can be wide variability in the efficiency of transfection obtained between batches of2× HeBS. Efficiency should be checked with each new batch. The 2× HeBS solution can berapidly tested by mixing 0.5 ml of 2× HeBS with 0.5 ml of 250 mM CaCl2 and vortexing. Afine precipitate should develop that is readily visible in the microscope. Transfectionefficiency must still be confirmed, but if the solution does not form a precipitate in this test,there is something wrong.


20.3.5


COMMENTARY

Background InformationCalcium phosphate transfection was first

used to introduce adenovirus DNA into mam-malian cells by Graham and van der Eb (1973).It was later found to be possible to integrateexogenous DNA into mammalian chromo-somes using this technique (Wigler et al.,1978). The protocol described here has evolvedfrom these methods; in particular, the order ofaddition of the HEPES-buffered saline solu-tions (HeBS) to calcium chloride is different.In addition, many investigators have found thatit is not necessary to add chromosomal DNAas carrier when doing a transfection. Transfec-tions work well if only plasmid DNA, such aspUC vectors, is used.

This HEPES-based approach has been usedto analyze replication and promoter functionusing “transient” protocols, in which cells areharvested 48 to 60 hr after the transfection isstarted. It also is presently the most widely usedtechnique for producing cell lines in whichtransfected DNA is stably integrated into thechromosome, although the BES-based tech-nique (see Alternate Protocol) is gaining wide-spread use for production of stable transfor-mants. Calcium phosphate–mediated transfec-t ion tends to work much better thanDEAE-dextran-mediated transfection (UNIT

20.4) in formation of stable cell lines. It is be-lieved that this is because cells in a calciumphosphate transfection pick up more DNA thanDEAE-dextran-transfected cells. Electropora-tion (UNIT 20.5) and liposome-mediated transfec-tion (UNIT 20.6) can also be successfully used toproduce stable cell lines.

Another major strength of calcium phos-phate transfection is that transfected cells gen-erally contain a representative sampling of thevarious plasmids in the precipitate. Hence, onecan prepare a 10:1 ratio of two plasmids andexpect that the plasmids will be present in thatratio in the transfected cells.

The BES-based high-efficiency calciumphosphate transfection (see Alternate Protocol)is a modification of the standard calcium phos-phate method that employs a buffer systemoriginally developed for phage particle–medi-ated gene transfer (Ishiura et al., 1982). Withthis buffer system the calcium phosphate–DNAprecipitate forms gradually in the culture me-dium, dropping gently onto the cells over a 15-to 24-hr period. This method can stably trans-form most common mammalian fibroblast andepithelial cell lines 10- to 100-fold more effi-

ciently than other methods. For transient ex-pression, it is no better than the standardmethod.

Critical Parameters andTroubleshooting

Calcium phosphate transfections are fin-icky—they are not difficult to do, they just donot always work—even in the hands of peoplewho routinely do them. In the Basic Protocol,the most common reason for failure is a 2×HeBS solution that is no longer at the appropri-ate pH. The optimum pH range for transfectionis extremely narrow (between 7.05 and 7.12;Graham and van der Eb, 1973). The pH of thesolution can change during storage and an old2× HeBS solution may not work well. Someinvestigators also have noticed that the 2.5 MCaCl2 solution can go bad over time. Bothsolutions should be made fresh if transfectionshave stopped working well.

A second problem is that the pH of themedium can turn acidic while the transfectionis in progress. This results in an extremelyheavy precipitate (making the medium resem-ble orange juice) and generally results in celldeath. Care should be taken to maintain a pHof 7.2 to 7.4 and CO2 concentrations in theincubator as listed in the protocols. Incubatorand medium conditions that are fine for rou-tinely growing cells may not suffice for calciumphosphate transfection.

Many factors can influence the efficiency ofHEPES-buffered calcium phosphate–mediatedtransfection. A description of experiments thatcan be done to optimize transfection efficiencyusing both this procedure and the BES proce-dure can be found in the discussion of optimi-zation of transfection (UNIT 20.7).

Several parameters are crucial to achievehigh efficiency with the Alternate Protocol: pHof the 2× BES-buffered saline (BBS), percent-age of carbon dioxide in the incubator duringformation of precipitate, and form and amountof DNA used.

A pH curve of the 2× BBS buffer should bemade because minor variations in pH can havesubstantial effects on transfection efficiency.Perform pilot experiments with buffers of vary-ing pH. The optimal pH is within a very narrowrange (6.95 to 6.98). Once the optimal buffer isfound, use it as a reference to prepare bufferstocks. If no precipitate forms, the concentra-tion of calcium chloride or 2× BES solution(BBS) may be wrong. Be sure to mix reagents


20.3.6

CalciumPhosphate

Transfection

thoroughly before adding them to the DNA.Crystal formation upon the addition of calciumchloride indicates incorrect calcium chlorideconcentration, and the transfection must berepeated.

The first overnight incubation should be at3% CO2, but a variation of 0.5% may be ac-ceptable. After overnight incubation at 3% CO2

the culture medium should be alkaline (pH 7.6).Measure the CO2 levels of the incubator beforeusing. A Fyrite device is recommended for this.

Only plasmid DNA gives high efficienciesof gene transfer with the Alternate Protocol.Efficiency is also dependent on the purity andconcentration of the DNA. Toxicity that oftenoccurs with common fibroblasts and epithelialcell lines is usually caused by impure DNA, notcalcium phosphate. DNA prepared by cesiumchloride gradient centrifugation is rarely toxicto cells. The optimal DNA concentration variesamong plasmid preparations as well as withdifferent cells and media. Each new plasmidpreparation and each new cell line being trans-fected should be tested for optimum DNA con-centration.

If it is suspected that a particular plasmidpreparation is toxic, use a control plasmid—one known not to be toxic to these cells—to testfor toxicity. If the plasmid DNA is toxic, pre-pare new DNA.

Cotransfection efficiency is 10- to 20-foldbetter with the BES method (see Alternate Pro-tocol) than with the Basic Protocol, althoughefficiencies vary with the plasmid and markergene used. A 1:10 ratio of selectable marker tononselected gene is recommended, but the ef-ficiency of transfection will depend on opti-mum DNA dose. Glycerol shock or DMSOtreatment will not increase the number of cellstransfected with this method.

The BES protocol (see Alternate Protocol)has been optimized for use with cells thatgrow in Dulbecco modified Eagle mediumcontaining 10% (v/v) fetal bovine serum(FBS). RPMI and minimal essential medi-umα (MEMα) have also been demon-strated to give good results under the statedconditions. The FBS must be tested beforeuse by examining the growth, plating effi-ciency, and transformation efficiency of atleast two cell lines. (Serum is tested withoutheat inactivation.) Because FBS is verycostly, 10% (v/v) newborn calf serum and 5%(v/v) FBS can be added to the medium (atotal of 75 ml serum/500 ml medium) insteadof 10% FBS. This gives equivalent efficien-cies of stable transformation. The lots of new-

born calf serum also must be tested for growthand plating efficiencies, as these have beenfound to vary. If horse or other serum or me-dium is required, optimum conditions mayneed to be rechecked.

The Alternate Protocol works well for mostestablished cell lines that grow as monolayers,including mouse, rat, hamster, monkey, andhuman. It does not seem to work well forneuronal lines. This may be due to the delete-rious effect of the calcium on these cells. Cellsthat grow in suspension are transfected ratherpoorly by this method, but their stable transfor-mation frequencies seem to be better than thoseobtained by the Basic Protocol and almost com-parable to those obtained by electroporation.

Anticipated ResultsThe efficiency that can be obtained with

calcium phosphate–mediated transfection var-ies with cell type and other parameters as de-scribed. Methods for optimizing these parame-ters are presented in the discussion of optimi-zation of transfection (UNIT 20.7). Up to 103

colonies can be obtained by transfecting 1 µgof a plasmid containing a dominant selectablemarker into 106 cells by the HEPES-basedprotocol. Efficiencies for stable transformantsare generally >10- to 100-fold higher when theBES-based protocol is used, with 10% to 50%of the cells on a plate stably transformed (Chenand Okayama, 1987). Transient expression iscomparable in the Basic and Alternate Proto-cols (Chen and Okayama, 1988).

Time ConsiderationsFor the Basic Protocol, preparation of

twelve DNA precipitates and addition of theprecipitates to the cells takes 1 to 2 hr. Withoutthe ethanol precipitation step, the procedurecan be done in 1 hr. With practice, the actualmixing of the CaCl2 and 2× HeBS solutionswill take ∼1 min. This means that up to eighteenprecipitates can be made before the first pre-cipitate is ready to apply to the cells.

For the Alternate Protocol, no ethanol pre-cipitation step has been necessary for eithertransient or stable transfections. It takes slightlyless time than the Basic Protocol because the2× BBS does not need to be added dropwise tothe calcium chloride–DNA solution.

Literature CitedChen, C. and Okayama, H. 1987. High efficiency

transformation of mammalian cells by plasmidDNA. Mol. Cell. Biol. 7:2745-2752.


20.3.7


Chen, C. and Okayama, H. 1988. Calcium phos-phate–mediated gene transfer: A highly efficientsystem for stably transforming cells with plas-mid DNA. BioTechniques 6:632-638.

Graham, F.L. and van der Eb, A.J. 1973. A newtechnique for the assay of infectivity of humanadenovirus 5 DNA. Virology 52:456.

Ishiura, M., Hirose, S., Uchida, T., Hamada, Y.,Suzuki, Y., and Okada, Y. 1982. Phage particle–mediated gene transfer to cultured mammaliancells. Mol. Cell. Biol. 2:607-616.

Wigler, M., Pellicer, A., Silverstein, S., and Axel, R.1978. Biochemical transfer of single-copy eu-caryotic genes using total cellular DNA as donor.Cell 14:725.

Key ReferencesChen and Okayama, 1987. See above.

Ishiura et al., 1982. See above.

Provides the basis for BES-mediated transfection.

Contributed by Robert E. Kingston (HEPES method)Massachusetts General Hospital and Harvard Medical SchoolBoston, Massachusetts

Claudia A. Chen (BES method)National Institute of Mental HealthBethesda, Maryland

Hiroto Okayama (BES method)Osaka UniversityOsaka, Japan


20.3.8

CalciumPhosphate

Transfection

UNIT 20.4Transfection Using DEAE-DextranTransfection of cultured mammalian cells using diethylaminoethyl (DEAE)-dextran/DNAcan be an attractive alternative to other transfection methods in many circumstances. Themajor advantages of the technique are its relative simplicity and speed, limited expense, andremarkably reproducible interexperimental and intraexperimental transfection efficiency.Disadvantages include inhibition of cell growth and induction of heterogeneous morphologi-cal changes in cells. Furthermore, the concentration of serum in the culture medium must betransiently reduced during the transfection. Any of these factors may adversely affect or beincompatible with some bioassays or experimental goals. In addition, for nonstandard celltypes there may be a requirement for extensive preliminary investigation of optimal transfec-tion conditions. Together, these factors influence the suitability of this technique to specificpurposes. In general, DEAE-dextran DNA transfection is ideal for transient transfections withpromoter/reporter plasmids in analyses of promoter and enhancer functions, and is suitablefor overexpression of recombinant protein in transient transfections or for generation of stablecell lines using vectors designed to exist in the cell as episomes. The procedure may also be usedfor expression cloning (Aruffo and Seed, 1987; Kluxen and Lubbert, 1993; Levesque et al.,1991), although electroporation is usually preferred for this purpose (Puchalski and Fahl, 1992).

This unit presents a general description of DEAE-dextran transfection (see Basic Proto-col) as well as two more specific protocols for typical experimental applications (seeAlternate Protocols 1 and 2).

The Basic Protocol is suitable for transfection of anchorage-dependent (attached) cells.For cells that grow in suspension, electroporation (UNIT 20.5) or lipofection (UNIT 20.6) isusually preferred, although DEAE-dextran-mediated transfection can be used (Fregeauand Bleackley, 1991). For suspension cells, the transfection step should be performed oncollected cells that have been resuspended at 107 cells/ml in transfection medium, usingreagents and conditions that are otherwise similar to those of the Basic Protocol.

NOTE: All reagents and equipment coming into contact with live cells must be sterile,and proper aseptic technique should be followed accordingly.

NOTE: All culture incubations are performed in a 37°C, 5% CO2 incubator unlessotherwise specified.

BASICPROTOCOL

GENERAL PROCEDURE FOR DEAE-DEXTRAN TRANSFECTION

Cultured cells are incubated in medium containing plasmid DNA and DEAE-dextran,which form complexes that are taken up by cells via endocytosis. Chloroquine can beincluded to inhibit degradation of plasmid DNA. Cells are exposed transiently to DMSOor another permeabilizing agent to increase DNA uptake (DMSO “shock”). Importantvariables include the concentration of DEAE-dextran, the ratio of DNA to DEAE-dextran,the duration of transfection, and the presence and timing of chloroquine exposure (seeCritical Parameters). This protocol is suitable for transfection of COS and CV1 cells;Alternate Protocols 1 and 2 describe two examples of transfection experiments.

Materials

Cells to be transfected and appropriate culture medium (e.g., complete DMEM;UNIT 1.1) with and without 10% FBS

100 mM (1000×) chloroquine diphosphate in PBS, filter-sterilized (store at 4°C)Plasmid DNA(s), prepared by CsCl density-gradient centrifugation or affinity

chromatographyTE buffer (APPENDIX 2A)

Supplement 19

Contributed by Tod GulickCurrent Protocols in Cell Biology (2003) 20.4.1-20.4.10Copyright © 2003 by John Wiley & Sons, Inc.

20.4.1


10 mg/ml DEAE-dextran stock solution (see recipe)10% (v/v) dimethyl sulfoxide (DMSO) in PBS, filter-sterilized (store up to 1

month at room temperature)Phosphate-buffered saline (PBS; APPENDIX 2A)

Appropriate-sized tissue culture vessels (Table 20.4.1)Inverted microscope

Additional reagents and equipment for mammalian cell culture (UNIT 1.1)

1. Plate cells at a density that will achieve 50% to 75% confluence on the target day fortransfection. For COS or CV1 cells, perform a 1:10 split 2 days prior to transfection.

The surface area of various cell culture vessels given in Table 20.4.1 can be used todetermine how to split cells to the desired density.

Some cell types including many primary cells show particular sensitivity to the toxicity ofDEAE-dextran. These cells should be plated at higher density or transfected after reachingnear-confluence.

2. Determine the total volume of medium to be used in the transfection based on the numberof culture vessels containing cells to be transfected and the volume per vessel shown inTable 20.4.1. Make up this amount of medium (plus some excess) to contain 2.5% FBSby combining 1 part medium containing 10% FBS with 3 parts serum-free medium.

DEAE-dextran can precipitate in the presence of high medium protein, necessitating useof a low FCS concentration. Alternatively, NuSerum (Collaborative Research), whichcontains only ∼30% serum, can be used at a final concentration of 10%.

3. Add 100 mM (1000×) chloroquine diphosphate stock solution to the 2.5%-FBS-con-taining transfection medium prepared in step 2 to achieve a final concentration of 100µM. Warm transfection medium to 37°C.

Chloroquine is toxic to all cells, so exposure time should be limited to <4 hr. If longertransfection times are required for optimal transfection of a particular cell type, chloro-quine should be added during the final hours of the transfection.

Table 20.4.1 Surface Areas of Commonly Used Tissue CultureVessels and Corresponding Appropriate DEAE-Dextran TransfectionMedium Volumes

Vessel Area (cm2)Appropriate vol.DEAE-dextranmediuma (ml)

T175 flask 175T150 flask 150T75 flask 75T25 flask 25150-mm dish 148b 10100-mm dish 55b 460-mm dish 21b 235-mm dish 8b 16-well plate (35-mm wells) 9.4b 112-well plate (22-mm wells) 3.8b 0.524-well plate (15.5-mm wells) 1.9b 0.25aThese volumes are roughly a linear function of vessel surface area. To ensure that cellsare completely covered by medium during the transfection, small wells require propor-tionately larger volumes due to annular sequestration of medium because of surfacetension at the periphery.bCostar; other manufacturer products may deviate slightly.


20.4.2

TransfectionUsing

DEAE-Dextran

4. Dilute plasmid DNA in TE buffer or distilled water to between 1.0 and 0.1 µg/µl,depending on the quantity to be transfected. Add the DNA solution directly to thewarmed transfection medium to a final concentration of 1.0 µg/ml.

DNA solution(s) should comprise <1% of the total volume of transfection medium, sothat the concentration of medium components is not significantly altered. Optimal DNAconcentration in the transfection medium may have to be determined experimentally.

Maintaining dilute stock DNA solutions for dedicated use in transfections reduces interex-perimental variation as well as the time required to set up transfection experiments.

5. Warm the 10 mg/ml DEAE-dextran stock solution to 37°C and mix thoroughly byinversion. Add to the DNA-supplemented transfection medium to a final concentra-tion of 100 µg/ml DEAE-dextran and mix by inversion.

The order of addition to the transfection medium is critical. Adding plasmid DNA to mediumthat has already been supplemented with DEAE-dextran can result in precipitation, seenas a ropy white glob. Optimal DEAE-dextran concentration in the transfection may haveto be determined experimentally.

6. Aspirate medium from the 50% to 70% confluent cell cultures (see step 1) and replacewith the appropriate volume of 37°C DEAE-dextran/DNA-supplemented transfec-tion medium (see Table 20.4.1). Incubate 4 hr.

Uniformity of transfection efficiency may be improved by placing culture vessels on a rockerplatform within the incubator during the transfection to ensure even exposure of cells toDEAE-dextran/DNA in the medium and to avoid dessication of cells in the center of thevessel. Optimal transfection time may have to be determined experimentally.

7. Examine cells with an inverted microscope.

Cells may appear granular, some cell nuclei may appear pyknotic, and some cell bordersmay be somewhat ragged. An efficient DEAE-dextran transfection is usually associatedwith 25% to 75% cell death.

8. Warm the 10% DMSO/PBS to 37°C. Aspirate the transfection medium, note thevolume, and replace with 2 to 3 volumes of 37°C DMSO/PBS. Incubate at roomtemperature for >2 but <10 min. Aspirate the DMSO/PBS and wash the cell layerwith a volume of PBS equal to the amount of DMSO/PBS removed. Aspirate andreplace with a standard amount of complete medium containing 10% FBS.

Loss of firm cellular anchorage to the culture vessel may occur. Medium exchange and cellwashing should therefore involve careful aspiration and pipetting, perhaps by holding thetip of the pipet against a wall of the culture dish or well. It is sometimes advisable to omitthe PBS wash (as in the experiment described in Alternate Protocol 1, step 8) and simplyadd the complete medium, then change the medium a second time several hours after theDMSO shock when cells have recovered and are more firmly adherent.

9. Continue incubating the cells and analyze at times appropriate to the bioassay orintended purpose of the experiment.

The onset and duration of expression of the transfected gene varies from one cell type toanother, and especially with the expression vector used. It is advisable to perform a paralleltransfection with a readily assayable reporter gene in the identical vector to assess thetemporal features of expression. A reporter that is secreted by the cell into the culturemedium, such as human growth hormone or secreted alkaline phosphatase, is ideal for thispurpose, since aliquots of medium from a single transfection sample can be collected atserial time points. This parallel transfection can also be used in preliminary experimentsto optimize transfection conditions.


20.4.3


ALTERNATEPROTOCOL 1

SAMPLE EXPERIMENT: TRANSFECTION TO TEST PROMOTERFUNCTION

In this protocol for a typical application of DEAE-dextran transfection, a thyroid hor-mone–response element in a hormone-responsive gene promoter will be mapped. Thyroidhormone (T3) modulates transcription by activating the thyroid hormone receptor (TR),a transcription factor that binds to specific response elements in target-gene promoters asa heterodimer with the retinoid X receptor (RXR). Expression of TR, but not RXR, isminimal and limiting in fibroblasts, such that overexpression of TR using an expressionvector significantly increases transcriptional response to T3 in these cells. In this example,four promoter/reporter constructs will be tested, representing a promoter 5′ deletionseries. The hormones, retinoids, and fatty acids in fetal bovine serum (FBS) can interferewith or cause high background in transcription assays in transfected cells. These moietiescan be removed from FBS by charcoal treatment (see Support Protocol).

This protocol corresponds step-for-step with Basic Protocol; variations from the originalprocedure and reagents specific to this particular experiment are noted.


CV-1 cells (ATCC #CCL 70) growing in 100-mm dishComplete DMEM medium (UNIT 1.2) with and without 10% FBSComplete DMEM medium (UNIT 1.2) with 10% charcoal-treated FBS (see Support

Protocol)Plasmid DNAs: Control reporter plasmid (e.g., β-galactosidase, secreted alkaline phosphatase,

or growth hormone, driven by a viral promoter) Four test promoter constructs (promoter/CAT or promoter/luciferase) Expression plasmid with TR gene insert (pTR) No-insert expression plasmid (p[–])Complete DMEM medium (UNIT 1.2) with 10% charcoal-treated FBS (see Support

Protocol), supplemented with 10 nm thyroid hormone (T3)

12-well tissue culture plates100-ml tissue culture dishes

Additional reagents and equipment for trypsinizing and subculturing monolayercells (UNIT 1.1) and analyzing reporter gene activity (APPENDIX 3A)

1. Two days prior to the transfection, trypsinize and suspend CV1 cells from a confluent100-mm dish in 36 ml complete DMEM medium/10% FBS. Place 1 ml completeDMEM/10% FBS in each well of four 12-well plates, then add 250 µl of the cellsuspension to each of these wells. Plate the residual cells in 100-mm dishes for lateruse, or discard. 12 to 24 hr before the transfection, change medium to completeDMEM/10% charcoal-treated FBS.

The sensitivity of most reporter assays permits use of many fewer cells/transfectionconditions than are generally used, with consequent cost savings. CV1 cells in a well of a12-well plate will provide sufficient reporter-gene activity for most promoter/reporters. Inthis protocol, triplicate wells for each condition will be analyzed. Four promoter/CAT orpromoter/luciferase reporters will be tested. Cells will include or exclude pTR cotransfec-tion. Transfected cells will be incubated in the presence or absence of T3. Thus, four 12-wellplates are required for the experiment—i.e., 3 wells (triplicates) × 4 wells (four reporters)× 2 wells (with and without pTR cotransfection) × 2 wells (with and without T3) = 48 wells.These 48 wells include ∼180 cm2 (see Table 20.4.1) such that approximately one-third ofthe cells on one 100-mm (55 cm2) dish will be used in order to achieve a 1:10 split.


20.4.4

TransfectionUsing

DEAE-Dextran

Addition of suspended cells to empty tissue culture plates or wells results in an unevendistribution of adherent cells, which can introduce undesirable intersample variability;hence medium is added to the wells first.

Preincubation in medium supplemented with charcoal-stripped FBS (see Support Protocol)ensures that any hormones of interest are absent from medium bathing the control cellsduring subsequent experiments.

2. Add 7 ml DMEM/10% charcoal-treated FBS to 21 ml serum-free DMEM to make28 ml of DMEM/2.5 % FBS.

In this experiment, the FBS in the DMEM/10 has been stripped of low molecular weighthydrophobic moieties, including T3, using charcoal.

The amount here was calculated as 48 wells multiplied by 0.5 ml/well, and a small excesswas added. In experiments in which the transfection medium will be divided into multiplealiquots carrying different plasmids or plasmid combinations, it is useful to carry a volumeexcess throughout the preparation of the separate transfection media to adjust for pipet-calibration errors.

3. Add 28 µl 100 mM chloroquine diphosphate to the medium and place the tube in a37°C water bath.

4. Dilute the reporter plasmids (control and test promoter constructs) in TE buffer to 1µg/µl; dilute the TR (pTR) and no-insert (p[–]) expression plasmids in TE buffer to0.2 µg/µl. Add 14 µl of the diluted reporter plasmid to the transfection medium (finalconcentration, 0.5 µg/ml). Divide this medium into four equal 6.6-ml aliquots andadd 6.6 µl of a test promoter construct to each separate tube (final concentration, 1µg/ml). Divide each of these into two tubes, each containing 3.2 ml. Add 8 µl pTRto one set of four tubes and 8 µl p[–] to the other set of four tubes (final concentration,0.5 µg/µl). Use each of these eight transfection medium samples to transfect cellswithin six wells in step 6, below.

All cells will be transfected with a control reporter—e.g., β-galactosidase, secreted alkalinephosphatase, or growth hormone—driven by a viral promoter. Each of the four testpromoter/reporters will be transfected into cells within 12 wells. A TR expression vectorwill be transfected into 6 of each of these sets of 12 wells. Cells in triplicate wells in eachof these conditions will be cultured in medium supplemented with T3, while those in theother triplicate wells will be cultured in medium devoid of T3.

Plasmids that are included in more than one transfection condition are added prior todivision of medium into separate aliquots to ensure that these samples receive equivalentamounts of plasmid DNA. The final concentration of DNA in each transfection mediumsample should be equivalent. For this and other reasons, an “empty vector” should be usedas described for p[–] above.

5. Warm the stock DEAE-dextran to 37°C, mix by inversion, and add 32 µl to each ofthe eight tubes containing DNA-supplemented transfection medium (final DEAE-dextran concentration, 100 µg/ml). Mix by gentle inversion.

6. Aspirate medium from six wells on one plate, and replace with one of the eighttransfection-medium samples prepared in step 4 at 500 µl per well. Repeat for eachof the different transfection-medium samples. Incubate 4 hr.

7. Examine cells with inverted microscope.

8. Aspirate medium from wells in one plate and add 1 ml DMSO/PBS per well. Repeatfor each plate. Return to the first plate, aspirate the DMSO/PBS and replace with 1ml/well complete DMEM/10% charcoal-treated FBS. Incubate cells for 4 to 12 hr.Aspirate medium from wells and replace the medium from one set of triplicate wellsfor each transfection condition with 1 ml/well T3-supplemented DMEM/10% char-


20.4.5


coal-treated FBS and the other set of triplicate wells for each transfection conditionwith (T3-unsupplemented) DMEM/10% charcoal-treated FBS.

9. Incubate cells 24 to 48 hr. Aspirate 500 µl of medium from each separate well andsave for control reporter activity determinations in order to normalize test reporteractivities. Wash wells with PBS and harvest cells for CAT or luciferase activitymeasurements.

Reporter activity is used to confirm and quantitate promoter T3 responsiveness (+T3 /−T3),to verify a direct transcriptional response mediated by the TR (augmentation of responseto T3 in pTR-cotransfected cells), and to map the T3-responsive region of the promoter(region present in a T3-responsive promoter/reporter and absent in an unresponsive one).

The use of a control reporter permits normalization for transfection efficiency and fornonspecific-stimulus effects on gene expression. In many cases, when using this transfectiontechnique, adequate and informative preliminary experiments can be conducted withoutthis control (since transfection efficiency is so uniform), thereby saving time and expense.This is seldom possible when using other transient-transfection techniques, especiallycalcium phosphate coprecipitation (UNIT 20.3), where transfection efficiency varies mark-edly within an experiment. Of course, initial experiments should be performed to excludenonspecific stimulus effects.

ALTERNATEPROTOCOL 2

SAMPLE EXPERIMENT: TRANSFECTION TO TEST ENZYMESTRUCTURE/ACTIVITY RELATIONSHIPS

In this experimental application of DEAE-dextran transfection, an enzyme and severalenzyme mutants are overexpressed in COS cells to provide material for kinetic analysesin a structure/activity analysis. A vector designed for high-level expression that replicatesin SV40-transformed cells (e.g., CDM8) will be used.

This protocol corresponds step-for-step with Basic Protocol; variations from the originalprocedure and reagents specific to this particular experiment are noted.


COS cells (ATCC #1650) growing in 100-mm dishComplete DMEM medium (UNIT 1.2) with and without 10% FBSControl plasmid containing reporter gene (e.g., luciferase, CAT, or secreted

alkaline phosphatase)CDM8 vectors containing gene for wild-type enzyme and genes for four mutant

enzymes100-ml tissue culture dishes

Additional reagents and equipment for analyzing reporter gene activity (APPENDIX

3A) and analysis of recombinant proteins (APPENDIX 3A)

1. Two days prior to the transfection, split five 100-mm dishes of confluent COS cellsinto fifty 100-mm dishes.

Ten 100-mm dishes of COS cells will provide sufficient recombinant enzyme activity forkinetic analyses. Recombinant wild-type enzyme and four mutant enzymes will be overex-pressed. Thus, fifty dishes are required for this experiment.

2. Add 50 ml DMEM/10% FBS to 150 ml serum-free DMEM to make 200 mlDMEM/2.5% FBS.

This was calculated as fifty dishes at 4 ml/100-mm dish (see Table 20.4.1).

3. Warm the transfection medium in a 37°C water bath. Do not add chloroquinediphosphate.


20.4.6

TransfectionUsing

DEAE-Dextran

Chloroquine treatment increases DEAE-dextran transfection efficiency, but may reduce theamount of recombinant protein produced by the transfected cells. It is advisable to test thisin early pilot experiments.

4. Dilute the reporter gene plasmid and each of the CDM8/enzyme expression vectorsto 1 µg/µl in TE buffer. Add 20 µl reporter plasmid to the transfection medium andmix (final concentration, 0.1 µg/ml). Divide the medium into five aliquots of 40 ml.Add 160 µl of one CDM8/enzyme expression plasmid to one aliquot (final concen-tration, 4 µg/ml) and repeat this for each of the CDM8/enzyme expression plasmids.

All cells will be transfected with a control plasmid containing a reporter gene such asluciferase, CAT, or secreted alkaline phosphatase to evaluate transfection efficiency. Eachof the five enzyme expression vectors will be used to transfect cells in ten dishes.

If the COS cells have an endogenous activity identical or similar to the activity of therecombinant protein to be overexpressed, it may be prudent to include cells that aretransfected with “empty vector” in experiments of this type to permit parallel assays ofendogenous COS cell activities for “background” subtraction.

Plasmids may compete for replication and/or transcription factors. The control reporterplasmid can be included at low concentration because the reporter has a very sensitiveassay.

5. Warm the stock DEAE-dextran to 37°C, mix by inversion, and add 800 µl to each ofthe tubes containing DNA-supplemented transfection medium (final DEAE-dextranconcentration, 200 µg/ml). Mix by gentle inversion.

6. Aspirate medium from ten dishes and replace with 4 ml of the appropriate DEAE-dextran/DNA-supplemented transfection medium. Repeat for each set of ten dishes.Incubate 3 hr.

7. Examine cells with inverted microscope. Continue the transfection until some cellsappear slightly granular.

8. Aspirate transfection medium from one of the sets of ten dishes and replace with 10ml/dish DMSO/PBS. After 2 min, aspirate the DMSO/PBS and wash gently with 10ml PBS. Aspirate PBS and add 10 ml DMEM/10 FBS. Repeat for each set of tendishes.

9. Incubate cells 48 to 96 hr. Harvest cells as appropriate for recombinant protein assays.Save aliquots of culture medium (for secreted control reporter) or cell extract(intracellular reporter) to determined transfection efficiency.

Normalization for transfection efficiency may not be necessary, particularly in circum-stances where an independent assay for recombinant protein production is available, asmight be provided by a specific antibody.

SUPPORTPROTOCOL

CHARCOAL STRIPPING OF FETAL BOVINE SERUM

Activated charcoal is used to remove low-molecular-weight lipophilic compounds fromserum including hormones, retinoids, and fatty acid ligands of nuclear receptor transcrip-tion factors.

Materials

Fetal bovine serum (FBS), heat-inactivated (UNIT 1.1)Activated charcoal, acid-washed (Sigma)Ultracentrifuge with Beckman SW 28, JA-20.1, or equivalent swinging-bucket

rotor


20.4.7


1. Add 2 g activated charcoal per 100 ml heat-inactivated FBS. Add a stir-bar and placeon a stir plate in a 4°C cold room or refrigerator. Stir for 2 hr.

Although it is difficult to maintain aseptic conditions during charcoal stripping, care shouldbe taken to avoid flagrant contamination and to keep the serum at 4°C.

2. Collect serum in centrifuge tubes and centrifuge 30 min at 72,000 × g (20,000 rpmin SW 28 rotor) or 60 min at 51,500 × g (20,000 rpm in JA-20.1), 4°C.

3. Gently pour off serum from each centrifuge tube into a sterile beaker, divide intoaliquots in sterile conical tubes, and store frozen at −20°C.

Some residual charcoal may be present but the serum should be only lightly peppered withcharcoal after centrifugation.

4. Prior to use, thaw a tube of charcoal-stripped medium and use immediately tosupplement complete medium. Filter sterilize the medium using a 0.22-µm bottletopfilter and collect in a sterile bottle. Store at 4°C.

The serum is filtered after it is added to the medium because the undiluted serum is tooviscous to filter readily.


Use deionized, distilled water in all recipes and protocol steps. For common stock solutions, seeAPPENDIX 2A; for suppliers, see SUPPLIERS APPENDIX.

DEAE-dextran stock solution, 10 mg/ml (100×)Make a 10 mg/ml stock solution of diethylaminoethyl (DEAE)-dextran (mol. wt.∼500,000 Da; Sigma) in tissue culture–quality PBS (APPENDIX 2A). Mix well, filtersterilize using an 0.22-µm filter, mix again, divide into aliquots, and store up to 3months at 4°C.

Warm to 37°C and mix well by inversion immediately before each use.

COMMENTARY

Background InformationThe mechanism by which cells take up DNA

in DEAE-dextran-mediated transfection ap-pears to involve endocytosis after adsorption ofDNA/DEAE-dextran complexes onto cells.The advantages of the technique relate largelyto the relative simplicity, limited expense, andlack of interexperiment and intraexperimentvariability in transfection efficiency.

Critical ParametersThere are several crucial parameters in the

transfection procedure, and the weight of im-portance of each differs for different cell types.Furthermore, maximizing efficiency of a trans-fection (percent of cells transfected) does notnecessarily correspond with optimizing the de-sired goal of the transfection, such as produc-tion of recombinant protein (Kluxen and Lub-bert, 1993) or maintenance of colony-formingpotential of cells containing transfected DNA(Puchalski and Fahl, 1992). Systematic analy-ses of variables in DEAE-dextran/DNA trans-

fection for particular cell types have been re-ported (Fregeau and Bleackley, 1991; Puchal-ski and Fahl, 1992; Kluxen and Lubbert, 1993;Yang and Yang, 1997), and these studies pro-vide useful information. However, the exist-ence of numerous variables and their mutualcodependence makes interpolation, extrapola-tion, or guessing transfection conditions towardany specific end for any particular cell typedifficult to extract from literature reports. Thus,the investigator should carry out a modest setof pilot experiments to optimize conditions.

The major variables that influence DEAE-dextran/DNA transfection include: (1) DEAE-dextran concentration; (2) DNA concentrationand the ratio of DNA concentration to DEAE-dextran concentration; (3) duration of transfec-tion; (4) use of chloroquine; (5) use of perme-abilizing agents; and (6) serum concentration.The influence of each of these factors on thevarious goals of DNA transfection will be ad-dressed.


20.4.8

TransfectionUsing

DEAE-Dextran

The concentration of DEAE-dextran used intransfections varies from 50 to 500 µg/ml.There is an inverse relationship between theconcentration used and the duration of expo-sure prior to onset of cytotoxicity for all celltypes. In initial experiments, it may be best touse a low concentration (100 or 200 µg/ml) toprovide an adequate temporal window to evalu-ate cytotoxicity microscopically. Lethal cyto-toxicity can precede microscopic evidence ofthe same, such that transfections with highconcentrations of DEAE-dextran can result innear-complete cell loss even when most cellsappear healthy at the end of the transfectionperiod.

The DNA concentration used depends inpart on the vector, cell type, and the purpose ofthe transfection. For maximal cell adsorptionof complexes and maximal transfection effi-ciency, the ratio of transfection-mediumDEAE-dextran concentration to DNA concen-tration should be 40:1 to 50:1, perhaps becauseof the existance of an optimal electrostatic cellmembrane/DEAE-dextran/DNA-complex in-teraction (Yang and Yang, 1997). Thus, at aDEAE-dextran concentration of 200 µg/ml,plasmid DNA should be included at 4 to 5µg/ml. Since this ratio influences transfectionefficiency, “empty vector” should be includedin controls at the same concentration as testvectors. This ideal [DEAE-dextran]/[DNA] ra-tio may depend on transfection-medium serumconcentration.

The amounts of DNA to be used in cotrans-fection experiments again depend on the in-tended purpose of each component transfec-tion. When a control reporter plasmid is usedto simply normalize for transfection efficiency,it is often possible and desirable to include alow concentration of the plasmid, since reporterenzyme assays are generally exquisitely sensi-tive. In experiments in which simultaneouscotransfection of single cells with two plasmidsis a goal, it is appropriate to add the plasmidsat the same or similar concentrations. Further-more, transfection efficiency is of paramountimportance in this circumstance, since the per-centage of cells that take up both plasmids is afraction of those that take up each alone. Thisis particularly important in a case like thatpresented in Alternate Protocol 1, where coex-istence of the transcription-factor expressionvector and the promoter/reporter plasmid in asingle cell is important.

DEAE-dextran-mediated cytotoxicity is afunction of exposure time. In general, efficienttransfections can be achieved with a 4-hr incu-

bation if other parameters are adjusted appro-priately. This is a convenient transfection dura-tion since it corresponds to the maximal allow-able period of cell exposure to chloroquine.Shorter transfection times may be appropriatefor some cell types.

The utility of chloroquine in increasing theefficiency of DEAE-dextran transfection iswell documented. However, there may be anattenuation in the amount of transfected geneexpression (Kluxen and Lubbert, 1993) andincreased cell loss and disruption of cellularmorphology (Puchalski and Fahl, 1992) whenthis reagent is included. Thus, use of chloro-quine is appropriate for purposes where trans-fection efficiency is a dominant priority. Inother cases, preliminary experiments shouldevaluate the impact of this agent on the bioac-tivity desired. While some investigators addchloroquine in the final stage of (or after) alonger transfection, it is generally easier toincrease the DEAE-dextran concentration inthis circumstance to permit a single 4-hr trans-fection in medium containing all components.

Using a final cell “shock” with a permeabi-lizing agent markedly increases DEAE-dextrantransfection efficiency without additional cyto-toxicity (Lopata et al., 1984) and should be useduniversally, unless this manipulation somehowinterferes with the desired bioactivity. DMSOat a concentration of 10% is generally used,although 15% glycerol may be more effectivefor some cell types. Enhancement of transfec-tion efficiency increases as a function of per-meabilizing-agent exposure time up to 2 min,after which there is no additional impact (Suss-man and Milman, 1984). Since longer expo-sure, up to 5 to 10 min, produces no negativeeffect, the “shock” should be for >2 min, butneed not be rigorously timed or reproduced,even between transfected samples within anexperiment.

Use of transfection medium supplementedwith 10% FBS results in formation of macro-scopic protein/DEAE-dextran/DNA com-plexes that are not compatible with efficienttransfection. Serum-free medium can be usedduring the transfection, as can medium supple-mented with either 2.5% FBS or 10%NuSerum. The concentration of serum in thetransfection medium affects the extent ofDEAE-dextran-mediated and chloroquine-me-diated cytotoxicity, with a protective effect pro-vided by the serum. FBS concentration mayalso influence the optimal ratio of [DEAE-dex-tran]/[DNA].


20.4.9


Anticipated ResultsThe efficiency of DEAE-dextran-mediated

transfection varies considerably among celltypes. One can expect to achieve 20% to 60%transfection efficiency with many cells usingthis procedure if proper attention is paid tooptimization of transfection conditions. Fol-lowing transfection using this technique, thereare generally significant morphologicalchanges in cells, and some of these may weighagainst the use of this technique for certainpurposes.

Time ConsiderationsSplitting cells into the required number of

plates several days prior to the transfection maytake ∼30 min. Depending on the complexity ofthe transfection, preparing transfection mediamay take 5 min to 1 hr. If stock solutions ofDNA, DEAE-dextran, chloroquine, andDMSO/PBS are prepared in advance, 30 minshould be adequate for this phase, even in amoderately complex transfection experimentlike that presented in Alternate Protocol 1. Dur-ing the subsequent transfection, cells should bemonitored using a microscope periodically af-ter 3 hr. The DMSO or glycerol shock, cellwash, and medium replacement requires only∼10 min. Thus, with minimal but careful plan-ning of experimental design, a transfection canreadily be completed in 5 hr.

Literature CitedAruffo, A. and Seed, B. 1987. Molecular cloning of

a CD28 cDNA by a high-efficiency COS cellexpression system. Proc. Natl. Acad. Sci. U.S.A.84:8573-8577.

Fregeau, C.J. and Bleackley, R.C. 1991. Factorsinfluencing transient expression in cytotoxic Tcells following DEAE-dextran-mediated genetransfer. Somatic Cell Mol. Genet. 17:239-257.

Kluxen, F.-W. and Lubbert, H. 1993. Maximal ex-pression of recombinant cDNAs in COS cells foruse in expression cloning. Anal. Biochem.208:352-356.

Levesque, J.P., Sansilvestri, P., Hatzfeld, A., andHatzfeld, J. 1991. DNA transfection in COScells: A low-cost serum-free method comparedto lipofection. Biotechniques 11:313-318.

Lopata, M.A., Cleveland, D.W., and Sollner-Webb,B. 1984. High level transient expression of achloramphenical acetyl transferase gene byDEAE-dextran mediated DNA transfection cou-pled with a dimethyl sulfoxide or glycerol shocktreatment Nucl. Acids Res. 12:5707-5717.

Puchalski, R.B. and Fahl, W.E. 1992. Gene transferby electroporation, lipofection, and DEAE-dex-tran transfection: Compatibility with cell-sortingby flow cytometry.Cytometry 13:23-30.

Sussman, D.J. and Milman, G. 1984. Short-term,high-efficiency expression of transfected DNA.Mol. Cell. Biol. 4:1641-1643.

Yang, Y.-W. and Yang, J.-C. 1997. Studies of DEAE-dextran-mediated gene transfer Biotechnol.Appl. Biochem. 25:47-51.

Contributed by Tod GulickMassachusetts General HospitalCharlestown, Massachusetts


20.4.10

TransfectionUsing

DEAE-Dextran

UNIT 20.5Transfection by Electroporation

Electroporation—the use of high-voltage electric shocks to introduce DNA into cells—isa procedure that is gaining in popularity. It can be used with most cell types, yields a highfrequency of both stable transformation and transient gene expression, and, because itrequires fewer steps, can be easier than alternate techniques (UNITS 20.3, 20.4 & 20.6).

The Basic Protocol describes the electroporation of mammalian cells. The alternateprotocol outlines modifications for preparation and transfection of plant protoplasts.

BASICPROTOCOL

ELECTROPORATION INTO MAMMALIAN CELLS

Electroporation can be used for both transient and stable transfection of mammalian cells.Cells are placed in suspension in an appropriate electroporation buffer and put into anelectroporation cuvette. DNA is added, the cuvette is connected to a power supply, andthe cells are subjected to a high-voltage electrical pulse of defined magnitude and length.The cells are then allowed to recover briefly before they are placed in normal growthmedium. Factors that can be varied to optimize electroporation effectiveness are discussedin UNIT 20.7.

Materials

Mammalian cells to be transfectedComplete medium (UNIT 1.2) without and with appropriate selective agents

(APPENDIX 3A)Electroporation buffer, ice-cold (see recipe)Linear or supercoiled, purified DNA preparation (see step 7)

Beckman JS-4.2 rotor or equivalentElectroporation cuvettes (Bio-Rad #165-2088) and power source

Additional reagents and equipment for stable transformation in selective mediumand for harvesting transfected cells (APPENDIX 3A)

Prepare the cells for electroporation1. Grow cells to be transfected to late-log phase in complete medium.

Each permanent transfection will usually require 5 × 106 cells to yield a reasonable numberof transfectants. Each transient expression may require 1–4 × 107 cells, depending on thepromoter.

2. Harvest cells by centrifuging 5 min at 640 × g (1500 rpm in a JS-4.2 rotor), 4°C.

Adherent cells are first trypsinized (UNIT 1.1) and the trypsin inactivated with serum.

3. Resuspend cell pellet in half its original volume of ice-cold electroporation buffer.

The choice of electroporation buffer may depend on the cell line used. See CriticalParameters for a complete discussion.

4. Harvest cells by centrifuging 5 min as in step 2.

5. Resuspend cells at 1 × 107/ml in electroporation buffer at 0°C for permanenttransfection. Higher concentrations of cells (up to 8 × 107) may be used for transientexpression.

6. Transfer 0.5-ml aliquots of the cell suspension into desired number of electroporationcuvettes set on ice.

Supplement 19

Contributed by Huntington PotterCurrent Protocols in Cell Biology (2003) 20.5.1-20.5.6Copyright © 2003 by John Wiley & Sons, Inc.

20.5.1

Introduction andExpression ofForeignMacromoleculesinto Cells

Add DNA and electroporate the cells7. Add DNA to cell suspension in the cuvettes on ice.

For stable transformation, DNA should be linearized by cleavage with a restriction enzymethat cuts in a nonessential region and purified by phenol extraction and ethanol precipita-tion. For transient expression, the DNA may be left supercoiled. In either case, the DNAshould have been purified through two preparative CsCl/ethidium bromide equilibriumgradients followed by phenol extraction and ethanol precipitation. The DNA stock may besterilized by one ether extraction; the (top) ether phase is removed and the DNA solutionallowed to dry for a few minutes to evaporate any remaining ether. See APPENDIX 3A forcross-references to these procedures.

For transient expression, 10 to 40 �g is optimal. For stable transformation, 1 to 10 �g issufficient. Cotransfection, although not recommended because of the work required toselect and test transformants, can be done with 1 �g of a selectable marker containing DNAand 10 �g of the DNA containing the gene of interest.

8. Mix DNA/cell suspension by holding the cuvette on the two “window sides” andflicking the bottom. Incubate 5 min on ice.

9. Place cuvette in the holder in the electroporation apparatus (at room temperature) andshock one or more times at the desired voltage and capacitance settings.

The number of shocks and the voltage and capacitance settings will vary depending on thecell type and should be optimized (Critical Parameters; see also UNIT 20.7).

10. After electroporation, return cuvette containing cells and DNA to ice for 10 min.

Culture and harvest the transfected cells11. Dilute transfected cells 20-fold in nonselective complete medium and rinse cuvette

with this same medium to remove all transfected cells.

12a. For stable transformation: Grow cells 48 hr (about two generations) in nonselectivemedium, then transfer to antibiotic-containing medium.

Selection conditions will vary with cell type. For example, neo selection generally requires∼400 �g/ml G418 in the medium. XGPRT selection requires 1 �g/ml mycophenolic acid,250 �g/ml xanthine, and 15 �g/ml hypoxanthine in the medium.

It is often convenient to plate adherent cells at limiting dilution immediately following theshock, or suspension cells at the time of antibiotic addition.

12b. For transient expression: Incubate cells 50 to 60 hr, then harvest cells for transientexpression assays.

Transfected cells can be visualized by standard transient expression assays.

ALTERNATEPROTOCOL

ELECTROPORATION INTO PLANT PROTOPLASTSThis is a modification of the Basic Protocol that is intended for use with plant cells. Plantcells are stripped of their cell walls and DNA is introduced into the resulting protoplasts.


5-mm strips (1 g dry weight) sterile plant materialProtoplast solution (see recipe)Plant electroporation buffer (see recipe)

80-µm-mesh nylon screenSterile 15-ml conical centrifuge tube

Additional reagents and equipment for plant RNA preparation (APPENDIX 3A)


20.5.2

Transfection byElectroporation

1. Obtain protoplasts from carefully sliced 5-mm strips of sterile plant material byincubating in 8 ml protoplast solution for 3 to 6 hr at 30°C on a rotary shaker.

2. Remove debris by filtration through an 80-µm-mesh nylon screen.

3. Rinse screen with 4 ml plant electroporation buffer. Combine protoplasts in a sterile15-ml conical centrifuge tube.

4. Centrifuge 5 min at 300 × g (1000 rpm in a JS-4.2 rotor). Discard supernatant, add 5ml plant electroporation buffer, and repeat wash step. Resuspend in plant electropo-ration buffer at 1.5–2 × 106 protoplasts/ml.

Protoplasts can be counted with a hemacytometer (UNIT 1.1).

5. Carry out electroporation as described for mammalian cells (steps 6 to 11 of the BasicProtocol). Use one or several shocks at 1 to 2 kV with a 3- to 25-µF capacitance asa starting point for optimizing the system.

Alternatively, use 200 to 300 V with 500 to 1000 �F capacitance if the phosphate in theelectroporation buffer is reduced to 10 mM final.

6. Harvest cells after 48 hr growth and isolate RNA, assay for transient gene expression,or select for stable transformants.

Protoplasts can also be selected and grown into full transgenic plants (Rhodes et al., 1988).


Use deionized distilled water for all recipes and protocol steps. For common solutions, see APPENDIX 2A;for suppliers see SUPPLIERS APPENDIX.

Electroporation buffersChoice of electroporation buffer depends on the cells being used in the experiment(see Critical Parameters). The following buffers (stored at 4°C) can be used:

1. PBS (APPENDIX 2A) without Ca2+ or Mg2+

2. HEPES-buffered saline (HeBS; UNIT 20.3)

3. Tissue culture medium without FBS (UNIT 1.1)

4. Phosphate-buffered sucrose: 272 mM sucrose/7 mM K2HPO4 (adjustedto pH 7.4 with phosphoric acid)/1 mM MgCl2

Plant electroporation bufferPrepare in PBS (APPENDIX 2A):0.4 M mannitol5 mM CaCl2

Store at 4°C

Protoplast solution2% (w/v) cellulase (Yakult Honsha)1% (w/v) macerozyme (Yakult Honsha)0.01% (w/v) pectylase0.4 M mannitol40 mM CaCl2

10 mM 2-[N-morpholino]ethanesulfonic acid (MES), pH 5.5Prepare fresh before use

20.5.3



COMMENTARY

Background InformationDNA transfection by electroporation is a

technique that is applicable to perhaps all celltypes. It yields a high frequency of stable trans-formants and has a high efficiency of transientgene expression. Electroporation makes use ofthe fact that the cell membrane acts as an elec-trical capacitor that is unable to pass current(except through ion channels). Subjectingmembranes to a high-voltage electric field re-sults in their temporary breakdown and theformation of pores that are large enough toallow macromolecules (as well as smallermolecules such as ATP) to enter or leave thecell. The reclosing of the membrane pores is anatural decay process that is delayed at 0°C.

During the time that the pores are open,nucleic acid can enter the cell and ultimatelythe nucleus. Linear DNA with free ends is morerecombinogenic and more likely to be inte-grated into the host chromosome to yield stabletransformants. Supercoiled DNA is more easilypackaged into chromatin and is generally moreeffective for transient gene expression.

The use of high-voltage electric shocks tointroduce DNA into cells was first performedby Wong and Neumann using fibroblasts (Neu-mann et al., 1982; Wong and Neumann, 1982).The technique was then generalized (Potter etal., 1984) to all cell types—even those such aslymphocytes that, unlike fibroblasts, cannot betransfected with other procedures (e.g., calciumphosphate or DEAE-dextran DNA coprecipi-tates). Although whole plants or leaf tissue havebeen reported to be transfectable by electropo-ration, plant cells must generally be made intoprotoplasts before DNA can be easily intro-duced into them (Alternate Protocol; Fromm etal., 1985; Ou-Lee et al., 1986). Like mammal-ian cells, plant protoplasts may be electropo-rated under a variety of electrical conditions(Critical Parameters). Both high voltage withlow capacitance (short pulse duration) or lowvoltage with high capacitance (long pulse du-ration) have been used to achieve successfulgene transfer (Chu et al., 1987).

The wide use of electroporation has beenmade possible in large part by the availabilityof commercial apparatuses that are safe andeasy to use and that give extremely reproduc-ible results. Designs of these machines varysubstantially, but fall into two basic categoriesthat use different means of controlling pulseduration and voltage (the two electrical pa-rameters that govern pore formation). One kind

uses a capacitor discharge system to generatean exponentially decaying current pulse, andthe other generates a true square wave (or anapproximation thereof). The capacitor dis-charge instruments charge their internal capaci-tor to a certain voltage and then discharge itthrough the cell-DNA suspension. Both the sizeof the capacitor and the voltage can be varied.Because the current pulse is an exponentiallydecaying function of (1) the initial voltage, (2)the capacitance setting of the instrument, and(3) the resistance of the circuit (including thesample), changing the capacitor size to allowmore (or less) charge to be stored at the voltagewill result in longer (or shorter) decay timesand hence a different effective pulse duration.In contrast, square wave generators controlboth the voltage and pulse duration with solid-state switching devices. They also can producerapidly repeating pulses.

Most of our electroporation experimentshave used the Bio-Rad Gene Pulser, a capacitordischarge device, but are directly applicable toother capacitor discharge devices, and withsome adjustment to square wave generators.Capacitor discharge devices are also availablefrom Life Technologies, BTX, Hoeffer Scien-tific, and International Biotechnologies (seeSUPPLIERS APPENDIX for suppliers’ addresses).These machines, either in a single unit orthrough add-on components, can deliver a va-riety of electroporation conditions suitable formost applications. Square wave generators areavailable from BTX or Baekon and offer greatcontrol over pulse width, allow multiple, rapidpulses, and can be more effective for cells thatare very sensitive or otherwise difficult to trans-fect. These machines are generally more expen-sive. It has become apparent that alternatingcurrent pulses at ∼100 kHz may be the mosteffective wave form for electroporation andpossibly electrofusion (Chang, 1989). How-ever, dedicated electroporation devices utiliz-ing such waves are not yet commercially avail-able and must be constructed from components.For a complete discussion of electroporationinstruments, see Potter (1988).

Electroporation can be easier to carry outthan alternative techniques, which is why it isbecoming popular. Its drawback for use withtransient analysis is that almost five-fold morecells and DNA are needed than with eithercalcium phosphate– or DEAE-dextran-medi-ated transfection (UNITS 20.3 & 20.4). The maindifference between electroporation and cal-

20.5.4


Supplement 36 Current Protocols in Molecular Biology

cium phosphate coprecipitation procedures isthe state of the integrated DNA after selectionin appropriate antibiotic media. In the case ofcalcium phosphate, the amount of DNA takenup and integrated into the genome of eachtransfected cell is in the range of 3 × 106 bp. Asa result, the transfected DNA often integratesas large tandem arrays containing many copiesof the transfected DNA. This would be anadvantage when transfection of genomic DNAinto recipient cells and selection for some phe-notypic change such as malignant transforma-tion is desired; here a large amount of DNAintegrated per recipient cell is essential. In con-trast, electroporation can be adjusted to resultin one to many copies of inserted DNA perrecipient cell. This would be an advantage forgene expression studies, as the identity of theparticular copy responsible for the gene expres-sion can be controlled.

Critical ParametersAs discussed above, the two parameters that

are critical for successful electroporation arethe maximum voltage of the shock and theduration of the current pulse (see also UNIT 20.7).The voltage and capacitance settings must beoptimized for each cell type, with the resistanceof the electroporation buffer being critical forchoosing the initial instrument settings. Theguidelines presented in this unit are meant tobe adapted according to the manufacturers’instructions and the individual investigator’sneeds. Optimal stable and transient transforma-tions occur at about the same instrument set-tings, so transient expression can be used tooptimize conditions for a new cell type.

For low-resistance (high-salt) buffers suchas PBS, HeBS, or tissue culture medium, startwith a capacitor setting of 25 µF and a voltageof 1200 V for 0.4-cm cuvettes, then increase ordecrease the voltage until optimal transfectionis obtained (usually at ∼40% to 70% cell viabil-ity as detected by trypan blue exclusion; UNIT

1.1). For many cell types, the choice betweenPBS, HeBS, and tissue culture medium is arbi-trary. However, some cells (especially primarycells) are very easily killed and thus electropo-rate poorly at the high voltages needed for PBSor HeBS electroporation buffers. Particularlysensitive cells seem to prefer tissue culturemedium, though it has been shown that thecalcium and magnesium ions in the mediumlower the electroporation efficiency (Neumannet al., 1982). Phosphate-buffered sucrose hasthe advantage that it can be optimized at volt-ages several hundred volts below those used

with PBS or HeBS. Alternatively, Chu et al.(1987) found many sensitive cells were electro-porated more effectively in HeBS with a lowvoltage/high capacitance setting that resultedin at least 10-fold longer pulse duration. Forthese conditions, start at 250 V/960 µF andchange the voltage up to 350 V or down to 100V in steps to determine optimal settings.

Keeping cells on ice (at 0°C) often improvescell viability and thus results in higher effectivetransfection frequency, especially at highpower which can lead to heating (Potter et al.,1984). However, Chu et al. (1987) found thatunder low voltage/high capacitance conditions,some cell lines electroporate with higher effi-ciency at room temperature. Therefore, steps 6to 10 of the Basic Protocol should be carriedout separately at both temperatures to deter-mine the optimum conditions for a new cellline.

Another factor contributing to cell deathappears to be the pH change that results fromelectrolysis at the electrodes. This problem canbe reduced by replacing some of the ionicstrength of the PBS with extra buffer (e.g., 20mM HEPES, pH 7.5).

Optimal parameters for plant electropora-tion differ depending on whether tissue culturecells or various parts of the whole plant are usedas a source of protoplasts. In particular, the highsalt in PBS can be damaging to protoplastsfreshly produced from plant tissue. Replacingthe NaCl in PBS with 135 mM LiCl mayincrease CAT transient gene expression in elec-troporated plant protoplasts 4- to 70-fold(Saunders et al., 1989). Alternatively, an elec-troporation buffer of 0.6 M mannitol/25 mMKCl for leaf cells, or 0.7 M mannitol/40 mMKCl/4 mM MES (pH 5.7)/1 mM 2-ME addedfor root and stem cells, is recommended(Sheen, 1990). In addition, 0.1% BSA/15 mM2-ME/1 mM MgCl2 can be added to eitherprotoplast isolation buffer and the CaCl2 re-duced to 1 mM final. A low salt concentrationin the electroporation buffer reduces the opti-mal capacitance setting to 200 µF.

Anticipated ResultsThe efficiency of transfection by electropo-

ration is dependent upon cell type. For fi-broblasts, which are easily transfected by cal-cium phosphate or DEAE-dextran coprecipita-tion (UNITS 20.3 & 20.4), electroporation gives astable transformation frequency of 1 in ∼103 to104 live cells—approximately that obtainableby the above traditional procedures. For cellsrefractory to traditional methods, electropora-

20.5.5



tion gives a stable transformation frequencybetween 1 in 104 to 105 for most cell types.Occasionally a cell line (e.g., some T lympho-cytes) will transfect poorly under our standardconditions (1 in 106), and even this frequencyis sufficient to obtain significant numbers oftransfectants. In general, cells that transfectefficiently for stable transformants also do sofor transient gene expression. Increasing thenumber of cells and the amount of DNA usedin the electroporation for studying transientgene expression can circumvent problems oflow transfection efficiency and low pro-moter/enhancer efficiency.

For plant protoplast electroporation, the fre-quency of stable transformants is between 1 in102 and 1 in 103 dividing cells.

Time ConsiderationsThe entire process of electroporation of

mammalian cells will take <1 hr. Electropora-tion of plant cells requires ≤6 hr to prepare theprotoplasts and <1 hr for the actual electropo-ration process. As with other transfection pro-cedures, the experiment should be planned toallow for harvest or splitting of the cells 1 to 2days after transfection.

Literature CitedChang, D.C. 1989. Cell poration and cell fusion

using an oscillating electric field. Biophys. J.56:641-652.

Chu, G., Hayakawa, H., and Berg, P. 1987. Electro-poration for the efficient transfection of mam-malian cells with DNA. Nucl. Acids Res.15:1311-1326.

Fromm, M., Taylor, L.P., and Walbot, V. 1985. Ex-pression of genes transferred into monocot anddicot plant cells by electroporation. Proc. Natl.Acad. Sci. U.S.A. 82:5824-5828.

Neumann, E., Schaefer-Ridder, M., Wang, Y., andHofschneider, P.H. 1982. Gene transfer intomouse lyoma cells by electroporation in highelectric fields. EMBO J. 1:841-845.

Ou-Lee, T.M., Turgeon, R., and Wu, R. 1986. Up-take and expression of a foreign gene linked toeither a plant virus or Drosophila promoter inprotoplasts of rice, wheat and sorghum. Proc.Natl. Acad. Sci. U.S.A. 83:6815-6819.

Potter, H. 1988. Electroporation in biology: Meth-ods, applications, and instrumentation. Anal.Biochem. 174:361-373.

Potter, H., Weir, L., and Leder, P. 1984. Enhancer-dependent expression of human κ immunoglob-ulin genes introduced into mouse pre-B lympho-cytes by electroporation. Proc. Natl. Acad. Sci.U.S.A. 81:7161-7165.

Rhodes, C.A., Pierce, D.A., Mettler, I.J., Mascaren-has, D., and Detmar, J.J. 1988. Genetically trans-formed maize plants from protoplasts. Science240:204-207.

Saunders, J.A., Matthews, B.F., and Miller, P.D.1989. Plant gene transfer using electrofusion andelectroporation. In Electroporation and Electro-fusion in Cell Biology (E. Neumann, A.E. Sow-ers, and C.A. Jordan, eds.) p. 343-354. Plenum,New York.

Wong, T.K. and Neumann, E. 1982. Electric fieldmediated gene transfer. Biochem. Biophys. Res.Commun. 107:584-587.

Key ReferencePotter et al., 1984. See above.

The original paper from which the Basic Protocol isadapted.

Contributed by Huntington PotterHarvard Medical SchoolBoston, Massachusetts

20.5.6


Supplement 36 Current Protocols in Molecular Biology

UNIT 20.6Transfection of Cultured Eukaryotic CellsUsing Cationic Lipid Reagents

The development of high-efficiency methods for the introduction of functional geneticmaterial into eukaryotic cells using cationic lipid–based transfection reagents has accel-erated biology research in the studies of gene expression, control of cell growth, and celllineage. Cationic lipid–mediated transfection techniques are commonly used in industrialprotein production as well as in some clinical gene therapy protocols.

Most natural lipids are either neutral or negatively charged (anionic). Positively charged(cationic) lipids were first introduced in 1987 (Felgner et al., 1987). The cationic lipidsfunction by spontaneous electrostatic interaction of their positive charges with thenegative charges in the backbone of DNA, RNA, or oligonucleotides, condensing theextended macromolecules to a compact structure. The cationic charges and the lipophilicnature of the cationic lipids then allow the condensed aggregates to interact with and crossthe negatively charged and hydrophobic cell membrane and enter the target cells. It isalso possible to deliver some proteins into cells using cationic lipids (Sells et al., 1995).Most (but not all) cationic lipid reagents used for transfection consist of mixtures ofcationic and neutral lipids (e.g., DOPE, cholesterol) that are formulated in water to yieldnoncovalent structures called liposomes—hollow spheres with aqueous cores and adiameter of 100 to 400 nm (Felgner et al., 1987). Some are dissolved in ethanol and formmicelles (Behr et al., 1989). There are many cationic lipid reagents available (seeBackground Information and Table 20.6.1). They perform with various efficiencies indifferent applications and target cells.

This unit describes cationic lipid–mediated transfection of a variety of cell types. DNAtransfection is presented for adherent mammalian cells (cell lines as well as primarycultures; see Basic Protocol 1), along with a modified protocol for enhanced transfection(see Alternate Protocol). DNA transfection of suspension mammalian cells (lymphoid,myeloid, and leukemic-derived cells) is also presented (see Basic Protocol 2). Foradherent mammalian cells, RNA transfection is also covered (see Basic Protocol 3).Finally, DNA transfection is presented for insect cells (see Basic Protocol 4). To determine

Supplement 20

Contributed by Pamela Hawley-Nelson and Valentina CiccaroneCurrent Protocols in Cell Biology (2003) 20.6.1-20.6.17Copyright © 2003 by John Wiley & Sons, Inc.

Table 20.6.1 Partial Listing of Commercially Available Cationic Lipid TransfectionReagents

Supplier Reagent Uses

Invitrogen PerFect LipidTransfection Kit (8 lipids)

Test for different cell types

Life Technologies LipofectAmine 2000 General, rapidLipofectAmine Plus Difficult-to-transfect adherent cellsLipofectAmine GeneralLipofectin Liver and endothelial cells,

oligonucleotidesDMRIE-C Suspension cells, RNACellFectin Insect cells

Promega Transfectam GeneralTfx Transfection Trio Test for different cell types

Qiagen Effectene GeneralRoche/BMB DOTAP General

DOSPER GeneralFuGENE 6 General

20.6.1


the best transfection conditions for a particular reagent, use the optimization/fine-tuningprocedure (see Support Protocol).

NOTE: There are minor differences among the recommended protocols for the variouscommercially available cationic lipid reagents. The appropriate product profile sheetsshould be consulted before beginning an experiment.

NOTE: All culture incubations for mammalian cells should be performed in a humidified37°C, 5% CO2 incubator. Some media may require altered levels of CO2 (e.g., for growthof CHO cells in suspension, 8% CO2 is preferable) to maintain pH 7.4. Insect cells arecultured at 27°C.

BASICPROTOCOL 1

CATIONIC LIPID–MEDIATED TRANSFECTION OF ADHERENTMAMMALIAN CELLS WITH DNA

This protocol describes the procedure for transfection of DNA into most adherentmammalian cell lines or cultures of primary cells grown attached to culture vessels (Fig.20.6.1). DNA and lipid reagent are diluted into separate aliquots of serum-free medium,and are then mixed together and allowed to form complexes. Complexes and transfectionmedium (which may contain serum) are added to the cells in one of two ways. Either thecomplexes are diluted with transfection medium and this mixture is added to cells thathave been rinsed and aspirated (as shown in Fig. 20.6.1), or complexes are added directlyto transfection medium that has already been added to the cells (with or without washing).The cells and complexes are incubated together for several hours. After transfection, thevolume of the medium is increased if necessary to prevent drying, serum is added if thetransfection was serum free, and cells are incubated an additional day or two to allowexpression of the transgene.

It is advisable to optimize the conditions for transfection using the Support Protocol.Suggested starting ranges for optimizing the various components of these mixtures aregiven in Table 20.6.2 for six different popular culture vessel sizes. Transfections can bescaled up to other vessel sizes by increasing the amounts of lipid, DNA, and medium in

DNA lipid complexes(must be without serum)

100 µlmedium &

cationiclipid reagent

100 µlmedium& DNA

form complexes(15 min, room temperature)

800 µltransfectionmedium

cells35-mm dish50%-95%confluent(plated daybeforetransfection)

rinse withtransfectionmedium,aspirate

incubate 2-24 hr,then addor replacemedium

Figure 20.6.1 Diagram of cationic lipid–mediated transfection procedure.


20.6.2

Transfection ofCultured

Eukaryotic CellsUsing CationicLipid Reagents

proportion to the difference in surface area. Table 20.6.3 shows the surface areas of severalpopular culture vessels.

Materials

Adherent cellsCell culture medium with serum (e.g., complete DMEM, UNIT 1.2)Dilution medium: serum-free cell culture medium or specialized medium for

lipid-mediated transfection (e.g., Opti-MEM I, Life Technologies)Plasmid DNA, purified by anion-exchange chromatography (e.g., Concert High

Purity columns, Life Technologies; or see Goldsborough et al., 1998), cesiumchloride density gradient, or alkaline lysis (UNIT 1.6)

Cationic lipid reagent (see Table 20.6.1)Polystyrene or polypropylene tubes

Additional reagents and equipment for trypsinization and counting of cells (UNIT

1.1), Xgal staining, and selection of stable transformants (APPENDIX 3A)

1. The day before transfection, trypsinize and count adherent cells (UNIT 1.1). Plate cellsin cell culture medium with serum so that they are 50% to 95% confluent on the dayof transfection. Avoid antibiotics at the time of plating and during transfection.

The single most important factor in reproducible, high-efficiency transfection is a consis-tent number of healthy, proliferating cells. Transfection is most efficient when the cells aremaintained in mid-log growth. Because transfection efficiency is sensitive to culture

Table 20.6.2 Suggested Starting Ranges of Reagents for Lipid-Mediated Transfectiona

Culture vessel DNA (µg)Dilutionmedium (µl)

Cationic lipidreagent (µl)

Transfectionmedium (ml)

Transfectionvolume (ml)

Step 2 Steps 2 & 3 Step 3 Step 5 Step 696-well 0.05-0.4 10-25 0.075-1.5 0.08-0.1 0.1-0.1524-well 0.2-1.6 25-50 0.5-10 0.2-0.5 0.25-0.612-well 0.4-3.2 50-100 1-20 0.4-1 0.5-1.26-well 1-8 100-250 2.5-50 0.8-2.5 1-360-mm 2-16 250-500 5-100 2-5 2.5-6100-mm 6-48 750-1500 15-300 5-15 6.5-18aStep numbers are indicated from Basic Protocol 1. Volumes have been optimized for LipofectAmine 2000. SeeSupport Protocol for additional optimization strategies.

Table 20.6.3 Surface Areas of Commonly UsedCulture Vessels

Culture vessel Surface area (cm2)

96-well 0.3 24-well 2 12-well 4 6-well 10 35-mm 8 60-mm 20 100-mm 60 150-mm 140 T25 25 T75 75 T150 150


20.6.3


confluency, cultures should be maintained carefully and passaged frequently, and astandard seeding protocol should be followed from one experiment to the next. Antibioticsmay cause some toxicity if present during transfection. For some transfection reagents, thehigher cell density is recommended (90% to 95%).

Multiwell cell culture dishes are the easiest to use. Some cells are weakly adherent. Ifnecessary, increase adherence by plating cells on polylysine-coated wells (0.1 mg/mlpoly-L-lysine, Sigma; poly-D-lysine-precoated plates, Becton Dickinson).

This protocol is written without specific amounts of reagents. Table 20.6.2 gives therecommended starting amounts for several popular vessels. See Support Protocol for finetuning the reagent volumes for highest transfection efficiency.

2. On the day of transfection, dilute plasmid DNA into dilution medium in a polystyreneor polypropylene tube and mix. Prepare in bulk for multiple transfections.

Although DNA prepared by anion-exchange chromatography or CsCl gradients yield thebest results, DNA prepared by alkaline lysis (miniprep) will work with lower efficiency.

Commercial medium that is specialized for lipid-mediated transfection (e.g., Opti-MEM I)yields the highest efficiency, but other serum-free media may be used.

Polystyrene or polypropylene tubes work well for dilutions. For small-scale transfections,round-bottom 96-well plates with covers are suitable.

3. Dilute cationic lipid reagent into dilution medium in a second tube and mix. Preparein bulk for multiple transfections.

See Table 20.6.1 for a partial listing of commercially available reagents. A preparation ofthe cationic lipid DDAB with the neutral lipid DOPE can be made in the laboratory (Roseet al., 1991), although efficiency may be lower than with some commercial preparations.

If using Lipofectin, dilute into Opti-MEM I and allow to incubate at room temperature for30 to 45 min (Ciccarone and Hawley-Nelson, 1995). If using LipofectAmine 2000, diluteinto Opti-MEM I and allow to incubate no more than 30 min (Ciccarone et al., 1999).

4. Combine diluted DNA and diluted cationic lipid reagent, mix, and incubate for 15min at room temperature.

Incubation times >15 min (up to 6 hr for some reagents) work just as well.

5. While complexes are forming, replace medium on the cells with the appropriatevolume of fresh transfection medium.

This step is not necessary if the complexes are diluted with transfection medium or if usingLipofectAmine 2000 (see step 6).

This medium can be the same as the dilution medium. It is possible to use serum in thetransfection medium at this step.

6. Add DNA-lipid complexes to each well containing cells. Mix complexes into themedium gently, holding the plate at a slant. Incubate 5 hr at 37°C in 5% CO2.

Adding transfection medium directly to the cells (as described in the steps) helps preventcells in multiwell plates from drying out, as transfection medium can be added to multiplewells rapidly. Alternatively, complexes can be diluted with the appropriate volume of freshtransfection medium and added to cells from which the cell culture medium has beenaspirated (with or without washing, see Fig. 20.6.1). If using LipofectAmine 2000, freshtransfection medium is not required. Undiluted complexes can be added directly to the cellculture medium.

The exposure time may be >5 hr (up to overnight). Be sure that there is sufficient mediumto prevent the cells from drying out (it is not necessary to increase other components if thisis done). If necessary to maximize cell growth, replace the medium containing complexeswith fresh complete medium after 5 hr incubation.


20.6.4



7. After 5 hr incubation, add cell culture medium to reach normal volume and add serumto bring the final concentration to that of normal cell culture medium.

This step is omitted in some protocols, especially when serum is present during transfectionand volumes are adequate to prevent drying.

8a. For transient expression analysis: Assay cell extracts or stain cells in situ 24 to 48 hrafter the start of transfection, depending on cell type and promoter activity.

8b. For stable expression analysis: Passage cells into fresh culture medium 1 day afterthe start of transfection. At 2 days posttransfection, add the appropriate antibiotic toselect for expression of the transfected antibiotic-resistance gene.

Several days or weeks of selection are required for stable expression.

ALTERNATEPROTOCOL

ENHANCED CATIONIC LIPID–MEDIATED TRANSFECTION OFADHERENT MAMMALIAN CELLS WITH DNA

This is an efficient and reproducible protocol for transfection of DNA into most adherentmammalian cell lines or cultures of primary cells grown attached to culture vessels (Dube,1997; Shih et al., 1997; Fig. 20.6.2). The procedure is essentially as described in BasicProtocol 1, except that DNA is diluted into serum-free medium along with a proprietaryenhancing reagent and incubated for 15 min, allowing the formation of precomplexedDNA before addition to the diluted cationic lipid reagent.

The protocol that follows was developed for LipofectAmine Plus, which is composed oftwo reagents: LipofectAmine (the cationic lipid reagent) and Plus reagent (the enhancer).One of the main advantages of the Plus enhancer is a high plateau of transfection activity

1. plate cells 1 daybefore transfection

5. replace mediumwith fresh transfectionmedium

3. dilutecationic lipid reagentinto medium without serum

4. combine dilutedreagent andDNA/enhancer mixture mix

2. dilute DNA into mediumwithout serum, mix

addenhancingreagent, mix

incubate 15 min

incubate 15 min

incubate 3 hr

incubate 24-48 hr

6. add complexes to cells(50%-80% confluent)

7. increase volume, add serumif transfected without serum

8. stain, assay, or passage

Figure 20.6.2 Diagram of enhanced cationic lipid–mediated transfection procedure.


20.6.5


across a broad range of lipid and DNA concentrations. This decreases the necessity foroptimization and allows the recommendation of specific starting conditions (Table 20.6.4).Transfections can be scaled up to other vessel sizes by increasing the amounts of lipid, DNA,enhancer, and medium in proportion to the difference in surface area (see Table 20.6.3).

The other commercially available enhanced cationic lipid reagent is Effectene (Qiagen,see Table 20.6.1). If using this product, consult the appropriate product profile sheetsbefore beginning the experiment.

NOTE: Consult annotations of the standard transfection procedure (see Basic Protocol 1)for additional details, which also apply to this protocol.


Cationic lipid reagent and enhancer (e.g., LipofectAmine Plus, includingLipofectAmine and Plus reagents; Life Technologies)

1. The day before transfection, trypsinize and count adherent cells (UNIT 1.1). Plate cellsin cell culture medium with serum so that they are 50% to 80% confluent on the dayof transfection. Avoid antibiotics at the time of plating and during transfection.

For this protocol, refer to Table 20.6.4 for recommended amounts of reagents in differentvessels.

2. On the day of transfection, dilute plasmid DNA into dilution medium in a polystyreneor polypropylene tube and mix well. Add enhancer, mix, and incubate 15 min at roomtemperature.

DMEM is preferred over Opti-MEM I in this protocol. It is important to add the DNA firstand mix well before adding the Plus reagent to avoid precipitation of the DNA. Incubationtimes >15 min (up to an hour) work just as well.

3. Dilute cationic lipid reagent into dilution medium in a second tube and mix.

4. Combine precomplexed DNA and diluted cationic lipid reagent, mix, and incubatefor 15 min at room temperature.

Incubation times >15 min (up to an hour) work just as well when LipofectAmine is thecationic lipid and Plus reagent is the enhancer.

5. While complexes are forming, replace medium on the cells with the appropriatevolume of fresh transfection medium.

The medium can be the same as the dilution medium. It is possible to use serum in thetransfection medium at this step. In some cells (e.g., HeLa and NIH 3T3), transfection inmedium containing serum is as efficient or more efficient than in medium without serum.

Table 20.6.4 Suggested Starting Amounts of Reagents for Transfection with LipofectAmine Plusa

Culture vessel DNA (µg)Plus reagent(µl)

Dilutionmedium (µl)

LipofectAmine(µl)

Transfectionmedium (ml)

Transfectionvolume (ml)

Step 2 Step 2 Steps 2 & 3 Step 3 Step 5 Step 696-well 0.1 1 10 0.5 0.08 0.124-well 0.4 4 25 1 0.2 0.25012-well 0.7 5 50 2 0.4 0.56-well 1 6 100 4 0.8 1.060-mm 2 8 250 12 2 2.5100-mm 4 20 750 30 5 6.5aStep numbers indicated from Alternate Protocol. It is possible to fine tune transfections by testing a range of lipid and DNA concentrationsto obtain optimal efficiency; however, the peak activity is usually a broad plateau with this reagent.


20.6.6



6. Add DNA-enhancer-lipid complexes to each well containing cells. Mix complexesinto the medium gently, holding the plate at a slant. Incubate at 37°C in 5% CO2 forseveral hours.

The exposure time with LipofectAmine Plus may be as short as 3 hr or up to overnight. Besure there is sufficient medium to prevent the cells from drying out (it is not necessary toincrease other components if this is done).

7. After incubation, add cell culture medium to reach normal volume and add serum tobring the final concentration to that of normal cell culture medium.

8. Perform transient or stable expression analysis (see Basic Protocol 1, steps 8a and8b).

BASICPROTOCOL 2

CATIONIC LIPID–MEDIATED TRANSFECTION OF SUSPENSION CELLSWITH DNA

This protocol is essentially the same as for adherent cells (see Basic Protocol 1) in thatlipid and DNA are diluted separately into dilution medium, mixed, and allowed to formcomplexes before exposing to cells. However, complexes are formed in the wells ofmultiwell culture plates, and cells are then distributed into the wells containing complexesand allowed to transfect.

Materials

Dilution medium: cell culture medium without serum or specialized medium fortransfection (e.g., Opti-MEM I, Life Technologies)

Cationic liposome reagent (e.g., DMRIE-C or LipofectAmine 2000, LifeTechnologies; also see Table 20.6.1)

Plasmid DNA, purified by anion-exchange chromatography or Goldsborough etal., 1998), cesium chloride density gradient, or alkaline lysis

Cell suspension: 1 × 107 cells/ml in normal cell culture medium without serum orantibiotics

Cell culture medium (e.g., complete DMEM; UNIT 1.2)Serum6-well tissue culture plates

1. To each well of a 6-well tissue culture plate add 0.5 ml dilution medium.

Commercial medium that is specialized for lipid-mediated transfection (e.g., Opti-MEMI), without serum or antibiotics, gives the best results. However, other serum-free mediamay also be used.

When transfecting in different-sized culture plates, change the amounts of DNA, cationiclipid reagent, and medium in proportion to the difference in surface area (see Table 20.6.3).

2. Add 0, 2, 4, 6, 8, or 12 µl cationic lipid reagent to each well and mix gently by swirlingthe plate.

DMRIE-C was found to give high efficiency transfection of DNA in Jurkat (human T celllymphoma), K562 and KG-1 (human myeologenous leukemia), and MOLT-4 (humanlymphoblastic leukemia) cell lines. It is a lipid suspension that may settle with time. Toensure that a homogenous sample is taken, mix thoroughly by inverting the tube 5 to 10times before removing a sample for transfection.

3. Add 0.5 ml dilution medium containing 4 µg plasmid DNA to each well. Mix byswirling plate.

The amount of DNA should be optimized for each cell line.

4. Incubate at room temperature for 15 to 45 min to allow formation of lipid-DNAcomplexes.


20.6.7


5. Add 0.2 ml cell suspension (2 × 106 cells) to each well and mix gently.

The single most important factor in reproducible, high-efficiency transfection is a consis-tent number of healthy, proliferating cells. Transfection is most efficient when the cells aremaintained in mid-log growth.

6. Incubate several hours at 37°C in a 5% CO2 incubator.

A 4-hr incubation is adequate for DMRIE-C transfections.

7. To each well add 2 ml cell culture medium containing 1.5× the usual amount of serum.

For Jurkat and MOLT-4 cells, addition of 1 �g/ml phytohemagglutinin (PHA) and 50 ng/mlphorbol myristate acetate (PMA) enhances promoter activity and gene expression. ForK562 and KG-1 cells, PMA alone enhances promoter activity.

8. Assay the cells at 24 or 48 hr post-transfection for transient or stable expression (seeBasic Protocol 1, step 8a or 8b).

BASICPROTOCOL 3

CATIONIC LIPID–MEDIATED TRANSFECTION OF ADHERENT CELLSWITH RNA

In this protocol, lipid is first diluted into dilution medium and mixed. RNA is then mixeddirectly into the diluted lipid and immediately added to cells (which have been rinsed withserum-free medium), and cells are incubated for transfection.

Materials

Adherent cellsCell culture medium with serum (e.g., complete DMEM; UNIT 1.2)

Dilution medium: serum-free cell culture medium or specialized medium fortransfection (e.g., Opti-MEM I, Life Technologies)

Cationic lipid reagent (e.g., DMRIE-C, Life Technologies; also see Table 20.6.1)mRNA (see APPENDIX 3A)

6-well or 35-mm tissue culture plate12 × 75–mm polystyrene tubes

Additional reagents and equipment for trypsinizing, counting, and plating cells(UNIT 1.1)

1. The day before transfection, trypsinize and count adherent cells (UNIT 1.1). In eachwell of a 6-well tissue culture plate, or in six 35-mm tissue culture plates, seed ∼2–3× 105 cells in 2 ml of the appropriate cell culture medium supplemented with serum.

Transfection is most efficient when the cells are growing rapidly. Cultures should bemaintained carefully and passaged frequently. As transfection efficiency may be sensitiveto culture confluency, it is important to maintain a standard seeding protocol fromexperiment to experiment.

2. Incubate at 37°C in a 5% CO2 incubator until the cells are ∼80% confluent.

This will usually take 18 to 24 hr, but the time will vary among cell types.

3. On the day of transfection, wash the cells in each well with 2 ml dilution medium atroom temperature.

Commercial medium that is specialized for lipid-mediated transfection (e.g., Opti-MEMI), without serum or antibiotics, gives the best results. However, other serum-free mediamay also be used.

4. Add 1.0 ml dilution medium to each of six 12 × 75–mm polystyrene tubes.


20.6.8



5. Add 0, 2, 4, 6, 8, or 12 µl cationic lipid reagent to each tube and mix or vortex briefly.

DMRIE-C was found to give high-efficiency transfection of RNA in adherent cell lines(Ciccarone et al., 1995). It is a lipid suspension that may settle with time. To ensure that ahomogenous sample is taken, mix thoroughly by inverting the tube 5 to 10 times beforeremoving a sample for transfection.

6. Add 2.5 to 5.0 µg RNA to each tube and vortex briefly.

mRNA that is capped and polyadenylated is translated more efficiently and is more stablewithin the cell.

7. Immediately add lipid-RNA complexes to washed cells and incubate 4 hr at 37°C ina 5% CO2 incubator.

The time of exposure of cells to lipid-RNA complexes, as well as the amount of RNA addedto the cells, should be adjusted for each cell type.

8. Replace transfection medium with cell culture medium containing serum.

9. Allow cells to express the RNA for 16 to 24 hr and analyze them for expression ofthe transfected RNA as appropriate for the transgene used.

BASICPROTOCOL 4

CATIONIC LIPID–MEDIATED TRANSFECTION OF ADHERENT Sf9 ANDSf21 INSECT CELLS WITH BACULOVIRUS DNA

As for transfecting mammalian cells (see Basic Protocol 1), cationic lipid reagent andnucleic acid are diluted separately into serum-free medium and then mixed and allowedto form complexes. Complexes are then diluted with fresh transfection medium and addedto the cells for transfection. After the cells are fed and incubated, budded virus can beisolated from the medium.

Materials

Insect cells: Sf9 or Sf21 cellsInsect medium (e.g., Sf-900 II SFM, Life Technologies) with and without serum

and antibioticsBaculovirus DNA: purified DNA or bacmid DNA miniprep (Anderson et al., 1995)Cationic lipid reagent (Table 20.6.1)

6-well tissue culture plate27°C incubator12 × 75–mm polystyrene tubes, sterile

Additional reagents and equipment for culturing insect cells and harvestingbaculovirus from cell supernatants (APPENDIX 3A)

1. In each well of a 6-well tissue culture plate, seed ∼9 × 105 insect cells in 2 ml insectmedium without serum or antibiotics.

Insect cells must be plated when they are in mid-log growth phase. Cells that have reachedstationary phase transfect and infect at very low efficiency. Therefore, it is advisable tomaintain a standard cell passage protocol that keeps the cells in log growth. For Sf9 orSf21 cells adapted in Sf-900 II SFM, cells are passaged twice weekly to a density of 3 ×105 cells/ml in suspension, and plated for transfection on the third day postseeding, whenthey are in mid-log phase. For other cell culture media and growth conditions, adjustconditions to maintain similar growth characteristics.

For culture of insect cells, use 50 units/ml penicillin and 50 �g/ml streptomycin (half theusual final concentration). For transfection, it is preferable to omit antibiotics from themedium to avoid toxicity.


20.6.9


2. Allow cells to attach at 27°C for ≥1 hr.

3. For each transfection, dilute 1 to 2 µg baculovirus DNA into 100 µl insect mediumwithout serum or antibiotics in a 12 × 75–mm polystyrene tube.

4. For each transfection, dilute 1.5 to 9 µl cationic lipid reagent into 100 µl insectmedium without serum or antibiotics in a separate 12 × 75–mm polystyrene tube.

The suggested amount is 6 �l, but this should be optimized for each system.

CellFectin gives high-efficiency transfection of DNA in insect cell lines (Anderson et al.,1995). It is a lipid suspension that may settle with time. To ensure that a homogenous sampleis taken, mix thoroughly by inverting the tube 5 to 10 times before removing a sample fortransfection.

5. Combine the two solutions, mix gently, and incubate at room temperature for 15 to45 min to form lipid-DNA complexes.

6. For each transfection, add 0.8 ml insect medium without serum or antibiotics to eachtube containing lipid-DNA complexes and mix gently.

7. Aspirate medium from cells and overlay diluted lipid-DNA complexes onto thewashed cells.

Alternatively, the medium on the cells can be replaced with 0.8 ml fresh insect medium andthe undiluted complexes can be added directly to the fresh medium on the cells.

8. Incubate cells for 5 hr in a 27°C incubator. Protect plates from evaporation by puttingthem in a humidified container.

9. Remove transfection mixture and add 2 ml insect medium containing antibiotics andserum, if desired. Incubate cells in a 27°C incubator for 72 hr.

10. Harvest baculovirus from cell supernatants.

Gene expression may also be evaluated in the cells after removal of virus-containingmedium.

SUPPORTPROTOCOL

FINE TUNING OR OPTIMIZING CONDITIONS FOR CATIONIC LIPIDREAGENT TRANSFECTIONS

This protocol provides an example of a simple one-step procedure for determiningconditions conducive to high-efficiency transfections using cationic lipid reagents in anytarget cell type. A matrix of DNA and lipid reagent concentrations is used on transfectionsperformed in a multiwell plate (Fig. 20.6.3). Once the best conditions have been deter-mined, the transfections may be scaled up to larger vessels using the relative surface area(see Table 20.6.3) to increase the amounts of all reagents proportionately. This protocolcan be modified for use with any transfection protocol.

Additional Materials (also see Basic Protocol 1 and Alternate Protocol)

24-well tissue culture plates96-well round-bottom plates (sterile, with lid)


20.6.10



1. The day before transfection, trypsinize and count cells (UNIT 1.1). Plate cells in eachwell of a 24-well tissue culture plate using normal cell culture medium with serum,so that they are 50% to 95% confluent on the day of transfection. Avoid antibioticsat the time of plating and during transfection.

The single most important factor in high-efficiency transfection is healthy, proliferatingcell cultures. Antibiotics may cause some toxicity if present during transfection.

In a 24-well plate, seeding 4 × 104 to 2 × 105 cells per well will usually give good platingdensity. Any type of plate may be used by scaling the reagent and cell amounts in proportionto the relative surface area (see Table 20.6.3).

2. Dilute DNA into dilution medium (appropriate for the lipid being optimized) withoutserum or antibiotics in four microcentrifuge tubes. Use a range of DNA concentra-tions, and use a volume of dilution medium that is 7× the appropriate protocol volume(see Basic Protocol 1, step 2, and Table 20.6.1). Mix gently after each addition.

This makes enough DNA per tube for seven wells on a 24-well plate. Good ranges include0.2 to 1.6 �g DNA per well.

If the Plus enhancer is being used, include it in the diluted DNA tubes, using 10 �l Plusreagent per �g DNA. Add the Plus reagent to the diluted DNA after mixing well. If the Plusreagent is added first, precipitation may occur.

3. Dilute cationic lipid reagent into dilution medium without serum or antibiotics in sixmicrocentrifuge tubes. Use a range of DNA concentrations, and use a volume ofdilution medium that is 5× the appropriate protocol volume (see Basic Protocol 1,step 3, and Table 20.6.1). Mix gently after each addition.

Be sure to observe timing that works best for the cationic lipid reagent being used.

This makes enough diluted lipid per tube for five wells on a 24-well plate. Good rangesinclude 0.5 to 5 �l lipid reagent per well.

4. Pipet equal per-well volumes of diluted DNA and diluted cationic lipid reagent intothe wells of a 96-well plate in a matrix corresponding to the wells on the 24-wellplate (Fig. 20.6.3). Mix the complexes with the pipet tip by triturating. Cover the plateand incubate for 15 min at room temperature.

Incubation times >15 min (up to an hour) work just as well, but be sure the complexes donot dry by covering them well.

0.2

0.4

0.8

1.2

1.0 1.5 2.52.0 3.0 3.5

Cationic lipid reagent (µl)

DN

A (

µg)

Figure 20.6.3 A sample matrix for fine tuning (optimizing) transfection reagent efficiencies usingcationic lipid reagents.


20.6.11


5. While complexes are forming, replace medium on the cells with fresh transfectionmedium.

See Basic Protocol 1, steps 5 and 6, for alternate procedures for combining complexes,medium, and cells. The medium can be the same as the serum-free dilution medium. It ispossible to use serum in the transfection medium at this step. It is also possible to omit thisstep when using LipofectAmine 2000.

6. Add aliquots of DNA-lipid complexes (total volume from wells in step 4) to eachwell containing cells with fresh transfection medium. Mix complexes into themedium gently, holding the plate at a slant. Incubate at 37°C in 5% CO2 for 5 hr.

The exposure time may be >5 hr (up to overnight). Be sure there is sufficient medium toprevent the cells from drying out (it is not necessary to increase other components if thisis done). If using the Plus enhancer, a 3-hr exposure is sufficient.

7. After 5 hr incubation, add cell culture medium to reach normal volume and add serumto bring the final concentration to that of normal cell culture medium.

If necessary to maximize cell growth, replace the medium containing the complexes withfresh complete medium after 5 hr incubation. This step may be omitted entirely for someprotocols.

8. Check expression as described (see Basic Protocol 1, steps 8a and 8b).

If peak activity is found to occur on the edge of the matrix of concentrations tested, adjustthe concentrations to include the observed peak at the center of a new matrix and repeatthe transfection.

COMMENTARY

Background InformationThere are currently at least eight companies

that market cationic lipid–based transfectionreagents. A partial listing of companies andproducts may be seen in Table 20.6.1. Manycompanies offer more than one type of reagent.Among the more popular ones are Lipofect-Amine 2000 and LipofectAmine Plus (LifeTechnologies), DOTAP and FuGENE 6 (Roche),and Effectene (Qiagen). Some of the structuresare proprietary. The structures that are publish-ed can be classified into two general categoriesbased on the number of positive charges in thelipid headgroup. The first cationic lipid(DOTMA) has a single positive charge permolecule and is used in Lipofectin (Life Tech-nologies; Felgner et al., 1987). Several othercationic lipid–based transfection reagents suchas DOTAP liposomal transfection reagent (Ro-che) and DMRIE-C (Life Technologies) alsomake use of singly charged cationic lipid mole-cules. Increasing the number of positivecharges per cationic lipid molecule to as manyas five improved transfection efficiency dra-matically in most cell types. This can be seenin the examples of DOGS, the cationic lipid inTransfectam (Promega; Behr et al., 1989);DOSPA in LipofectAmine (Life Technologies;

Hawley-Nelson et al., 1993); and TMTPS inCellFectin (Life Technologies; Anderson et al.,1995). Further increase in transfection effi-ciency can sometimes be achieved by precom-plexing DNA with a proprietary enhancer. Twocommercially available transfection kits withenhancers are LipofectAmine Plus (Life Tech-nologies; Shih et al., 1997) and Effectene(Qiagen).

Life Technologies has designed cationiclipid reagents with specialized applicationssuch as high-efficiency transfection of insectcells (see Basic Protocol 4) or delivery of RNA(see Basic Protocol 3). Lipofectin has highactivity for endothelial cell transfection(Tilkins et al., 1994).

Basic Protocol 1 and the Alternate Protocoldescribed in this unit are the procedures withthe highest potential for efficient DNA trans-fection of adherent mammalian cells (Shih etal., 1997; Ciccarone et al., 1999). Lipofect-Amine 2000 has a simple protocol that yieldsthe highest transfection efficiencies in manycell types. Using the enhancer reagent resultsin more reproducible transfections without ex-tensive optimization because of the overall highactivity. Prior to the availability of enhancedcationic liposome transfections (e.g., using


20.6.12



LipofectAmine 2000 and Effectene), the mosteffective procedure for transfection of adherentmammalian cells with DNA was with otherpolycationic reagents (e.g., LipofectAmine;Hawley-Nelson et al., 1993) following BasicProtocol 1. In order to achieve high-efficiencytransfections with Basic Protocol 1, it is neces-sary to optimize lipid and DNA concentrationswith the target cells at the desired plating den-sity using a procedure similar to that describedin the Support Protocol. Many cationic lipidreagents, as well as transfection reagents basedon other chemistries, are available that can beused in Basic Protocol 1 for adherent mammal-ian cell DNA transfection, but they may yieldlower efficiencies than the Alternate Protocolwith the enhancer. Optimization using the Sup-port Protocol is highly recommended when notusing the enhancer, and the protocol can bemodified for use with any cationic lipid reagent.

Critical ParametersThe most critical parameter for successful

transfection is cell health. Cells should be pro-liferating as rapidly as possible at the time theyare plated for transfection. On the day of trans-fection, mitoses should be abundant in healthycultures. Fresh cultures with a finite life spanshould be used at the earliest possible passage.

For reproducible transfection results, it iscritical to plate the same number of healthycells for each transfection. Cells should alwaysbe counted, preferably using a hemacytometerand trypan blue (UNIT 1.1).

Although optimization is not required forhigh-efficiency transfection when using an en-hancer (see Alternate Protocol), it is essentialfor success without the enhancer, and may im-prove efficiency even with the enhancedmethod.

The medium used to dilute and form com-plexes between the cationic liposomes and theDNA must not contain serum. Serum containssulfated proteoglycans and other proteins,which compete with the DNA for binding tothe cationic lipids. The medium should also notcontain antibiotics. There is toxicity to the cellswhen cationic lipid reagents are used in thepresence of antibiotics.

The dilution medium/plating medium forthe cells may have some influence on transfec-tion efficiency. Some proprietary serum-freemedia contain components that inhibit trans-fection and should be replaced with Opti-MEMI, DMEM, or other media without serum duringtransfection (Hawley-Nelson and Ciccarone,1996).

Serum may be present in the medium on thecells during transfection. For most cationiclipid reagents, on most cell types, transfectionactivity is not inhibited in the presence of serumprovided the complexes were formed in serum-free medium (Brunette et al., 1992; Ciccaroneet al., 1993, 1999; Shih et al., 1997).

The specific serum-free medium used todilute the lipid and DNA can have a slight effecton the efficiency of transfection. For the en-hanced protocol (Alternate Protocol), normalculture medium such as DMEM is recom-mended. For the standard procedure (BasicProtocols 1, 2, and 3), Opti-MEM I mediumworks best. The improvements resulting fromusing the recommended media are less than twofold. When using Lipofectin, dilution in Opti-MEM I followed by a 30- to 45-min incubationis recommended (Ciccarone and Hawley-Nel-son, 1995). With LipofectAmine 2000, the re-verse is true: extended incubation (>30 min) ofLipofectAmine 2000 in Opti-MEM prior toaddition of DNA results in lower transfectionactivity (Ciccarone et al., 1999).

High-purity DNA will increase transfectionefficiency. Miniprep DNA does work, however,when efficiency is not critical. A wide range ofsizes of polynucleotides may be transfected,from 18-mer single-stranded oligonucleotides(Chiang et al., 1991; Bennett et al., 1992;Yeoman et al., 1992; Wagner et al., 1993) to400-kb YAC DNAs (Lamb et al., 1993). Excessvortexing of complexes or DNA solutions mayresult in some shearing, especially with largermolecules. The concentration of EDTA in thediluted DNA should not exceed 0.3 mM.

Transgene expression may be increased insome cell types by inducing the promoter. Thisis observed in Jurkat cells when phytohemag-glutinin and phorbol myristate acetate areadded following transfection to activate thecytomegalovirus promoter (Schifferli and Cic-carone, 1996).

TroubleshootingThe most common complaints surrounding

transfections include decreased transfection ef-ficiency and low cell yield. Decreases in effi-ciency often result from changes in the targetcell line. Cultured cell lines are usually aneu-ploid and often consist of a mixture of geno-types and phenotypes that can be subject toselection in the laboratory environment. Pri-mary cultures, although usually genotypicallyuniform, often consist of a mixture of pheno-types from different tissues and can changetheir population characteristics in response to


20.6.13


their environment. Whenever a decrease intransfection efficiency is observed, the firstthing to try is to work with a freshly thawedculture or isolate (Hawley-Nelson and Shih,1995). Be sure the same number of cells isplated in each experiment, since plating densityaffects efficiency and peak position (Hawley-Nelson et al., 1993).

Low cell yield often results from the use oftoo much DNA or cationic lipid reagent. Uselower concentrations of these two componentsand examine the results for transfection effi-ciency as well as cell yield. Acceptable effi-ciency can usually be obtained with higher cellyield by using lower concentrations of lipid and

DNA (Hawley-Nelson et al., 1993; Life Tech-nologies, 1999).

Cell yield can also be improved in severalother ways. (1) Increasing the plating density.This usually requires adjustment of lipid andDNA amounts, but often the transfection effi-ciency as well as the cell yield increases withhigher plating input (Life Technologies, 1999).(2) Decreasing time of exposure of the cells tocationic lipid–DNA complexes. This can bedone by increasing volume and adding backserum at earlier times or by removing the com-plexes from the cells at the end of transfection.(3) Performing the transfection in the presenceof serum. Most cationic lipid reagents work

0.4

0.8

1.2

1.6

DN

A (

µg/w

ell)

0 0.5 1 21.5 2.5

2.5

2.5

2.5

1.5

1.5

1.5

1

1

1

2

2

2

3

3

3

3.5

3.5

3.5

A

B

Cationic lipid reagent (µl)

Figure 20.6.4 Results of fine-tuning or optimizing conditions for transfection. Before transfection,293 H cells were plated at 2 × 105/well in a 24-well plate precoated with poly-D-lysine. The followingday, cells were transfected with pCMV⋅SPORTβgal DNA using LipofectAmine 2000 as described(see Support Protocol). One day posttransfection, cells were fixed and stained with Xgal. (A)Amounts of DNA and lipid reagent used. (B) Results of Xgal staining.


20.6.14



well in transfection medium containing serum(Brunette et al., 1992; Ciccarone et al., 1993,1999; Shih et al., 1997). One exception isLipofectAmine without the Plus enhancer.

Some cationic lipid solutions are naturallycloudy. Sometimes cloudiness is observedwhen complexes are made with DNA. Usuallythis does not interfere with transfection effi-ciency. Most cationic liposome solutions (es-pecially DMRIE-C and CellFectin) should bemixed gently by inversion just before use toproduce a uniform suspension. With Plus re-agent, it is possible to precipitate the DNAwhen the Plus reagent is diluted first into theDMEM and DNA is added second. Alwaysdilute the DNA into DMEM and mix wellbefore adding Plus reagent.

Anticipated ResultsTransfection should be observed for most

adherent mammalian cells transfected withDNA using Basic Protocol 1. Efficiencies varywith cell type. For example, 293, COS-7, andCHO-K1 cells yield 95% or more blue cellsfollowing Xgal staining of cells transfectedwith pCMVSPORTβgal plasmid DNA usingLipofectAmine 2000. The authors have notedefficiencies of other cell types as high as 49%for SK-BR3 breast cancer cell lines, 77% forBE(2)C human neuroblastoma cells, and 43%for MDCK canine kidney cells (Ciccarone etal., 1999). Efficiencies also vary for suspensioncells. The authors note that while Lipofect-Amine Plus is relatively inefficient for trans-fecting Jurkat cells, DMRIE-C can yield up to85% blue cells following pCMV⋅SPORTβgalplasmid DNA transfection, gene activation

Table 20.6.5 Activity for a Scaled-up Transfection Using LipofectAmine Plus in BHK-21 Cells

Plate Surface area ratioto 24-well plate

Cells/well(× 104)

DNA/well(µg)

Plus reagent(µl)

LipofectAminereagent (µl)

β-gal(ng/cm2)a

24-well 1 4 0.4 2 2 188 ± 512-well 2 8 0.8 4 4 193 ± 126-well 5 20 2 10 10 179 ± 2760-mm 10 40 4 20 20 171 ± 16100-mm 28 112 11.2 560 56 157aResults are the mean of three transfections ± the standard deviation.

2.01.81.61.41.21.00.80.60.40.2

0

4 3 2 1 0 0.10.2

0.40.8

pSV2neo (µg)LipofectAmine (µl)

% G

enet

icin

-res

ista

nt c

olon

ies

Figure 20.6.5 Stable transfection of NIH 3T3 cells. Cells were plated at 6 × 104 cells/well in 24-wellplates. The day after plating, cells were transfected with LipofectAmine Plus complexed withpSV2neo DNA. The following day, cells were passaged at a total dilution of 1/150. Cells wereexposed to 0.6 mg/ml Geneticin antibiotic from day 3 to day 13, and were then washed once withPBS and stained with 0.2% toluidine blue in PBS with 10% formalin.


20.6.15


with phytohemagglutinin and phorbol myris-tate acetate, and Xgal staining (Ciccarone et al.,1995, Schifferli and Ciccarone, 1996).

The result of a typical fine-tuning/optimiza-tion protocol is shown in Figure 20.6.4. Thetransfection reagent was LipofectAmine 2000,the DNA was pCMV⋅SPORTβgal, the cellswere 293 H. Cells were stained the day follow-ing transfection and were allowed to stain over-night at 37°C. A selection of transfection con-ditions can be made.

Conditions found to be advantageous fortransfection in small wells may be scaled up,the results of a typical scale-up are given inTable 20.6.5.

The results of a stable transfection of NIH3T3 cells with pSV2neo DNA using an en-hancer reagent (LipofectAmine Plus) areshown in Figure 20.6.5. The transfection wasdone on 24-well plates, the cells were passagedonto 6-well plates the following day, and selec-tion with geneticin was done for 10 days. Thefigure shows optimization of conditions and thegenerally high efficiency that can be achievedusing this method.

Time ConsiderationsCounting and plating the cells should be

done the day before transfection and will usu-ally require <1 hour. Transfection is usuallydone in the morning. Depending on the numberof conditions being evaluated, it may requireall morning plus a short period in the afternoonto increase medium volume or feed the cells.The total time required is <1 day.

Literature CitedAnderson, D., Harris, R., Polayes, D., Ciccarone, V.,

Donahue, R., Gerard, G., Jessee, J., and Luckow,V. 1995. Rapid generation of recombinant bacu-lovirus and expression of foreign genes using theBac-to-Bac baculovirus expression system. Fo-cus 17.2:53-58.

Behr, J.-P., Demeneix, B., Loeffler, J.-P., and Perez-Nutul, J. 1989. Efficient gene transfer into mam-malian primary endocrine cells withlipopolyamine-coated DNA. Proc. Natl. Acad.Sci. U.S.A. 86:6982-6986.

Bennett, C.F., Chiang, M.-Y., Chan, H., Shoemaker,J.E.E., and Mirabelli, K. 1992. Cationic lipidsenhance cellular uptake and activity of phos-phorothioate antisense oligonucleotides. Mol.Pharmacol. 41:1023.

Brunette, E., Stribling, R., and Debs, R. 1992.Lipofection does not require the removal of se-rum. Nucl. Acids Res. 20:1151.

Chiang, M.-Y., Chan, H., Zounes, M.A., Freier,S.M., Lima, W.F., and Bennett, C.F. 1991. Anti-sense oligonucleotides inhibit intercellular adhe-

sion molecule 1 expression by two distinctmechanisms. J. Biol. Chem. 266:18162-18171.

Ciccarone, C. and Hawley-Nelson, P. 1995.Lipofectin transfection activity increased by pro-tocol improvement. Focus 17:103.

Ciccarone, V., Hawley-Nelson, P., and Jessee, J.1993. Cationic liposome-mediated transfection:Effect of serum on expression and efficiency.Focus 15:80-83.

Ciccarone, V., Anderson, D., Lan, J., Schifferli, K.,and Jessee, J. 1995. DMRIE-C reagent for trans-fection of suspension cells and for RNA trans-fections. Focus 17.3:84-87.

Ciccarone, V., Chu, Y., Schifferli, K., Pichet., J.-P.,Hawley-Nelson, P., Evans, K., Roy, L., and Ben-nett, S. 1999. LipofectAmine 2000 Reagent forrapid, efficient transfection of eukaryotic cells.Focus 21.2:54-55.

Dube, S. 1997. Transfection using LipofectAminePlus Reagent. Focus 19.3:57.

Felgner, P.L., Gadek, T.R., Holm, M. Roman, R.,Chan, H.W., Wenz, M., Northrop, J.P., Ringold,G.M., and Danielsen, M. 1987. Lipofection: Ahighly efficient, lipid-mediated DNA-transfec-tion procedure. Proc. Natl. Acad. Sci. U.S.A.84:7413-7417.

Goldsborough, M.D., Evans, K., Xu, L., and Young,A. 1998. High purity plasmid DNA from anionexchange chromatography. Focus 20:68-69.

Hawley-Nelson, P. and Shih, P.-J. 1995. Sensitivityof transfection efficiency to culture age. Focus17:62.

Hawley-Nelson, P. and Ciccarone, V. 1996. Tran-sient transfection efficiency of human keratino-cytes in two serum-free media. Focus 18.2:43-44.

Hawley-Nelson, P., Ciccarone, V., Gebeyehu, G.,Jessee, J. and Felgner, P. 1993. LipofectAminereagent: A new, higher efficiency polycationicliposome transfection reagent. Focus 15.3:73-79.

Lamb, B.T., Sisodia, W.W., Lawler, A.M., Slunt,H.H., Kitt, C.A., Kearns, W.G., Pearson, P.L.,Price, D.L., and Gearhart, J.D. 1993. Introduc-tion of the 400 kilobase precursor amyloid pro-tein gene in transgenic mice. Nature Genet. 5:22-30.

Life Technologies. 1999. Guide to eukaryotic trans-fections with cationic lipid reagents, 2nd ed. LifeTechnologies, Inc., Rockville, Md.

Rose, J.K., Buonocore, L., and Whitt, M. 1991. Anew cationic liposome reagent mediating nearlyquantitative transfection of animal cells.BioTechniques 10:520-525.

Schifferli, K.P. and Ciccarone, V. 1996. Optimiza-tion of cationic lipid reagent-mediated transfec-tion for suspension cell lines. Focus 18:45-47.

Sells, M.A., Li., J., and Chernoff, J. 1995. Deliveryof proteins into cells using cationic liposomes.BioTechniques 19:72-78.

Shih, P.J., Evans, K., Schifferli, K., Ciccarone, V.,Lichaa, F., Masoud, M., Lan, J., and Hawley-


20.6.16



Nelson, P. 1997. High efficiency transfectionwith minimal optimization using the Lipofect-Amine Plus Reagent. Focus 19.3:52-56.

Tilkins, M.L., Hawley-Nelson, P., and Battista, P.1994. Transient transfection of endothelial cells.Focus 16.4:117-119.

Wagner, R.W., Matteucci, M.D., Lewis, J.G., Gu-tierrez, A.J., Moulds, C., and Froehler, B.C.1993. Antisense gene inhibition by oligonu-cleotides containing C-5 propyne pyrimidines.Science 260:1510.

Yeoman, L.C., Danels, Y.J., and Lynch, M.J. 1992.Lipofec‘tin enhances cellular uptake of antisenseDNA while inhibiting tumor cell growth. Anti-sense Res. Dev. 2:51.

Key ReferencesKriegler, M. 1990. Gene Transfer and Expression:

A Laboratory Manual. Stockton Press, NewYork.

Good general review on gene expression.

Life Technologies, 1999. See above.

Describes history and gives protocols and consid-erations for cationic lipid reagent transfections.

Tilkins, M.L., Hawley-Nelson, P., and Ciccarone, V.1998. Transfection of mammalian and inverte-brate cells using cationic lipids. In Cell Biology:A Laboratory Handbook, Vol. 4, 2nd ed. (J.E.Celis, ed.) pp. 145-154. Academic Press, NewYork.

Review of cationic lipid transfection procedures.

Felgner et al., 1987. See above.

The original description of cationic lipid transfection.

Contributed by Pamela Hawley-Nelson and Valentina CiccaroneLife Technologies, Inc.Rockville, Maryland


20.6.17


UNIT 20.7Optimization of Transfection

When embarking upon any transfection procedure, a critical first step is to optimizeconditions. Every mammalian cell type has a characteristic set of requirements for optimalintroduction of foreign DNA; there is a tremendous degree of variability in the transfectionconditions that work, even among cell types that are very similar to one another. Often,an experimenter must screen a wide variety of cell types for a desired regulatory trait,such as an appropriate response to a particular effector molecule. It is thus helpful to havea straightforward, systematic approach to optimizing transfection efficiency. Transientassay systems are particularly useful for this purpose. A fusion gene that is known tofunction in mammalian cells can be transfected into cells under a variety of conditions,and transfection efficiency can be easily monitored by assaying for the fusion geneproduct. The human growth hormone (hGH) assay system is particularly useful for thispurpose because both harvest and assay take very little time. However, any reporter systemcan be used to optimize transfection efficiency.

The single most important factor in optimizing transfection efficiency is selecting theproper transfection protocol. This usually comes down to a choice among calciumphosphate–mediated gene transfer (UNIT 20.3), DEAE-dextran-mediated gene transfer (UNIT

20.4), electroporation (UNIT 20.5), and liposome-mediated transfection (UNIT 20.6). Fusiontechniques such as protoplast fusion and microinjection may also be considered. Cellsare variable with respect to which transfection protocol is most efficient. It is recom-mended that any adherent cell line under investigation be tested for transfection abilitywith DEAE-dextran, calcium phosphate, and liposome-mediated transfection. Nonadher-ent cell lines can be transfected by electroporation and liposome-mediated transfection.Generally, if a cell can be grown in culture, it can be transfected.

CALCIUM PHOSPHATE TRANSFECTION

The primary factors that influence efficiency of calcium phosphate transfection (UNIT 20.3)are the amount of DNA in the precipitate, the length of time the precipitate is left on thecell, and the use and duration of glycerol or DMSO shock. A calcium phosphateoptimization is shown in Table 20.7.1. Generally, higher concentrations of DNA (10 to50 µg) are used in calcium phosphate transfection. Total DNA concentration in theprecipitate can have a dramatic effect on efficiency of uptake of DNA with calciumphosphate–mediated transfection. With some cell lines, more than 10 to 15 µg of DNA

Table 20.7.1 Optimization of Calcium Phosphate Transfection

Dish(10-cm)

pXGH5(µg)

pUC13(µg)

Exposure toprecipitate (hr)

Glycerolshock (min)

1 5 5 6 — 2 5 15 6 — 3 5 35 6 — 4 5 5 16 — 5 5 15 16 — 6 5 35 16 — 7 5 5 6 3 8 5 15 6 3 9 5 35 6 310 5 5 16 311 5 15 16 312 5 35 16 3

Supplement 19

Contributed by John K. RoseCurrent Protocols in Cell Biology (2003) 20.7.1-20.7.4Copyright © 2003 by John Wiley & Sons, Inc.

20.7.1

Introduction andExpression ofForeignMacromolecules

added to a 10-cm dish results in excessive cell death and very little uptake of DNA. Withother cell types, such as primary cells, a high concentration of DNA in the precipitate isnecessary to get any DNA at all into the cell on a routine basis. For example, with humanforeskin fibroblasts, transfection of 5 µg of a reporter plasmid with 5 µg of carrier DNA(e.g., pUC13) gives significantly less expression than does transfection of 5 µg of reporterplasmid with 35 µg of carrier DNA. Presumably, this is because the amount of DNAaffects the nature of the precipitate and thus alters the fraction of the applied DNA that istaken up into cells.

The optimal length of time that the precipitate is left on cells varies with cell type. Somecell types, such as HeLa or BALB/c 3T3, are efficiently transfected by leaving theprecipitate on for 16 hr. Other cell types cannot survive this length of exposure to theprecipitate. Transfection efficiency of some cell types, such as CHO DUKX BII, isdramatically increased by glycerol or DMSO shock (UNIT 20.3). The pilot experiment listedwill indicate whether the cell type is tolerant to long exposure to a calcium phosphateprecipitate and whether glycerol shock should be used. Once the results of this experimentare in hand, finer experiments can be done to further optimize conditions. For example, ifshocking with 10% glycerol for 3 min enhances transfection efficiency, an experiment varyingthe time of glycerol shock or also trying 10% and 20% DMSO shock might be done.

Once optimal conditions for transfection are found, extensive DNA curves varying theamount of reporter plasmid should be prepared. The total amount of DNA should bekept constant at the optimal level determined in the first experiment. The amount ofreporter plasmid DNA (e.g., pXGH5) should be varied, and carrier DNA (e.g., pUC13)should be used to make up the difference. This is to ensure that transfections areperformed under conditions where the amount of reporter plasmid in the cell is notsaturating the cellular transcription and translation machinery.

DEAE-DEXTRAN TRANSFECTION

There are several factors that can be varied in DEAE-dextran transfection (UNIT 20.4). Thenumber of cells, concentration of DNA, and concentration of DEAE-dextran added to thedish are the most important to optimize. To a first approximation, most cell types that canbe transfected using DEAE-dextran will have a preference for 1 to 10 µg DNA/10-cmdish and for 100 to 400 µg DEAE-dextran/ml of medium. Table 20.7.2 shows how thedishes in an optimization might be chosen. The 20-dish experiment consists of two setsof 10 dishes; one set is plated at 5 × 105 cells/dish, the other is plated at 2 × 106 cells/dish.Each set contains dishes that will be transfected with 1 to 10 µg of a reporter plasmid and

Table 20.7.2 Optimization of DEAE-Dextran Transfection

5 × 105 cells/10-cm dish: 2 × 106 cells/10-cm dish:

DishpXGH5

(µg)DEAE-dextran

(µg/ml)Dish

pXGH5(µg)

DEAE-dextran(µg/ml)

1 1 400 11 1 400 2 1 200 12 1 200 3 1 100 13 1 100 4 4 400 14 4 400 5 4 200 15 4 200 6 4 100 16 4 100 7 10 400 17 10 400 8 10 200 18 10 200 9 10 100 19 10 10010 0 200 20 0 200


20.7.2

Optimization ofTransfection

100 to 400 µg/ml DEAE-dextran. If an hGH expression vector such as pXGH5 is used,a time course of expression under each condition can be determined by removing 100-µlaliquots of the medium 2, 4, and 7 days posttransfection (with a medium change after theday 4 aliquot is removed).

With the results of this pilot experiment in hand, a second experiment using a narrowerrange of DEAE-dextran concentrations and a wider range of DNA doses should beundertaken. For example, if the cells appear to express more hGH at 100 µg/ml DEAE-dextran than at higher concentrations in the pilot experiment, the second experimentshould cover from 25 to 150 µg/ml DEAE-dextran. Because DEAE-dextran is toxic tosome cells, a brief exposure to small concentrations may be optimal. The wide range ofadded DNA in this experiment is crucial in two respects. First, it is valuable to know thesmallest amount of the transfected reporter gene that can give a readily detectable signal.Second, the linearity of the dose of DNA with the amount of reporter gene expressiongenerally decays for large amounts of input DNA. When excessive (i.e., nonlinear)amounts of DNA are used in transfection experiments, it is possible that the effectsobserved are dose-response effects rather than the phenomenon intended for study. Thisserious and common problem can be eliminated by doing a careful DNA dose–responsecurve as above.

ELECTROPORATION

Perhaps because it is not a chemically based protocol, electroporation (UNIT 20.5) tends tobe less affected by DNA concentration than either DEAE-dextran- or calcium phosphate–mediated gene transfer. Generally, DNA amounts in the range of 10 to 40 µg/107 cellswork well, and there is a good linear correlation between the amount of DNA present andthe amount taken up. The parameter that can be varied to optimize electroporation is theamplitude and length of the electric pulse, the latter being determined by the capacitanceof the power source. The extent to which this can be varied is determined by the electronicsof the power supply used to supply the pulse. The objective is to find a pulse that killsbetween 20% and 60% of the cells. This generally is in the range of 1.5 kV at 25 µF. Ifexcessive cell death occurs, the length of the pulse can be lowered by lowering thecapacitance. Settings between 3 and 25 µF can be tried.

LIPOSOME-MEDIATED TRANSFECTION

Three primary parameters—the concentrations of lipid and DNA and incubation time ofthe liposome-DNA complex—affect the success of DNA transfection by cationic lipo-somes (UNIT 20.6). These should be systematically examined to obtain optimal transfectionfrequencies.

Concentration of Lipid

In general, increasing the concentrations of lipid improves transfection of four cell linesexamined (CV-1 and COS-7 with Lipofectin, and HeLa and BHK-21 with TransfectACE;see UNIT 20.6). However, at high levels (>100 µg), the lipid can be toxic. For each particularliposome mixture tested, it is important to vary the amount as indicated in Table 20.7.3.

Concentration of DNA

In many of the cell types tested, relatively small amounts of DNA are effectively takenup and expressed. In fact, higher levels of DNA can be inhibitory in some cell types withcertain liposome preparations. In the optimization protocol outlined in Table 20.7.3, thestandard reporter vector pSV2CAT is used; however, any plasmid DNA whose expressioncan be easily monitored would be suitable.


20.7.3

Introduction andExpression ofForeignMacromolecules

Time of Incubation

When the optimal amounts of lipid and DNA have been established, it is desirable todetermine the length of time required for exposure of the liposome-DNA complex to thecells. In general, transfection efficiency increases with time of exposure to the liposome-DNA complex, although after 8 hr, toxic conditions can develop. HeLa or BHK-21 cellstypically require ∼3 hr incubation with the liposome-DNA complex for optimal tranfec-tion, while CV-1 and COS-7 cells require 5 hr of exposure.

Contributed by John K. RoseYale University School of MedicineNew Haven, Connecticut

Table 20.7.3 Optimization of Liposome-Mediated Transfection

Dish(35-mm)

pSV2CAT(µg)

Liposomes(µl)

1 0.1 12 0.1 23 0.1 44 0.1 85 0.1 126 0.5 17 0.5 28 0.5 49 0.5 8

10 0.5 12

11 5 512 5 1013 5 1514 5 2015 5 3016 10 517 10 1018 10 1519 10 2020 10 30

Dish(35-mm)

pSV2CAT(µg)

Liposomes(µl)


20.7.4

Optimization ofTransfection

UNIT 20.8Inducible Gene Expression Using anAutoregulatory, Tetracycline-ControlledSystem

Tetracycline-regulated gene expression systems have been developed to overcome someof the obstacles encountered using other strategies for inducible gene expression in mam-malian cells. These difficulties include pleiotropic, nonspecific effects or toxicity of in-ducing agents or treatments, and high uninduced background levels of expression. Thisunit describes protocols for using a modified tetracycline-regulated system in which atranscriptional transactivator drives expression of itself and a target gene in cultured cellsand, to some extent, in transgenic mice. This transactivator (tTA) is a fusion protein con-sisting of the tetracycline-repressor of E. coli and the transcriptional activation domain ofthe VP16 protein of herpes simplex virus. In the absence of tetracycline, tTA binds to andactivates genes preceded by a heptamerized version of the tetracycline-resistance operatorof Tn10 plus a minimal CMV promoter (here collectively referred to as Tet P). Bindingof tTA to Tet P and subsequent gene activation are blocked in the presence of tetracycline.The plasmid pTet-Splice (Fig. 20.8.1A) contains Tet P upstream, and SV40 splice andpolyadenylation signals downstream, of a multiple cloning site into which sequencesencoding the open reading frame (ORF) of a target gene of choice is easily inserted.Autoregulatory tTA expression is driven from the plasmid pTet-tTAk (Fig. 20.8.1B), inwhich the tTA ORF (including an optimal sequence for initiation of translation accordingto Kozak) has been inserted into pTet-Splice.

The protocols in this unit describe the transfection of adherent cells and the testing ofresultant clones for inducible transactivator or target gene protein expression. Stablytransfected fibroblast cell lines expressing transactivator and target gene(s) can be de-rived by first cotransfecting pTet-tTAk and a plasmid encoding a selectable marker andobtaining stable lines with inducible transactivator expression (see Basic Protocol). Theselines are subsequently stably cotransfected with plasmids encoding the target gene(s) anda second selectable marker. The procedure may also be used to cotransfect pTet-tTAkwith the target gene–encoding plasmid(s) and a single selectable marker plasmid. Thechoice of method depends upon the feasibility of screening for the protein products ofthe target genes. While the consecutive method is more systematic, cotransfection maybe faster given a relatively straightforward screening method for expression of the targetgene (see Critical Parameters).

A Support Protocol also describes methods to test stably transfected cell lines for induciblegene expression, for transient transfection and induction of tet-regulated plasmids, andfor detection of the tTAk gene in cells (or transgenic mice).

BASICPROTOCOL

CALCIUM PHOSPHATE-MEDIATED STABLE TRANSFECTION OF NIH3T3CELLS WITH pTET-tTAk AND TETRACYLINE-REGULATED TARGETPLASMIDS

This protocol describes the stable transfection of adherent cells with pTet-tTAk for thederivation of cell lines expressing inducible tTA. In the first round of transfection stablecell lines expressing inducible tTA alone are produced. The single transfection proceduremay also be used for stable cotransfection of pTet-tTAk and plasmids expressing thetarget gene(s). In the second round of transfection tTA-expressing lines are transfectedwith plasmids expressing the target gene(s).

Contributed by Penny Shockett and David SchatzCurrent Protocols in Cell Biology (2005) 20.8.1-20.8.10Copyright C© 2005 by John Wiley & Sons, Inc.


20.8.1

Supplement 27

Inducible GeneExpression

20.8.2


Figure 20.8.1 (A) The plasmid pTet-Splice (Shockett et al., 1995) is designed to drive tetracycline-regulated expression of a target gene inserted into the multiple cloning site (mcs). The tetracycline-regulated promoter (TetP) consists of a heptamerized tetracycline operator (double-ended arrow)upstream of a minimal human CMV promoter that includes bases −53 (triangle) to +75. The tran-scriptional start site (+) and TATAA box (small rectangle) are also indicated. This TetP fragmentis an Xhol-SaII fragment derived from pUHC13-3 (Gossen and Bujard, 1992). SV40-derived se-quences downstream of the MCS drive mRNA splicing and polyadenylation. The backbone of theplasmid is from Bluescript II KS+ (Stratagene) and carries the ampicillin resistance gene (ampr).(B) pTet-tTAk (Shockett et al., 1995) consists of the tTAk open reading frame inserted into theHindIII-EcoRV sites of pTet-Splice.


20.8.3


Materials

NIH3T3 cellsComplete DMEM-10 medium (see recipe)Complete DMEM/tet: complete DMEM-10 medium (see recipe) containing

0.5 µg/ml tetracycline hydrochloride (Sigma; dilute 10 mg/ml stock in 70%ethanol and store protected from light at −20◦C)

Selection medium (see recipe) containing 125 µM, 250 µM, or 500 µM L-histidinolPlasmids for first-round or cotransfection procedure: pTet-tTAk (Life

Technologies) and plasmids containing target gene ORF(s) cloned intopTet-Splice (Life Technologies), pSV2-His, or another selectable markerplasmid; purified by CsCl banding or anion-exchange chromatography

Plasmids for second round transfection procedure: plasmids containing target geneORF(s) cloned into pTet-Splice, pPGKPuro, or another selectable markerplasmid; purified by CsCl banding or anion-exchange chromatography

2 M CaCl2HEPES-buffered saline (HeBS; see recipe)10 mg/ml chloroquine (19 mM; optional; Sigma); dilute in water and store at

−20◦C85% (v/v) HeBS/15% (v/v) glycerol, prewarmed to 37◦C3 mg/ml puromycin (Sigma) diluted in PBS (APPENDIX 2A)Phosphate-buffered saline (PBS; APPENDIX 2A)1× trypsin/EDTA (Invitrogen)

10-cm and 6-cm tissue culture plates4-ml polystyrene tubes (Falcon)24-well and 6-well tissue culture plates

NOTE: All tissue culture incubations are performed in a humidified 37◦C, 5% CO2

incubator.

Grow the cells1a. First round only: Grow cells in complete DMEM-10 medium. The day before

transfection split cells into 10-cm tissue culture plates in complete DMEM/tet toachieve one-third confluence on the day of the transfection.

From this point on cells are kept in the presence of 0.5 µg/ml tet.

One plate per transfection is needed at this stage. A typical experiment might includeone plate for tTA only, one for tTA plus target gene, and one to serve as the untransfectedcontrol plate.

1b. Second round only: Grow stable cell lines that inducibly express autoregulatorytTA in selection medium/500 µM L-histidinol. The day before transfection splitinto 10-cm plates in this same medium to achieve one-third confluence on the dayof transfection.

Transfect the cells2. Linearize plasmids prior to transfection and adjust concentration to ≥0.5 mg/ml.

See Damke et al. (1995) for discussion of other selectable markers. All plasmids shouldbe purified by CsCl banding (APPENDIX 3A) or on a Qiagen column.

3a. First round only: Mix 10 to 20 µg of pTet-tTAk (in the presence or absence of anequimolar amount of target gene plasmids) plus 1 to 2 µg pSV2-His (a molar ratioof ∼10:1 of each tet plasmid to selectable marker plasmid) with 500 µl HeBS in aclear 4-ml polystyrene tube.


20.8.4


A control mock transfection should be performed with no DNA added to the transfection.All of these cells should die in the selection medium/125 µM L-histidinol introduced instep 14.

3b. Second round only: Mix 10 to 20 µg each of target gene plasmid(s) plus 1 to 2 µgpPGKPuro (a molar ratio of ∼10:1 of each tet plasmid to selectable marker plasmid)with 500 µl HeBS in a clear 4-ml polystyrene tube.

A control mock transfection should be performed with no DNA added to the transfection.All of these cells should die in the presence of the puromycin introduced in step 14. Theoptimal killing concentration for puromycin (lowest dose between 0.1 µg/ml to 10 µg/mlthat kills all untransfected cells within a few days) should be determined empirically priorto the transfection and varies with the cell type.

4. Add 32.5 µl of 2 M CaCl2 to plasmid DNA and mix immediately by gentle vortexing.With occasional gentle mixing, allow precipitate to form for 15 to 30 min at roomtemperature or until solution is visibly cloudy when compared to a tube containingwater.

5. Aspirate all of the medium from cells, doing one plate at a time. Mix precipitatea few times by pipetting with a Pasteur pipet, and apply dropwise and evenly overcells.

6. Incubate 30 min, gently rocking the plate after 15 min to ensure even coverage overentire plate.

7a. First round only: Add 10 ml complete DMEM/tet, with or without 25 µM chloro-quine (final), to each plate.

Although the use of chloroquine may further reduce cell integrity during the glycerolshock (step 9), it can improve transfection efficiency.

7b. Second round only: Add 10 ml selection medium/500 µM L-histidinol, with orwithout 25 µM chloroquine (final), to each plate.

8. Incubate 4 to 5 hr.

The optimal length of incubation may vary for different cell types.

9. Gently aspirate medium from cells with minimal disruption of the precipitate thathas settled onto the cells. Shock cells by adding dropwise 2.5 ml of prewarmed 85%HeBS/15% glycerol.

It is normal for the cells to look somewhat ragged before and especially after glycerolshock. Two to four plates may be shocked at one time, depending on the speed of theresearcher.

10. Aspirate HeBS/glycerol after exactly 2.5 min. Work quickly, as glycerol can be verytoxic to the cells.

The length of time cells are exposed to glycerol solution can be varied and increased upto 4 to 5 min to optimize transfection efficiency for different cell types. Cells should beshocked the maximal length of time which results in the least cell death.

11a. First round only: Immediately, gently, and quickly wash cells twice by adding 10 mlcomplete DMEM/tet and immediately aspirating.

Because cells tend to come loose from the plate after glycerol addition, add all mediumto a single spot on the plate.

11b. Second round only: Immediately, gently, and quickly wash cells twice by adding10 ml selection medium/500 µM L-histidinol and immediately aspirating.

Again, add medium to a single spot on the plate to avoid loosening the cells.


20.8.5


12a. First round only: Add 10 ml complete DMEM/tet. Incubate cells overnight.

12b. Second round only: Add 10 ml selection medium/500 µM L-histidinol. Incubatecells overnight.

13a. First round only: The morning after the transfection, aspirate the medium andreplace with 10 ml complete DMEM/tet. Continue incubation.

13b. Second round only: The morning after the transfection, aspirate the medium andreplace with 10 ml selection medium/500 µM L-histidinol. Continue incubation.

Select and clone transfected cells14a. First round only: At 48 hr posttransfection, split cells into selection medium/125

µM L-histidinol at several dilutions ranging from 3 × 104 to 1 × 106 cells per10-cm plate. Make more than one plate in the mid-range that corresponds to anapproximate split from one confluent plate of 1:16 to 1:32.

14b. Second round only: At 48 hr posttransfection, split cells as above, using selectionmedium/500 µM L-histidinol containing 3 µg/ml puromycin (final).

The optimal killing concentration for puromycin (lowest dose between 0.1 µg/ml to10 µg/ml that kills all untransfected cells within a few days) should be determinedempirically prior to the transfection and varies with the cell type. The concentration of3 µg/ml puromycin is sufficient for selection of transfected NIH3T3 cells.

15a. First round only: Refeed cells 4 days later with selection medium/125 µML-histidinol. When colonies have formed, increase the concentration of L-histidinolin the selection medium to 250 µM.

L-histidinol is normally toxic to cells. The concentration of L-histidinol in the selectionmedium is therefore kept low initially and is raised as the number of cells expressingpSV2-His at high levels reaches a critical mass.

15b. Second round only: Refeed cells 4 days later with selection medium/500 µML-histidinol/puromycin.

16. When colonies are well established (at about day 12 to 14 of selection), circle theirborders with a marker. Aspirate medium from plate and place a plastic cloning ring(autoclaved upright in vacuum grease) on the plate to surround an individual clone.Wash clones quickly with ∼100 µl PBS and add 2 drops of trypsin (∼100 µl) for30 sec to 1 min.

Pick cells from plates on which individual colonies are moderately spaced and can easilybe distinguished.

17a. First round only: Loosen cells by pipetting up and down with a Pasteur pipet andtransfer colonies to wells of a 24-well plate into 1 ml selection medium/250 µML-histidinol.

17b. Second round only: Loosen cells as for first round, transferring them into 1 mlselection medium/500 µM L-histidinol/puromycin.

18a. First round only: When cells are heavy in wells, split into 6-cm dishes in selectionmedium/500 µM L-histidinol.

18b. Second-round only: When cells are heavy in wells, split into 6-cm dishes in selectionmedium/500 µM L-histidinol/puromycin.

All trypsinization is performed by standard methods (UNIT 1.1), involving a quick PBSwash, a 1 to 3 min trypsin/EDTA incubation (2 ml per confluent 10-cm plate), andusing 3rd selection medium/500 µM L-histidinol (± puromycin) and containing 10%calf serum to dilute and stop the trypsin.


20.8.6


19a. First round only: Expand cells for testing in selection medium/500 µM L-histidinol.Freeze aliquots of cells for storage in liquid nitrogen and grow in selectionmedium/500 µM L-histidinol from this point on. Test for tTA or target gene ex-pression (if applicable; see Support Protocol for methods that may be used). Or,if applicable, repeat transfection procedure with target gene plasmid(s), followingsteps 1 to 18 and using the options listed for second-round transfection.

19b. Second round only: Test for target gene expression by northern or immunoblotting(UNIT 6.2) after induction (see Support Protocol). Freeze aliquots for storage in liquidnitrogen and grow in selection medium/500 µM L-histidinol/puromycin from thispoint on.

SUPPORTPROTOCOL

ANALYSIS OF TARGET GENE PROTEIN EXPRESSION

This protocol outlines methods for the analysis of target gene expression and inducibility.Instructions for inducing stable cell lines, for examining transient target gene expressionwith and without induction, and for PCR amplification of the tTA gene are included,with references to detection procedures such as Southern, northern, and immunoblotting(UNIT 6.2) techniques.

Induction of Stable Cell LinesStable cell lines can be tested for tTA or target gene expression by comparing induced touninduced cells for tTA mRNA or target gene mRNA (see Detection of tTA Transgenein Cellular or Tail DNA by Southern Blotting), or protein expression or protein activity.Multiple lines may be screened at a time.

The night before induction, the cells are plated in selection medium/500 µM L-histidinol(see recipe) containing 3 µg/ml puromycin at an appropriate density such that cellswill be subconfluent to confluent at the time of harvest. Cells are washed three timeswith PBS (APPENDIX 2A), with gentle swirling. Immediately, the medium is replaced withselection medium without 0.5 µg/ml tetracycline hydrochloride (tet). (For tet+ controls,simply aspirate medium and replace with fresh selection medium containing tet.) Cellsare incubated 6 to 48 hr in a humidified 37◦C, 5% CO2 incubator, then trypsinized(UNIT 1.1) and harvested at 4◦C, and an aliquot of 0.15–0.4 × 106 cells is analyzed byimmunoblotting (see UNIT 6.2).

Alternatively, cells may be grown in selection medium in the presence of tet, transferred totubes [with a quick wash with cold PBS followed by trypsinization (UNIT 1.1) and stoppingof the trypsin by addition of selection medium containing tet], washed three times withPBS (or just pelleted, for tet+ controls), and replated into selection medium with andwithout tet at an appropriate density such that the cells will be subconfluent to confluentat the time of harvest.

Induction of Gene Expression in Transiently Transfected CellsTransient transfection of tet-regulated plasmids is useful in several situations, includingthe initial testing of the autoregulatory system in a given cell line, screening stable tTA ex-pressors for inducible expression, and biological applications where transient expressionis specifically desired.

The night before the transfection, cells are split into medium containing 0.5 µg/ml tetracy-cline hydrochloride; the following day they are then transfected by methods appropriatefor the cells being used (UNITS 20.3–20.6). Cells are induced by washing them three times inmedium without tet. For CaPO4 transfection, washes are incorporated into those normallyperformed after glycerol shock (see Basic Protocol, step 11). Uninduced cell controls are


20.8.7


washed with medium containing tet. Medium with and without tet is added to the ap-propriate plates, then the cells are incubated for 12 to 48 hr in a humidified 37◦C, 5%CO2 incubator. The cells are harvested at 4◦C and, if trypsinized (UNIT 1.1), cold mediumcontaining 10% FBS (with and without tet, as appropriate) is used to stop the action ofthe trypsin. Cells are pelleted for freezing or lysis, and tTA or target gene (experimentalor reporter) expression can be analyzed by northern blotting, immunoblotting (UNIT 6.2),or by an appropriate activity assay (see Commentary).

Detection of tTA Transgene in Cellular or Tail DNA by PCRPCR is routinely used to detect the Tet-tTAk transgene in candidate transgenic mouse tailDNA. The forward primer derives from the minimal human CMV promoter, CMV-F1:

5′-TGACCTCCATAGAAGACACC-3′

The reverse primer, TTA-REV1, is specific for the tTA ORF:

5′-ATCTCAATGGCTAAGGCGTC-3′

Hot-start PCR (APPENDIX 3F) is performed on 150 ng of each tail DNA to be analyzed ina reaction mix containing 1.5 mM MgCl2, 0.5 µM each primer, and 0.2 mM each dNTP.PCR cycling conditions are as follows:

1 cycle: 3 min 94◦C80◦C (pause) add Taq polymerase

30 cycles: 45 sec 94◦C (denaturation)45 sec 58◦C (annealing)90 sec 72◦C (extension)

1 cycle: 10 min 72◦C (extension)80◦C (end).

Products are analyzed on a 1% to 1.3% agarose gel; the main product of interest is visibleas a 290-bp band after ethidium bromide staining.

Detection of tTA Transgene in Cellular or Tail DNA by Southern BlottingThe tTA transgene may also be detected by Southern blot analysis (APPENDIX 3A). TailDNA is digested with EcoRI and blots are probed with a 761-bp XbaI-SalI tTA insertfrom pTet-tTA. This fragment detects a 1094-bp tTA fragment of the transgene. Thisprobe may also be used to detect tTA mRNA by northern blotting (APPENDIX 3A).

REAGENTS AND SOLUTIONSUse deionized, distilled water in all recipes and protocol steps. For common stock solutions, seeAPPENDIX 2A; for suppliers, see SUPPLIERS APPENDIX.

Complete DMEM-10Dulbecco’s minimal essential medium containing:10% (v/v) donor bovine calf serum (JRH Biosciences)100 U/ml penicillin/100 µg/ml streptomycin (Invitrogen)2 mM glutamine (Invitrogen)

All DMEM complete medium used in this unit (with or without selection reagents or0.5 µg/ml tetracycline hydrochloride) may be stored protected from light ∼1 month at4◦C).

Fetal bovine serum (FBS) may also be used in place of donor bovine calf serum, but thelatter is less expensive.


20.8.8


HEPES-buffered saline (HBS)6 mM dextrose137 mM NaCl5 mM KCl0.7 mM Na2HPO4·7H2O21 mM HEPES (free acid)Adjust final pH to 7.05 with NaOHFilter sterilize and store in aliquots at −20◦C

Selection mediumComplete histidine-free DMEM (Irvine Scientific, purchased without glutamine),

containing:10% (v/v) donor bovine calf serum (JRH Biosciences)100 U/ml penicillin/100 µg/ml streptomycin (Invitrogen)2 mM glutamine (Invitrogen)0.5 µg/ml tetracycline·HCl (Sigma; dilute 10 mg/ml stock in 70% ethanol and

store protected from light at −20◦C)125 µM, 250 µM, or 500 µM L-histidinol (Sigma, dilute in water as a 125 mM

stock and store at −20◦C)

COMMENTARY

Background InformationInducible, tetracycline-regulated gene

expression systems were initially developedto allow the controlled expression in eu-karyotic cells of foreign genes not toleratedconstitutively in cultured cells or duringthe development of transgenic animals. Thegeneral features of tetracycline-regulated geneexpression strategies and their improvementsover previous inducible expression systemshave been addressed in current review articles(Gossen et al., 1993; Barinaga, 1994; Damkeet al., 1995; Shockett and Schatz, 1996).The autoregulatory tTA system used in thisprotocol derives directly from a constitutivetTA system described by Gossen and Bujard(1992). Although tight regulatory controland high inducibility was achieved with theoriginal system in HeLa cells, the inabilityto detect clones expressing moderate to highlevels of tTA by immunoblotting suggestedthat the tTA was toxic when expressed consti-tutively. The autoregulatory tTA system wasdesigned to overcome possible toxic effectsof constitutive tTA expression by makingtTA expression itself tetracycline regulated.Autoregulated tTA expression theoreticallyallows for the selection of clones expressinghigher levels of tTA via an autoregulatoryfeed-forward mechanism that is activated onlyin the absence of tetracycline. In the presenceof tetracycline, low-level tTA and target geneexpression are driven from the minimal humanCMV promoter. However, any tTA produced

is unable to bind to tet operators upstreamof the tTA or target gene. Conversely, whentetracycline is removed from the system, thesmall amounts of tTA protein expressed fromthe minimal promoter can bind the tet opera-tors upstream of the tTA gene, driving higherlevels of tTA (for controlled periods of time)and, subsequently, target gene expression.

The theoretical benefits of the autoregu-latory tTA system have been confirmed byexperiments in stably transfected NIH3T3cell lines (Shockett et al., 1995). In theseexperiments, expression of the recombinationactivating genes RAG-1 and RAG-2, andsubsequent DNA recombination activated bythese proteins, was higher and more frequentlydetected among stable transfectants express-ing autoregulatory tTA than in constitutivetTA expressors. In transgenic mice expressinga luciferase reporter target transgene, thelevels of expression appear to be 1 to 2 ordersof magnitude greater with the autoregulatorysystem, although the uninduced levels alsoappear to be higher. Several studies havesuccessfully used the autoregulatory tTAsystem for regulated gene expression in celllines or transgenic animals (for examples, seeSheehy and Schlissel, 1999; Sikes et al., 1999;Chen et al., 2002; Shockett et al., 2004).

Since the description of the early tTAsystems, several laboratories have createdmodified vectors, including streamlined ver-sions containing both tTA and the targetgene, viral vectors, and vectors in which


20.8.9


expression of two different target genes maybe differentially or co-regulated. Some of thesesystems and their applications have recentlybeen reviewed (Shockett and Schatz, 1996;Blau and Rossi, 1999).

Critical Parameters andTroubleshooting

Cell lines stably expressing both autoregu-latory tTA and target genes have been derivedat fairly high efficiencies by simultaneoustransfection of all plasmids. This method maybe faster, but it may require the screening ofmore clones than if stable lines with low basaland high induced levels of tTA are first derivedand subsequently transfected with plasmidsencoding the target genes. For the derivationof these clones, any selectable marker combi-nation should theoretically work for consecu-tive cotransfection. Additionally, although theBasic Protocol describes calcium phosphate–mediated transfection of adherent fibroblastcell lines, the procedure can be adapted forother cell types using their optimal methodsof transfection and selection. The protocol canalso be scaled down to require fewer cells byusing smaller dishes or wells and reducing allcomponents proportionately.

Using the autoregulatory tTA system, tTAmRNA induction appears to be a good indi-cator of induced tTA expression (see SupportProtocol). Alternatively, the vector pUHC13-3(Life Technologies) encoding luciferase undertet control may be transiently transfected intoputative stable tTA expressors as previouslydescribed (see Support Protocol and Damkeet al., 1995). Cells are then cultured for 12 to48 hr in the presence and absence of tetracy-cline. Luciferase activity is easily measuredin cell lysates using a kit (Luciferase AssaySystem and Dual-Luciferase Reporter AssaySystem; Promega) in which luciferase activ-ity in cell lysates is normalized either to totalprotein determined using a Bradford proteinassay (APPENDIX 3H), or to a transfection con-trol, respectively. Although basal expression oftarget plasmids tends to be higher when tran-siently transfected and luciferase detection isextremely sensitive, this method can be usefulfor the initial testing of the system in a givencell type (Damke et al., 1995).

It is imperative after stable transfection withpTet-tTAk that cells be maintained in mediumcontaining 0.5 µg/ml tetracycline to preventany toxic effects of tTA expression and subse-quent selection against clones expressing highlevels of tTA.

Anticipated ResultsIn the authors’ experience with stably trans-

fected NIH3T3 cells, expression of inducedtTA and target gene has been observed by 6hr and peaks at ∼12 hr after induction. In cellsthat stably express tTA, transient target geneexpression has been observed by 12 hr. In cellstransiently expressing tTA and a tet-sensitiveluciferase reporter (pUHC13-3), luciferase ac-tivity induced by 2 orders of magnitude hasbeen observed by 20 hr.

Time ConsiderationsStarting with the plasmid vectors and fol-

lowing the transfection protocols above, stableclones expressing tTA (or tTA + target gene(s)if cotransfecting) are obtained in ∼12 to 14days. Approximately 2 additional weeks arerequired for expansion and testing of candi-date clones. Subsequent transfection of a sta-ble inducible tTA clone with vectors express-ing target genes will require the same amountof time. Transient transfection and induciblegene expression may be achieved within48 hr.

Literature CitedBarinaga, M. 1994. Researchers devise a master

gene control switch. Science 265:26-28.

Blau, H.M. and Rossi, F.M.V. 1999. Tet B or not tetB: Advances in tetracycline-inducible gene ex-pression. Proc. Natl. Acad. Sci. U.S.A. 96: 797-799.

Chen, J., Kelz, M.B., Zeng, G., Steffen, C.,Shockett, P.E., Terwilliger, G., Schatz, D.G.,and Nestler, E.J. 2002. Inducible, reversible hairloss in transgenic mice. Transgenic Res. 11:241–247.

Damke, H., Gossen, M., Freundlieb, S., Bujard,H., and Schmid, S.L. 1995. Tightly regu-lated and inducible expression of dominantinterfering dynamin mutant in stably trans-formed HeLa cells. Methods Enzymol. 257:209-220.

Gossen, M. and Bujard, H. 1992. Tight controlof gene expression in mammalian cells bytetracycline-responsive promoters. Proc. Natl.Acad. Sci. U.S.A. 89:5547-5551.

Gossen, M., Bonin, A.L., and Bujard, H. 1993.Control of gene activity in higher eukaryoticcells by prokaryotic regulatory elements. TrendsBiochem. Sci. 18:471-475.

Sheehy, A.M. and Schlissel, M.S. 1999. Overex-pression of RelA causes G1 arrest and apoptosisin a Pro-B cell line. J. Biol. Chem. 274:8708–8716.

Shockett, P.E. and Schatz, D.G. 1996. Commentary:Diverse strategies for tetracycline-regulated in-ducible gene expression. Proc. Natl. Acad. Sci.U.S.A. 93:5173-5176.


20.8.10


Shockett, P., Difilippantonio, M., Hellman, N.,and Schatz, D. 1995. A modified tetracycline-regulated system provides autoregulatory, in-ducible gene expression in cultured cells andtransgenic mice. Proc. Natl. Acad. Sci. U.S.A.92:6522-6526.

Shockett, P.E., Zhou, S., Hong, X., and Schatz,D.G. 2004. Partial reconstitution of V(D)Jrearrangement and lymphocyte developmentin RAG-deficient mice expressing inducible,tetracycline-regulated RAG transgenes. Mol.Immunol. 40:813–829.

Sikes, M.L., Suarez, C.C., and Oltz, E.M. 1999.Regulation of V(D)J recombination by trans-criptional promoters. Mol. Cell Biol. 19:2773–2781.

Contributed by Penny ShockettSoutheastern Louisiana UniversityHammond, Louisiana

David SchatzHoward Hughes Medical Institute andYale University School of MedicineNew Haven, Connecticut

Documents

CHAPTER 20 Expression and Introduction of Macromolecules ...sun-lab.med.nyu.edu/files/sun-lab/attachments/CPCB.ch20.Macromo… · Expression and Introduction of Macromolecules into