Bio

KEY CONCEPTS

g

.... Figure 20.1 How can this array of spots be used tocompare normal and cancerous tissues?

20.1 DNA cloning yields multiple copies of a geneor other DNA segment

20.2 DNA technology allows us to study thesequence, expression, and function of a gene

20.3 Cloning organisms may lead to production ofstem cells for research and other applications

20.4 The practical applications of DNA technologyaffect our lives in many ways

r'bliA'lt'.

The DNA Toolbox

In 1995, a major scientific milestone was announced: For thefirst time, researchers had sequenced the entire genome ofa free-living organism, the bacterium Haemophilus influen­

zac. This news electrified the scientific community. Few amongthem would have dared to dream that a mere 12 years later,genome sequencing would be under way for more than 2,000species. By 2fX17, researchers had completely sequenced hun­dreds of prokaryotic genomes and dozens of eukaryotic ones,including all 3 billion base pairs ofthe human genome.

Ultimately, these achievements can be attributed to ad·vances in DNA technology-methods of working with andmanipulating DNA-that had their roots in the 1970s. A keyaccomplishment was the invention of techniques for makingrecombinant DNA, DNA molecules formed when segmentsof DNA from two different sources-often different species­are combined in vitro (in a test tube). This advance set thestage for further development of powerful techniques for an­alyzing genes and gene expression. How scientists prepare re­combinant DNA and use DNA technology to answerfundamental biological questions are one focus ofthis chapter.

Another focus of the chapter is how our lives are affected bybiotechnology, the manipulation oforganisms or their compo·

3%

nents to make useful products. Biotechnologyhas a long historythat includes such early practices as selective breeding of farmanimals and using microorganisms to make wine and cheese.Today, biotechnology also encompasses genetic engineering,the direct manipulation ofgenes for practical purposes. Geneticengineering has launched a revolution in biotechnology, greatlyexpanding the scope ofits potential applications. Tools from theDNA toolbox are now applied in ways that were unthinkableonly a decade ago, affecting everything from agriculrure tocriminal law to medical research. For instance, on the DNA mi­croarray in figure 20.1, the colored spots represent the relativelevel of expression of 2,400 human genes. Using microarrayanalysis, researchers can quickly compare gene expression indifferent samples, such as those obtained from normal and can­cerous tissues. The knowledge gained from such gene expres­sion studies is making a significant contribution to the study ofcancer and other diseases.

In this chapter, we first describe the main techniques formanipulating DNA and analyzing gene expression and func­tion. Next, we explore paranel advances in cloning organismsand producing stem cells, techniques that have both expandedour basic understanding ofbiology and enhanced our ability toapply this understanding to global problems. Finally, we sur­vey the practical applications of biotechnology and considersome of the social and ethical issues that arise as modernbiotechnology becomes more pervasive in our lives.

r~~:j;:n~~; ~ields multiplecopies of a gene or otherDNA segment

The molecular biologist studying a particular gene faces achallenge. Naturally occurring DNA molecules are very long,

A-PDF Split DEMO : Purchase from www.A-PDF.com to remove the watermark

and a single molecule usually carries many genes. Moreover,in many eukaryotic genomes, genes occupy only a small pro­portion of the chromosomal DNA, the rest being noncodingnucleotide sequences. A single human gene, for example,

might constitute only '1100.000 of a chromosomal DNA mol­ecule. As a further complication, the distinctions between a

gene and the surrounding DNA are subtle, consisting only ofdifferences in nucleotide sequence. To work directly with spe­cific genes, scientists have developed methods for preparingwell-defined segments of DNA in multiple identical copies, aprocess called DNA cloning.

of a doned gene from bacteria for use in basic research or toendow an organism with a new metabolic capability, such aspest resistance. For example, a resistance gene present in one

crop species might be cloned and transferred into plants ofan­

other species. Alternatively, a protein with medical uses, suchas human growth hormone, can be harvested in large quanti­ties from cultures of bacteria carrying the cloned gene for theprotein.

Most protein-coding genes exist in only one copy perhaploid genome-roughly one part per million in the case ofhuman DNA-so the ability to prepare large amounts of

Basicresearchon proteirl

DNA ofchromosome

Human growth hor­mone treats stuntedgrowth

••••••.".'.' ....,..,..

Cell containing geneof interest /_,

\:.:~P,_o_,,~,o~harvested

Protein dissolvesblood clots in heartattack therapy

o Gerle inserted irltoplasmid

o Basic research andvarious applications

·--GeneofRecombinant Interest

DNA (plasmid) ~f) Plasmid put into

bacterial cell

Gene used to alterbacteria for cleaningup toxic waste

Plasmid

Gene of----.'1''8.....interest

Copies of gene f~J-­~-----

Recombinantbacterium

Bacterium

Bacterialchromosome

Gene for pestresistance insertedmto plants

Basicresearchon gene

... Figure 20.2 A preview of gene cloning and some uses of cloned geMs. In thissimplified diagram of gene cloning, we start with aplasmid isolated from a bacterial cell and agene ofinterest from another organism. Only one copy of the plasmid and one copy of the gene of interest areshown at the top of the figure. but the starting materials would include many copies of each.

DNA Cloning and ItsApplications: APreview

Most methods for cloning pieces ofDNAin the laboratory share certain general

features. One common approach usesbacteria, most often Escherichia coli. Re­

call from Chapter 16 that the E. coli chro­mosome is a large circular molecule ofDNA. In addition, E. coli and many otherbacteria have plasmids, small circularDNA molecules that replicate separatelyfrom the bacterial chromosome. A plas­mid has only a small number of genes;these genes may be useful when the bac­terium is in a particular environment butmay not be required for survival or repro­

duction under most conditions.To clone pieces of DNA in the labo­

ratory, researchers first isolate a plasmidfrom a bacterial cell and insert DNAfrom another source ("foreign" DNA)

into it (Figure 20.2). The resulting plas­mid is now a recombinant DNA mole­cule, combining DNA from two sources.The plasmid is then returned to a bac­terial cell, producing a recombinantbacterium. This single cell reproducesthrough repeated cell divisions to form adone of cells, a population ofgenetically

identical cells. Because the dividing bac­teria replicate the recombinant plasmidand pass it on to their descendants, theforeign DNA and any genes it carries arecloned at the same time. The productionof multiple copies of a single gene iscalled gene doning.

Gene cloning is useful for two basicpurposes: to make many copies of a par­ticular gene and to produce a proteinproduct. Researchers can isolate copies

CHAPTER TWENTY Biotechnology 397

such rare DNA fragments is crucial for any application in­volving a single gene. In the rest of this chapter, you willlearn more about the techniques outlined in Figure 20.2 andrelated methods.

Restriction site

~DNA 5' !!!!!!!G~A~A~T*T~C!!!!!!3'

3' 5'

Using Restriction Enzymes to MakeRecombinant DNA

o Restriction enzyme cutsthe sugar-phosphatebackbones at each arrow.

Recombinant DNA molecule

Fragment from differentDNA molecule cut by thesame restriction enzyme

!o DNA ligaseseals the strands

Now that you've learned about restriction enzymes and DNA

ligase, we can take a closer look at how genes are cloned inplasmids. The original plasmid is called a doning vector, de­fined as a DNA molecule that can carry foreign DNA into ahost cell and replicate there. Bacterial plasmids are widelyused as doning vectors for several reasons. They can be easilyisolated from bacteria, manipulated to form recombinantplasmids by insertion of foreign DNA in vitro, and then rein­troduced into bacterial cells. Moreover, recombinant bacter­ial plasmids (and the foreign DNA they carry) multiply rapidlyowing to the high reproductive rate of their host cells.

e DNA fragment from anothersource is added. Base pairingof sticky ends producesvarious combinations.

Cloning a Eukaryotic Genein a Bacterial Plasmid

.... Figure 20.3 Using a restriction enzyme and DNA ligaseto make recombinant DNA. The restriction enzyme In thisexample (called EcoRI) recognizes a specific six-base-pair sequence. therestriction site, and makes staggered cuts in the sugar·phosphatebackbones within this sequence, producing fragments with stickyends. Any fragments with complementary sticky ends can base-pair,including the two original fragments; If the fragments come fromdifferent DNA molecules, the product is recombinant DNA.••p.W"1 The restriction enzyme HindlIl recognizes the sequenceS'-AAGCTT-3'. cutting between the two ·As. Draw the double­stranded sequence before and after the enzyme cuts,

Gene cloning and genetic engineering rely on the use of en­zymes that cut DNA molecules at a limited number of specificlocations. These enzymes, called restriction endonucleases,or restriction enzymes, were discovered in the late 1960s byresearchers studying bacteria. As you learned in Chapter 19,restriction enzymes protect the bacterial cell by cutting upforeign DNA from other organisms or phages.

Hundreds of different restriction enzymes have been iden­

tified and isolated. Each restriction enzyme is very specific,recognizing a particular short DNA sequence, or restrictionsite, and cutting both DNA strands at precise points withinthis restriction site. The DNA of a bacterial cell is protectedfrom the cell's own restriction enzymes by the addition ofmethyl groups (-CH3) to adenines or cytosines within the se­quences recognized by the enzymes.

The top ofFigure 20.3 illustrates a restriction site recognizedby a particular restriction enzyme from E. coli. As shown in thisexample, most restriction sites are symmetrical. That is, the se­quence of nudeotides is the same on both strands when read inthe 5' ---+ 3' direction. Most restriction enzymes recognize se­

quences containing four to eight nucleotides. Because any se­quence this short usually occurs (by chance) many times in along DNA molecule, a restriction enzyme will make many cutsin a DNA molecule, yielding a set of restriction fragments.All copies of a particular DNA molecule always yield thesame set of restriction fragments when exposed to the samerestriction enzyme. In other words, a restriction enzymecuts a DNA molecule in a reproducible way. (Later you willlearn how the different fragments can be separated and dis­tinguished from each other.)

The most useful restriction enzymes cleave the sugar­phosphate backbones in the two DNA strands in a staggeredmanner, as indicated in Figure 20.3. The resulting double­

stranded restriction fragments have at least one single­stranded end, called a sticky end. These short extensions canform hydrogen-bonded base pairs with complementary stickyends on any other DNA molecules cut with the same enzyme.The associations formed in this way are only temporary butcan be made permanent by the enzyme DNA ligase. As youlearned in Chapter 16, this enzyme catalyzes the formation ofcovalent bonds that close up the sugar-phosphate backbonesof DNA strands; for example, it joins Okazaki fragments dur­ing replication. You can see at the bottom of Figure 20.3 thatthe ligase-catalyzed joining of DNA from two differentsources produces a stable recombinant DNA molecule.

398 UNIT THREE Genetics

Research MethodProducing Clones of CellsCarrying Recombinant Plasmids • ~:ZOA

Cloning Genes in Bacterial Plasmids

APPLICATION Gene cloning is a process that produces many copies of a gene of interestThese copies can be used in sequencing the gene, in producing its encoded protein, or in ba­sic research or other applications.

Hummingbird cell

Bacteria carryingplasmids

Colony carryingrecombinant plasmidwith disruptedlad gene

lacZ gene(lactosebreakdown)

Nonrecombinantplasmid

~o0 0ctPJ~

Recombinant plasm ids

Colony carrying non·recombinant plasmidwith intad lacZ gene

TECHNIQUE In thiS example, hummingbird genes are inserted into plasmids from E coliOnly three plasmids and three hummingbird DNA fragments are shown, but millions of copiesof the plasmid and a miKlure of millions of different humming'bird DNA fragments would be present in the samples,

Bacterial cello Isolate plasmid DNAfrom bacterial cellsand DNA fromhummingbird cells, ~The hummingbirdDNA contains the Restridion

gene of interest. ~';;"'!","..;:t;,;;::;;ampR gene(ampicillin Bacterialresistance) plasmid

restriction enzyme, one that makes asingle cut within the lad gene and manycuts within the hummingbird DNA. 0 C ,~ene of

OY""Sticky mterest

ends" }HUmming•~ bird DNAYQ fragments

OM;, th' oct pl"mid,,,' DNA 0 0 0 0fragments. Some Join by basepairing; add DNA ligase to seal themtogether, The products arerecombinant plasmids and manynonrecombinant plasmids.

oMix the DNA with baderial cellsthat ha~e a mutation in their own ladgene. Some cells take up a recombinantplasmid or other DNA molecule bytransformation

o Plate the baderia on agar containingampicillin and X-gal, a moleculeresembling lactose, Incubate untilcolonies grow.

RESULTS Only a cellthat took up a plasmid, which hasthe ampR gene, will reproduceand form acolony, Colonies withnonrecombinant plasmids will beblue, because they can hydrolyzeX·gal, forming a blue product.Colonies with recombinant plas·mids, in which lad is disrupted,will be white, because theycannot hydrolyze X-gal

.','hUII4 If the medium used instep 5 did not contain ampicillin,what other colonies would grow?What color would they be?

Let's say we are researchers interested instudying the f3-globin gene in a particu­lar species of hummingbird to see if thisoxygen-carrying protein is different fromits counterpart in other, less metaboli­cally active species. Figure 20.4 detailsone method for doning hummingbirdgenes using a bacterial plasmid as thedoning vector.

o We begin by isolating humming­bird genomic DNA from hummingbirdcells. We also isolate our chosen vector, aparticular bacterial plasmid from E. colicells. The plasmid has been engineeredto carry hm genes that will later proveuseful: amr/, which makes E. coli cellsresistant to the antibiotic ampicillin, andUlCZ, which encodes an enzyme calledl3-galactosidase that hydrolyzes thesugar lactose. TIlis enzyme can also hy­drolyze a similar synthetic moleculecalled X-gal to form a blue product. Theplasmid contains onlyonecopy ofthe re­striction site re<ognized by the restric­tion enzyme used in the next step; thatsite is within the UlCZ gene.

e Both the plasmid and the hum­mingbird DNA are cut with the same re­striction enzyme, and then e thefragments are mixed together, allowingbase pairing between their complemen­tarystickyends. Wethen add DNA ligase,which covalently bonds the sugar­phosphate backbones of the fragmentswhose stickyends have base-paired. Someof the resulting recombinant plasmidscontain hummingbird DNA fragmentslike the three shown in Figure 20.4; one ofthe three carries the l3·globin gene. Thisstep will also generate other products,such as ptasmids containing several hum­mingbird DNA fragments, a<ombinationoftwo plasmids, or a rejoined, nonrecom­binant version of the original plasmid.

oThe DNA mixture is then added tobacteria that have a mutation in the lacZgene on their own chromosome, makingthem unable to hydrolyze lactose or X­gal. Under suitable experimental condi­tions, the cells take up foreign DNA by

CHAPTER TWENTY Biotechnology 399

transformation (see pp. 306 and 561). Some cells acquire a re­combinant plasmid carrying a gene, while others may take up anonrecombinant plasmid, a fragment of noncoding humming­bird DNA, or nothing at alL The ampR and tacZ genes on the

plasmid can help us sort out these possibilities.

o First, plating out all the bacteria on solid nutrientmedium (agar) containing ampicillin allows us to distin­guish the cells that have taken up plasmids, whether recom­binant or not, from the other cells. Under these conditions,

only cells with a plasmid will reproduce because only theyhave the ampR gene conferring resistance to the ampicillin

in the medium. Each reproducing bacterium forms a cloneof cells. Once the clone contains between 105 and 108 cells,it is visible as a mass, or colony, on the agar. As cells repro­duce, any foreign genes carried by recombinant plasmidsare also copied (cloned).

Second, the presence of X-gal in the medium allows us to

distinguish colonies with recombinant plasmids from thosewith nonrecombinant plasmids. Colonies containing nonre­combinant plasmids have the lacZ gene intact and will pro­duce functional ~-galactosidase. These colonies will be bluebecause the enzyme hydrolyzes the X-gal in the medium,forming a blue product. In contrast, no functional ~-galactosi­

dase is produced in colonies containing recombinant plasmidswith foreign DNA inserted into the facZ gene; these colonieswill therefore be white.

The procedure to this point will have cloned many differenthummingbird DNA fragments, not just the ~-globingene thatinterests us. In fact, taken together, the white colonies shouldrepresent all the DNA sequences from the hummingbird

genome, including noncoding regions as well as genes. How

do we find the colony {cell clone} carrying the f3-globin geneamong the many clones carrying other pieces ofhummingbirdDNA? Before addressing this question, we must consider howthe clones are stored.

Storing Cloned Genes in DNA libraries

The cloning procedure in Figure 20.4, which starts with a mix­ture of fragments from the entire genome of an organism, iscalled a ~shotgun" approach; no single gene is targeted forcloning. Thousands of different recombinant plasmids areproduced in step 3, and a clone of cells carrying each type ofplasmid ends up as a white colony in step 5. The complete setof plasmid-containing cell clones, each carrying copies of aparticular segment from the initial genome, is referred to as agenomic library (Figure 20.Sa). Each "plasmid clone" in the

library is like a book containing specific information. Today,scientists often obtain such libraries (or even particularcloned genes) from another researcher, a commercial source,

or a sequencing center.Certain bacteriophages have also been used as cloning vec­

tors for making genomic libraries. Fragments of foreign DNA

lBACclone

Large insertwith many geneslarge plasmid

Phageclones

Recombinantphage DNA

Ij---ll-:'Recombinantplasmids

Vl;JForeign genomecut up with

~... ~_ restrictIOnenzyme

7"'"'"Bacterialclones

(a) Plasmid library. Shown are three of thethousands of "books" in a plasmid library,Each "book" is aclone of bacterial cells,which contain copies of a particular foreigngenome fragment (pink, yellow, blacksegments) in their recombinant plasmids.

... Figure 20.5 Genomic libraries. Agenomic library is a collection of many bacterialor phage clones, Each clone carries copies of aparticular DNA segment from a foreign

(b) Phage library. The same three foreigngenome segments are shown in three"books" of a phage library,

genome, integrated into an appropriate DNAvector, such as a plasmid or a trimmed·downphage genome. In a complete genomic library,the foreign DNA segments cover the entire

(c) A library of bacterial artificial chromo­some (BAC) clones. Such libraries areusually stored in a "multiwell" plastic plate;a 384-well plate is shown here, Each cloneoccupies one well, (The library of an entiregenome would require many such plates,)Plasmid libraries can also be stored thiS way

genome of an organism. Note that the bacterialchromosomes in (a) and (c) are not drawn toscale; they are actually about 1,000 times aslarge as the vectors,

400 UNIT THREE Genetics

Screening a Library for Clones Carrying a Geneof Interest

i!--.s'

cDNA

(jj NAi'nucleus

mRNAs in~b~~cytOPla;m

oReverse transcrip-~tase is added to a

test tube containingmRNA isolated from

the cell.

.. Figure 20.6 Making complementary DNA (eDNA) for aeukaryotic gene, Complementary DNA is DNA made in vitro usingmRNA as a template for the first strand, Because the mRNA containsonly exons, the resulting double-stranded cDNA carries the completecoding sequence of the gene but no introns, Although only one mRNAis shown here, the final collection of eDNAs would reflect all themRNAs that were present in the cell,

5'3'

DNA--­polymerase I

QThe result is cDNA,r twhich carries the 5'complete coding 3'sequence of the

gene but no introns.

8 Reverse transcrip-tase makes the first Reverse

DNA strand using mRNA tranSUIptase Poly-A tailtheRNAasatem- 5' AAAAA13'

plate and a stretch of 3·~l.LT If 5'dr's as a DNA primer. • DNA Primer

. ~ strando mRNA IS degraded~by another enzyme.

5'~ •••••AAA AAA]'3' ii "oiiiT T T T T 5'

ODNA polymerasesynthesizes thesecond strand,

using a primer inthe reaction

mixture. (Severaloptions exist for

primers.)

version ofthe gene from a eDNA library. In our example of thehummingbird f3-globin protein, a eDNA library would serveus well. We know which cells express the gene, so we couldstart making the library by isolating mRNA from humming­bird red blood cells. AeDNA library is also useful for studyingthe set of genes responsible for the specialized functions of aparticular cell type, such as brain or liver cells. Finally, by mak­ing cDNA from cells of the same type at different times in thelife ofan organism, researchers can trace changes in patternsofgene expression during development.

Now, returning to the results in Figure 20.4, we're ready toscreen all the colonies with recombinant plasmids (the whitecolonies) for a clone of cells containing the hummingbird 13­globin gene. We can detect this gene's DNA by its ability tobase-pair with a complementary sequence on another nudeicacid molecule, using nucleic acid hybridization. The comple­mentary molecule, a short, single-stranded nucleic acid that

can be spliced into a trimmed-down version ofa phage genome,as intoa plasmid, by using a restriction enzyme and DNA ligase.The normal infection process allows production of many newphage particles, each carrying the foreign DNA. An advantageof using phages as vectors is that while a standard plasmid cancarry a DNA insert no larger than 12,000 base pairs (12 kb), aphage can carry an insert of about 25 kb. A genomic librarymade using phages is stored as a collection of phage clones(Figure 20.Sb). Because restriction enzymes do not recognizegene boundaries, some genes in either type ofgenomic librarywill be cut and divided up among two or more dones.

Another type of vector used in library construction is abacterial artificial chromosome (RAC). In spite ofthe name,these are simply large plasmids, trimmed down so they containjust the genes necessary to ensure replication and capable ofcarrying inserts of 100-300 kb. The very large insert size min­imizes the number ofclones needed to make up the genomic li­brary, but it also makes them more challenging to work with inthe lab. BAC clones are usually stored in multiwelled plasticplates, with one done per well (Figure 20.Se). This orderlystorage ofdones, identified by their location in the plate, makesscreening for the gene of interest very efficient, as we will see.

Researchers can make another kind of DNA library by start­ing with mRNA extracted from cells (Figure 20.6). The enzymereverse transcriptase (obtained from retroviruses) is used in vitroto make single-stranded DNA transcripts of the mRNA mole­cules. Recall that the 3'end ofthe mRNA has astretch ofadenine(A) ribonucleotides called a poly-A tail. TIlis feature allows useof a short strand of thymine (dT) deoxyribonudeotides as aprimer for the reverse transcriptase. Followingenzymaticdegra­dation ofthe mRNA, asecond DNA strand,complementary to thefirst, is synthesized by DNA polymerase. The resulting double­stranded DNA is called complementary DNA (eDNA). Forcreating a library, the cDNA is modified by the addition of re­striction enzyme recognition sequences at each end. Then thecDNA is inserted into vector DNA in a manner similar to the in­sertion of genomic DNA fragments. The extracted mRNA is amixture of all the mRNA molecules in the original cells, tran­scribed from many different genes. Therefore, the cDNAs thatare cloned make up a eDNA library containing a collection ofgenes. However, a eDNA library represents only part of thegenome-only the subset ofgenes that were transcribed in thecells from which the mRNA was isolated.

Genomic and cDNA libraries each have advantages, de­pending on what is being studied. If you want to clone a genebut don't know what cell type expresses it or cannot obtainenough cells of the appropriate type, a genomic library is al­most certain to contain the gene. Also, if you are interested inthe regulatory sequences or introns associated with a gene, agenomic library is required because these sequences are ab­sent from the fully processed mRNAs used in making a eDNAlibrary. For this very reason, if you are interested only in thecoding sequence of a gene, you can obtain a stripped-down

CHAPTER TWENTY Biotechnology 401

can be either RNA or DNA, is called a nucleic add probe. Ifwe know at least part of the nucleotide sequence of the gene ofinterest (perhaps from knowing the amino acid sequence oftheprotein it encodes or, as in our case, the gene's nucleotide se~

quence in a closely related species), we can synthesize a probe

complementary to it. For example, if part of the sequence onone strand of the desired gene were

5' w···GGCIAACTTAGC··· 3'

then we would synthesize this probe:

Each probe molecule, which will hydrogen-bond specifi­cally to a complementary sequence in the desired gene, is la­beled with a radioactive isotope or a fluorescent tag so wecan track it.

Recall that the clones in our hummingbird genomic libraryhave been stored in a multiwell plate (see Figure 20.5c). If we

transfer a few cells from each well to a defined location on amembrane made of nylon or nitrocellulose, we can screen alarge number of clones simultaneously for the presence ofDNA complementary to our DNA probe (Figure 20.7).

Once we've identified the location of a done carrying thej3-globin gene, wecan grow some cells from that colony in liquid

m!!m'm Research MethodDetecting a Specific DNA Sequence by Hybridization with a Nucleic Acid Probe

APPLICATION Hybridization with a complementary nucleic acid probe detects a specific DNAsequence within a mixture of DNA molecules. In this example, a collection of bacterial clonesfrom a hummingbird genomic library is screened to identify clones that carry a recombinantplasmid bearing the gene of interest. The library is stored in many multiwell plates, with oneclone per well (see Figure 20.5c)

TECHNIQUE Cellslrom each clone are applied to a special nylon membrane. Each mem­brane has room for thousands of clones (many more than are shown here) so only a few mem­branes are needed to hold samples of all the clones in the library. This set of membranes is anarrayed library that can be screened for a specific gene using a labeled probe. Here the label is aradioactive nucleotide, but other commonly used labels include enzymes. covalently linked tothe probe nucleotides, that can produce either a colored or luminescent product.

Location ofDNA with thecomplementarysequence

-Nylonmembrane

•

')o7---Gene ofinterest

Single-strandedDNA from cell

ProbeDNA

f.i.':fk;'! iii:!ttl!/:/1!!I!l!!.'!!!!!ff!

Solution in plastic bagcontains radioactivelylabeled probe molecules.

Nylon membrane

'\, ®,,,,1-:c'!-f:c::c'j-f.:-':;c!.-~:-:;-,"

Multiwell platesholding libraryclones

oPlate by plate. cells from each well,representing one clone, are transferred toa defined spot on a special nylon mem­brane. The nylon membrane is treated tobreak open the cells and denature theirDNA; the resulting single-stranded DNAmolecules stick to the membrane.

9 The membrane is then Incubated in a solution ofradioactive probe molecules complementary tothe gene of interest. Because the DNA immobi­lized on the membrane is single-stranded, thesingle-stranded probe can base-pair with anycomplementary DNA on the membrane. ExcessDNA is then rinsed off. (One spot with radio­active probe-DNA hybrids is shown here inorange but would not be visible yet.)

OThe membrane is laid under photographicfilm, allOWing any radioactive areas toexpose the film (autoradiography). Blackspots on the film correspond tothe locations on the membrane of DNAthat has hybridized to the probe. Thislocation can be traced back to the originalwell containing the bacterial clone thatholds the gene of interest.

RESULTS The location of the black spot on the photographic film identifies the clonecontaining the gene of interest. By using probes with different nucleotide sequences, researcherscan screen the collection of bacterial clones for different genes.

402 UNIT THREE Genetics

culture in a large tank and then easily isolate many copies ofthe gene for our studies. W/e can also use the doned gene as aprobe to identify similar or identical genes in DNA from othersources, such as other species of birds.

Expressing Cloned Eukaryotic Genes

Once a particular gene has been cloned in host cells, its pro­tein product can be produced in large amounts for research

purposes or valuable practical applications, which we'll ex­plore in Concept 20.4. Cloned genes can be expressed as pro­tein in either bacterial or eukaryotic cells; each option hasadvantages and disadvantages.

Bacterial Expression Systems

Getting a cloned eukaryotic gene to function in bacterial hostcells can be difficult because certain aspects ofgene expressionare different in eukaryotes and bacteria. To overcome differ­ences in promoters and other DNA control sequences, scien­tists usually employ an expression vector, a doning vectorthat contains a highly active bacterial promoter just upstreamof a restriction site where the eukaryotic gene can be insertedin the correct reading frame. The bacterial host cell will recog­

nize the promoter and proceed to express the foreign gene nowlinked to that promoter. Such expression vectors allow the syn­thesis of many eukaryotic proteins in bacterial cells.

Another problem with expressing doned eukaryotic genesin bacteria is the presence of noncoding regions (introns) inmost eukaryotic genes. lntrons can make a eukaryotic genevery long and unwieldy, and they prevent correct expressionof the gene by bacterial cells, which do not have RNA-splicingmachinery. This problem can be surmounted by using acDNA form of the gene, which includes only the exons.

Eukaryotic Cloning and Expression Systems

Molecular biologists can avoid eukaryotic-bacterial incompat­ibility by using eukaryotic cells such as yeasts, rather than bac­teria, as hosts for doning and/or expressing eukaryotic genesof interest. Yeasts, single-celled fungi, offer WiO advantages:They are as easy to grow as bacteria, and they have plasmids, a

rarity among eukaryotes. Scientists have even constructed re­combinant plasmids that combine yeast and bacterial DNAand can replicate in either type of cell. Another useful tool fordoning eukaryotic genes are yeast artificial chromosomes(YACs), which combine the essentials of a eukaryotic chro­

mosome-an origin for DNA replication, a centromere, andtwo telomeres-with foreign DNA. These chromosome-likevectors behave like ordinary chromosomes during mitosis,doning the foreign DNA as the yeast cell divides. Because aYAC can carry a much longer DNA segment than can a plas­mid vector, a cloned fragment is more likely to contain an en­tire gene rather than just a portion of it.

Another reason to use eukaryotic host cells for expressinga cloned eukaryotic gene is that many eukaryotic proteins willnot function unless they are modified after translation, for ex·

ample by the addition of carbohydrate or lipid groups. Bacte­

rial cells cannot carry out these modifications, and if the geneproduct requiring such processing is from a mammal, evenyeast cells may not be able to modify the protein correctly. Theuse of host cells from an animal cell culture may therefore benecessary.

Scientists have developed a variety ofmethods for introducingrecombinant DNA into eukaryotic cells. In electroporation, abrief electrical pulse applied to a solution containing cells cre­ates temporary holes in their plasma membranes, throughwhich DNA can enter. (This technique is now commonly usedfor bacteria as welL) Alternatively, scientists can inject DNA di­rectly into single eukaryotic cells using microscopically thin

needles. To get DNA into plant cells, the soil bacteriumAgrobacterium can be used, as well as other methods you willlearn about later. lfthe introduced DNA is incorporated into acell's genome by genetic recombination, then it may be ex­pressed by the cell.

Amplifying DNA in Vitro: The PolymeraseChain Reaction (PCR)

DNA cloning in cells remains the best method for preparinglarge quantities of a particular gene or other DNA sequence.However, when the source of DNA is scanty or impure, thepolymerase chain reaction, or PCR, is quicker and more se·lective. In this technique, any specific target segment within

one or many DNA molecules can be quickly amplified(copied many times) in a test tube. With automation, PCR

can make billions of copies of a target segment of DNA in afew hours, significantly faster than the days it would take toobtain the same number ofcopies by screening a DNA libraryfor a done with the desired gene and letting it replicate withinhost cells. In fact, PCR is being used increasingly to makeenough of a specific DNA fragment to insert it directly into avector, entirely skipping the steps of making and screening alibrary. To continue our literary analogy, PCR is like photo­copying just one page rather than checking out all the booksin a library.

In the PCR procedure, a three-step cycle brings about a

chain reaction that produces an exponentially growing popula­tion of identical DNA molecules. During each cycle, the reac­tion mixture is heated to denature (separate) the DNA strands

and then cooled to allow annealing (hydrogen bonding) ofshort, single-stranded DNA primers complementary to se­quences on opposite strands at each end ofthe target sequence;finally, a heat-stable DNA polymerase extends the primers inthe 5' ---> 3' direction. Ifa standard DNA polymerase were used,

the protein would bedenatured along with the DNA during thefirst heating step and would have to be replaced after each

CHAPTH TWENTY Biotechnology 403

RESULTS After 3 cycles, one-fourth of the molecules match the target sequence ex-actly. Alter 30 cycles, more than 99.99% of the molecules match the target sequence.

•

3'

5'

!

N,wnucleo­tides

Primers

L !

Genomic DNA

€) Extension:DNA polymeraseadds nucleotides tothe 3' end of eachprimer.

e Annealing:Cool to allowprimers to formhydrogen bondswith ends oftarget sequence.

o Denaturation:Heat brieflyto separate DNAstrands.

Cycle 1yields

2mole{Ules

Cycle 2yields

4molecules

Cycle 3Yields 8

molecules;2 molecules

(in white boxes)match target

sequence

•

TECHNIQUE PCR requires double-stranded DNA containing the target sequence. aheat-resistant DNA polymerase. all four nucleotides, and two 15- to 20-nucleotide DNAstrands that seNe as primers. One primer is complementary to one end of the target se­quence on one strand: the second primer is complementary to the other end of the sequenceon the other strand. 5' 3'

}

TOC9etsequence

]' 5'

1\5'13' _

!

APPLICATION With PCR. any specific segment-the target sequence-within a DNA sam-ple can be copied many times (amplified), completely in vitro.

The Polymerase Chain Reaction (PCR)

• 20.1cycle. The key to automating PCR wasthe discovery of an unusual heat-stableDNA polymerase, first isolated fromcells of a bacterial species living in hot

springs, that could withstand the heat at

the start ofeach cycle. Figure 20.8 illus­trates the steps in PCR.

Just as impressive as the speed ofPCRis its specificity. Only minute amounts ofDNA need be present in the starting ma­terial, and this DNA can be in a partiallydegraded state, as long as a few mole­cules contain the complete target se­quence. The key to this high specificity isthe primers, which hydrogen-bond onlyto sequences at opposite ends of the tar­

get segment. (For high specificity, theprimers must be at least 15 or so nu­cleotides long.) By the end of the thirdcycle, one-fourth of the molecules areidentical to the target segment, withboth strands the appropriate length.With each successive cycle, the numberof target segment molecules of the cor­rect length doubles, soon greatly out­numbering all other DNA molecules inthe reaction.

Despite its speed and specificity, PCRamplification cannot substitute for gene

cloning in cells when large amounts of agene are desired. Occasional errors dur­ing PCR replication impose limits onthe number of good copies that can bemade by this method. When PCR isused to provide the specific DNA frag­ment for cloning, the resulting clonesare sequenced to select clones witherror-free inserts.

Devised in 1985, PCR has had a ma­jor impact on biological research andbiotechnology. PCR has been used toamplify DNA from a wide variety of

sources: fragments of ancient DNAfrom a 4Q,OOO-year-old frozen woolly

mammoth; DNA from fingerprints orfrom tiny amounts of blood, tissue, or

semen found at crime scenes; DNAfrom single embryonic cells for rapidprenatal diagnosis of genetic disorders;and DNA of viral genes from cells in­fected with viruses that are difficult todetect, such as KIV. We'll return to ap­plications of PCR later in the chapter.

404 UNIT THREE Genetics

For suggested answers, see Appendix A.

G,I

Anode

sourcePower

Cathode

Powersource

f} When the Cllrrent is turned on, the negatively charged DNAmolecules move toward the positive electrode, with shortermolecules moving faster than longer ones, Bands are shownhere in blue, but on an actual gel. the bands would not bevisible at this time,

•

APPLICATION Gel eledrophoresis is used for separating nu-cleic acids or proteins that differ in size, electrical charge, or otherphysical properties. DNA molecules are separated by gel elec­trophoresis in restriction fragment analysis of both cloned genes(see Figure 20,10) and genomic DNA (see Figure 20.11).

.. Fl~20.9

Gel Electrophoresis

TECHNIQUE Gel electrophoresis separates macromoleculeson the basis of their rate of movement through a polymeric gel inan electric field: The distance a DNA molecule travels is inverselyproportional to its length. A mixture of DNA molecules. usuallyfragments produced by restriction enzyme digestion (Clltting) orPCR amplification. is separated Into bands Each band containsthousands of molecules of the same length.

o Each sample, a mixture of DNA molecules, is placed in aseparate well near one end of a thin slab of gel, The gel is setinto asmall plastic support and immersed in an aqueoussolution in a tray with electrodes at each end.

Mixture ofDNA mol­eculesof~differentsizes

20.1CONCEPT CHECK

r~~:J:e:~~i:gyallows us tostudy the sequence, expression,and function of a gene

1. The restriction site for an enzyme called Pvul is thefollowing sequence:

S'-CGATCG-3'3'-GCTAGC-S'

Staggered cuts are made between the T and C oneach strand. What type of bonds are being cleaved?

2. ,.p.W"1 One strand ofa DNA molecule has the fol­lowing sequence: 5'-CCTTGACGATCGTTACCG-3'.Draw the other strand. \XliU Pvu! cut this molecule? Ifso, draw the products.

3. What are some potential difficulties in using plasmidvectors and bacterial host cells to produce large quan­tities of proteins from cloned eukaryotic genes?

4. _i,ij:f.,IIM !fyou wanted to amplify the double­stranded DNA fragment you drew for question 2,show the sequence of the primers you would use, as­suming each is four nucleotides long. (In reality,primers are much longer.) Be sure to label the 5' and3' ends.

RESULTS After the current is turned off, a DNA-bindingdye is added This dye fluoresces pink In ultraviolet light, revealingthe separated bands to which it binds. In the gel below. the pinkbands correspond to DNA fragments of different lengths sepa­rated by electrophoresis, If all the samples were initially cut withthe same restriction enzyme, then the different band patterns in­dicate that they came from different sources,

Once DNA cloning has provided us with large quantities ofspecific DNA segments, we can tackle some interesting ques­tions about a particular gene and its function. For example,does the sequence of the hummingbird l3-globin gene suggesta protein structure that can carry oxygen more efficiently thanits counterpart in less metabolically active species? Does a par­ticular human gene differ from person to person, and are cer­tain alleles of that gene associated with a hereditary disorder?\Xfhere in the body and when is a given gene expressed? And,ultimately, what role does a certain gene play in an organism?

Before we can begin to address such compelling questions,we must consider a few standard laboratory te<hniques thatare used to analyze the DNA ofgenes.

Gel Electrophoresis and Southern Blotting

Many approaches for studying DNA molecules involve gclelectrophoresis. This technique uses a gel made ofa polymer,such as a polysaccharide. The gel acts as a molecular sieve toseparate nucleic acids or proteins on the basis of size, electri­cal charge, and other physical properties (Figure 20.9). Be­cause nucleic acid molecules carry negative charges on theirphosphate groups, they all travel toward the positive pole in

Longermolecules

CHAPTER TWENTY Biotechnology 405

1-175 bp-(-201 bp~~'gef,~gmen~

1----376 bp----+---t~'gef,~gmen~

Ode!

Ddel

376 bp

Sickle-cellallele

5

Ode!

Ode!

Normalallele

Normal p-globin allele,

Ode!

I 5

Sickle-cell mutant P-globin allele,

201 bp175 bp

IS

15

Ode!

Ode!

largefragment

ally a radioactive single-stranded DNA molecule that is com­plementary to the gene of interest. Figure 20.11 outlines theentire procedure and demonstrates how it can differentiate aheterozygote (in this case, for the sickle-cell allele) from an in­dividual homozygous for the normal allele.

The identification of carriers of mutant alleles associatedwith genetic diseases is only one ofthe ways Southern blottinghas been used. In fact, this technique has been a laboratoryworkhorse for many years. Recently, however, it has been sup­planted by more rapid methods, often involving PCR amplifi­cation of the specific parts of genomes that may differ.

(a) Ddel restriction sites in normal and sickle·cell alleles of~globin gene. Shown here are the cloned alleles. separatedfrom the ~ector DNA but including some DNA next to the cooingsequence. The normal allele contains two sites within the codingsequence recognized by the Odel restriction enzyme. The sickle­cell allele lacks one of these sites.

(b) Electrophoresis of restriction fragments from normal andsickle-cell alleles. Samples of each purified allele were cut withthe Odel enzyme and then subjected to gel electrophoresis,resulting in three bands for the normal allele and two bands forthe sickle-cell allele (The tmy fragments on the ends of bothinitial DNA molecules are identical and are not seen here,)

... Figure 20.10 Using restriction fragment analysis todistitlguish the nonnal and sickle-cell alleles of the humanjJ-globin gene. (a) The sickle-cell mutation destroys one of the Odelrestriction sites within the gene. (b) A5 a result, digestion with the Odelenzyme generates different fragments from the normal and sickle-cell alleles._i,'!:t.iIiM Given recombinant baaerial clones carrying each ofthese alleles, how would you isolate the DNA of the alleles to provide thepure samples run on the gel in (b)? (Hint: Study Figures 20.4 and 20,9.)

an electric field. As they move, the thicket of polymer fibersimpedes longer molecules more than it does shorter ones,separating them by length. Thus, gel electrophoresis separatesa mixture oflinear DNA molecules into bands, each consist­ing of DNA molecules of the same length.

One useful application of this technique is restriction frag­ment analysis, which can rapidly provide useful informationabout DNA sequences. In this type of analysis, the DNA frag­ments produced by restriction enzyme digestion (cutting) of aDNA molecule are sorted by gel electrophoresis. When themixhtre of restriction fragments undergoes electrophoresis, ityields a band pattern characteristic of the starting moleculeand the restriction enzyme used. In fact, the relatively smallDNA molecules of viruses and plasmids can be identified sim­ply by their restriction fragment patterns. Because DNA can berecovered undamaged from gels, the procedure also provides away to prepare pure samples of individual fragments-if thebands can be clearly resolved. (Very large DNA molecules,such as those ofeukaryotic chromosomes, yield so many frag­ments that they appear as a smear instead of distinct bands.)

Restriction fragment analysis is also useful for comparingtwo different DNA molecules-for example, two alleles of agene. A restriction enzyme recognizes a specific sequence ofnucleotides, and a change in even one base pair of that se­quence will prevent it from cutting at a particular site. There­fore, if the nucleotide differences between two alleles occurwithin a restriction site, digestion with the enzyme that recog­nizes the site will produce a different mixture of fragmentsfrom each allele. Each mixture will give its own band patternin gel electrophoresis. For example, sickle-cell disease iscaused by mutation ofa single nucleotide located within a re­striction sequence in the human ~-globin gene (see Figure 17.22and p. 278). Consequently, restriction fragment analysis byelectrophoresis can distinguish the normal and sickle-cellalleles of the ~-g1obin gene, as shown in Figure 20.10.

The starting materials in Figure 20.10 are samples of thecloned and purified ~-g1obin alleles. But what can we do if wedon't have purified alleles to start with? Suppose we wanted todetermine whether a person is a heterozygous carrier of themutant allele for sickle-cell disease. In this case, we would di­rectly compare the genomic DNA from that person with DNAfrom both a person who has sickle-cell disease (and is ho­mozygous for the mutant allele) and a person who is homozy­gous for the normal allele. As we mentioned already,electrophoresis of genomic DNA digested with a restrictionenzyme and stained with a DNA-binding dye yields too manybands to distinguish them individually. However, a methodcalled Southern blotting (developed by British biochemistEdwin Southern), which combines gel electrophoresis and nu­cleic acid hybridization, allows us to detect just those bandsthat include parts of the ~-globin gene. The principle is thesame as in nucleic acid hybridization for screening bacterialclones (see Figure 20.7). In Southern blotting, the probe is usu-

406 UNIT THREE Genetics

Research Method• FI~20."

Southern Blotting of DNA Fragments

APPLICATION Researchers can detect specific nucleotide sequences within a complex DNAsample with this method, In particular, Southern blotting is useful for comparing the restrictionfragments produced from different samples of genomic DNA.

TECHNIQUE In this example. we compare genomic DNA samples from three individuals: ahomozygote for the normall3-globin allele (I), a homozygote for the mutant sickle-cell allele (II),and a heterozygote (Ill) As in Figure 20.7, we show a radioactively labeled probe, but othermethods of probe labeling and detection are also used.

L~-_

Nitrocellulose blot

, ,11 Sickle-cell III Heterozygoteallele

- "'Film overblot

•

II III

e DNA transfer (blotting). With the gelarranged as shown above, capillary actionpulls the alkaline solution upward throughthe gel, transferring the DNA to anitrocellulose membrane, producing theblot: the DNA is denatured in the process(Another version of this method uses anelectrical current to hasten the DNAtransfer,) The single strands of DNA stuckto the nitrocellulose are positioned inbands corresponding to those on the gel.

Probe base-pairswith fragmentscontaining normalor mutant ~-globin

DNA sequences,

'Fragment fromsickle-cell~-globin allele

4Fragment fromnormal ~-globinallele

Heavy

II III Nitrocelluloseweight- -- membrane (blot)

- - -

- - -- -- - -

- -

= - Paper- -II " towels

e Gel electrophoresis. The restrictionfragments in each sample are separated byelectrophoresis, forming acharacteristicpattern of bands, (In reality, there would bemany more bands than shown here, andthey would be invisible unless stained)

•

, - .,;-,:: ',-

"'

Restrictionfragments

II

DNA + restriction enzyme,

~ISolution in plasticbag contains radio­actively labeledprobe for ~-globin

gene.

,I Normall3-globinallele

o Preparation of restriction fragments.Each DNA sample is mixed with the samerestriction enzyme, in this case Ode!.Digestion of each sample yields a mixtureof thousands of restriction fragments.

o Hybridization with radioactive probe. The nitrocellulose blot is exposed to asolution containing a radioactively labeled probe. In this example. the probe is single­stranded DNA complementary to the ~-globin gene. Probe molecules attach bybase-pairing to any restriction fragments containing a part of the ~-globin gene (Thebands would not be visible yet.)

" Probe detection. A sheet ofphotographic film is laid over the blot.The radioactivity in the bound probeexposes the film to form an imagecorresponding to those bands containingDNA that base-paired with the probe,

RESULTS Because the band patterns for the three samples are clearly different, thismethod can be used to identify heterozygous carriers of the sickle-<:ell allele (III), as well as thosewith the disease, who have two mutant alleles (II), and unaffected individuals, who have twonormal alleles (I), The band patterns for samples I and II resemble those observed for the purifiednormal and mutant alleles, respectively, seen in Figure 20, lOb. The band pattern for the samplefrom the heterozygote (III) is acombination of the patterns for the two homozygotes (I and II).

CHAPTER TWENTY Biotechnology 407

~Researeh MethodDideoxy Chain Termination Method for Sequencing DNA

APPLICATION The sequence of nucleotides In any cloned DNA fragment up to about800 base pairs in length can be determined rapidly with machines that carry out sequencingreactions and separate the labeled reaction products by length.

TECHNIQUE This method synthesiZes a set of DNA strands complementary to the originalDNA fragment. Each strand starts with the same primer and ends with a dideoxyribonucleotide(ddNTP). a modified nucleotide. Incorporation of a ddNTP terminates agrowing DNA strandbecause it lacks a3' -QH group. the site for attachment of the neKt nucleotide (see Figure 16.14),In the set of strands synthesized. each nucleotidl" position along the original sequence isrepresented by strands ending at that point with the complementary ddNTfl Because each type ofddNTP is tagged with a distinct fluorescent label. the Identity of the ending nucleotides of the newstrands, and ultimately the entire original sequence, can be determined.

-ddCTP

ddTIP

Dideoxyribonucleotides(fluorescently tagged)

labeled strandsddG

ddA AddC C C

T T TddG G G G

A A A AA A A AG G G GC C C CT T T TG G G GT T T TT T T T

longest

Deoxyribonucleotides

ddGCTGTT

ddiJShortest

DNA (templateC strand)TGACTTCG

~ 1

DNA(template strand)

S'

3'

PrimerT_ 3'

i ~= I!DIG T- s' II!lillII~ .-T DNA .....

~ polym",~ ~

~r-3_'_A O_H -,

\; S'

e Synthesis of each new strandstarts at the 3' end of the primerand continues until adideoxy­ribonucleotide is inserted, atrandom, instead of the normalequivalent deoxyribonucleotide.ThiS prevents further elongationof the strand. Eventually, a set oflabeled strands of various lengthsis generated, with the color of thetag representing the last nucleotidein the sequence

GThe fragment of DNA to be sequenced isdenatured into single strands and inCllbatedin a test tllbe with the necessary ingredientsfor DNA synthesis: a primer designed tobase pair with the known 3' end of thetemplate strand, DNA polymerase, the fourdeoxyribonucleotldes, and the fourdideoxyribonucleotides, each tagged witha specific fluorescent molecule.

8 The labeled strands in the mixture areseparated by passage through a polyacryl·amide gel. with shorter strands movingthrough faster. For DNA sequencing. the gel ISformed in a capillary tube rather than a slablike that shown in Figure 20.9. The small sizeof the wbe allows a fluorescence detector tosense the color of each fluorescent tag as thestrands come through. Strands differing inlength by as little as one nucleotide can bedistinguished from each other.

RESULTS The color of the fluorescenttag on each strand indicates the identity of thenucleotide at its end. The results can be printedout as a spectrogram, and the sequence, whichis complementary to the template strand, canthen be read from bottom (shortest strand) totop (longest strand). (Notice that the sequencehere begins after the primer.)

last baseof longestlabeled strand

last baseof shortestlabeled strand

408 UNIT THREE Genetics

TECHNIQUE In this example. samples containing mRNAsfrom six embryonic stages of hummingbird were processed asshown below. (The mRNA from only one stage is shown.)

1Embryonic stages2 3 4 5 6. ---..

Primers

~~-globln

gene

RESULTSThe mRNA for this genefirst is expressed at stage 2and continu~ to be ex­pressed through stage 6,The size of the amplifiedfragment depends on thedistance between theprimers that were used,

o peR amplification of thesample is performed usingprimers specific to thehummingbird ~-globin

gene,

oGel electrophoresis willreveal amplified DNA productsonly in samples that containedmRNA transcribed from the~~Iobin gene

oeDNA synthesis is carried outby incubating the mRNAs withreverse transcriptase and othernecessary components.

APPLICATION RT-PCR uses the enzyme reverse tranSUIptase(RT) in combination with PCR and gel electrophoresis. RT-PCR canbe used to compare gene expression between samples-for in·stance. in different embryonic stages, in different tissues, or in thesame type of cell under different conditions.

'~:ZO.1J

RT-PCR Analysis of the Expression ofSingle Genes

•

gins similarly to Northern blotting. with the isolation of mRNAsfrom different developmental stages of hummingbird embryos.Reverse transcriptase is added next to make eDNA, which thenserves as a template for PeR amplification using primers from ther.-globin gene. \Vhen the products are run on a gel, copies oftheamplified region will be observed as bands only in samples thatoriginally contained the r.·globin mRNA. In the case of hum·mingbird r.·globin, for instance, we might expect to see a bandappear at the stage when red blood. cells begin forming, with allsubsequent stages showing the same band. RT-PeR can also becarried out with mRNAs collected from different tissues at onetime to discover which tissue is producing a specific mRNA.

An alternative way to determine which tissues or cells areexpressing certain genes is to track down the location ofspe­cific mRNAs using labeled probes in place, or in situ, in the in-

Analyzing Gene Expression

DNA Sequencing

Studying the Expression of Single Genes

Suppose we want to find out how the expression ofthe r.·globingene changes during the embryonic development ofthe hum­mingbird. There are at least two ways to do this.

The first is called Northern blotting (a play on words basedon this method's similarity to Southern blotting). In thismethod, we carry out gel electrophoresis on samples ofmRNAfrom hummingbird embryos at different stages of develop­ment, transfer the samples to a nitrocellulose membrane, andthen allow the mRNAs on the membrane to hybridize with alabeled probe re<ognizing r.-globin mRNA. If we expose a filmto the membrane, the resulting image will look similar to theSouthern blot in Figure 20.11, with one band of a given sizeshowing up in each sample. Ifthe mRNA band is seen ata par­ticular stage, we can hypothesize that the protein functionsduring events taking place at that stage. Like Southern blotting,Northern blotting has been a mainstay over the years, but it isbeing supplanted in many labs by other techniques.

A method that is quicker and more sensitive (and thereforebecoming more widely used) is the reverse trar1scriptase­polymerase chain reaction, or RT-PCR (Figure 20.13). Analy­sis of hummingbird r.-globin gene expression with RT-PCR be-

Once a gene is cloned, its complete nucleotide sequence canbe determined. Today, sequencing is automated, carried out

by sequencing machines. The automated procedure is basedon a technique called the dideoxyribol1ucleotide (or dideoxy,for short) chain termination method, for reasons you can seein Figure 20.12. This method was developed by British bio­chemist Frederick Sanger, who received the Nobel Prize in1980 for this accomplishment. (One of only fOUT people to wintwo Nobel Prizes, Sanger also won one in 1975 for determin­ing the amino acid sequence of insulin.)

Knowing the sequence ofa gene allows researchers to com­pare it directly with genes in other species, where the functionof the gene product may be known. If two genes from differ­ent species are quite similar in sequence, it is reasonable tosuppose that their gene products perform similar functions. Inthis way, sequence comparisons provide clues to a gene's func­tion, a topic we'll return to shortly. Another set ofclues is pro­vided by experimental approaches that analyze when andwhere a gene is expressed.

Having cloned a given gene, researchers can make labelednucleic acid probes that will hybridize with mRNAs tran­scribed from the gene. The probes can provide informationabout when or where in the organism the gene is tran­scribed. Transcription levels are commonly used as a meas­ure of gene expression.

CHAPTER TWENTY Biotechnology 409

DNA Microarray Assay of Gene Expression Levels

DNA microarray

~

APPLICATION With this method. researchers can test thou­>ands of genes simultaneously to determine which ones are ex­pressed in a particular tissue. under different environmentalconditions, in various disease states, or at different developmentalstages. They can also look for coordinated gene expression.

DNA fragmentsrepresenting'P"ilI

~ Tissue sample

®~~~...--~

mRNA molecules

~

®~~~...--~

Labeled eDNA molecules(single strands)

f) Make cDNA byreverse tran­SCription. usingfluorescentlylabelednucleotides.

oApply the cDNA mixture toa mlCrO<lrray, a microscopeslide on which copies ofsingle-stranded DNA frag­ments from the organism'sgenes are fixed. adifferentgene in each spot. ThecDNA hybridizes with anycomplementary DNA onthe microarray

•• FI 20.15

TECHNIQUE

o Isolate mRNA.

OR;,,,, off """ ,DNA;"':4 ~ -;7mlcroarray for fluorescence. ,Each fluorescent spot co ,') ") , .",(yellow) represents a ~ ~ - ~ --gene expressed in the

tissue sample. • DNA microarrayWith 2,400human genes(adual size)

RESULTS The intensity of fluorescence at each spot is ameasure of the expression in the tissue sample of the gene repre­sented by that spot. Most often, as in the actual microarrayabove, two different samples are tested together by labeling thecDNAs prepared from each sample with labels of different colors.often green and red. The resulting color at aspot reveals the rela­tive levels of expression of a particular gene in the two samples:Green indicates expression in one sample. red in the other, yellowin both, and black in neither. (See Figure 20.f for a larger view.)

, ,{.~ } ~ j l 1'\'v ,\,' l '1 i ~" } l

1 I J. .~, • >---<50 jim

tact organism. This technique, called in situ hybridization, ismost often carried out with probes labeled by attachment offluorescent dyes (see Chapter 6). Different probes can be laobeled with different dyes, sometimes with strikingly beautifulresults (Figure 20.14),

... Figure 20.14 Determining where genes are expressedby in situ hybridization analysis. This Drosophila embryo wasincubated in a solution containing probes for fi~e different mRNAs,each probe labeled with a different fluorescently colored tag. Theembryo was then viewed using fluorescence microscopy, Each colormarks where a specific gene is expressed as mRNA,

Studying the Expression of Interacting Groups of Genes

A major goal ofbiologists is to learn how genes act together toproduce and maintain a functioning organism. Now that theentire genomes of a number of organisms have been se­quenced, it is possible to study the expression of large groupsof genes-a systems approach. Researchers use genome se­quences as probes to investigate which genes are transcribed indifferent situations, such as in different tissues or at differentstages ofdevelopment. They also look for groups ofgenes thatare expressed in a coordinated manner, with the aim of identi­fying networks ofgene expression across an entire genome.

The basic strategy in such global (genome-wide) expressionstudies is to isolate the mRNAs made in particular cells, usethese molecules as templates for making the correspondingcDNAs by reverse transcription, and then employ nucleic acidhybridization to compare this set ofcDNAs with a collection ofDNA fragments representing all or partofthe genome. The re­sults identify the subsetofgenes in the genome that are being ex­pressed at a given time or under certain conditions. DNAte<:hnology makes such studies possible; \\ith automation, theyare easily performed on a large scale. Scientists can now meas­ure the expression ofthousands ofgenes at one time.

Genome-wide expression shldies are made possible byDNA microarray assays. A DNA microarray consists of tinyamounts ofa large number ofsingle-stranded DNA fragmentsrepresenting different genes fixed to a glass slide in a tightlyspaced array, or grid (see Figure 20.1). (The microarray is alsocalled a DNA chip by analogy to a computer chip.) Ideally, thesefragments represent all the genes ofan organism. Figure 20.15outlines how the DNA fragments on a microarray are tested for

410 UNlllHRH Genetics

I. Suppose you carried out electrophoresis on a sample ofgenomic DNA isolated from an individual and treatedwith a restriction enzyme. After staining the gel with aDNA-binding dye, what would you see? Explain.

2. Describe the roles played by complementary basepairing between nucleic acid strands in each of thefollowing techniques: Southern blotting, DNA se­quencing, Northern blotting, RT-PCR, and micro­array analysis.

3. • ',Illf.iIl4 Look at the microarray in Figure 20.1,

which is a larger version of the one in Figure 20.15. If

one sample, labeled with a green fluorescent dye, wasfrom normal tissue, and the other, labeled red, was

from cancerous tissue, what does this mean for a spotthat is green? Red? Yellow? Black? Based on their ex­pression patterns, which genes would you be inter­ested in examining further if you were studyingcancer? Explain.

For suggested answers. see Appendix A

ger RNA or to block its translation. To date, the RNAi tech­nique has been used successfully to reduce eknock down") theexpression of specific genes in mammalian cells, including hu­man cells in culture, and plans are under way to try RNAi for

the treatment of certain human disorders, including macular

degeneration of the eye. In other organisms, such as the nem­atode and the fruit fly, RNAi has already proved valuable for an­alyzing the functions of genes on a large scale. In one study,RNAi was used to prevent expression of 86% of the genes inearly nematode embryos, one gene at a time. Analysis of thephenotypes of the worms that developed from these embryosallowed the researchers to classify most of the genes into asmall number ofgroups by function. This type ofgenome-wideanalysis of gene function is sure to become more common asresearch focuses on the importance of interactions betweengenes in the system as a whole-the basis of systems biology(see Chapter I).

The techniques and experimental approaches you havelearned about thus far have already taught us a great dealabout genes and the functions of their products. This DNAresearch is now being augmented by the development ofpowerful techniques for cloning whole multicellular organ­isms. An aim of this work is to obtain special types of cells,called stem cells, that give rise to all the different kinds of tis­sues. On a basic level, stem cells would allow scientists to usethe DNA methods previously discussed to study the processof cell differentiation. On a more applied level, recombinantDNA techniques could be used to alter stem cells for thetreatment ofdisease. Methods involving the cloning oforgan­isms and production of stem cells are the subject of the next

section.

hybridization with cDNA molecules that have been preparedfrom the mRNAs in particular cells ofinterest and labeled withfluorescent dyes.

Using this technique, researchers have performed DNA

microarray assays on more than 90% ofthe genes of the nem­

atode Caenorhabditis elegans, during every stage of its life cy­cle. The results show that expression of nearly 60% of thegenes changes dramatically during development and thatmany genes are expressed in a sex-specific pattern. This studysupports the model held by most developmental biologiststhat embryonic development involves a complex and elabo­rate program of gene expression, rather than simply the ex­pression of a small number of important genes. This exampleillustrates the ability of DNA microarrays to reveal generalprofiles of gene expression over the lifetime of an organism.

In addition to uncovering gene interactions and providingclues to gene function, DNA microarray assays may con­tribute to a better understanding of diseases and suggest new

diagnostic techniques or therapies. For instance, comparingpatterns ofgene expression in breast cancer tumors and non­cancerous breast tissue has already resulted in more informedand effective treatment protocols. Ultimately, informationfrom DNA microarray assays should provide a grander view ofhow ensembles of genes interact to form an organism andmaintain its vital systems.

Determining Gene Function

How do scientists determine the function of a gene identifiedby the techniques described thus far in the chapter? Perhaps

the most common approach is to disable the gene and thenobserve the consequences in the cell or organism. In one ap­plication of this approach, called in vitro mutagenesis, spe­cific mutations are introduced into a cloned gene, and thenthe mutated gene is returned to a cell in such a way that it dis­ables eknocks out") the normal cellular copies of the samegene. Ifthe introduced mutations alter or destroy the functionof the gene product, the phenotype of the mutant cell mayhelp reveal the function of the missing normal protein. Usingmolecular and genetic techniques worked out in the I980s, re­searchers can even generate mice with any given gene dis­abled, in order to study the role of that gene in developmentand in the adult. Mario Capecchi, Martin Evans, and Oliver

Smithies received the 2007 Nobel Prize in Medicine for firstaccomplishing this feat. Several projects currently underwayaim to disable everyone ofthe over 20,000 genes in the mousegenome. These ambitious efforts will enhance our under­standing of mammalian gene function.

A newer method for silencing expression of selected genesexploits the phenomenon of RNA interference (RNAi), de­scribed in Chapter 18. This experimental approach uses syn­thetic double-stranded RNA molecules matching the sequenceof a particular gene to trigger breakdown ofthe gene's messen-

CONCEPT CHECK 10.2

CHAPTH TWENTY Biotechnology 411

Plantlet wascultured onagar medium.later it wasplanted in soil.

Crosssection ofcarrot root

Embryonicplant developedfrom a culturedsingle cell.

Single cellsfrC€ insuspensionbegan todiVide.

. ··f

Fragments werecultured in nu­trient medium;stirring causedsingle cells toshear all Intothe liquid,

RESULTS

\ .(

::e 2-mgfragments

A singlesomatic (nonreproductive) carrotcell developed Into a maturecarrot plant The new plant wasagenetic duplicate (clone) of theparent plant.

20.1& •

Can a differentiated plant cell develop into awhole plant?

EXPERIMENT In 1958- F. C Steward and colleagues at Cor·nell University tested individual cells Irom a fully formed carrot fortheir ability to form a plant.

In parallel with advances in DNA technology, scientists havebeen developing and refining methods for cloning whole

multicellular organisms from single cells. In this context,cloning produces one or more organisms genetically identicalto the ~parent~ that donated the single ceiL This is often called

organismal clOllillg to differentiate it from gene doning and,more significantly, from cell cloning-the division of an asex­ually reproducing cell into a collection ofgenetically identicalcells. (The common theme for all types of doning is that theproduct is genetically identical to the parent. In fact, the wordclone comes from the Greek klon, meaning "twig.") The cur~

rent interest in organismal doning arises primarily from itspotential to generate stem cells, which can in turn generate

many different tissues.The cloning of plants and animals was first attempted over

so years ago in experiments designed to answer basic biologi­cal questions. For example, researchers wondered if all thecells of an organism have the same genes (a concept calledgenomic equivalence) or if cells lose genes during the processof differentiation (see Chapter 18). One way to answer thisquestion is to see whether a differentiated cell can generate awhole organism-in other words, whether doning an organ­ism is possible. Let's discuss these early experiments before weconsider more recent progress in organismal cloning and pro~

cedures for producing stem cells.

~.~:~~::o~:'~sms may lead toproduction of stem cells forresearch and other applications

SOURCE

Cloning Plants: Single-Cell Cultures

The successful cloning of whole plants from single differenti­ated cells was accomplished during the 19505 by F. C. Stewardand his students at Cornell University, who worked with car­rot plants (Figure 20.16). They found that differentiated cellstaken from the root (the carrot) and incubated in culture

medium could grow into normal adult plants, each geneticallyidentical to the parent plant. These results showed that differ­entiation does not necessarily involve irreversible changes inthe DNA. In plants, at least, mature cells can "dedifferentiate~

and then give rise to all the specialized cell types of the organ­ism. Any cell with this potential is said to be totipotent

Plant doning is now used extensively in agriculture. Forsome plants, such as orchids, doning is the only commerciallypractical means of reproducing plants. In other cases, cloninghas been used to reproduce a plant with valuable characteris­tics, such as the ability to resist a plant pathogen. In fact, you

yourself may be a plant cloner: If you have ever grown a newplant from a cutting, you have practiced cloning!

Adult plant

CONCLUSION At least some differentiated somatic cells inplants are totipotent, able to reverse their differentiation and thengive rise to all the cell types in a mature plant.

F. C, Stew~rd et ~I , Growth ~nd ofg~mzed developmentof cultured cells. II, Org~mz~tlon in cultures grown from suspended cells.Alll<'fic'dn Jootndl of Botany 45:705-708 (1958).

.'..MilIA If each individual cell had developed into only onetype of tissue instead 01 awhole plant. what might the re·searchers have concluded?

Cloning Animals: Nuclear Transplantation

Differentiated celts from animals generally do not divide inculture, much less develop into the multiple cell types ofa neworganism. Therefore, early researchers had to use a differentapproach to the question of whether differentiated animalcells can be totipotent. Their approach was to remove the

412 UNlllHRH Genetics

Frog tadpole

I

eMost stop developingbefore tadpole stage

In ui

j

Most developinto tadpoles

Frog embryo

• Fl~:ZO.17

Can the nucleus from a differentiated animalcell direct development of an organism?

When the transplanted nuclei came from an early embryo, whosecells are relatively undifferentiated. most of the recipient eggs de·veloped into tadpoles. But when the nuclei came from the fullydifferentiated intestinal cells of a tadpole, fewer than 2% of theeggs d~eloped into normal tadpoles, and most of the embryosstopped developing at a much earlier stage.

CONCLUSION The nucleus from adifferentiated frog cell candired d~elopment of a tadpole, However, its ability to do so de­creases as the donor cell becomes more differentiated, presum­ably because of changes in the nucleus.

SOURCE J,6 Gurdon et aI., The developmental C<lpilCity of nooeitransplanted from ker~lInlzed cells 01 adult frogs, joum~1 of fmbiyoJogy <IlldE~perim('f1MI Morp!lology 34:93-112 (1975)

I Fully differ-Less differ- entiatedentiated cell (intestinal) cell

Donor ./ "- Donornucleus Enucleated nucleustrans- egg cell trans-planted

J

planted

Egg with donor nucleus

1activated to begindevelopment

RESULTS

EXPERIMENT John Gurdon and colleagues at Oxford Univer·sity, in England, destroyed the nuclei of frog eggs by exposing theeggs to ultraviolet light. They then transplanted nuclei from cellsof frog embryos and tadpoles into the enucleated eggs,

viduals; this is known as reproductive cloning. We have alreadylearned a lot from such experiments. For example, cloned ani­mals of the same species do not always look or behave identi­cally. In a herd of cows cloned from the same line of culturedcells, certain cows are dominant in behavior and others are

_@UIlIl If each cell in a four·cell embryo was already so spe·ciallzed that It was not totipotent. what results would you predldfor the experiment on the left side of the figure?

nucleus of an unfertilized or fertilized egg and replace it withthe nucleus of a differentiated cell, a procedure called nucleartransplantation. If the nucleus from the differentiated donorcell retains its full genetic capability, then it should be able to

direct development of the recipient cell into all the tissues and

organs of an organism.Such experiments were conducted on frogs by Robert

Briggs and Thomas King in the I950s and by John Gurdon inthe 1970s. These researchers transplanted a nucleus from anembryonic or tadpole cell into an enucleated (nucleus-lacking)egg of the same species. In Gurdon's experiments, the trans­planted nucleus was often able to support normal develop­ment of the egg into a tadpole (Figure 20.17). However, hefound that the potential of a transplanted nucleus to directnormal development was inversely related to the age of thedonor: the older the donor nucleus, the lower the percentageof normally developing tadpoles.

From these results, Gurdon concluded that something inthe nucleus does change as animal cells differentiate. In frogsand most other animals, nuclear potential tends to be re­stricted more and more as embryonic development and celldifferentiation progress.

Reproductive Cloning of Mammals

In addition to cloning frogs, researchers have long been able toclone mammals using nuclei or cells from a variety of earlyembryos. But it was not known whether a nucleus from a fullydifferentiated cell could be reprogrammed to succeed in act­ing as a donor nucleus. In 1997, however, Scottish researchers

captured newspaper headlines when they announced thebirth of Dolly, a lamb cloned from an adult sheep by nucleartransplantation from a differentiated cell (Figure 20.18, on the

next page). These researchers achieved the necessary dediffer­entiation of donor nuclei by culturing mammary cells in nutri­ent-poor medium. They then fused these cells with enucleatedsheep eggs. The resulting diploid cells divided to form earlyembryos, which were implanted into surrogate mothers. Outofseveral hundred implanted embryos, one successfully com­pleted normal development, and Dolly was born.

Later analyses showed that Dolly's chromosomal DNA wasindeed identical to that of the nucleus donor. (Her mitochon­drial DNA came from the egg donor, as expected.) In 2003, at

age 6, Dolly suffered complications from a lung disease usuallyseen only in much older sheep and was euthanized. Dolly'spremature death, as well as her arthritic condition, led to spec­ulation that her cells were in some way not quite as healthy asthose of a normal sheep, possibly reflecting incomplete repro­gramming of the original transplanted nucleus.

Since 1997, researchers have cloned numerous other mam­mals, including mice, cats, cows, horses, mules, pigs, and dogs.In most cases, their goal has been the production of new indi-

CHAPTH TWENTY Biotechnology 413

more submissive. Another example of nonidentity in clones is

the first cloned cat, named CC for Carbon Copy (Figure 20,19).

She has a calico coat, like her single female parent, but the color

and pattern are different because ofrandom X chromosome in­

activation, which is a normal occurrence during embryonic de­

velopment (see Figure 15.8). And identical human tv.'ins, which

are naturally occurring "clones,n are always slightly different.

C1early, environmental influences and random phenomena can

playa significant role during development.

The successful doning of so many mammals has height­

ened speculation about the doning of humans. Scientists in

several labs around the world have tackled the first steps ofthis

feat. In the most common approach, nuclei from differenti­

ated human cells are transplanted into unfertilized enucleated

eggs, and the eggs are stimulated to divide. In 2001, a research

group in Massachusetts observed a few early cell divisions in

such an experiment. A few years later, South Korean re­

searchers reported cloning embryos to an early stage called the

blastocyst stage. This apparent success of human cloning

techniques raised unprecedented ethical issues, igniting a

heated debate. The later retraction of the Korean report has

bought us a little more time to consider such issues.

... Figure 20.19 CC, the first cloned cat, and her singleparent. Rainbow (left) donated the nucleus in a cloning procedurethat resulted in CC (right). However, the two cats are not identICal:Rambow IS a classic calico cat with orange patches on her fur and hasa "reserved personality," while CC has a gray and white coat and ismore playful,

Nucleusremoved

Surrogatemother

Nucleus frommammary cell

Egg celldonor

!o Embryonic

development

o Grown in culture ~

Early embryo

o Implanted in uterusof a third sheep

Egg cell

~"om 0"'0

Cultured {) Cellsfuse~mammary cellsare semistarved.arresting the cellcycle and causingdedifferentiation,

•• F 20.1.

Reproductive Cloning of a Mammal by NuclearTransplantation

APPLICATION This method is used to produce cloned animalswhose nuclear genes are identical to those of the animal supply­ing the nucleus.

TECHNIQUE Shown here is the procedure used to produceDolly, the first reported case of a mammal cloned using the nu·cleus of adifferentiated cell.

RESULTS

Mammarycell donor

lamb ("Dolly")genetically identical tomammary cell donor

The genetic makeup of the cloned animal is identical to that ofthe animal supplying the nucleus but differs from that of the eggdonor and surrogate mother, (The lalter two are "Scottish black­face" sheep, with dark faces,)

Problems Associated with Animal Cloning

In most nuclear transplantation studies thus far, only a small

percentage ofcloned embryos develop normally to birth. And

like Dolly, many doned animals exhibit defects. Cloned mice,

for instance, are prone to obesity, pneumonia, liver failure,

and premature death. Scientists assert that even cloned ani­

mals that appear normal are likely to have subtle defects.

414 UNlllHRH Genetics

I\~~

Adult stem cells

From bone marrowin this example

Cells that cangenerate allembryonic celltypes

Embryonic stem cells

Early human embryoat blastocyst stage

(mammalian equiva·lent of blastula)

Culturedstem cells

Differentcultureconditions

In recent years, we have begun to uncover some reasonsfor the low efficiency of cloning and the high incidence ofabnormalities. In the nuclei of fully differentiated cells, asmall subset of genes is turned on and expression of the rest

is repressed. This regulation often is the result of epigenetic

changes in chromatin, such as acetylation of histones ormethylation of DNA (see Figure 18.7). During the nucleartransfer procedure, many of these changes must be reversedin the later-stage nucleus from a donor animal for genes tobe expressed or repressed appropriately in early stages ofdevelopment. Researchers have found that the DNA in em­bryonic cells from cloned embryos, like that of differenti­ated cells, often has more methyl groups than does the DNAin equivalent cells from uncloned embryos of the samespecies. This finding suggests that the reprogramming ofdonor nuclei requires chromatin restructuring, which oc­curs incompletely during cloning procedures. Because DNAmethylation helps regulate gene expression, misplaced methyl

groups in the DNA of donor nuclei may interfere with the pat­tern of gene expression necessary for normal embryonic de­velopment. In fact, the success of a cloning attempt maydepend in large part on whether or not the chromatin struc­ture in the donor nucleus can be restored to that ofa newly fer­tilized egg.

... Figure 20.20 Working with stem cells. Animal stem cells.which can be isolated from early embryos or adult tissues and grown inculture. are self·perpetuatlng. relatively undifferentiated cellsEmbryonic stem cells are easier to grow than adult stem cells and cantheoretically give rise to all types of cells in an organism. The range ofcell types that can arise from adult stem cells is not yet fully undmtood.

searchers have reported finding stem cells in skin, hair, eyes,and dental pulp. Although adult animals have only tiny num­bers of stem cells, scientists are learning to identify and isolatethese cells from various tissues and, in some cases, to growthem in culture. \Vith the right culture conditions (for in­stance, the addition of specific growth factors), cultured stemcells from adult animals have been made to differentiate into

multiple types of specialized cells.Research with embryonic or adult stem cells is a source of

valuable data about differentiation and has enormous poten­tial for medical applications. The ultimate aim is to supplycells for the repair of damaged or diseased organs: for exam­ple, insulin-producing pancreatic cells for people withdiabetes or certain kinds ofbrain cells for people with Parkin­son's disease or Huntington's disease. Adult stem cells from

Blood cellsNerve cellsliver cellsDifferenttypes ofdifferentiatedcellsThe major goal of cloning human embryos is not reproduc­

tion, but the production of stem cells for treating human dis­

eases. A stem cell is a relatively unspecialized cell that canboth reproduce itself indefinitely and, under appropriate con­ditions, differentiate into specialized cells of one or moretypes. Thus, stem cells are able both to replenish their ownpopulation and to generate cells that travel down specific dif­ferentiation pathways.

Many early animal embryos contain stem cells capable ofgiving rise to differentiated embryonic cells of any type. Stemcells can be isolated from early embryos at a stage called theblastula stage or its human equivalent, the blastocyst stage(Figure 20.20). In culture, these embryonic stem (ES)ce/ls re­produce indefinitely; and depending on culture conditions,

they can be made to differentiate into a variety of specializedcells, including even eggs and sperm.

The adult body also has stem cells, which serve to replacenonreproducing specialized cells as needed. In contrast to EScells, adult stem cells are not able to give rise to all cell types inthe organism, though they can generate multiple types. For ex­ample, one ofthe several types ofstem cells in bone marrow cangenerate all the different kinds of blood cells (see Figure 20.20),and another can differentiate into bone, cartilage, fat, muscle,and the linings of blood vessels. To the surprise of many, theadult brain has been found to contain stem cells that continueto produce certain kinds of nerve cells there. And recently, re-

Stem Cells of Animals

CHAPTER TWENTY Biotechnology 415

CONCEPT CHECI(

bone marrow have long been used as a source of immune sys­tem cells in patients whose own immune systems are nonfunc­tional because of genetic disorders or radiation treatmentsfor cancer.

The developmental potential of adult stem cells is limited to

certain tissues. ES cells hold more promise than adult stem cellsfor medical applications because ES cells are pluripotent, capa·bleofdifferentiating into manydifferentceU types. The only wayto obtain ES cells thus far, however, has been to harvest them

from human embryos, which raises ethical and political issues.ES cells are currently obtained from embryos donated by

patients undergoing infertility treatment or from long-termcell cultures originally established with cells isolated fromdonated embryos. If scientists are able to done human em­bryos to the blastocyst stage, they might be able to use suchclones as the source of ES cells in the future. Furthermore,with a donor nucleus from a person with a particular dis­ease, they might be able to produce ES cells for treatment

that match the patient and are thus not rejected by his or herimmune system. \'V'hen the main aim ofcloning is to produceES cells to treat disease, the process is called therapeuticcloning. Although most people believe that reproductivecloning of humans is unethical, opinions vary about themorality of therapeutic doning.

Resolving the debate now seems less imperative due to re­cent reports that ES cells can be acquired by turning back theclock in fully differentiated adult cells. Accomplishing thisfeat, which posed formidable obstacles, was announced in2007, first by labs using mouse skin cells and then by othersusing human skin cells. In all cases, researchers transformedthe skin cells into ES cells by using retroviruses to introduceextra cloned copies offour "stem cell" master regulatory genes.AU tests carried out so far indicate that the transformed cells,which are known as induced pluripotent stem (iPS) cells, can

do everything ES cells can do. Fine-tuning of techniques todirect iPS cells to become specific cell types is an area of in­tense research that has already seen some success. These celltypes could eventually provide tailor-made "replacement"cells for patients without using any human eggs or embryos,thus circumventing most ethical objections.

20.3I. If you clone a carrot, will all the progeny plants

("clones") look identical? \'V'hy or why not?

2. Based on current knowledge, how would you ex­plain the difference in the percentage of tadpolesthat developed from the two kinds of donor nucleiin Figure 20.17?

3. -'W'UiM If you were a doctor who wanted to useiPS cells to treat a patient with severe diabetes, whatnew technique would have to be developed?

For suggested answers. see Appendi~ A.

416 UNIT THREE Genetics

r;~::~:t~~i~pplications of~NA technology affect our livesIn many ways

DNA technology is in the news almost every day. Most often,the topic is a new and promising application in medicine, butthis is just one of numerous fields benefiting from DNA tech­nology and genetic engineering.

Medical Applications

One important use of DNA technology is the identification ofhuman genes whose mutation plays a role in genetic diseases.These discoveries may lead to ways of diagnosing, treating,and even preventing such conditions. DNA technology is alsocontributing to our understanding of "nongenetic" diseases,from arthritis to AIDS, since a person's genes influence sus­ceptibility to these diseases. Furthermore, diseases of all sortsinvolve changes in gene expression within the affected cellsand often within the patient's immune system. By using DNA

microarray assays or other techniques to compare gene ex·pression in healthy and diseased tissues, as seen in Figure 20.1,

researchers hope to find many of the genes that are turned onor off in particular diseases. These genes and their productsare potential targets for prevention or therapy.

Diagnosis of Diseases

A new chapter in the diagnosis of infectious diseases has beenopened by DNA technology, in particular the use ofPCR and la­

beled nucleic acid probes to track down pathogens. For exam·pie, because the sequence ofthe RNA genome ofHIVis known,RT·PCR can be used to amplify, and thus detect, HIV RNA inblood or tissue samples (see Figure 20.13). RT-PCR is often thebest way to detect an otherwise elusive infective agent.

Medical scientists can now diagnose hundreds of humangenetic disorders by using peR with primers that target thegenes associated with these disorders. The amplified DNAproduct is then sequenced to reveal the presence or absence ofthe disease-causing mutation. Among the genes for humandiseases that have been identified are those for sickle-cell dis­ease, hemophilia, cystic fibrosis, Huntington's disease, and

Duchenne muscular dystrophy. Individuals afflicted with suchdiseases can often be identified before the onset of symptoms,even before birth. PCR can also be used to identify symptom·less carriers of potentially harmful recessive alleles, essentiallyreplacing Southern blotting for this purpose.

For some genetic disorders, medical scientists can detect anabnormal disease-causing allele by testing for genetic markersthat are known to be very close (linked) to the allele. A geneticmarker is a DNA sequence that varies in a population; in a gene,such sequence variation is the basis of different alleles. Just like

Cloned gene(,oem,1 .W.WWallele, r- -,absent \ Ifrom \ I 0 Insert RNA version of normal allele

, I into retrovirus.patient'scells)

... Figure 20.22 Gene therapy using a retroviral vector. Aretrovirus that has been rendered harmless is used as a vector in thisprocedure, which eKploits the ability of a retrovirus to insert a DNAtranscript of its RNA genome into the chromosomal DNA of its host cell(see Figure 198) If the foreign gene carried by the retroviral vector iseKpressed. the cell and its descendants Will possess the gene product.and the patient may be cured. Cells that reproduce throughout life,such as bone marrow cells, are ideal candidates for gene therapy.

o Viral DNA carrying the normalallele inserts into chromosome.

Viral RNA

f) Let retrovirus Infect bone marrow cellsthat have been removed from thepatient and cultured.

Bonemarrowcell frompatient

f

'cf--...

o Inject engineeredcells into patient.

Retroviruscapsid

Human Gene Therapy

Gene therapy-introducing genes into an afflicted individualfor therapeutic purposes-holds great potential for treating

disorders traceable to a single defective gene. In theory, a nor­mal allele of the defective gene could be inserted into the so­matic cells of the tissue affected by the disorder.

For gene therapy of somatic cells to be permanent, the cellsthat receive the normal allele must be ones that multiplythroughout the patient's life. Bone marrow cells, which include

the stem cells that give rise to all the cells of the blood and im­mune system, are prime candidates. Figure 20.22 outlines onepossible procedure for gene therapy of an individual whosebone marrow cells do not produce a vital enzyme because of asingle defective gene. One type of severe combined immuno­deficiency (SCID) is caused by just this kind of defect. If thetreatment is successful, the patient's bone marrow cells will be­gin producing the missing protein, and the patient will be cured.

INP

Normal alleleT

cDisease'causing

allele

... Figure 20.21 Single nucleotide polymorphisms (SNPs)as genetic markers for disease-causing alleles. This diagramdepicts homologous segments of DNA from a family in which somemembers have agenetic disease. In this family. unaffected familymembers have aT at a particular SNP locus. If a family member has a Cat that locus, there is a high probability that the individual has alsoinherited the disease-causing allele. (Here. only aSingle strand isshown for each DNA mole{Ule.)

DNA

coding sequences, noncoding DNA at a specific locus on a chro­mosome may exhibit small nucleotide differences among individ­uals. Variations in DNA sequence are called po/ymorphisms(from the Greek for "many formsn).

Among the most useful of these genetic markers are single

base-pair variations in the genomes of the human population.A single base-pair site where variation is found in at least 1% ofthe population is called a single nucleotide polymorphism(SNP, pronounced "snipn). SNPs occur on average about once

in 100 to 300 base pairs in the human genome and are foundin both coding and noncoding DNA sequences. (About 99%of our genome doesn't code for protein, as you will learn inChapter 21.)

Some SNPs alter the sequence recognized by a restrictionenzyme, as is the case for the single-nucleotide difference be­tween the alleles for normal and sickle-cell ~-globin. Such al­terations change the lengths of the restriction fragmentsformed by digestion with that enzyme (see Figure 20.10). This

type of sequence change, which can occur in either coding ornoncoding regions, is called a restriction fragment lengthpolymorphism (RFLP, pronounced "Rif_lipn). Scientists fig­

ured out how to use Southern blotting to detect RFLPs almost30 years ago, realizing that RFLPs could serve as useful geneticmarkers. It is not necessary to acrually sequence the DNA ofmultiple individuals to find SNPSi today they can be detectedby very sensitive microarray analysis or by PCR.

But how can RFLPs or other SNPs help LIS diagnose a geneticdisorder? The presence ofan abnormal allele can be diagnosedwith reasonable accuracy if a closely linked SNP marker hasbeen found (Figure 20.21). Alleles for Huntington's diseaseand a number of other genetic diseases were first detected by

means of RFLPs in this indirect way. If the marker and thegene itselfare close enough, crossing over between the markerand the gene is very unlikely during gamete formation. There­fore, the marker and gene will almost always be inherited to­gether, even though the marker is not part of the gene. Thesame principle applies to all kinds of markers.

CHAPTER TWENTY Biotechnology 417

The procedure shown in Figure 20.22 has been used in gene

therapy trials for scm. In a trial begun in France in 2000, ten

young children with SCiD were treated by the same proce­

dure. Nine of these patients showed significant, definitive im­

provement after m·o years, the first indisputable success of

gene therapy. However, three of the patients subsequently de­

veloped leukemia, a type of blood cell cancer, and one of them

died. Researchers discovered that in rn'o cases, the retroviral

vector used to carry the normal allele into bone marrow cells

had inserted near a gene involved in the proliferation and de­

velopment of blood cells, which could have led to the

leukemia. In a recent experiment on mice, a replacement of

the mouse version of the same gene led to a high incidence of

lymphoma, also a blood cancer. These results suggest that an

unknown function of the gene itself may be responsible.

Gene therapy also raises several other technical questions.

For example, how can the activity of the transferred gene be

controlled so that cells make appropriate amounts of the gene

product at the right time and in the right place? How can we

be sure that the insertion of the therapeutic gene does not

harm some other necessary cell function? As more is learned

about DNA control elements and gene interactions, re­

searchers may be able to answer such questions.

In addition to technical challenges, gene therapy raises eth­

ical questions. Some critics believe that tampering with hu­

man genes in any way is immoral. Other observers see no

fundamental difference between the transplantation of genes

into somatic cells and the transplantation of organs.

Treatment of human germ-line cells in the hope of correct­

ing a defect in future generations raises further ethical issues.

Such genetic engineering is routinely done in laboratory mice,

and the technical problems relating to similar genetic engi­

neering in humans will eventually be solved. Under what cir­

cumstances, if any, should we alter the genomes of human

germ lines? Would this inevitably lead to the practice of

eugenics, a deliberate effort to control the genetic makeup

of human populations? From a biological perspective, the

elimination of unwanted alleles from the gene pool could

backfire. Genetic variation is a necessary ingredient for the

survival of a species as environmental conditions change with

time. Alleles that are damaging under some conditions may be

advantageous under other conditions (one example is the

sickle-cell allele, discussed in Chapter 14). Are we willing to

risk making genetic changes that could be detrimental to the

survival of our species in the future? We may have to face this

question soon.

Pharmaceutical Products

The pharmaceutical industry derives significant benefit from

advances in DNA technology and genetic research, applying

them to the development of useful drugs to treat diseases.

Pharmaceutical products are synthesized using methods of ei-

418 UNlllHRH Genetics

ther organic chemistry or biotechnology, depending on the

nature of the product.

Synthesis of Small Molecules for Use as Drugs An excit­

ing recent development has been the synthesis of small mole­

cules that are tailored to combat certain cancers by blocking thefunction of a protein crucial for the tumor cells' survival. One

drug, imatinib (trade name Gleevec), is asmall molecule that in­

hibits a specific receptor tyrosine kinase (see Figure 11.7). The

overexpression of this receptor, resulting from a chromoso­

mal translocation, is instrumental in causing chronic myel­

ogenous leukemia (CML; see Figure 15.17). Patients in the

early stages of CML who are treated with imatinib have ex­

hibited nearly complete, sustained remission from the cancer.

Drugs that work like this have also been used with success to

treat a few types of lung and breast cancers. This approach is

feasible only for cancers for which the molecular basis is fairly

well understood.

Pharmaceutical products that are proteins can be synthe­

sized on a large scale, using cells or whole organisms. Cell cul­

tures are more widely used at present.

Protein Production in Cell Cultures You learned earlier in

the chapter about DNA cloning and gene expression systems

for producing large quantities of proteins that are present nat­

urally in only minute amounts. The host cells used in such ex­

pression systems can even be engineered to secrete a protein

as it is made, thereby simplifying the task of purifying it by tra­

ditional biochemical methods.

Among the first pharmaceutical products "manufactured"

in this way were human insulin and human growth hormone

(HGH). Some 2 million people with diabetes in the United

States depend on insulin treatment to control their disease.

Human growth hormone has been a boon to children born

with a form of dwarfism caused by inadequate amounts of

HGH. Another important pharmaceutical product pro­

duced by genetic engineering is tissue plasminogen activator

(TPA). If administered shortly after a heart attack, TPA

helps dissolve blood clots and reduces the risk of subsequent

heart attacks.

Cells in culture can also be used to produce vaccines, which

stimulate the immune system to defend the body against spe­

cific pathogens (see Chapter 43). A pathogen typically has one

or more proteins on its surface that trigger an immune re­

sponse against it. This type of protein, made by recombinant

DNA techniques, can function asa vaccine against the pathogen.

Alternatively, genetic engineering can be used to modify a

pathogen's genome, resulting in a weakened pathogen that canthen serve as a "live" vaccine.

Protein Production by "Pharm" Animals and Plants In

some cases, instead of using cell systems in vitro to produce

large quantities of protein products, pharmaceutical scientists

can use whole animals. Their techniques are those we alludedto when we discussed the possibility ofgenetically engineeringhuman germ-line cells, but they are performed on animalsother than humans. Using these methods, scientists can intro­

duce a gene from an animal of one genotype into the genomeofanother individual, often ofa different species. This individ­

ual is then called a transgenic animal. To do this, they first re­move eggs from a female of the recipient species and fertilizethem in vitro. Meanwhile, they have cloned the desired genefrom the donor organism. They then inject the cloned DNAdirectly into the nuclei of the fertilized eggs. Some of the cellsintegrate the foreign DNA, the transgene, into their genomesand are able to express the foreign gene. The engineered em­bryos are then surgically implanted in a surrogate mother. Ifanembryo develops successfully, the result is a transgenic animal,containing a gene from a third "parent;' which may be ofa dif­ferent species.

Assuming that the introduced gene encodes a protein de­

sired in large quantities, these transgenic animals can act aspharmaceutical "factories~ For example, a transgene for a hu­

man blood protein such as antithrombin can be inserted intothe genome of a goat in such a way that the transgene's prod­uct is secreted in the animal's milk (Figure 20.23). The pro­

tein can then be purified from the milk, usually more easilythan from a cell culture. Researchers have also engineeredtransgenic chickens that express large amounts of the trans­gene's product in eggs. Biotechnology companies consider thecharacteristics of candidate animals in deciding which to usefor engineering. For example, goats reproduce faster thancows, and it is possible to harvest more protein from goat milk

than from the milk of other rapidly reproducing mammals,such as rabbits.

Human proteins produced in transgenic farm animals foruse in humans may differ in some ways from the naturally pro­duced human proteins, possibly because of subtle differencesin protein modification. Therefore, such proteins must be

.. Figure 20.23 Goats as "pharm" animals. This transgenicgoat carries a gene for a human blood protein. antithrombin, whichshe se<;retes in her milk. Patients with a rare hereditary disorder inwhich this protein is lacking suffer from formation of blood clots intheir blood vessels. Easily purified from the goat's milk, the protein iscurrently under evaluation as an anticlotting agent.

tested very carefully to ensure that they (or contaminants fromthe farm animals) will not cause allergic reactions or other ad­verse effects in patients who receive them.

In a novel twist, the pharmaceutical industry is beginning

to develop "pharm~ plants, analogous to "pharm~animals. Al­

though natural plants have long been sources of drugs, re­searchers are now creating plants that make human proteinsfor medical use and viral proteins for use as vaccines. In 2007,the U.S. Food and Drug Administration (FDA) approved aplan to plant over 3,000 acres in Kansas with rice harboringgenes for milk proteins. The harvested proteins would be usedin rehydration formulas to treat infant diarrhea, a seriousproblem in developing countries.

Forensic Evidence and Genetic Profiles

In violent crimes, body fluids or small pieces of tissue may beleft at the scene or on the clothes or other possessions of thevictim or assailant. If enough blood, semen, or tissue is avail­

able, forensic laboratories can determine the blood type or tis­sue type by using antibodies to detect specific cell-surfaceproteins. However, such tests require fairly fresh samples inrelatively large amounts. Also, because many people have thesame blood or tissue type, this approach can only exclude asuspect; it cannot provide strong evidence of guilt.

DNA testing, on the other hand, can identify the guilty in­dividual with a high degree of certainty, because the DNA se­quence of every person is unique (except for identical twins).Genetic markers that vary in the population can be analyzedfor a given person to determine that individual's unique set of

genetic markers, or genetic profile. (This term is preferredover "DNA fingerprint" by forensic scientists, who want to

emphasize the heritable aspect of these markers rather thansimply the fact that they produce a pattern on a gel that, like afingerprint, is visually recognizable.) TIle FBI started applyingDNA technology in forensics in 1988, using RFLP analysis bySouthern blotting to detect similarities and differences inDNA samples. This method required much smaller samples ofblood or tissue than earlier methods-only about 1,000 cells.

Today, forensic scientists use an even more sensitive methodthat takes advantage of variations in length of genetic markerscalled short tandem repeats (STRs). These are tandemly re­peated units of2- to 5-base sequences in specific regions of the

genome. The number of repeats present in these regions ishighly variable from person to person (polymorphic). For ex­ample, one individual may have the sequence ACAT repeated30 times at one genome locus, whereas another individual mayhave 18 repeats at this locus. PCR is used to amplify particularSTRs, using sets of primers that are labeled with different­colored fluorescent tags; the length of the region, and thus thenumber of repeats, can then be determined by electrophoresis.Because Southern blotting is not required, this method isquicker than RFLP analysis. And the peR step allows use ofthe

CHAPTER TWENTY Biotechnology 419

method even when the DNA is in poor condition or availableonly in minute quantities. A tissue sample containing as few as20 cells can be sufficient for peR amplification.

In a murder case, for example, this method can be used tocompare DNA samples from the suspect, the victim, and asmall amount of blood found at the crime scene. The forensicscientist tests only a few selected portions ofthe DNA-usually13 STR markers. However, even this small set of markers canprovide a forensically useful genetic profile because the prob­ability that two people (who are not identical twins) wouldhave exactly the same set ofSTR markers is vanishingly small.The Innocence Project, a nonprofit organization dedicated tooverturning wrongful convictions, uses STR analysis ofarchived samples from crime scenes to revisit old cases. As of2006, 18 innocent people had been released from prison as aresult of forensic and legal work by this group (Figure 20.24).

Genetic profiles can also be useful for other purposes. Acomparison of the DNA of a mother, her child, and the pur­ported father can conclusively settle a question of paternity.Sometimes paternity is of historical interest: Genetic profiles

(a) In 1984, Earl washington wasconvicted and sentenced todeath for the 1982 rape andmurder of Rebecca Williams.His sentence was commutedto life in prison in 1993 dueto new doubts about theeVIdence In 2000. STR analysisby forensic scientists associ­ated with The InnocenceProject showed conclusivelythat he was innocent. Thisphoto shows Washington justbefore his release in 2001,after 17 years in prison.

Source of STR STR STRsample marker 1 marker 2 marker 3

Semen on victim 17, 19 13, 16 12, 12

Earl washington 16, 18 14, IS 11, 12

Kenneth Tinsley 17, 19 13, 16 12, 12

(b) In STR analysis, selected STR markers in a DNA sample are amplifiedby PCR, and the peR products are separated by electrophoresisThe procedure reveals how many repeats are present for each STRlocus in the sample. An individual has two alleles per STR locus,each with acertain number of repeats. This table shows the num­ber of repeats for three STR markers in three samples: from semenfound on the victim, from Washington, and from another mannamed Kenneth Tinsley, who was in prison because of an unrelatedconviction. These and other STR data (not shown) exoneratedWashington and led Tinsley to plead guilty to the murder.

... Figure 20.24 STR analysis used to release an innocentman from prison.

420 UNIT THREE Genetics

provided strong evidence that Thomas Jefferson or one of hisclose male relatives fathered at least one of the children of hisslave Sally Hemings. Genetic profiles can also identify victimsof mass casualties. The largest such effort occurred after theattack on the World Trade Center in 2001; more than 10,000samples of victims' remains were compared with DNA sam­ples from personal items, such as toothbrushes, provided byfamilies. Ultimately, forensic scientists succeeded in identify­ing almost 3,000 victims using these methods.

Just how reliable is a genetic profile? The greater the num­ber of markers examined in a DNA sample, the more likely itis that the profile is unique to one individual. In forensic casesusing STR analysis with 13 markers, the probability of twopeople having identical DNA profiles is somewhere betweenone chance in 10 billion and one in several trillion. (For com­parison, the world's population in 2007 was about 6.6 billion.)The exact probability depends on the frequency of thosemarkers in the general population. Information on how com­mon various markers are in different ethnic groups is criticalbecause these marker frequencies may vary considerablyamong ethnic groups and between a particular ethnic groupand the population as a whole. \Vith the increasing availabilityof frequency data, forensic scientists can make extremely ac­curate statistical calculations. Thus, despite problems that canstill arise from insufficient data, human error, or flawed evi­dence, genetic profiles are now accepted as compelling evi­dence by legal experts and scientists alike.

Environmental Cleanup

Increasingly, the remarkable ability ofcertain microorganisms totransfonn chemicals is being exploited for environmentalcleanup. Ifthe growth needs ofsuch microbes make them unsuit­able for direct use, scientists can now transfer the genes for theirvaluable metabolic capabilities into other microorganisms, whichcan then be used to treat environmental problems. For example,many bacteria can extract heavy metals, such as copper, lead, andnickel, from their environments and incorporate the metals intocompoundssuch as coppersulfateor lead sulfate, which are read·ily recoverable. Genetically engineered microbes may bewmeimportant in both mining minerals (especially as ore reserves aredepleted) and cleaning up highly toxic mining wastes. Biotech­nologists are also trying to engineer microbes that can degradechlorinated hydrocarbons and other harmful compounds. Thesemicrobes could be used in wastev.oater treatment plants or bymanufacturers before the compounds are ever released into theenvironment.

In a more "old-fashioned" application of biotechnology,biofuels from crops such as corn, soybeans, and cassava havebeen proposed as asupplementoreven replacement for fossil fu­els. In this case, no genetic engineering is involved. To produce"bioethanoI;' the starch made naturally by the plants is simplyconverted to sugar and then fermented by microorganisms; a

TDNA:'i

Agrobaeterium tumefaciens

Tiplasmid

Plant withnew trait

DNA withthe geneofmterest

RecombinantTi plasmid

Site whererestriction _~€genzyme culS

TECHNIQUE

•

€) Recombinant plasmids can beintroduced into cultured plantcells by electroporation. Orplasmids can be returned toAgrobaaerium, which is thenapplied as a liquid suspensionto the leaves of susceptibleplants, infl"{ting them. Once aplasmid is taken into a plantcell, its TDNA integrates intothe cell's chromosomal DNA.

't' ~:ZD.25

Using the Ti Plasmid to Produce TransgenicPlants

APPLICATION Genes conferring useful traits. such as pest re-sistance. herbicide resistance. delayed ripening. and increasednutritional value, can be transferred from one plant variety orspecies to another using the Ti plasmid as avector,

RESULTS Transformedcells carrying the transgene of in­terest can regenerate completeplants that exhibit the new traitconferred by the transgene,

8 The foreign gene of interestis inserted into the middle ofthe TDNA using methodsshown in Figure 20.4

o The Ti plasmid is isolated fromthe bacterium AgrobaaeriumfUmefaciens The segment ofthe plasmid that integrates intothe genome of host celis iscalled TDNA.

duce recombinant Ii plasmids into plant cells by electropora­tion. Alternatively, the recombinant plasmid can be put backinto Agrobacteriumi susceptible plants or plant cells growingin culture are then infected with bacteria that contain the re­combinant plasmid.

Scientists are working to learn more about the genomes ofagriculturally important plants and animals. For a number of

years, they have been using DNA technology in an effort toimprove agricultural productivity.

Agricultural Applications

Genetic Engineering in Plants

Agricultural scientists have already endowed a number ofcropplants with genes for desirable traits, such as delayed ripeningand resistance to spoilage and disease. In one striking way,plants are easier to genetically engineer than most animals. Formany plant species, a single tissue cell grown in culture cangive rise to an adult plant (see Figure 20.16). Thus, genetic ma­nipulations can be performed on an ordinary somatic cell andthe cell then used to generate an organism with new traits.

The most commonly used vector for introducing newgenes into plant cells is a plasmid, called the 1i plasmid, fromthe soil bacterium Agrobacterium tumefaciens. This plasmidintegrates a segment of its DNA, known as T DNA, into thechromosomal DNA ofits host plant cells. Forvector purposes,researchers work with versions of the plasmid that do notcause disease (unlike the wild-type version) and that havebeen engineered to carry genes of interest within the bordersofthe T DNA. Figure 20.25 outlines one method for using theTI plasmid to produce transgenic plants. Scientists can intro-

Animal Husbandry

similar process can produce "biodiesel" from plant oils. Eitherproduct can be mixed with gasoline or used alone to power ve­hicles. Proponents say these fuels have less impact on the envi­ronment than fossil fuels, but others disagree, asserting that the

environmental effects of growing these crops make their total

impact greater than that of fossil fuels.

The selective breeding of livestock, or animal husbandry, hasexploited naturally occurring mutations and genetic recombi­nation for centuries. As we described earlier, DNA technologyenables scientists to produce transgenic animals, whichspeeds up the selective breeding process. The goals of creat­ing a transgenic animal are often the same as the goals of tra­ditional breeding-for instance, to make a sheep with betterquality wool, a pig with leaner meat, or a cow that will maturein a shorter time. Scientists might, for example, identify andclone a gene that causes the development of larger muscles(muscles make up most of the meat we eat) in one breed of

cattle and transfer it to other cattle or even to sheep.However, problems such as low fertility or increased sus­

ceptibility to disease are not uncommon among farm animalscarrying genes from humans and other foreign species. Ani­mal health and welfare are important issues to consider whendeveloping transgenic animals.

CHAPTH TWENTY Biotechnology 421

Genetic engineering is rapidly replacing traditional plant­breeding programs, especially for useful traits, such as herbi­cide or pest resistance, determined by one or a few genes.Crops engineered with a bacterial gene making the plants re­

sistant to herbicides can grow while weeds are destroyed, and

genetically engineered crops that can resist destructive insectsreduce the need for chemical insecticides. In India, the inser­

tion ofa salinity resistance gene from a coastal mangrove plantinto the genomes of several rice varieties has resulted in riceplants that can grow in water three times as salty as seawater.The research foundation that carried out this feat of geneticengineering estimates that one-third of all irrigated land hashigh salinity owing to overirrigation and intensive use ofchemical fertilizers, representing a serious threat to the foodsupply. Thus, salinity-resistant crop plants would be enor­mously valuable worldwide.

Genetic engineering also has great potential for improvingthe nutritional value of crop plants. For instance, scientists

have developed transgenic rice plants that produce yellow ricegrains containing beta-carotene, which our body uses to makevitamin A (see Figure 38.18). This ~goldenH rice could help

prevent vitamin A deficiency in the half of the world's popula­tion that depends on rice as a staple food. Currently, largenumbers ofyoung children in Southeast Asia suffer from vita­min A deficiency, which leads to vision impairment and in­creases susceptibility to disease.

Safety and Ethical Questions Raisedby DNA Technology

Early concerns about potential dangers associated with recom­binant DNA technology focused on the possibility that haz­ardous new pathogens might be created. What might happen,for instance, if cancer cell genes were transferred into bacteriaorviruses? To guard against such rogue microbes, scientists de­veloped a set ofguidelines that were adopted as formal govern­ment regulations in the United Statesand some othercountries.One safety measure is a set of strict laboratory procedures de­signed to protect researchers from infe<tion by engineered mi­crobes and to prevent the microbes from accidentally leavingthe laboratory. In addition, strains of microorganisms to be used

in recombinant DNA experiments are genetically crippled toensure that they cannot survive outside the laboratory. Finally,certain obviously dangerous experiments have been banned.

Today, most public concern about possible hazards centersnot on recombinant microbes but on genetically modified(GM) organisms used as food. In common language, a GM or­ganism is one that has acquired by artificial means one or moregenes from another species or even from another variety of thesame species. Some salmon, for example, have been geneticallymodified by addition ofa more active salmon growth hormonegene. However, the majority of the GM organisms that con­tribute to our food supply are not animals, but crop plants.

422 UNIT THREE Genetics

GM crops are widespread in the United States, Argentina,and Brazil; together these countries account for over 8()<}6 oftheworld's acreage devoted to such crops. In the United States, the

majority of corn, soybeans, and canola are GM crops, and GM

products are not required to be labeled. However, the samefoods are an ongoing subject of controversy in Europe, wherethe GM revolution has met with strong opposition. Many Eu­ropeans are concerned about the safety of GM foods and thepossible environmental consequences of growing GM plants.Early in 2000, negotiators from 130 countries (including theUnited States) agreed on a Biosafety Protocol that requires ex­porters to identify GM organisms present in bulk food ship­ments and allows importing countries to decide whether theproducts pose environmental or health risks. Since then, Euro­pean countries have, on occasion, refused crops from theUnited States and other countries, leading to trade disputes.

Although a small number of GM crops have been grown onEuropean soil, these products have generally failed in localmarkets, and the future of GM crops in Europe is uncertain.

Advocates of a cautious approach toward GM crops fearthat transgenic plants might pass their new genes to close rel­atives in nearby wild areas. We know that lawn and cropgrasses, for example, commonly exchange genes with wild rel­atives via pollen transfer. If crop plants carrying genes for re­sistance to herbicides, diseases, or insect pests pollinated wildones, the offspring might become "super weedsHthat are verydifficult to control. Another possible hazard, suggested by onelaboratory-based study, is that a transgene encoding a pesticide­

like protein might cause plants to produce pollen toxic to but­terflies. However, scientists with the Agricultural Research

Service concluded from a two-year field study that butterflieswere unlikely to be exposed to toxic levels of pollen.

As for the risks to human health from GM foods, some

people fear that the protein products of transgenes might leadto allergic reactions. Although there is some evidence that thiscould happen, advocates claim that these proteins could betested in advance to avoid producing ones that cause allergicreactions.

Today, governments and regulatory agencies throughoutthe world are grappling with how to facilitate the use ofbiotechnology in agriculture, industry, and medicine while en­suring that new products and procedures are safe. In the

United States, such applications ofbiotechnology are evaluatedfor potential risks by various regulatory agencies, including theFDA, the Environmental Protection Agency, the National In­stitutes of Health, and the Department of Agriculture. Mean­while, these same agencies and the public must consider theethical implications of biotechnology.

Advances in biotechnology have allowed us to obtain com­plete genome sequences for humans and many other species,providing a vast treasure trove of information about genes. Wecan ask how certain genes differ from species to species, as wellas how genes and, ultimately, entire genomes have evolved.

For suggested answers, see AppendiK A.

I. What is the advantage of using stem cells for genetherapy?

2, List at least three different properties that have beenacquired by crop plants via genetic engineering.

3. _',11$111" As a physician, you have a patient withsymptoms that suggest a hepatitis A infection. Thesymptoms come and go, but you have not been ableto detect viral proteins in the blood. Knowing thathepatitis A is an RNA virus, what lab tests could youperform to support your diagnosis? Explain what theresults would mean.

(These are the subjects of Chapter 21.) At the same time, theincreasing speed and falling cost of determining the genomesequencesofindividuals are raising significantethical questions.Who should have the right to examine someone else's geneticinformation? How should that information be used? Should aperson's genome be a factor in determining eligibility for a jobor insurance? Ethical considerations, as well as concerns aboutpotential environmental and health hazards, will likely slowsome applications of biotechnology. There is always a dangerthat too much regulation will stifle basic research and its po­tential benefits. However, the power of DNA technology andgenetic engineering-our ability to profoundly and rapidly al­ter species that have been evolving for millennia-demandsthat we proceed with humility and caution.

CONCEPT CHECK 20.4

-W"'''. Go to the Study Area at www.masteringbio.comforBioFlix3·0 Animations, MP3 Tutors, Videos. Practice Tests. an eBook, and more.

Recombinant plasm ids are returned to host cells, each ofwhich divides to form a clone of cells. Collections of clonesare stored as libraries.

Recombin~nt DNA pl~smids

SUMMARY OF KEY CONCEPTS

_"Iilil'_ 20.2

Acth'ily Applications of DNA Technology

Acth'ity Restriction En~ymes

Acthily Goning a Gene in Bacteria

In'',,,,ligation Howean Antibiotic-Resi'tant Pla,mid. Transform £. (:(lin

DNA technology allows us to study the sequence,expression, and function of a gene (pp. 405-411)

.. Gel Electrophoresis and Southern Blotting DNA restric­tion fragments of different lengths can be separated by gelelectrophoresis. Specific fragments can be identified by South­ern blotting, using labeled probes that hybridize to the DNAimmobilized on a "blot" of the gel.

.. DNA Sequencing Relatively short DNA fragments can besequenced by the dideoxy chain termination method, whichcan be performed in automated sequencing machines.

.. Analyzing Gene Expression Expression of a gene can be in­vestigated using hybridization with labeled probes to look forspecific mRNAs, either on a gel (Northern blotting) or in awhole organism (in situ hybridization). Also, RNA can be tran­scribed into eDNA by reverse transcriptase and the eDNA am­plified with specific primers (RT-PCR). Microarrays allowresearchers to compare the expression of many genes at once indifferent tissues, at different times, or under different conditions.

.. Expressing Cloned Eukaryotic Genes Several technical dif­ficulties hinder the expression of cloned eukaryotic genes inbacterial host cells. The use of cultured eukaryotic cells ashost cells and yeast artificial chromosomes (YACs) as vectorshelps avoid these problems.

.. Amplifying DNA in Vitro: The Polymerase Chain Reac­tion (PCR) PCR can produce many copies of a specific targetsegment of DNA, using primers that bracket the desired se­quence and a heat-resistant DNA polymerase.

oo

_',Ii'''''_ 20.1

Cut by same rest"alOn ~nzyme,

mi~d. ~nd li9~ted

DNA cloning yields multiple copies of a gene or otherDNA segment (pp. 396-405)

.. DNA Cloning and Its Applications: A Prcvicw DNAcloning and other techniques, collectively termed DNA tech·nology, can be used to manipulate and analyze DNA and toproduce useful new products and organisms.

.. Using Restriction Enzymes to Make Recombinant DNABacterial restriction enzymes cut DNA molecules withinshort, specific nucleotide sequences to yield a set of double­stranded DNA fragments with single-stranded sticky ends.The sticky ends on fragments from one DNA source can base­pair with complementary sticky ends on fragments from otherDNA molecules; sealing of the base-paired fragments withDNA ligase produces recombinant DNA molecules.

.. Cloning a Eukaryotic Gene in a Bacterial Plasmid

C :\ DNA fragments from (je'lOOl1C DNAVector ~ or eDNA or copy of DNA obl~lrled

'Q by PeR

Y

CHAPTH TWENTY Biotechnology 423

.. Determining Gene Function For a gene of unknown func­tion, experimental inactivation of the gene and observationof the resulting phenotypic effects can provide clues to itsfunction.

Acti\ity Gel EIe<:lrophore~is orONA

Activity Analyzing DNA Fragments U~ing Gel Elcclrophore;;is

Inn.ligation How Can Gel Electrophoresis Be Used 10 Analyze DNA?

.',Ii'''''. 20.3Cloning organisms may lead to production of stemcells for research and other applications (pp. 412-416).. Studies showing genomic equivalence (that an organism's cells

have the same genome) were the first examples of organismalcloning.

.. Cloning Plants: Single-Cell Cultures Differentiated cellsfrom mature plants are often capable of generating a completenew plant.

.. Cloning Animals: Nuclear Transplantation The nucleusfrom a differentiated animal cell can sometimes give rise to anew animal if transplanted to an enucleated egg.

.. Stem Cells of Animals Certain stem cells from animal em­bryos or adult tissues can reproduce and differentiate in vitroas well as in vivo, offering the potential for medical use.

....II.i"· 20.4The practical applications of DNA technology affectour lives in many ways (pp. 416-423).. Medical Applications DNA technology is increasingly be­

ing used in the diagnosis of genetic and other diseases andoffers potential for better treatment of genetic disorders oreven permanent cures. Single nucleotide polymorphisms(SNPs) and restriction fragment length polymorphisms(RFLPs) are useful as genetic markers linked to disease­causing alleles. Large-scale production of protein hormonesand other proteins with therapeutic uses. including safervaccines. is possible with DNA technology. Some therapeu­tic proteins are being produced in transgenic "pharm" ani·mals and plants.

.. Forensic Evidence and Genetic Profiles Analysis of ge­netic markers such as short tandem repeats (STRs) in DNAisolated from tissue or body fluids found at crime scenes canprovide definitive evidence that a suspect is guilty or inno­cent. Such analysis is also useful in parenthood disputes andin identifying the remains of crime victims.

.. Environmental Cleanup Genetically engineered microor­ganisms can be used to extract minerals from the environmentor degrade various types of potentially toxic waste materials.

.. Agricultural Applications The aim of developing transgeniCplants and animals is to improve agricultural productivity andfood quality.

.. Safety and Ethical Questions Raised by DNA TechnologyThe potential benefits of genetic engineering must be care­fully weighed against the potential hazards of creating prod­ucts or developing procedures that are harmful to humans orthe environment.

-&I4,Jt.-Activity DNA Fingerprinting

Activity Making Decisions About DNA TechnologY' Golden Rice

Activity The Human Genome Proje<:l: Gene, on Human Chromosome 17

424 UNlr rHREE Genetics

TESTING YOUR KNOWLEDGE

SELF·QUIZ

I. Which of the following tools of recombinant DNA technologyis incorrectly paired with its use?

a. restriction enzyme-production ofRFLPs

b. DNA ligase-enzyme that cuts DNA, creating the sticky

ends of restriction fragmentsc. DNA polymerase-used in a polymerase chain reaction to

amplify sections of DNAd. reverse transcriptase-production of cDNA from mRNA

e. electrophoresis-separation of DNA fragments

2. Which of the fonowing would not be true of cDNA produced

using human brain tissue as the starting material?

a. It could be amplified by the polymerase chain reaction.

b. It could be used to create a complete genomic library.

c. It is produced from mRNA using reverse transcriptase.

d. It could be used as a probe to detect genes expressed in

the brain.

e. It lacks the introns of the human genes.

3. Plants are more readily manipulated by genetic engineering

than are animals because

a. plant genes do not contain introns.b. more vectors are available for transferring recombinant

DNA into plant cells.c. a somatic plant cell can often give rise to a complete plant.

d. genes can be inserted into plant cells by microinjection.e. plant cells have larger nuclei.

4. A paleontologist has recovered a bit of tissue from the 400­

year-old preserved skin of an extinct dodo {a bird). The re­

searcher would like to compare a specific region of the DNA

from the sample with DNA from living birds. Which ofthe fol­

lowing would be most useful for increasing the amount of dodo

DNA available for testing?

a. RFLP analysis

b. polymerase chain reaction (peR)

c. electroporation

d. gel electrophoresis

e. Southern blotting

5. Expression of a cloned eukaryotic gene in a bacterial cell in­

volves many challenges. The use of mRNA and reverse tran­

scriptase is part of a strategy to solve the problem of

a. post-transcriptional processing.

b. electroporation.

c. post-translational processing.

d. nucleic add hybridization.

e. restriction fragment ligation.

6. DNA technology has many medical applications. Which of the

fonowing is not done routinely at present?

a. production of hormones for treating diabetes and dwarfismb. production of viral proteins for vaccines

c. introduction of genetically engineered genes into human

gametes

d. prenatal identification of genetic disease genes

e. genetic testing for carriers of harmful alleles

10. -m'·illjM Imagine you want to study human crystallins,

proteins present in the lens ofthe eye. To obtain a sufficient

amount ofthe protein, you decide to done the crystallin gene.

Would you construct a genomic library or a cDNA library?

What material would you use as a source of DNA or RNA?

e.AAAA

TTTTd.ACCA

TGGTc.GGCC

eeGGb,AGTC

TCAG

7. Which of the following sequences in double-stranded DNA is

most likely to be recognized as a cutting site for a restriction

enzyme?

a.AAGG

TTee

8. In recombinant DNA methods, the term vector can refer to

a. the enzyme that cuts DNA into restriction fragments.

b. the sticky end of a DNA fragment.

c. a RFLP marker.

d. a plasmid used to transfer DNA into a living cell.

e. a DNA probe used to identify a particular gene.

For Seif·Qlliz answers, see Appendix A.

-51401". Visit the Study Area at www.masteringbio.com for aPractice Test.

EVOLUTION CONNECTION

9. ••@WIII You are making a genomic library for the aard­

vark, using a bacterial plasmid as a vector. The green diagrambelow shows the plasmid, which contains the restriction site for

the enzyme used in Figure 20.3. Above the plasmid is a region

of linear aardvark DNA. Diagram your cloning procedure,showing what would happen to these two molecules during

each step. Use one color for the aardvark DNA and its bases

and another color for those of the plasmid. Label each step.

5', TCCATGAATTCTAAAGCGCTTATGAATTCACGGC II 3'3' ,AGGTACTTAAGATTTCGCGAATACTTAAGTGCCG. 5'

Aardvark DNA

11. If DNA-based technologies become widely used, how might

they change the way evolution proceeds, as compared with the

natural evolutionary mechanisms of the past 4 billion years?

SCIENTIFIC INQUIRY

12. You hope to study a gene that codes for a neurotransmitter

protein in human brain cells. You know the amino acid se­

quence of the protein. Explain how you might (al identify the

genes expressed in a specific type of brain cell, (b) identify the

gene for the neurotransmitter, (c) produce multiple copies of

the gene for study, and {dl produce a quantity of the neuro­

transmitter for evaluation as a potential medication.

Plasmid

SCIENCE, TECHNOLOGY, AND SOCIETY

13. Is there danger of discrimination based on testing for "harmful"

genes? What policies can you suggest that would prevent such

abuses?

14. Government funding of embryonic stem cell research has been

a contentious political issue. Why has this debate been so

heated? Summarize the arguments for and against embryonic

stem cell research, and explain your own position on the issue.

CHAPTER TWENTY Biotechnology 425