Chapter 13

GENE TECHNOLOGY

Section 1: DNA TECHNOLOGY-Tools of DNA

Positive ID at a crime scenePositive ID at a crime scene

Improvement of food cropsImprovement of food crops

Human predisposition for diseaseHuman predisposition for disease

Research treatments for genetic diseasesResearch treatments for genetic diseases

DNA Identification

No two human beings are identical genetically No two human beings are identical genetically – except identical twins– except identical twins

Human beings have pretty much the same Human beings have pretty much the same DNA except for 0.1%DNA except for 0.1%

Because of this difference, we can compare Because of this difference, we can compare samples of humans for paternity, providing samples of humans for paternity, providing evidence, tracing human origins, identifying evidence, tracing human origins, identifying remainsremains

Noncoding DNA

We only use about 2% of our DNAWe only use about 2% of our DNA

The remaining 98% is called noncoding DNAThe remaining 98% is called noncoding DNA

This DNA contains many long, repeating This DNA contains many long, repeating varying nucleotide sequences called varying nucleotide sequences called variable variable number tandem repeats – VNTRnumber tandem repeats – VNTR

CACACA CACACA CACACA CACACA CACACA CACACA CACACA CACACA CACACACACACA

Noncoding DNA, cont.

The pattern of repeating nucleotides varies The pattern of repeating nucleotides varies tremendously in the human population and tremendously in the human population and can be used to make up a DNA profilecan be used to make up a DNA profile

Steps in DNA Identification

DNA Extraction (isolation)DNA Extraction (isolation)

PCR – polymerase chain reaction – the PCR – polymerase chain reaction – the molecular photocopying processmolecular photocopying process

http://learn.genetics.utah.edu/content/labs/pcr/

Steps, cont. – RE’s

Restriction enzymes – the molecular scissorsRestriction enzymes – the molecular scissors

Enzymes that can cut (hydrolyze) DNA at specific Enzymes that can cut (hydrolyze) DNA at specific sites.sites.

Current DNA technology is totally dependent on Current DNA technology is totally dependent on restriction enzymes. restriction enzymes.

Restriction enzymes are Restriction enzymes are endonucleases endonucleases – they cut – they cut within the DNAwithin the DNA

Steps, cont.

Bacterial enzymesBacterial enzymes – used to cut bacteriophage – used to cut bacteriophage DNA (viruses that invade bacteria) – why?DNA (viruses that invade bacteria) – why?

Different bacterial strains produce different Different bacterial strains produce different restriction enzymes restriction enzymes

The names of restriction enzymes are derived The names of restriction enzymes are derived from the name of the bacterial strain they are from the name of the bacterial strain they are isolated from isolated from

Steps, cont.

Titles of restriction enzymes are derived from the first Titles of restriction enzymes are derived from the first letter of the genus + the first two letters of the letter of the genus + the first two letters of the species of organism from which they were isolatedspecies of organism from which they were isolated. .

EcoEcoRI -  from RI -  from Escherichia coliEscherichia coli

BamBamHI - from HI - from Bacillus amyloliquefaciensBacillus amyloliquefaciens

HindHindIII - from III - from Haemophilus influenzaeHaemophilus influenzae

Steps, cont.

Steps, cont.

Using this piece of DNA, cut it with Using this piece of DNA, cut it with EcoEco RI RI

GG//AATTCAATTC

GACCGGACCG//AATTCAGTTAATTCGAATTCAGTTAATTCG//AATTCAATTC

GACCGGACCG//AATTCAGTTAATTCGAATTCAGTTAATTCG//AATTCAATTC

Steps, cont.Sticky endsSticky ends – Creates an overhang. – Creates an overhang. BamBamH1H1

BluntsBlunts- Enzymes that cut at precisely opposite - Enzymes that cut at precisely opposite sites without overhangs. sites without overhangs. SmaSmaI is an example of I is an example of an enzyme that generates blunt endsan enzyme that generates blunt ends

Steps, cont. GE

Gel Electrophoresis – the molecular sieveGel Electrophoresis – the molecular sieve

Separates nucleic acids or proteins based on Separates nucleic acids or proteins based on size and chargesize and charge

DNA fingerprinting – DNA fingerprinting –

Banding pattern of the fragments of cut DNA on a Banding pattern of the fragments of cut DNA on a special gel medium (special gel medium (agaroseagarose))

Steps, cont. GEhttp://learn.genetics.utah.edu/content/labs/gel/

Steps, cont. GE

DNA Fingerprinting

A powerful tool to analyze VNTRA powerful tool to analyze VNTR

Odds are 1/100,000,000,000 that any two Odds are 1/100,000,000,000 that any two people will have the same genetic people will have the same genetic fingerprint!!!fingerprint!!!

Recombinant DNA

The process of altering genetic material to The process of altering genetic material to make new substances – make new substances – genetic engineeringgenetic engineering

The product is called The product is called recombinant DNArecombinant DNA

Cloning Vectors

Many copies of a desired gene can be cloned and Many copies of a desired gene can be cloned and its product harvestedits product harvested

This is accomplished by using a This is accomplished by using a cloning vector – cloning vector – an organism that contains the desired gene and an organism that contains the desired gene and can multiply rapidly – this organism is usually a can multiply rapidly – this organism is usually a bacteriumbacterium

Vector = carrierVector = carrier

http://www.bioteach.ubc.ca/TeachingResources/Applications/GMOpkgJKloseGLampard2.swf

Probes

A strand of DNA or RNA that is radiolabeledA strand of DNA or RNA that is radiolabeled

It is used to “fish” for the desired gene when It is used to “fish” for the desired gene when either carrying out recombination, or either carrying out recombination, or identifying unknown DNAidentifying unknown DNA

Section 2: The Human Genome

Huge research project, conducted over 13 Huge research project, conducted over 13 years, sequenced and identified 20-25,000 years, sequenced and identified 20-25,000 human geneshuman genes

Findings include: 2% coding DNA, RNA useful Findings include: 2% coding DNA, RNA useful in regulating gene expression, transposons in regulating gene expression, transposons shuffle to make new genetic combinationsshuffle to make new genetic combinations

Section 3: Genetic Engineering

Gene therapy Gene therapy – treat a genetic disorder by – treat a genetic disorder by inserting a functional geneinserting a functional gene

CFTR gene in cystic fibrosis, a temporary fixCFTR gene in cystic fibrosis, a temporary fix

Gene inserted into a nonpathogenic virus and Gene inserted into a nonpathogenic virus and introduced into nasal sprayintroduced into nasal spray

Not completely successful; lung tissue is deep, Not completely successful; lung tissue is deep, cells slough off, rejection responsescells slough off, rejection responses

Cloning

HELLO DOLLY!!!Dolly died prematurely as she had short Dolly died prematurely as she had short telomeres telomeres = ends of chromosomes – like = ends of chromosomes – like aglets!aglets!

Currently animals can be cloned to grow up Currently animals can be cloned to grow up organs for human transplantsorgans for human transplants

Other applications

GMOs – genetically modified organisms, cropsGMOs – genetically modified organisms, crops

Increase yield, make crops weather and pest Increase yield, make crops weather and pest resistant, increase nutritional valueresistant, increase nutritional value

Controversy related to genetically modified (GM) Controversy related to genetically modified (GM) food : risk of harm from GM food, whether GM food food : risk of harm from GM food, whether GM food should be labeled, the role of government should be labeled, the role of government regulators, the effect of GM crops on the regulators, the effect of GM crops on the environment, the impact of GM crops for farmers, environment, the impact of GM crops for farmers, the role of GM crops in feeding the growing world the role of GM crops in feeding the growing world populationpopulation

GM foods, cont.

Soy, corn, dairySoy, corn, dairy

Buy organic, 100% grass fed beefBuy organic, 100% grass fed beef

Buy localBuy local

PLU codes – 5 numbers beginning with a 9 = PLU codes – 5 numbers beginning with a 9 = organic; 4 numbers = conventional; 5 organic; 4 numbers = conventional; 5 numbers beginning with an 8 = GMnumbers beginning with an 8 = GM