Cell Reports

Supplemental Information

Ferritin-Mediated Iron Sequestration Stabilizes

Hypoxia-Inducible Factor-1 upon LPS Activation

in the Presence of Ample Oxygen

Isabel Siegert, Johannes Schödel, Manfred Nairz, Valentin Schatz, Katja Dettmer,

Christopher Dick, Joanna Kalucka, Kristin Franke, Martin Ehrenschwender, Gunnar

Schley, Angelika Beneke, Jörg Sutter, Matthias Moll, Claus Hellerbrand, Ben Wielockx,

Dörthe M. Katschinski, Roland Lang, Bruno Galy, Matthias W. Hentze, Peppi Koivunen,

Peter J. Oefner, Christian Bogdan, Günter Weiss, Carsten Willam, and Jonathan

Jantsch

Supplemental Experimental Procedures Reagents and Inhibitors α-ketoglutaric acid disodium salt dehydrate (αKG), actinomycin D (ActD), dimethylfumarate

(DMF), ferric chloride (Fe(III)Cl3), LPS (E.coli O111:B4), malonate, MG132, N-acetylcysteine

(NAC), 8-hydroxyquinoline were purchased from Sigma-Aldrich. Ferric ammonium citrate

was obtained from Fluka. Ferrous chloride tetrahydrate (Fe(II)Cl2) and BAY11-7085 were

purchased from Merck. Desferrioxamine (DFO) was from Novartis. Completely

phosphorothioate-modified type B CpG ODN 1668 (TCC ATG ACG TTC CTG ATG CT) was

purchased from Thermo Scientific (Schwerte, Germany). Polyinosinic:polycytidylic acid

(poly(I:C)) was obtained from Amersham Biosciences. The calcein-AM was purchased from

Invitrogen. 2-(1-chloro-4-hydroxyisoquinoline-3-carboxamido) acetate (ICA) was synthesized

as previously described (Schley et al., 2012). THP-1 monocytic cell line was obtained from

ATCC.

Antibodies For Western blot analysis, primary rabbit antibodies against the following mouse targets were

used: Actin (A2066, Sigma Aldrich), SLC40a1 (FPN1; NBP1-21502, Novus), FTH1

(ab75973, Abcam), HIF1α (10006421; Cayman), hydroxy-HIF1α P402 (07-1585; Millipore;

(Tian et al., 2011)), hydroxy-HIF1α P564 (3434, Cell Signaling (Tian et al., 2011)), HSP90

(sc-7947, Santa Cruz), NOS2 (ADI-KAS-NO001-F; Enzo life sciences), PHD1 (NB 100-310;

Novus), PHD2 (NB100-2219; Novus), PHD3 (NB100-303; Novus), VHL (sc-5575; Santa

Cruz), Tubulin-α Ab-2 (clone DM1A; MS-581, Dunn Labortechnik). Polyclonal swine anti-

rabbit IgG/ HRP (P0399; Dako) was used as secondary reagent. For flow cytometry

fluorochrome-labelled CD11c (N418, eBiosciences), I-A/I-E MHC-II (2G9, BD Biosciences),

CD80 (clone 16-10A1, BD Biosciences) and CD86 (clone GL1, BD Biosciences) and the

respective isotype controls were used.

Generation of dendritic cells and cell culture experiments As described previously (Lutz et al., 1999), bone marrow-derived dendritic cells (DC) were

generated from C57BL/6 mice (Charles River Breeding Laboratories), ROSA26ODD-Luc

(ODD-Luc) mice (The Jackson Laboratory), Nos2-/- mice (Wiese et al., 2012), Cybb−/−Nos2−/−

(Wiese et al., 2012), Lcn2-/- mice (Warszawska et al., 2013) (Flo et al., 2004). For generation

of Phd2-deficient and Phd2/3-double-deficient DC, the LysM Cre-deleter strain (Clausen et

al., 1999) was crossed with Phd2fl/fl mice (Singh et al., 2013) and in addition with Phd3fl/fl

mice (Takeda et al., 2006), respectively. For generation of Irp1/2-double-deficient DC, DC

were generated from LysMCre Irp1/2fl/fl mice (Nairz et al., 2015).

At day 7-8 of bone marrow culture the DC were harvested, yielding a population of around

75% CD11c+ immature DC. Before stimulation or treatment the DC were allowed to settle

down in conventional polystyrene plates for at least one hour. Experiments took place in a

regular humidified incubator under normoxic conditions (37°C, 5% CO2, 21% O2) or under

hypoxic conditions (37°C, 5% CO2, 0.5% O2) using an adjustable hypoxic humified

workbench suitable for cell culture experiments (invivo300; Ruskinn Technology). Bone

marrow-derived macrophages were cultured in Teflon bags as described earlier (Siegert et

al, 2014).

RNA isolation, reverse transcription, real-time PCR and relative quantification Total RNA was extracted from cultured cells as described earlier (Jantsch et al., 2011) using

Trifast® (Peqlab) according to manufacturer’s instructions. 1-2 µg total RNA was reverse

transcribed using the High Capacity cDNA Archive kit (Applied Biosystems). Analysis was

performed by quantitative real-time PCR (qRT-PCR) with an ABI Prism 7900 sequence

detector (Applied Biosystems) using Taqman Universal Mastermix and Assays-on-Demand

(Applied Biosystems) as described earlier (Jantsch et al., 2011). For analysis of Fth1 mRNA

levels, contaminating DNA was removed prior to reverse transcription with the DNA-free kit

(Ambion) according to the instructions of the manufacturer. The following assays were used:

murine hypoxanthine guanine phosphoribosyl transferase 1 (Hprt1, Mm00446968_m1), 18S

ribosomal RNA (18S, Mm03928990_g1), hypoxia inducible factor 1α subunit (Hif1a,

Mm01283760_m1), lipocalin 2 (Lcn2, Mm01324470_m1), ferritin heavy chain (Fth1,

Mm00850707_g1), solute carrier family 40 (iron-regulated transporter) member 1 (Slc40a1

(ferroportin 1, Fpn1), Mm00489837_m1), Slc11a1 (Nramp1, Mm00443045_m1), type 2 nitric

oxide synthase (Nos2, Mm00440485_m1), Tnfip3 (A20, Mm00437121_m1),

phosphoglycerate kinase 1 (Pgk1, Mm01225301_m1), solute carrier family 2 (facilitated

glucose transporter) member 1 (Slc2a1 (Glut1), Mm01192270_m1). CD36 mRNA expression

was analyzed applying LightCycler technology (Roche) and QuantiTect Primer Assays

(Qiagen, Hilden, Germany) according to the manufacturers' instructions. Data were analyzed

using the ΔΔCT method. The normalized ratio of target mRNA to the internal control mRNA

Hprt1 or 18S was set to 1.

Nitrite production and immunoblotting At indicated time-points supernatants were collected and nitrite accumulation in the

supernatant as an indicator of NO production was determined by the Griess reaction using

sodium nitrite as a standard. Immunoblotting was performed as described earlier (Jantsch et

al., 2011). Briefly, DC were lysed using a PE-lysis buffer (6.65 M urea, 10% glycerol, 1%

SDS, Tris [tris(hydroxymethyl)aminomethane] HCl, pH 6.8, 5 mM DTT) supplemented with a

protease inhibitor cocktail (Roche Diagnostics). Lysates were diluted with SDS-PAGE

sample buffer and separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel

electrophoresis. Proteins were transferred onto polyvinylidene difluoride membrane

(Millipore) and detected by specific antibodies. The bound antibodies were visualized by ECL

technology and detected by the Chemo Star Imager (INTAS Science Imaging Instruments),

ChemiDoc™ XRS+ System und Image Lab Software (Bio-Rad) or by exposure of X-ray films

suitable for ECL detection.

RNA interference (RNAi) in dendritic cells Non-silencing siRNA (ns-siRNA) oligonucleotides siRNA (1027281) and siRNA-duplexes

directed against Hif1a (L-040638-00-010; outside of the ODD domain: J-040638-07/J-

040638-08), Fth1 (L-046965-01-0005), Fpn1 (L-041126-01-0005) were purchased from

Qiagen and Dharmacon via Thermo Scientific, respectively. RNA interference was performed

as described earlier (Jantsch et al., 2008; Siegert et al., 2014). Electroporation conditions

were set to 400 V, 150 µF and 100 Ω.

Measurement of PHD activity Measurement of the PHD activity is based on the protocol provided by Juva and Prockop

(Juva and Prockop, 1966). Cell pellets of BL/6 WT BM-DC were lysed with a suitable lysis

buffer (0.1 M NaCl, 0.1 M glycine, 10 µM DTT, 0.1% Triton X-100, 0.01 M Tris, pH 7.8). The

supernatants were used in the assay to hydroxylate [3H] proline-labeled HIF1α-ODD at 37°C

for 30 min either in the presence or absence of cofactors (5 µM iron, 2 mM αKG, 2 mM

vitamin C). The enzymatic reaction was stopped by adding K2HPO4, pH 5 and the reactions

were hydrolyzed in the presence of HCl overnight at 120°C. 4-hydroxy [3H] proline was then

separated from all other amino acids. PHD activity is expressed as dpm of 4-hydroxy [3H]

proline/1 x 106 dpm of incorporated [3H] proline. The relative maximal PHD activity was

calculated as a ratio of PHD activity in samples lacking the cofactors to PHD activity in

samples supplemented with cofactors. The values obtained for untreated DC were set as

100%.

Luciferase activity In order to detect luciferase activity, DC were lysed with a suitable lysis buffer (PBS, 2mM

EDTA, 1% TritonX-100 and 10% glycerol) and processed with luciferase substrate

(Promega). Luminescence was detected with a TopCount NTX reader (Perkin-Elmer).

Determination of total intracellular iron content by atomic absorption spectroscopy

For assessment of total intracellular iron content, DC were washed 2-3 times with PBS and

lysed with 0.1 % TritonX-100 and 0.1 N HCl and high purity water (Biochrom). Atomic

absorption spectroscopy was used to quantify total cellular iron content in DC with a

Shimadzu AA-7000 atomic absorption spectrophotometer (RSD < 2%). Calibrations were

established using certified Iron AAS standards (Merck KGA). Bradford assay (DCTM Protein

Assay, BioRad) was used to determine the protein concentration of an aliquot of the

respective samples.

Gel retardation assay The gel retardation assay was performed as described before (Weiss et al., 1997). Briefly,

a 32P-labeled IRE probe was transcribed in vitro from the plasmid I-12-CAT (linearized with

XbaI) by T7 RNA polymerase and purified by gel electrophoresis. The transcript had the

sequence 5‘-

GGGCGAAUUCGAGCUCGGUACCCGGGGAUCCUGCUUAACAGUGCUUGGACGGAU

CCU-3' (the unpaired C and the IRE loop are underlined). Detergent cell extracts were

prepared, and IRE/ IRP complexes were analyzed by nondenaturing gel electrophoresis and

autoradiography.

Analysis of the labile iron pool The labile iron pool was quantified by using the property of Fe(II) to quench the fluorescence

of calcein (Epsztejn et al., 1997). After incubation cells were washed twice with PBS. 1×106

BM-DC were stained with 1 µM calcein-AM, incubated at 37°C for 15 minutes and washed

twice with PBS again. Calcein fluorescence was analyzed by flow cytometry (FACS Canto II,

BD Biosciences) prior to and after incubation with 80 µM Fe(II)Cl2/ 0.04 µM 8-

hydroxyquinoline (in DMSO) (Ma et al., 2015). The data were analyzed with FlowJo software

(Tree Star). The quenchable iron pool was calculated by subtracting the geometric mean

fluorescence of (un)stimulated cells prior and after treatment with Fe(II)Cl2/ 8-

hydroxyquinoline. The greater the quenchable iron pool the smaller is the intracellular

available Fe.

Oyxgen consumption with Oxodish® and SDR SensorDish® Reader In order to quantify oxygen levels in cell culture plates, we used precalibrated OxoDish® six

well plates (Presens). These plates are made of oxygen-impermeable polystyrene and O2

sensor spots which are located on the bottom of the wells. This setup guarantees that O2

tension underneath the cell culture layer is detected by the O2-sensors. The O2 sensor spots

contain dyes whose luminescence lifetime is dependent on the oxygen partial pressure.

Signals were generated and detected by SDR SensorDish® Reader (Presens) that is capable

of detecting luminescence lifetime. Oxygen referenced images were generated by SDR

software (Presens).

Detection of ROS by flow cytometry The detection of intracellular ROS was performed as described earlier (Wiese et al., 2012).

Briefly, DC were stained with 10 µM CM-H2DCFDA (5-(and-6)-chloromethyl-2′,7′-

dichlorodihydrofluorescein diacetate, acetyl ester; Invitrogen) for 30 minutes. Where

indicated cells were pretreated with NAC 15 min prior stimulation with 10 ng/mL LPS. After 6

h the CM-H2DCFDA-fluorescence intensity of whole cells was analyzed by flow cytometry.

Analysis of TCA-intermediates by HPLC Cell pellets were spiked with 10 µL internal standard solution containing [U-13C] fumarate, [U-2H] succinate (both from Euriso-top) and [U-2H]α-ketoglutarate (Sigma-Aldrich) at 1mM each

in methanol. Pellets were extracted with 600 µL methanol (Sigma-Aldrich)/water (PURELAB

Plus water) (80/20, v/v) and washed twice with 200 µL methanol/water (80/20, v/v). The

combined extract was evaporated to dryness (CombiDancer) and reconstituted in 50 µL

water for HPLC-ESI-MS/MS analysis using multiple reaction monitoring (MRM) and negative

mode ionization. A 1200 SL HPLC system (Agilent) and a API 4000 QTrap mass

spectrometer (ABSciex) equipped with a TurboV electrospray ion source was used. HPLC

separation was performed employing a Phenomenex Luna 3uPFP(2) column (150 × 2 mm, 3

μm, Torrence) with 0.1% (v/v) formic acid (Sigma-Aldrich) in water as mobile phase A and

acetonitrile (LCMS grade, Sigma-Aldrich) as mobile phase B. Gradient elution with a flow

rate of 200 μL/min was performed: 100% A (6 min), 0% A at 6.01 min (2 min), 100% A at 8.

01 min (10 min). An injection volume of 10 µL was used. Quantification was performed using

calibration curves with the corresponding stable isotope labeled analog as internal standard.

Analysis of HIF1α in spleen DC C57BL/6 mice were injected i.p either with 1 mg ICA in vehicle or with the same volume of

vehicle (Tris-HCl pH8 + 5% DMSO). After 3 h, splenic single cell suspensions were

generated. To enrich for CD11c+ DC we used CD11c MicroBeads and a magnetic cell

separation technique (MACS, Milteny Biotec). Cells were fixed, permeabilized (using

eBioscience fixation/permeabilization diluent/concentrate and permeabilization buffer) and

subsequently stained for HIF1α. Intracellular HIF1α was detected with a HIF1α antibody

(MAB 1935, R&D systems) that was biotinylated with a Biotin-XX microscale protein labeling

kit according to the manufacturer’s instructions (life technologies). Bound antibodies were

labelled with streptavidin-PE-CF594 (BD Biosciences). Intracellular HIF1α accumulation was

analyzed by flow cytometry in DC.

C57BL/6 mice were injected i. p. either with 100 µL of 10 mg/mL Fe(III)-gluconate in PBS

(Ferrlecit, Sanofi Aventis) or 100 µL PBS. One hour later, the mice received either 30 µg LPS

in 300 µL PBS or 300 µL PBS for 3 h. From spleens of treated animals a single cell

suspension was generated and stained with CD11c- and MHCII-specific antibodies.

Afterwards the cells were fixed, permeabilized (using eBioscience fixation/permeabilization

diluent/concentrate and permeabilization buffer) and subsequently stained for HIF1α as

described above. All animal experiments were carried out according to protocols approved

by the Animal Welfare Committee of the local government (Regierung von Mittelfranken,

Ansbach, Germany).

Statistical analysis Results are expressed as means + SEM. If not indicated otherwise, ‘n’ represents biological

samples obtained from ‘N’ independent experiments (i.e. number of times experiment was

repeated in the laboratory)/ mice. Statistical significance was calculated with Prism v6.0

(GraphPad Software). Normality distribution was tested with the Kolmogorov-Smirnov test.

When comparing two groups with normally distributed data, unpaired two-tailed Student’s t-

tests were used for data where equal variances were assumed. Otherwise two groups of

normally distributed data were analyzed with an unpaired two-tailed t-test using the Welch

correction. For non-normally distributed datasets, Mann-Whitney test was used. When

comparing more than two groups, Kruskal-Wallis test followed by a Dunn's multiple

comparison tests was used. P-values of <0.05 were deemed statistically significant.

References:

Clausen, B.E., Burkhardt, C., Reith, W., Renkawitz, R., and Forster, I. (1999). Conditional gene targeting in macrophages and granulocytes using LysMcre mice. Transgenic Res 8, 265-277. Epsztejn, S., Kakhlon, O., Glickstein, H., Breuer, W., and Cabantchik, I. (1997). Fluorescence analysis of the labile iron pool of mammalian cells. Anal Biochem 248, 31-40. Flo, T.H., Smith, K.D., Sato, S., Rodriguez, D.J., Holmes, M.A., Strong, R.K., Akira, S., and Aderem, A. (2004). Lipocalin 2 mediates an innate immune response to bacterial infection by sequestrating iron. Nature 432, 917-921. Jantsch, J., Turza, N., Volke, M., Eckardt, K.U., Hensel, M., Steinkasserer, A., Willam, C., and Prechtel, A.T. (2008). Small interfering RNA (siRNA) delivery into murine bone marrow-derived dendritic cells by electroporation. J Immunol Methods 337, 71-77. Jantsch, J., Wiese, M., Schodel, J., Castiglione, K., Glasner, J., Kolbe, S., Mole, D., Schleicher, U., Eckardt, K.U., Hensel, M., et al. (2011). Toll-like receptor activation and hypoxia use distinct signaling pathways to stabilize hypoxia-inducible factor 1alpha (HIF1A) and result in differential HIF1A-dependent gene expression. J Leukoc Biol 90, 551-562.

Juva, K., and Prockop, D.J. (1966). Modified procedure for the assay of H-3-or C-14-labeled hydroxyproline. Anal Biochem 15, 77-83. Lutz, M.B., Kukutsch, N., Ogilvie, A.L., Rossner, S., Koch, F., Romani, N., and Schuler, G. (1999). An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. J Immunol Methods 223, 77-92. Ma, Y., Abbate, V., and Hider, R.C. (2015). Iron-sensitive fluorescent probes: monitoring intracellular iron pools. Metallomics 7, 212-222. Nairz, M., Ferring-Appel, D., Casarrubea, D., Sonnweber, T., Viatte, L., Schroll, A., Haschka, D., Fang, F.C., Hentze, M.W., Weiss, G., et al. (2015). Iron Regulatory Proteins Mediate Host Resistance to Salmonella Infection. Cell Host Microbe 18, 254-261. Schley, G., Klanke, B., Schodel, J., Kroning, S., Turkoglu, G., Beyer, A., Hagos, Y., Amann, K., Burckhardt, B.C., Burzlaff, N., et al. (2012). Selective stabilization of HIF-1alpha in renal tubular cells by 2-oxoglutarate analogues. Am J Pathol 181, 1595-1606. Siegert, I., Schatz, V., Prechtel, A.T., Steinkasserer, A., Bogdan, C., and Jantsch, J. (2014). Electroporation of siRNA into mouse bone marrow-derived macrophages and dendritic cells. Methods Mol Biol 1121, 111-119. Singh, R.P., Franke, K., Kalucka, J., Mamlouk, S., Muschter, A., Gembarska, A., Grinenko, T., Willam, C., Naumann, R., Anastassiadis, K., et al. (2013). HIF prolyl hydroxylase 2 (PHD2) is a critical regulator of hematopoietic stem cell maintenance during steady-state and stress. Blood 121, 5158-5166. Takeda, K., Ho, V.C., Takeda, H., Duan, L.J., Nagy, A., and Fong, G.H. (2006). Placental but not heart defects are associated with elevated hypoxia-inducible factor alpha levels in mice lacking prolyl hydroxylase domain protein 2. Mol Cell Biol 26, 8336-8346. Tian, Y.M., Yeoh, K.K., Lee, M.K., Eriksson, T., Kessler, B.M., Kramer, H.B., Edelmann, M.J., Willam, C., Pugh, C.W., Schofield, C.J., et al. (2011). Differential sensitivity of hypoxia inducible factor hydroxylation sites to hypoxia and hydroxylase inhibitors. J Biol Chem 286, 13041-13051. Warszawska, J.M., Gawish, R., Sharif, O., Sigel, S., Doninger, B., Lakovits, K., Mesteri, I., Nairz, M., Boon, L., Spiel, A., et al. (2013). Lipocalin 2 deactivates macrophages and worsens pneumococcal pneumonia outcomes. J Clin Invest 123, 3363-3372. Weiss, G., Bogdan, C., and Hentze, M.W. (1997). Pathways for the regulation of macrophage iron metabolism by the anti-inflammatory cytokines IL-4 and IL-13. J Immunol 158, 420-425. Wiese, M., Gerlach, R.G., Popp, I., Matuszak, J., Mahapatro, M., Castiglione, K., Chakravortty, D., Willam, C., Hensel, M., Bogdan, C., et al. (2012). Hypoxia-mediated impairment of the mitochondrial respiratory chain inhibits the bactericidal activity of macrophages. Infect Immun 80, 1455-1466.