CE 742 Advanced Topics in Environmental Engineering Lab Manual

Overview

Each team has been assigned so that at least one partner has some experience with molecular techniques Each team should choose a sample relevant to Environmental Engineering which they will focus on for the semester During the course of the semester you will qualitatively and quantitatively describe the bacterial composition of this sample

General Guidelines in the Lab

Proper attire

Always wear gloves in the lab This is both for your protection and also to protect the samples from contamination from your skin Remember DNA is everywhere you want to make sure you are studying the DNA from your sample and not random environmental DNA

A lab coat or other lab smock is recommended to protect your cloths from spills You may keep this in the lab for use during lab classes Also remember to wear closed-toed shoes and long pants or skirts which protect your legs

Waste Disposal

Most waste generated in this lab can be disposed of in the regular waste bin However there are some exceptions noted below These should be disposed of in the appropriate marked container for hazardous waste collection

Hazardous Chemicals

Ethidium Bromide (EtBr) This is used to stain gels and is a suspect carcinogen Formamide This is used in small quantities in PCR and also in the making of the DGGE gel in order to lower the melting temperature of DNA Acrylamide This is the main ingredient in the DGGE gel and is a known neurotoxin We will only use liquid acrylamide which eliminates hazards associated with inhaling the powder form

Using the pipeters

Pipeters are expensive tools that must be cared for properly Each group has 3 pipeters with 3 volumes 05-10 microl 10-100 microl and 100-1000 microl Always choose the appropriate pipeter for the appropriate volume Set the volume on the pipeter and then take a tip with the pipeter When taking sample release the button slowly to draw sample into the tip If you release the button too quickly the volume will not be accurate and may splash inside the pipeter Always hold pipeter vertically turning the pipeter sideways with sample in the tip will contaminate the pipeter and your sample Finally after taking the sample check to make sure there are no bubbles in the tip before dispensing the sample Dispense of the tip and use a fresh tip for each sample

Team Assignments

Group 1Luciana Pererya Mary Beth Talty and Chris Messersmith

Group 2Ruoting Pei and Mustafa Yarkin

Group 3Anurita and Matt Stephens

Group 4Matt Hoelscher and Winnie Lin

Lab I DNA Extraction and Quantification

Objective

You will extract DNA from the sample of your choice using the QBiogene FastDNA SpinKit for Soil This method employs physical disruption of the cells (bead-beating) followed by physical binding the DNA to a silica matrix washing with an Ethanol based solution and eluting in purified water Extraction will be verified by agarose gel electrophoresis and quantified by spectrophotometry

Procedure

Selection of Sample

Each team should select a sample of Environmental Engineering relevance for DNA extraction Examples include bacterial cultures (relatively easy to extract) soil (relatively more difficult) sediment or sludge You may also choose a sample relevant to your graduate research Make sure this sample is of interest to you you will be studying this sample the rest of the semester

Bring with you enough sample to perform the extraction in duplicate For soil or other solid sample 05 g per sample is required For culture 1 ml is typically sufficient but you will need to centrifuge it first pour off the supernatant and transfer the pellet to the extraction tube If you are unsure ask the instructor for advice on what sample and how much to bring

Agarose Gel Preparation

First you will prepare an agarose gel You will need this after DNA extraction to verify that it worked You will also use this procedure throughout the semester to visualize DNA

1) Set up the casting tray in the gel caster Place the comb with the appropriate number of wells in place at one extreme end of the gel tray

2) A 25 solution of agarose in 1X TAE buffer (already prepared and melted at 55ordmC) Caution Wear glovesThis solution contains 3 microl per 100 ml of ethidium bromide a DNA intercolating agent which binds to DNA and fluoresces under UV light This will allow you to visualize the DNA later This agent is also a suspect carcinogen and should not be allowed to contact the skin

3) Take this solution and pour into the gel tray- fill until about frac14 cm from the top of the space in the comb If any bubbles form while pouring the gel you may pop them or push them to the side using a pipet tip

4) Set aside and allow the gel to solidify

DNA ExtractionA Disrupting the Cells

1) Do a duplicate extraction of your sample Weigh the empty matrix tubes and record the weight Add your sample to the ldquomatrix tubesrdquo and record the volume with sample Use a sterile instrument (such as a spatula or pipet tip) to transfer the sample into the tubes

2) Add 978 microliters of phosphate buffer and 122 microliters of MT Buffer to the matrix tube using the 100-1000 microliter pipeter

3) Place cap on tightly and secure tubes in Bead-beater Make sure that samples are balanced as you would in a centrifuge Place setting on ldquoHomogenizerdquo and run for 3 minutes Note because of the force exerted in the bead-beating process it is recommended that you place the bead-beater on the floor during sample processing

4) After bead-beating centrifuge sample for 1 minute on highest setting (making sure samples are balanced)

B Binding the DNA5) Transfer the supernatant (the liquid forming the top layer) to a fresh 15 ml centrifuge

tube Add 250 microl of PPS (protein precipitating solution) Mix by inverting the tubes 10 times then centrifuge on the highest setting for 5 minutes

6) While centrifuging label one 15 ml centrifuge tube (with blue cap) and add 1 ml of Binding Matrix (make sure to shake the binding matrix prior to adding) After centrifuging transfer the supernatant to a 15 ml centrifuge tube taking care not to disturb the pellet Swirl the sample gently to mix Do this several times to maintain the sample in suspension for 2 minutes

7) Set the 15 ml tubes aside and allow the binding matrix to settle Once settled remove 05 ml of the supernatant with the pipet tip and discard taking care not to remove any settled binding matrix

8) Resuspend the sample by swirling and transfer 600 microliters into a tube with a spin filter (make sure to label these tubes appropriately) Centrifuge the tube with the spin filter for 1 minute The DNA should stay bound to the matrix and the remaining solution will come down into the bottom of the tube After centrifuging open the tube take the spin filter out with one hand and with the other discard the flow-through in the bottom of the tube Replace the spin filter and add 600 more microliters of the suspended binding matrix Centrifuge discard flow-through and repeat with remaining sample

C Washing the DNA9) Add 500 microl of SEWS-M to the spin filter Centrifuge and discard flow through After

discarding flow-through centrifuge empty tube for 2 minutes to ldquodryrdquo the spin filter

10)Transfer the spin filter containing the washed binding matrix to a fresh catch tube Allow to sit for an additional 5 minutes with the lid open to further dry the binding matrix

11)Add 50 microl of DES (ultrapure water DNA and pyrogen-free) and stir the binding matrix gently with the pipet tip Be careful not to put a hole in the spin filter while stirring

12)Let incubate 2 minutes and then centrifuge for 1 minute on high Check to make sure that the flow-through is clean and none of the binding matrix passed through the filter (If this happens transfer the sample to a fresh tube being careful not to transfer any of the binding matrix

13)DNA is now extracted Be sure to label this final tube appropriately for storage (Name date sample identirication) Check product on an agarose gel and store sample at -20ordmC

Loading and Running an Agarose gelA Setting up the Electrophoresis Unit

1) Carefully remove the comb from the solidified gel by pulling the comb slowly upwards2) Prepare 1 L of 1X TAE buffer solution by diluting the 50X concentrated TAE buffer with

DI water (eg 2 ml of 50X TAE per 100 ml solution = 1 X TAE)3) Turn the gel tray containing the solidified gel so that the wells are closest to the negative

(black) electrode [DNA has a negative charge so will travel towards the positive (black) electrode once potential is applied]

4) Pour the 1X TAE solution over the gel so that it fills the wells in the gel and also fills the electrophoresis chamber flush up until the level of the buffer is flush with the top of the gel

B Preparing the Samples and Loading the Gel5) Now cut a piece of parafilm (about 2 inch by 4 inch should be sufficient) and place on the

lab bench parafilm side up6) Using the 05-10 microl pipeter place four 2 microl ldquodotsrdquo of blue loading dye on the parafilm

(one dot for each of the samples that were extracted and one dot for each of the molecular weight standards)

7) Now take 3 microl of the first molecular weight marker and add to the first blue dot Mix by pipeting up and down Once mixed take the sample and dye mixture back up in the tip

8) Load this sample into the first well Do this by placing the tip gently about midway into the well and slowly releasing the mixture into the well (Careful Do not pierce the bottom of the well) The blue loading dye contains glycerol which makes the sample sink to the bottom of the well and helps prevent the samples from coming out of the wells and cross-contaminating other wells

9) Repeat this procedure with the two DNA extracts and finally with the second molecular weight marker

C Running and Visualizing the Gel10)Once the gel is loaded place the cover on the electrophoresis unit (red to red black to

black) and plug in the leads to the power supply (red to red black to black) Set the voltage on 120 v and press ldquorunrdquo If you are running two gels from the same power supply assuming that the resistance of each gel is the same set the voltage on 240 v Run until you see the blue dye move about halfway down the gel At this time turn off the voltage to the gel

11)In order to ldquoseerdquo the DNA you need to look at it 1 2 under UV light Take the gel over to the hand-held UV lamp Make sure that you are wearing the UV protection shield over your face and that any bare skin is covered completely by gloves and your sleeves Turn on the lamp and hold over the gel If your extraction is successful you should see something similar to Fig 1 On your gel you will have two molecular weight standards on either side of your samples

Fig 1 Example of DNA extract run on agarose gel and visualized under UV light 1) molecular weight marker or ldquoladderrdquo with top band of DNA = 1500 bp brightest band (middle) = 500 bp and bottom band = 100 bp 2) Extract of genomic DNA from E coli

Quantifying the DNA

The brightness of the band of the extracted DNA on the agarose gel should give you an indication of the yield of your extracted DNA Now we will use spectrophotometry to better quantify this yield You may want to get this part started while you are running the agarose gel

1) Warm the lamp on the spectrophotometer for 30 minutes prior to use2) Make a 1100 dilution of your DNA extract with a final volume of 500 microliters (eg 5

microliters of DNA extract added to 495 microliters of DI water) You can do this in a microcentrifuge tube You may use regular DI water to do the dilution (it is not necessary to use the ultrapure water since you will throw away this sample after measuring it)

3) Once the lamp is warmed-up Fill the quartz cuvette with the same water you used for the dilution Zero the instrument Note Handle the quartz cuvette carefully it is expensive Only wipe the surface of the cuvette with kimwipes other materials may cause scratches

4) Once the instrument is zeroed check the samples Rinse out the cuvette with DI water ldquotaprdquo dry on a kimwipe and transfer the sample to the cuvette using the pipeter

5) You will determine the absorbance at two wavelengths 260 nm (DNA) and 280 nm (protein) A high ratio of 260280 indicates that the sample is relatively pure with respect to protein contamination

6) Use the following formula to determine the concentration of DNA in your sample

To calculate the concentration of genomic DNA in the dilutionA260 50 ng microl = x ng microlTo calculate the concentration of genomic DNA in the extract before dilutionx ng microl (500 microl 5 microl) = y ng microlTo calculate the total mass of genomic DNA in the extracty ng microl 50 microl = z ng

Congratulations You have completed your first lab Be sure to record your observations in detail in your lab book

Lab 2 Polymerase Chain Reaction (PCR)

Objective

You will use PCR to amplify the 16S rDNA genes of the bacterial community DNA which you have extracted We will take a ldquonestedrdquo PCR approach This will require two PCR reactions 1) amplifying near full-length of the 16S gene (~1500 bp) using primers 8F and 1492R 2) Using the product of the first PCR reaction as template to amplify the ~200 bp V3 region within the 16S gene using primers 341F and 533R The PCR product from the first PCR will be used later in the semester for cloning while the second PCR product will be used next week for denaturing gradient gel electrophoresis (DGGE)

Fig 1 Position of PCR primers for ldquonestedrdquo PCR of 16S gene

Preparation

PCR is an exponential reaction Therefore it is highly susceptible to contamination by foreign DNA Clean the surface of your working area with ethanol and then with ldquoDNA awayrdquo to sterilize the area and minimize any foreign DNA Also clean the pipetters you will use with DNA away As always wear gloves

Each group has a Styrofoam container filled with ice The PCR reagents should all be kept on ice as much as possible during reaction preparation This reduces the activity of the Taq DNA polymerase during preparation If the reaction mixture is not kept cold during setup then this increased the likelihood of the formation of non-specific PCR products

Each group also has a set of ldquoaerosol barrierrdquo pipet tips You will notice that these tips contain a white ldquoplugrdquo which helps minimize cross-contamination of aerosolized DNA between samples Use these tips while setting up the PCR reactions

Setting up the PCR reaction with primers 8F and 1492R

PCR reagents for each group have been aliquotted and stored in the freezer Remove the reagents and allow them to thaw on ice For the first PCR reaction you will need

16S rRNA gene ~ 1500 bp

8F 341F 533R

5rsquo

3rsquo

Reagent Amount needed per 25 microl reaction

ldquoMaster Mixrdquo Amount needed for N+1 Reactions

(calculate)Purified Water 1315 microl10X buffer 25 microl5X buffer 5 microldNTP (10 mM) 1 microlPrimer 8F 1 microlPrimer 1492R 1 microlTaq Polymerase 035 microl

Totals 24 microl

See the above table for the required PCR reagents and the amounts required for a 25 microl reaction Use the far right column to calculate the amount of reagent that you will need to put in the Master Mix The Master Mix contains all of the reagents needed for the number of PCRs you will carry out 24 microl of which will then be aliquotted into PCR microtubes and finally one microliter of your extracted DNA will be added for a 25 microl total reaction

You will be carrying out 4 PCR reactions 1 for each of the extracted DNA samples 1 negative control and 1 positive control You need to prepare extra Master Mix in order to account for losses and pipetting error Therefore prepare enough Master Mix for N+1 (5) reactions

After you have finished the calculations and the PCR reagents have thawed you may begin preparing the Master Mix First vortex all of the reagents in order to eliminate any concentration gradients which may have formed during freezingthawing of the reagents Then add the reagents to a microcentrifuge tube in the order they appear on the table It is a good habit to add in this order (least costly to most costly) so that if any mistake is made you do not have to throw away expensive Taq polymerase (one 200 microl tube = $30000) After you have added all of the reagents- vortex and place on ice

Based on the concentration and purity of your DNA extract you will need to do a dilution of your DNA before using for PCR You should have calculated the concentration of your DNA at the end of the last lab- also determine the ratio of absorbance at 260 nm280 nm If this ratio is 2 or greater then you have relatively pure DNA and you will not have to do a high dilution (13 is probably a good dilution to try in this case) If this ratio is less than 2 then try a higher dilution (15 110 or 120 for high concentration DNA) Do not dilute the whole DNA extract instead- add the required volume of dilution water to a microtube and add the DNA extract to this tube For example for a 15 dilution add 4 microl of water to a microtube and 1 microl of DNA extract

Now label the microtubes that you will use for the PCR reactions Aliquot 24 microl of Master Mix into each of the PCR tubes Finally add 1 microl of the diluted DNA extract to each of the two sample tubes To the positive control add 1 microl of the positive control and to the negative control add 1 microl of purified water

When all of the groups are ready- place the tubes in the thermal cycler Until then maintain the microtubes on ice All of the samples will be run on the thermal cycler together- the program takes about 15 hours

Thermocycler program for Primers 8F 1492R94 ordmC 2 minutes Initial denaturing step94 ordmC 30 seconds denaturing50 ordmC 30 seconds Primer annealing72 ordmC 30 seconds extensionRepeat step 2-4 for 24 cycles68 ordmC 10 minute Final extension step4 ordmC infin hold

Making the agarose gel

While you are waiting for the first PCR reaction to finish you will make an agarose gel To make a 12 agarose gel weigh out 09 grams of agarose and transfer to a 250 ml flask Add 15 ml of 50X TAE buffer and 735 ml (this can be approximate) of DI water Swirl the mixture to mix and microwave 1 minute on high Swirl again to mix and microwave again watching closely Just as the mixture begins to boil- stop the microwave Swirl and make sure that the mixture is clear and there is no undissolved agarose Add 1 microl of ethidium bromide and swirl once more to mix Set up the gel casting tray for the appropriate number of samples and pour the mixture Be ready to pop any bubbles that form with a pipet tip or needle While the gel cools begin setting up the second PCR reaction

Setting up the second PCR Reaction with primers 341F and 533R

Now make the calculations for N+1 reactions with primers 341F and 533R You will use the four PCR products from the first PCR as template plus a new blank (N+1=6)

(calculate)Purified Water 1315microl10X buffer 25 microl5X buffer 5 microldNTP (10 mM) 1 microlPrimer 341F 1 microlPrimer 533R 1 microlTaq Polymerase 035 microl

Totals 24 microl

Prepare the Master Mix as you did for the first PCR Note that the only difference will be the primers used Vortex the Master Mix and aliquot 24 microl into the PCR microtubes Hold on ice until the first PCR is done

Load and Run the Agarose Gel

Once the gel has cooled remove the comb Prepare 1X TAE buffer from the 50X concentrated solution using DI water (you will need about 250 ml per gel) Pour the TAE buffer over the gel filling the wells and the chamber until the buffer level is about even with the top of the gel

Once the first PCR has finished load 3 microl of the PCR product onto the agarose gel using 3 microl of blue loading dye and parafilm as you did for Lab 1 Donrsquot forget to load the DNA molecular weight standard (ldquoladderrdquo) Load 5 microl of the standard (last week it seemed that 3 microl was not enough)

Run the gel at 150 volts until the blue dye is about 13 to frac12 way down the gel Look at the gel under UV light to verify PCR product The expected size of the PCR product is about 1500 bp If your reaction is successful you should see a band at ~1500 bp (see appendix for molecular weights of bands in size standard)

Running the Second PCR Primers 341F and 533R

After you have checked your PCR product from the first reaction prepare a dilution of the PCR product If the product looked very strong make a 15 dilution if it looked weak make a 13 dilution if you were not able to see any product do not make a dilution

Add 1 microl of the diluted PCR product (including the first blank) to the new PCR tubes and 1 microl of purified water to the new blank When all of the groups are finished- place the PCR tubes on the cycler Make sure that your PCR products are well-labeled so there is no confusion before the next lab

The program for the second PCR takes about 4 hours This is because it employs a ldquotouchdownrdquo method in which the annealing temperature is sequentially lowered by one degree from 52 to 47 degrees running 2 cycles at each annealing temperature Once 47 degrees is reached the program is run for 30 cycles This increases the specificity and sensitivity of the primers The denaturing temperature (94 ordmC) and the extension temperature (72 ordmC) are the same as the first PCR and there is also a final extension at 72 ordmC for 10 minutes

The cycler is set to hold the samples at 4 ordm C after the program is finished The TA will check your PCR products on an agarose gel before the next lab to verify that the reaction worked For the second PCR we expect a 200 bp product

Clean up

Save your first PCR product (well-labeled) in the freezer you will need this later in the semester when we do cloning Also remember to replace your DNA extract and any unused PCR reagents

in the freezer Empty the buffer from the electrophoresis chambers rinse with DI and place on the rack to dry

Appendix

Primer Sequences

8F5rsquo ndashAGAGTTTGATCCTGGCTCAG-3rsquo

11492R5rsquo-GGWTACCTTGTTACGACTT-3rsquo

2341FCGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGIGGCIGCA

3533R 5rsquo-TIACCGIIICTICTGGCAC-3rsquo

Lambda HindIII DNA Molecular Weight Standard (Ladder)

10 agarose05microglane8cm length gel1X TAE 17Vcm

Note under optimal conditions an additional two bands at 72 bp and 125 bp may be seen

Lab 3 Denaturing Gradient Gel Electrophoresis (DGGE)1 W indicates an A or a T2 This primer contains a GC clamp at the forward end to help with resolution when running DGGE3 I indicates inosine base- helps increase sensitivity of primer

Objective You will resolve your ~200 bp PCR products (with GC clamp) on a DGGE gel in order to get a profile of the microbial community present in your sample

OverviewWe will meet at the ERC for this lab Also this lab is going to be another long one so be prepared (I promise next week will be shorter =))

Because we only have one DGGE unit this lab will be a more of a demonstration than previous labs Rather than working separately in groups the four teams will run their samples together on one gel Each gel can hold 16 samples and each of the four groups has 4 samples Also because about 225 hours are required to run the gel the TA will prepare the gel in advance so that we can load it and start it at the beginning of the lab Then we will prepare a gel together while the first one is running so that you can see how it is made (like a cooking show)

Procedure

Running the GelWashing the WellsWhen you arrive the TA will already have prepared the gel and it will be in the electrophoresis chamber with 05X TAE buffer solution and heated to 57ordm C This high temperature helps to denature the DNA First you will rinse the wells in order to flush out any residual unsolidified gel which may be present in the wells Washing the wells is a critical step for preventing the samples from degrading inside the wells Wash the wells by filling a syringe with the heated buffer and flushing each well individually Flush each well each well 3 times

Loading the samplesAdd 10 microliters of blue loading dye directly to the PCR tubes with the 200 bp product and mix by pipetting up and down Before loading The TA will turn off the heater and the pump and remove the top portion of the electrophoresis unit and rinse the wells one final time

The TA will load the first sample and then each group will load their samples in order You will load the gel in the order of your group number in the following order 1) positive control 2) first sample 3) second sample 4) negative control You will use extra small-bore pipet tips which allow you to reach the bottom of the well with the sample Make sure when you take the sample into the pipet tip that there is a bubble of air beneath the sample (by setting the pipetter volume higher than the actual sample volume)- otherwise capillary action will pull your sample out of the tip before you are able to position it in the well

Running the gelAfter all of the groups have loaded their samples the TA will replace the top of the Electrophoresis unit and turn on the heater and the voltage to 300 volts We will wait to turn the pump on until the samples have visibly migrated into the gel The pump recirculates the buffer in the top chamber of the unit so that it maintains contact with the electrodes Turning on the pump too early however may disturb the freshly loaded samples We will run the gel for 2 hours and 15 minutes at 300 volts

Preparing the GelSetting up the Glass PlatesWhile the gel is running you will learn how to prepare a gel First the TA will demonstrate how to prepare the glass plates for pouring the gel First they are coated with SigmaCote using a Kimwipe (Warning SigmaCote is volatile and it is dangerous to inhale the fumes- we will do this in the fume hood) Then the spacers are put in place and the plates are clamped so that the spacers and the bottom of the glass plates are perfectly flush After this the plates will be secured in place and the gel will be prepared

Mixing the gel solutionsWe will keep the gel solutions on ice so that it does not solidify until we are ready One 50 ml centrifuge tubes will be labeled ldquoHrdquo (for high-density solution) and another will be labeled ldquoLrdquo (low density solution) The following will be added to the tubes

H L100 denaturing solution 132 ml 48 ml0 denaturing solution 108 ml 192 mlBlue dye 425 microl ---------

The 100 denaturing solution contains 7M urea and 40 volvol formamide in 1X TAE buffer and 8 acrylamidebis solution (the main component of the gel) The 0 solution contains only acrylamidebis in 1X TAE The blue dye serves as a marker to distinguish the tubes and also so that the gradient can be visualized when it is poured Danger Acrylamide is a neurotoxin and should not be allowed to come into contact with the skin

Now we will prepare a 100 mgml solution of Ammonium persulfate (APS) in DI water This will be added later to help solidify the gel Once this is made the syringes and the gradient pourer will be put in place It is important to have everything in order before pouring the gelonce the solidifying agents are added- you only have about 10 minutes to pour the gel before it begins solidifying

Once we are ready to pour the gel we will add about 25 ml (can be approx) of 100 denaturing solution to a separate centrifuge tube This will be used to form a seal at the bottom of the gel Add 75 microliters of the APS solution and 5 microliters of TEMED to this tube- vortex- and immediately fill a syringe and dispense enough of the gel solution between the plates to form a thin layer at the bottom of the glass plates This must be done very quickly or the solution will gel in the syringe Rinse the syringe out when done

Now add 24 microliters of APS and 24 microliters of TEMED to each of the tubes labeled ldquoHrdquo and ldquoLrdquo Fill each syringe with the appropriate gel solution and position them on the gradient pourer (blue tube on the right side) Once in position the syringes will be connected by a three-way connector and on the third end an 18 gauge needle will be connected Finally the cam of the gradient pourer will be turned slowly in order to avoid the formation of any bubbles You will notice that the blue solution pours faster at the beginning than the clear solution- this is how

the gradient is formed Once the gel solution reaches the top of the plates- a 1 inch spacer will be put in place and the gel will be placed in a warm place to aid solidification

After an hour- we will prepare the ldquostacking gelrdquo or the layer of the gel with the wells This is made just as the bottom of the gel was made- only with 0 denaturing solution rather than the 100 First we will remove the spacer and pour off any residual unsolidified gel After this we will prepare 5 ml of the stacking gel solution (with 10 microliters of TEMED and 15 microliters of APS) After vortexing and quickly adding the stacking gel solution to the top of the gel with a syringe- the 16 well comb will be put in place and allowed to solidify for about an hour

Preparing the Gel StainInstead of Ethidium bromide we will use SybrGold nucleic acid stain This stain is much more sensitive than ethidium bromide and has the advantage that it does not emit background fluorescence when not bound to the DNA We will prepare a 110000 dilution (20 ul in 200 ml) in 1X TAE buffer We will keep this away from light until ready for use (it is photosensitive)

Staining the GelOnce the gel is finished we will remove it from the unit cut off the wells notch the top right corner (for orientation) and place it in the gel stain We will then place it on an orbital shaker (covered) for 15 minutes While it is staining we will get the imager ready Also each group should label five 15 ml microcentrifuge tubes We will put the gel slices in these tubes when we cut the gel

Imaging the GelWe will carefully transfer the gel from the stain solution to the imager The gel is very fragile and can easily tear if mishandled Once on the imager- we will take a digital image of the gel After this- we will transfer the gel onto the cutting tray in order to avoid damaging the surface of the UV table with the razor blades Each group will then take turns cutting dominant bands from the gel The key to cutting the bands is to avoid the edges and only cut the central 1 mm square portion of the band Pick at least 5 bands and transfer to the microcentrifuge tubes Add 36 microliters of sterile water and make sure that the gel piece is pushed all the way to the bottom of the tube and submerged in the water Caution Make sure to wear the UV shield and protect all exposed skin from the UV light Trust me- it is possible to get a painful burn from the UV lighthellip

We will store the gel slices in the freezer until we are ready to re-amplify them for sequencing

Fig 1 Image of DGGE gel comparing microbial communities present in acid mine drainage remediating communities

Lab 3 ldquoShot-Gunrdquo Cloning

OverviewShot-gun Cloning is one method of obtaining 16S rRNA gene sequence information from the microbes present in your sample You already did a PCR of the near full-length 16S rRNA genes present in your DNA extract using primers 8F and 1492R Now you will ligate (or attach) these PCR products randomly into a plasmid vector We will use the 4-TOPO plasmid (see Fig 1) provided by Invitrogen for delivering your PCR product into the E coli cells These cells have been treated chemically so that they take up DNA readily from their environment This process is called transformation Once the cells are transformed with a plasmid containing a random PCR product insert they are then spread out on Petri dishes When spread properly one colony originates from one cell which was transformed with a single plasmid with a single insert Next week- you will learn how to do PCR on these individual colonies in order to retrieve the insert for sequencing

ProcedureGeneClean (Q Biogene) protocol for DNA purificationFirst you must clean your PCR products This removes any unused primers and dNTPs which may interfere with the ligation The geneclean kit works by binding the DNA to silica particles (Glassmilktrade) which allows you to ldquowashrdquo the DNA with an ethanol-based solution (New Washtrade) while it is bound Once the DNA is washed it is eluted with purified water (GC Elution Solution) This procedure should take about 10 minutes

1) Add 400 microliters of Glassmilk to a catch tube containing a spin filter (one for each DNA extraction) Make sure to shake the glassmilk before adding to suspend the silica particles

2) Add your DNA extract to the glassmilk and bind at room temperature for 5 minutes inverting tube every minute to mix

3) Centrifuge tubes at lt14000 g (Our centrifuge max is 13300 g) Empty the flow-through into a waste receptacle

4) Add 500 microliters of New Wash to the filter and centrifuge again5) Discard flow-through and centrifuge the empty tube for 2 minutes to dry the glassmilk6) Transfer the filter to a new catch tube and add 15 microliters of elution solution (purified

water)7) Centrifuge discard spin filter Your DNA is now purified (Note- You could elute the

spin filter a second time for a 10-15 increase in DNA recovery (by mass)) Label this final tube properly and proceed to the ligation step

LigationYou will now insert your Genecleaned PCR products into plasmid vectors which will then be inserted into Ecoli cells for cloning

1) Take 4 microliters of your genecleaned PCR product into a 200 microliter microtube 2) Add 1 microliter of salt solution and 1 microliter of 4-TOPO vector 3) Incubate the ligation reaction at room temperature for 15 minutes

Transformation of ClonesCareful The competent cells have been chemically treated in order to weaken their cell walls so that they can better take up DNA from the environment Thus they are very fragile and must be handled with care The competent cells have been stored at -80 degrees C and must thaw on ice to avoid shock

1) Thaw the cells on ice just prior to use 2) Take 4 microliters of your ligation reaction and add it very gently to the competent cells and stir gently with the pipet tip to mix (do NOT pipet up and down)3) Incubate the competent cells on ice for 20 minutes4) Heat shock the cells for 30 seconds at 42 C and place back on ice for 5 minutes During this incubation warm the SOC medium to room temperature5) Gently add 50 microliters of the SOC medium to the competent cells Incubate the cells for 15 minutes at 37 degrees C6) Plate 100 microliters of the competent cells onto a prewarmed (at 37 C) Petri dish containing LB agar and ampicillin Use a pipeter to transfer the transformed cells onto the medium and use a sterile hockey stick to spread the cells until the liquid is absorbed into the plate

The ampicillin antibiotic will ensure that only cells which have taken up the 4-TOPO vector which contains an ampicillin resistance gene will grow In order to ensure that only cells which contain a vector WITH a PCR product insert the 4-TOPO vector contains a ldquogene-killerrdquo This means that the insert takes place within the gene-killer gene thus inhibiting its lethal function Therefore if the insert is present then this gene does not function and the cell survives and can later be selected The clones will be allowed to grow overnight and then the TA will store them in the refrigerator until next week when we will screen clones and prepare them for DNA sequencing

Fig 1 Map of 4-TOPO Cloning Vector

Lab 5 PCR of Clones and DGGE bands for sequencing

OverviewWe will now retrieve the inserts of your clones for DNA sequencing and identification using primers specific to the plasmid vector We will use primers M13F and M13R (see map of vector from previous lab for location of priming sites) Because these primers are specific to the cloned vector and are not ldquouniversalrdquo primers then contamination is not as much of a concern as with previous PCRs using universal primers

At the same time- you will do PCR on the DGGE bands which you cut using the water that they have been soaking in as template These are universal primers- so contamination is a concern- be extra cautions with these

All the same guidelines apply for PCR- vortex all of the reagents before using them and maintain everything on ice as much as possible

PCR of clones

You will prepare a PCR reaction for 10 clones plus a blank Thus you will prepare enough Master Mix for N+1=12

Reagent Amount needed per 25 micro l reaction ldquoMaster Mixrdquo Amount needed for N+1 Reactions (calculate)

Purified Water 1615 microl10X buffer 25 microl5X buffer 5 microldNTP (10 mM) 05 microlPrimer M13F (20 microM) 025 microlPrimer M13R (20 microM) 025 microlTaq Polymerase 035 microl

Totals 25 micro l

Mix all of the above in a microcentrifuge tube- vortex and place on ice

Choose 10 colonies and circle them on the underside of the petri dish and label them 1-10 Choose colonies which are medium to large in size and which are well-separated Do not choose any tiny ldquopinpointrdquo colonies which are present these usually grow in regions where the antibiotic has degraded and do not contain the vector with the resistance gene

You will then aliquot out 25 microl of the Master Mix into 11 PCR tubes using pipet tips with a white plug Then lightly dip a pipet tip into one of the colonies and dip it into a PCR tube containing the master mix Do this for all ten colonies you have chosen using a fresh tip each time Do not do this with the 11th tube- this is your negative control After completing this close the tubes and label them accordingly

You will place the tubes on the thermal cycler which will run with the following program 94ordmC 10 minutes (this is longer than usual- both to break open the cells- and to denature the DNA)

followed by 30 cycles of 94ordmC (15 seconds) 55ordmC (15 seconds) 72ordmC (15 seconds) followed by 2 minute extension at 72ordmC This program takes about 15 hours

PCR of DGGE bands

While the first PCR is running set up a PCR for the DGGE bands Each group cut out 5 bands- so prepare enough for 5 reactions plus the blank- or N+1=7 according to the following table

Purified Water 1365microl10X buffer 25 microl5X buffer 5 microldNTP (10 mM) 05 microlPrimer DGGEF 1 microlPrimer DGGER 1 microlTaq Polymerase 035 microl

Totals 24 micro l

Vortex the Master Mix and aliquot out 24 microl into 6 PCR microtubes that have been labeled according to the band number Add 1 microl of the water that the band has been soaking in into the appropriate PCR tube To the blank- do not add anything Close the tubes and keep on ice

Once the first PCR is finished- the TA will put the second set of PCR tubes on the thermocycler and run the appropriate program (see lab 2 program for 341F 533R- these are modified versions of the primers used in this lab and have the same program) In the next lab you will purify these products and prepare them for DNA sequencing

Pick these Avoid these

Fig 1 Tips for choosing clones

Lab 6 Preparation for DNA Sequencing

Overview In this lab you will check your PCR products from both the clones and the DGGE bands from Lab 5 gene clean them and determine the DNA concentration This lab will be held at ERC so that we can use the gel documentation system to determine DNA concentrations

Checking PCR Products

PCR products will be checked by agarose gel electrophoresis as done in previous labs However since we will be doing this lab at ERC the TA will already have two agarose gels prepared one for all of the clone PCR products and one for all of the DGGE band PCR products Both gels will be made as before except that SybrGreen will be used instead of Ethidium Bromide to stain the gel SybrGreen provides better resolution than ethidium bromide which will be useful in determining product concentrations Also it does not migrate towards the cathode as ethidium bromide does which is useful when loading multiple rows of samples onto the same gel as we will be doing

Each group should take turns loading both their clone and DGGE band PCR products onto the two gels We will load the clone PCR products onto the larger gel since there are more of these and the DGGE bands products onto the smaller gel Load 3 microliters of your product mixed with 05 microliters of the dye Also- a molecular weight size standard needs to be loaded in each row

We will run the gel at 150 volts for 30 minutes

Documenting the Gel

The gels will be documented using the UVP BioChemi Imaging system This is the same high resolution system which we used to document the DGGE gel This system has a 16 bit camera which supercooled to reduce noise We will place the gels one at a time on the imager and position so that it is in the middle of the field of view of the camera Then we will make sure that the filter is set on ldquoSybrGreenrdquo and capture an image of the gel

This will be done for each gel We will compare to the size standard in order to determine the size of your insert For the clones- we expect a PCR product of about 1700 bp (the size of the 16S gene plus part of the vector) For the DGGE bands we expect a PCR product of around 250 bp Also make sure that there is not any contamination in the blank- especially in the DGGE band PCR since this was done with ldquouniversal primersrdquo We will use the standard ladder in order to verify the size of our PCR products

Preparing for Sequencing

You will now do a GeneClean on any PCR products which were the expected size Do up to five of the clones and all of the DGGE bands which worked Follow the GeneClean procedure described in Lab 4 You do not need to do an extra elution in the final step

You will need to run the gene cleaned product on a gel one final time in order to estimate the concentration We will document the gel on the imager and use the software to estimate concentration This process will be demonstrated to you

Fill out the attached form which is used for submitting samples for sequencing to the CSU macromolecular resource facility You need to fill out the sample name and the sample concentration The form also asks for details on the primer to be used for sequencing For the clones the primer is ldquoT7rdquo You do not need to fill out any more information than this because T7 is a standard sequencing primer and the facility will provide it free of charge For the DGGE bands however we need to provide a primer (since it was not inserted into a cloning vector) We will use the primer DGSeq which has a melting temperature of 55 ordmC and which we will provide at 32 pmolmicroliter

The sequencing facility promises two day turnaround Therefore we should have our sequences returned in time for the next lab on sequence analysis

Lab 7 Nuts and Bolts of DNA Sequence Analysis

Overview

You will now analyze your sequences from both the DGGE bands and the clones and determine the identity of the organisms represented by these sequences Sequence analysis for the purpose of classifying organisms or phylogenetics is a field in and of itself and we will only be able to scratch the surface with this exercise The purpose of this lab therefore is to give a basic idea of the techniques involved and allow you to identify your microorganisms For further interest see Phylogenetic Trees Made Easy A How To Manual for Molecular Biologists by Barry Hall

Sequence File format

Each group will receive a floppy disk containing their sequence files The sequence files will be named according to how you filled out the sheet- with an ldquoab1rdquo file extension This chromatogram file can be opened by a program called Chromas which is a free software available on the internet at httpwwwtechnelysiumcomau This program will already be downloaded on the computer Open each file and look at the overall quality of the chromatograms Note that each base is color coded in the chromatogram (A is green C is blue G is black and T is red) The sequence reader judges the identity of the nucleotide at each position by comparing the relative heights of the peaks If two peaks are overlapped then the program is not able to judge what the nucleotide is and you will se a pink ldquoNrdquo (unknown) in that position The following figures show examples of high quality sequence data and poor quality sequence data as viewed in Chromas

Fig 1 Example of a chromatogram with good quality sequence data

Fig 2 Example of a chromatogram with poor quality sequence data

Sequence Analysis

If you have high quality sequence data- then the analysis will be simple- if nothelliphellipit will be challenging The most common reason that a chromatogram has a noisy signal is that there were multiple templates present during the sequencing reaction Considering that our DGGE bands did not resolve very well it is likely that more than one sequence was present in some of the bands which you cut If you sequence multiple sequences at the same time- then the signals will overlap and you will get a noisy signal The clones are more likely to give a cleaner signal because they were well resolved as individual colonies Also the primer used for sequencing the clones (T7) is specific to the cloning vector and is not susceptible to background contamination present in your sample (The DGGE band primer used was a ldquouniversalrdquo primer)

After you open each file and take note of the sequence quality you will begin to analyze the sequences Go back to the beginning of your sequence list and open the file in Chromas Go to ldquoFileexportrdquo and export the file in the ldquoFASTArdquo format This is a very commonly used format for sequence files Once you have exported this file- you can open it in MS Word Word allows you to edit the file using the ldquoSearchReplacerdquo functions etc but save the file as ldquoTEXT onlyrdquo whenever you modify it After you open the file in Word copy the sequence portion of the file (everything after the first line- the first line contains the sequence name and the formatting commands for FASTA format) onto the clipboard

Now open your web browser and go to the National Institute of Health BLAST website httpwwwncbinlmnihgovBLAST This website links to the most comprehensive and up-to-date sequence information available on Planet Earth (that I am aware of) The advantage of Blast is that it will allow you to check your sequence against this large database and will give you a visual alignment of the closest matches which can help you correct any potential errors in your sequence Click on ldquonucleotide-nucleotiderdquo Blast and paste your sequence in the search window Then click ldquoBlastrdquo After this a new screen will come up- when this happens click ldquoFormatrdquo After this Blast will begin to query the database This could take a few seconds or several minutes depending on the traffic to the website at the time of your query After some time your alignment will come up When this happens you will see something like the Fig 4 The top portion is a summary of your sequence matches Red color indicates a good match along the length of your sequence while pink indicates that there is a lower match along the length of your sequences If you see green blue or black then that indicates that your sequence is too poor to analyze any further

Scroll down and look at the names of the organisms which gave the closest matches Note that it is not uncommon that several of these will be ldquounknownrdquo or ldquounculturedrdquo bacteria Remember that most bacterial have not yet been cultured and the only thing we know about them is their sequence information so this should not be surprising Also note that this format does not tell you much about how to classify your sequence- we will use a different website- the Ribosomal Database Project- to do this

Now scroll down and look at the alignments This gives you a chance to edit your sequence and look for and repair errors This is a tricky business and you must do this very CONSERVATIVELY The following are some general guidelines for sequence editing

Distribution of 100 Blast Hits on the Query Sequence

Sequences producing significant alignments (bits) Value

gi|30103112|gb|AY1773572| Phenanthrene-degrading bacterium 337 7e-90 gi|23345134|gb|AY1360801| Sphingomonas sp KIN84 16S ribos 337 7e-90 gi|4868348|gb|AF1312971|AF131297 Sphingomonas sp JSS-54 1 337 7e-90 gi|12247763|gb|AF3270691|AF327069 Sphingomonas sp SA-3 16 337 7e-90 gi|456233|dbj|D137271|SPP16SRR6 Sphingomonas terrae gene f 337 7e-90 gi|30103121|gb|AY1773662| Sphingomonas sp 86 16S ribosoma 329 2e-87 gi|30060219|gb|AY2546931| Uncultured alpha proteobacterium 329 2e-87 gi|40240919|emb|AJ6190811| uncultured alpha proteobacteriu 329 2e-87 gi|19699044|gb|AY0819811| Uncultured bacterium clone KRA30 329 2e-87

gtgi|30103112|gb|AY1773572| Phenanthrene-degrading bacterium M20 16S ribosomal RNA gene partial sequence Length = 1357

Score = 337 bits (170) Expect = 4e-90 Identities = 170170 (100) Strand = Plus Plus Query 1 cctacgggaggcagcagtggggaatattggacaatgggcgaaagcctgatccagcaatgc 60 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 264 cctacgggaggcagcagtggggaatattggacaatgggcgaaagcctgatccagcaatgc 323

Query 61 cgcgtgagtgatgaaggccctagggttgtaaagctcttttacccgggatgataatgacag 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 324 cgcgtgagtgatgaaggccctagggttgtaaagctcttttacccgggatgataatgacag 383

Query 121 taccgggagaataagctccggctaacttcgtgccagcagccgcggtaata 170 ||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 384 taccgggagaataagctccggctaacttcgtgccagcagccgcggtaata 433

Fig 3 Example of Blast Alignment

Guidelines for Sequence Editing

Scroll down the alignments and look for errors The most common error is a ldquoGaprdquo A gap occurs when the DNA sequencer either inserts an extra base- or removes a base- this causes a shift in the alignment Figure 3 presents a ldquoperfectrdquo or 100 match- and will not need any further editing Figure 4 presents an example of an alignment with gaps which need to be edited If gaps are found in Blast- then go back to the Chromas file and find these positions on the chromatogram (the numbers in both Blast and Chromas can help guide you) You will most likely notice that in the chromatogram at this position that it is either missing a base pair or one has been added InsertDelete this base pair as appropriate This is considered to be a conservative repair because gaps between closely related species are evolutionarily unlikely Figure 5 shows the corresponding chromatogram for Figure 4 Can you find the gaps

gi|22002633|gb|AY1226051| Uncultured bacterium clone OSS-41 16S ribosomal RNA gene partial sequence Length = 583

Score = 333 bits (168) Expect = 1e-88 Identities = 191196 (97) Gaps = 2196 (1) Strand = Plus Minus

Query 30 tattaccgcggnctgctggncacgtagttagccggtgcttattcttacggtaccgtcatg 89 ||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||Sbjct 195 tattaccgcgg-ctgctgg-cacgtagttagccggtgcttattcttacggtaccgtcatg 138

Query 90 tgccccaggtattaaccagagccttttcgttccgtacaaaagcagtttacaacccgaagg 149 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct 137 tgccccaggtattaaccagagccttttcgttccgtacaaaagcagtttacaacccgaagg 78

Query 150 ccttcttcctgcacgcggcattgctggatcagggttgcccccactgtccaaaattcctca 209 |||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||Sbjct 77 ccttcttcctgcacgcggcattgcaggatcagggttgcccccattgtccaaaattcccca 18

Query 210 ctgctgcctcccgtag 225 ||||||||||||||||Sbjct 17 ctgctgcctcccgtag 2

Fig 4 Example of an aligned sequence with gaps

Fig 5 Chromatogram corresponding to Figure 4 with gaps in this case two ldquoNrdquos have been inserted where they should not have been

Editing ldquoNrdquosOther sequence editing such as editing Ns is less conservative than editing gaps and should be done with caution One rule of thumb Check at least 10 alignments for the corresponding nucleotide present at the position of an N for the most closely related species If for example 10 out of 10 of these show a ldquoGrdquo go back to your chromatogram and look at this position If G is indeed the highest peak at this position- then you may change it- however you should maintain any changes in lower case What if not all of the alignments show the same base pair at this position or if the peak corresponding to that base pair is not the highest It is best to maintain that position as an N Another option that Fasta format options is for you to narrow this down using alternative symbols which represent more than one base pair See Figure 6

One more important bit of sequence editing For the clones you will need to cut out the parts of the sequence which belong to the cloning vector and not to your sequence and for the DGGE sequences you may need to cut off parts of the primers To do this just look at the Blast alignment and figure out where it starts and stops on the alignment Export your corrected chromatogram open the file in Word and cut off these parts where it starts and stops (This is where it is helpful to use the Word ldquoeditfindrdquo function) Once you have your sequence edited- save the file You should also save the html file with the Blast matches- this can be helpful later on if you need to go back to it and you do not have to wait to query the database again Go to File Save as and save as html (default) You will get an error message (ignore)

A --gt adenosine M --gt A C (amino) C --gt cytidine S --gt G C (strong) G --gt guanine W --gt A T (weak) T --gt thymidine B --gt G T C U --gt uridine D --gt G A T R --gt G A (purine) H --gt A C T Y --gt T C (pyrimidine) V --gt G C A K --gt G T (keto) N --gt A G C T (any) - gap of indeterminate length

Figure 6 Summary of FASTA format symbols

Using the Ribosomal Database Project to Classify Your Sequence

You may have noticed that Blast was not very helpful for classifying the organism represented by your sequence For this we will use the Ribosomal Database Project (RDP) This website is maintained by the Center for Microbial Ecology at Michigan State University and is an effort to phylogenetically classify all known microbial sequences

Open your corrected chromatogram file in Word You want to use this corrected sequence for RDP because it does not allow you to view and correct the actual sequence Go to httprdpcmemsueduhtml and click on ldquoEnter the Preview Siterdquo Now click on ldquoSequence Matchrdquo and copypaste your corrected sequence into the window

Conundrum In Blast it was not necessary for you to know if your sequence was ldquoforwardrdquo or ldquobackwardrdquo- Blast is smart and can figure that out In RDP however you must know this The DGGE sequences will all be in the forward direction because they were sequenced with the forward primer The clones however are randomly inserted forwards or backwards into the cloning vector In order to figure out what direction your DNA was inserted- go back to the Blast alignment and compare the numbers of ldquoQueryrdquo (your sequence) with ldquoSubjctrdquo (the sequence in the database) Are the numbers increasing for both If so your sequence was inserted in the forward direction If not then it is backwards In this case you will need to check the box which says ldquoUse the input sequences Complementedrdquo Everything else in RDP you can leave as default and finally click ldquoSubmit Sequencesrdquo

After a few seconds a tree should come up which shows the current classification of the sequences most closely related to yours This database is not as updated as Blast- so your matches may not be as high but you should have a better idea of how to classify your sequence You may also save the RDP html file for future reference Figure 7 shows the corresponding RDP tree for the Blast alignment in Fig 3

Congratulations You should now be able to identify your sequence at least to the Phylum or Class level and with some luck possibly to genus For the clones- you have longer sequence data so you may have better luck with these

Finally fill out a Table like the following in your lab book so that you can keep record of your sequences (The first one is done for you as an example) The last column is where you can make comments about the quality of the sequence data any gaps removed or Ns repaired etc The number of bp match and percent match can be determined from the Blast Alignment

Band Name Blast ID match

bp match

Ribosomal Database ID Comments

2ea1-5 Alpha ProteobacteriaSphingomonas (phenanthrene degrading)

99 170 bp

Alpha Proteobacteria SphingopyxisSphingomonas genus

Excellent Sequence Data

SEQUENCE_MATCH version 27 written by Niels Larsen

Bacteria(domain)

Proteobacteria(phylum)

Alphaproteobacteria(class)

Sphingomonadales(order)

Sphingomonadaceae(family)

Sphingomonas(genus)

S000011084 0945 1350 Sphingomonas sp JSS-28 JSS-28 KCTC 2883 AF031240

S000017176 0914 1318 uncultured soil bacterium 749-2 AF423291

S000017317 0908 1352 Sphingomonas sp BF14 BF14 (bright yellow group 1 colony type) = DSM 9257 Z23157

S000018731 0945 1350 Sphingomonas koreensis (T) JSS-26 AF131296

S000123650 0933 1196 uncultured alpha proteobacterium APe4_19 AB074601

S000135888 0945 1273 uncultured bacterium C-CF-15 AF443567

S000143882 0945 1322 uncultured alpha proteobacterium KCM-B-125 AJ581589

S000145112 0908 1367 Sphingomonas aurantiaca MA405 AJ429238

Sphingopyxis(genus)

S000004438 0982 1359 Sphingomonas sp SA-3 AF327069

S000006063 0951 1389 uncultured bacterium KRA30+14 AY081981

S000012022 0926 1325 Sphingomonas macrogoltabidus (T) IFO15033 D13723

S000015501 0908 1360 Sphingomonas sp IFO 15917 AB033950

S000015696 0939 1317 Sphingomonas macrogoltabidus IFO 15033T D84530

S000015765 0975 1325 Sphingomonas terrae (T) IFO15098 D13727

S000020374 0982 1360 Sphingomonas taejonensis (T) JSS-54 AF131297

S000021987 0939 1333 Sphingomonas adhaesiva IFO15099 D13722

S000146642 0982 1282 phenanthrene-degrading bacterium M20 M20 AY177357

S000147004 0939 1282 Sphingomonas sp 86 86 AY177366

Betaproteobacteria(class)

Burkholderiales(order)

Comamonadaceae(family)

unclassified

S000134527 0945 1264 uncultured bacterium C-FCF-16 AF443570

Fig 7 Ribsomal Database Project classification of sequence presented in Figure 3

Lab 8 Real-Time PCR

Overview Real-time PCR is a quantitative version of PCR which uses a fluorescent signal to monitor product formation in ldquoreal timerdquo The Ct value or threshold cycle correlates with the amount of template originally present A low Ct value indicates a high initial concentration of target DNA and vice versa We will meet at ERC for this lab

Real-time TaqMan PCR to Quantify Total Bacteria

We will use a TaqMan PCR assay to quantify the total bacterial populations present in your samples We will use universal PCR primers 1369F and 1492R to amplify a 123 bp region of the 16S gene We will also use probe TM1389F which targets a region between the two primers and carries the fluorescent dye Cy-6 on the 5rsquo end and the black hole quencher (BHQ) on the 3rsquo end As the Taq enzyme amplifies the region between the primers it encounters the TaqMan probe and the 5rsquo -3rsquo exonuclease activity of the enzyme releases the dye end of the primer from the quencher and thus releases the fluorescent signal The fluorescent signal is detected by the real time cycler and the data is collected by the Cephid SmartCycler software The tubes used for for the SmartCycler are specialized to maximize the signal intensity (Fig 2)

Setting up the Reactions

Each group will set up duplicate reactions for each DNA extraction The Smart Cycler can process 16 tubes at the same time We will therefore run 14 total samples (Group 4 has 1 extraction) and two of the blanks for the first run (the last two blanks will be run in a separate run) Each group will make a Master Mix for their samples according to Table 1 Prepare enough for N+1 reactions (4 samples 1 blank +1 = 6 reactions per group)

After you have prepared the Master Mix aliquot 48 microliters into two microtubes Add 2 microliters of your first DNA extraction to the first tube and 2 microliters of the second DNA extraction to the second tube Mix each tube thoroughly by vortexing then transfer 25 microliters of each mix into two Smart Cycler tubes for each sample Preparing the tubes in this way helps to get better duplication of the results Transfer the remaining master Mix to the 5th

Smart Cycler tube for the blank

1369F TM1389F

5rsquo

3rsquo

Fig 1 Schematic of TaqMan PCR of Total Bacterial 16S rRNA gene

BHQ Cy-6

Fig 2 Schematic of Cepheid SmartCycler System

Table 1 Setting up the Real Time PCR Reaction

Running the Samples

After you have prepared the SmartCycler tubes maintain them on ice until all groups are ready to run the samples When all groups are ready transfer them to the cycler- they will be run with the following program

95 ordmC 2 minutes Initial denaturing step95 ordmC 15 seconds denaturing53 ordmC 60 seconds Primer annealing72 ordmC 20 seconds extensionRepeat step 2-4 for 50 cyclesSmart Cycler cannot be set a temperature lower than 45 ordmC

The run will require 15 hours After the run is finished determine the Ct value for each sample To convert the Ct value use the following formula based on the previous calibration

Y= -028X + 9902YmdashLog [DNA]XmdashCt

Compare the value that you obtain with the original concentration of DNA that you had calculated based on absorbance at 260 nm

(calculate)Purified Water 129 microl10X buffer 25 microl5X buffer 5 microldNTP (10 mM) 05 microlPrimer 1369F 025 microlPrimer 1492R 025 microlTaqMan Probe 075 microlTaq Polymerase 035 microlMg 2+ 15 microl

Totals 24 microl

Team Assignments

Group 1Luciana Pererya Mary Beth Talty and Chris Messersmith

Group 2Ruoting Pei and Mustafa Yarkin

Group 3Anurita and Matt Stephens

Group 4Matt Hoelscher and Winnie Lin

Lab I DNA Extraction and Quantification

Objective

You will extract DNA from the sample of your choice using the QBiogene FastDNA SpinKit for Soil This method employs physical disruption of the cells (bead-beating) followed by physical binding the DNA to a silica matrix washing with an Ethanol based solution and eluting in purified water Extraction will be verified by agarose gel electrophoresis and quantified by spectrophotometry

Procedure

Selection of Sample

Each team should select a sample of Environmental Engineering relevance for DNA extraction Examples include bacterial cultures (relatively easy to extract) soil (relatively more difficult) sediment or sludge You may also choose a sample relevant to your graduate research Make sure this sample is of interest to you you will be studying this sample the rest of the semester

Bring with you enough sample to perform the extraction in duplicate For soil or other solid sample 05 g per sample is required For culture 1 ml is typically sufficient but you will need to centrifuge it first pour off the supernatant and transfer the pellet to the extraction tube If you are unsure ask the instructor for advice on what sample and how much to bring

Agarose Gel Preparation

First you will prepare an agarose gel You will need this after DNA extraction to verify that it worked You will also use this procedure throughout the semester to visualize DNA

1) Set up the casting tray in the gel caster Place the comb with the appropriate number of wells in place at one extreme end of the gel tray

Quantifying the DNA

Objective

Preparation

8F 341F 533R

5rsquo

3rsquo

Totals 24 microl

Clean up

Appendix

Primer Sequences

Procedure

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Quantifying the DNA

Objective

Preparation

8F 341F 533R

5rsquo

3rsquo

Totals 24 microl

Clean up

Appendix

Primer Sequences

Procedure

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Quantifying the DNA

Objective

Preparation

8F 341F 533R

5rsquo

3rsquo

Totals 24 microl

Clean up

Appendix

Primer Sequences

Procedure

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Quantifying the DNA

Objective

Preparation

8F 341F 533R

5rsquo

3rsquo

Totals 24 microl

Clean up

Appendix

Primer Sequences

Procedure

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Objective

Preparation

8F 341F 533R

5rsquo

3rsquo

Totals 24 microl

Clean up

Appendix

Primer Sequences

Procedure

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Clean up

Appendix

Primer Sequences

Procedure

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Clean up

Appendix

Primer Sequences

Procedure

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Clean up

Appendix

Primer Sequences

Procedure

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Appendix

Primer Sequences

Procedure

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Procedure

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

PCR of clones

Totals 25 micro l

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

PCR of DGGE bands

Totals 24 micro l

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Documenting the Gel

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Overview

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Sequence Analysis

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

bp match

99 170 bp

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Bacteria(domain)

Sphingomonas(genus)

Sphingopyxis(genus)

unclassified

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Lab 8 Real-Time PCR

1369F TM1389F

5rsquo

3rsquo

BHQ Cy-6

Running the Samples

Totals 24 microl

Running the Samples

Totals 24 microl

Running the Samples

Totals 24 microl

Documents

CE 742 Advanced Topics in Environmental Engineering Lab Manual