CDNA-AFLP Analysis on Transcripts Associated With

Biochemical Systematics and Ecology 38 (2010) 971–980

Contents lists available at ScienceDirect

Biochemical Systematics and Ecology

journal homepage: www.elsevier .com/locate/biochemsyseco

cDNA-AFLP analysis on transcripts associated with hydroxysafflor yellowA(HSYA) biosynthetic pathway in Carthamus tinctorius

Na Feng, Yakui Li, Jie Tang, Yan Wang, Meili Guo*

Department of Pharmacognosy, College of Pharmacy, Second Military Medical University, Shanghai 200433, China

a r t i c l e i n f o

Article history:Received 10 May 2010Accepted 1 September 2010Available online 29 September 2010

Keywords:Bulked segregant analysis (BSA)Carthamus tinctorius L.cDNA-AFLPEvolution analysisHydroxysafflor yellow A (HSYA)Rapid amplification of cDNA ends (RACE)

Abbreviations: Bp, base pair(s); ORF, open readincDNA amplified fragment length polymorphism; BSends.* Corresponding author. Tel./fax: þ86 21 2507457

E-mail address: [email protected] (M. Guo).

0305-1978/$ – see front matter � 2010 Elsevier Ltddoi:10.1016/j.bse.2010.09.001

a b s t r a c t

Hydroxysafflor yellow A (HSYA), an important active compound, is uniquely present in floretsof Carthamus tinctorius. In current study, we applied cDNA amplified fragment lengthpolymorphism (cDNA-AFLP) to screen genes expressed differently between plants with andwithout HSYA. One hundred and thirty-two primer combinations produced 6751 fragments,seven transcript-derived fragments (TDFs) showed consistent difference between two genepools. An independent RT-PCR expression analysis validated the expression pattern for 3TDFs (TDF-8, TDF-9 and TDF-27). The 3 TDFs were only transcripted in plants that containedHSYA, implying that they were associated with the formation of HSYA. In addition, a fulllength of TDF-8was achieved, which termed asWV-prl. Bioinformatics analysis showed thatit carried a sequence highly homologous to the Broad beanwilt virus. Our study revealed thatthe three genes are involved in the process of response to some virus infection and func-tioning in HSYA production.

� 2010 Elsevier Ltd. All rights reserved.

1. Introduction

Flavonoids are important secondary metabolites in the plant kingdom. Plants produce a wide variety of flavonoidcompounds, which play important roles in the survival of plants in their ecosystem. Plant flavonoids are therefore involved inresistance against pests, pathogens and diseases, attraction of pollinators, formation of anthocyanidins, and interaction withsymbiotic microorganisms (Dixon and Paiva, 1995; Dixon, 2001). As flavonoid compounds provide many pharmacologicallyactive agents with antioxidant, anticarcinogenic, anti-inflammatory and cardiovascular protective activities with low toxicity(Dixon and Steel, 1999), they have attracted much attention over the past decade (Barnes et al., 1994; Krakauer et al., 2001;Takahashi et al., 2001). Many investigations have disclosed the chemical structures of flavonoids in Carthamus tinctoriusL. (2n ¼ 2x ¼ 24) (Meselhy et al., 1993; Hang and Tang, 1995; Li and He, 2002), commonly known as safflower. Hydroxysaffloryellow A (HSYA), an important active member of flavonoids uniquely existing in the organ rather in the leaf, stem or root ofsafflower, is found to have a variety of biological actions (Zang et al., 2002; Jin et al., 2004; Sato et al., 2005). For example, HSYAis able to raise hypoxia tolerance, dilate the coronary artery, increase coronary blood flow, and inhibit ADP-induced plateletaggregation in rabbits (Zhu et al., 2003). But as safflower has a long history of plantation and good adaptation to the envi-ronment, intraspecific variation occurs and the content of HSYA in safflower varies greatly among different varieties (Guoet al., 2006a,b). In most cases, the natural yields of HSYA are very low, or even absent in partition of varieties.

g frame; HSYA, Hydroxysafflor yellow A; HPLC, high performance liquid chromatography; cDNA-AFLP,A, Bulked segregant analysis; TDFs, transcript-derived fragments; RACE, rapid amplification of cDNA

6.

. All rights reserved.

mailto:[email protected]

www.sciencedirect.com/science/journal/03051978

http://www.elsevier.com/locate/biochemsyseco

http://dx.doi.org/10.1016/j.bse.2010.09.001

http://dx.doi.org/10.1016/j.bse.2010.09.001

N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980972

Recently, various approaches such as introducing genes encoding the key biosynthetic enzymes or antisense genes toblock competitive pathways, or genes encoding regulatory proteins to overcome the specific rate-limiting steps have beenused to manipulate biosynthesis of flavonoids (Tanaka et al., 1998; Yu et al., 2000; Vom Endt et al., 2002). However, incomparison to other medical plants, very little research has been done on safflower with respect to transcriptome wideinformation of specific gene expression patterns based on various molecular tools, much less genes in relation to theformation of HSYA. Analysis of the molecular mechanism controlling the expression and differentiation of HSYA by moreefficient investigations is immensely important for exploitation and development of potential new medicines.

cDNA amplified fragment length polymorphism (cDNA-AFLP) is a reliable, stable and highly reproducible AFLP-basedmRNA fingerprinting technique (Bachem et al., 1996) and has beenwidely used in displaying gene differential expression andisolating genes of plants (Breyne et al., 2003; Albertini et al., 2004; Sarosh andMeijer, 2007). Recently, successful combinationof the cDNA-AFLP techniquewith bulked segregant analysis (BSA) (Michelmore et al., 1991) was used to detect expressed tags(ESTs) and clone candidate genes (Barcaccia et al., 2001; Murata et al., 2006), demonstrating that the cDNA-AFLP based BSAapproach could reveal the naturally existing genetic polymorphisms between two parental varieties contrasting in a giventrait, which can be used to get candidate genes.

Since 1997, we have undertaken studies on a molecular marker assisted breeding program targeting on HSYA analysis ofsafflower. We found that there was great genetic diversity in safflower populations by AFLP (Zhang et al., 2006) and RAPD(Guo et al., 2003). Also, pharmacologic studies with respect to chemical components of safflower showed that HSYA insafflower varies with different varieties, suggesting that the difference in HSYA content is mainly decided by heredity (Guoet al., 2006a). Zhang et al. used AFLP technology to screen theHSya-related genes. FourHSya-related genes from genomic DNAof Safflower have been identified and converted into SCAR markers (Zhang et al., 2009). To understand the mechanism ofHSYA formation, we utilized the cDNA-AFLP based BSA approach to reveal the genetic polymorphisms in expressed cDNAsequences between an HSYA present (H) pool and an HSYA absent (H0) pool and obtained a sHsp gene which suppressed theexpression of HSya (Tang et al., 2009). Furthermore, we achieved three other genes (TDF-8, TDF-9 and TDF-27) by the samemethod as Tang et al. (2009). Analysis of TDFs has revealed that TDFs as well as WV-prl gene share high homology with Broadbean wilt virus. Further investigation shows that these three genes may involve in the metabolic pathway of flavonoids andinduce the expression of HSya. The following is our first open report about this study.

2. Materials and methods

2.1. Plant materials

Two parental strains (No.0016 and No.0025) were selected from Chinese populations by our laboratory. The former (P1)was in the presence of HSYA with a content of 2.11% � 0.09% (n ¼ 83), and the latter (P2) was in the absence of HSYA witha content of 0.00% � 0.00% (n ¼ 89). The reciprocal crosses (P1 � P2, P2 � P1) were made and F1 seeds (87, 93) were hand-harvested in the summer of 2003 from the medicinal plant garden of the Second Military Medical University (Shanghai,China). The F2 seeds of the crosses were produced in the field of Sanya, Hainan Province by bagging F1 plants in paper bagsprior to the flowering period during 2003 and 2004. A segregating F2 population was obtained by shifting a single F1 (P1�P2)plant the next year in the medicinal plant garden of the said university. Two hundred and sixty-six segregating F2 individualswere obtained. F2 populations possessed the same genetic background except for HSYA difference.

2.2. Determination of HSYA content

HSYA standard sample (C27H32O16) was extracted from Flos Carthami, the purity of which was 99.5% by HPLC analysis andthe structure of which is illustrated in Fig. 1 (Guo et al., 2006b). Chromatography was performed on Agilent 1100 (USA) model510 binary gradient equipment, and an Agilent 1100 chromatography workstation equipped with an injection valve with20 mL sample loop. HSYAwas separated on a 250mm� 4.6 mm i.d., 5 mmparticle, ZORBAX SB-C18 column (Agilent Company).Optimum HPLC separation was achieved by use of 10% aqueous acetonitrile at a 1.0 mL min�1 low rate. The detectionwavelength was 403 nm and the temperature was 22 �C. Dry safflower florets (approx. 0.5 g) were weighed accurately intoa 250mL tube, extractedwith 100mLwater by soaking overnight, ultrasonicated for 20min in a sealed container, and filteredthrough a 0.45 lm Nylon syringe filter (Millex-HN, Ireland) before injection for HPLC analysis.

Fig. 1. The chemical structure of HSYA (C27H32O16).

Table 1cDNA-AFLP adapters and primer nucleotide sequences.

Adapters and primers Nucleotide sequence

EcoRI adapter 50-CTCGTAGACTGCGTACC-30

30-CTGACGCATGGTTAA-50

MseI adapter 50-GACGATGAGTCCTGAG-30

30-TACTCAGGACTCAT-50

EcoRI pre-amplification primer(E00) 50-GACTGCGTACCAATTC-30

EcoRI pre-amplification primer(M00) 50-GATGAGTCCTGAGTAA-30

MseI selective amplification primer (Eþ 2) 50-GACTGCGTACCAATTCNN -30 (N ¼ A or C or G or T)MseI selective amplification primer (Mþ 2) 50-GATGAGTCCTGAGTAANN -30 (N ¼ A or C or G or T)

N. Feng et al. / Biochemical Systematics and Ecology 38 (2010) 971–980 973

2.3. Total RNA extraction and cDNA synthesis

Total RNA was extracted from fresh florets using Plant RNA Mini Kit (Watson, China) according to the manufacturer’shandbook. First and second cDNA strands were synthesized from 20 mg total RNA with the M-MLVRTase cDNA synthesis Kit(TaKaRa, Japan) according to the manufacturer’s instructions.

2.4. Bulked segregant analysis (BSA)

For BSA, an equivalent amount of cDNA from 10 HSYA present and 10 HSYA absent in F2 populations was pooled to create Hand H0 bulks, respectively, based on the previous HSYA content from HPLC results. Both pools were analyzed using cDNA-AFLP methodology to identify different specific fragments that may be associated with the formation of HSYA.

2.5. cDNA-AFLP analysis

The cDNA-AFLP procedure was performed according to the method described by Bachem et al. (1998) with somemodifications. Double-stranded cDNA (500 ng) was digested with EcoRI andMseI (New England Biolabs, Beverly, MA, USA) ina final volume of 25 mL. EcoRI andMseI adapters (listed in Table 1) were subsequently ligated to the digested cDNA fragments.Based on the intensity on gel, digested-ligated products were diluted 10-fold for pre-amplification using primers corre-sponding to the EcoRI and MseI adapters without extension and a temperature profile including an initial step of 2 min at94 �C, followed by 25 cycles of 30 s at 94 �C, 30 s at 56 �C,1min at 72 �C and a final step of 10min at 72 �C. The 150-fold dilutedpre-amplification products were used as templates for selective amplificationwith two selective base extensions at the 30-endof the primers, and 132 possible primer combinations were performed. Amplification products were separated by electro-phoresis through a 6% denaturing polyacrylamide gel and visualized by silver staining.

2.6. Isolation and sequencing of fragments

Films were aligned with markings on gels. The bands of interest were cut out with a razor blade with meticulous care, andincubated in 50 mL water at 65 �C for 15 min and then left overnight at room temperature for elution. Eluted cDNA was re-amplified using the same PCR conditions and primer combinations as for selective amplification. The re-amplified productsrepresenting were cloned into PMD-18T vector (Takara, Japan) and sequenced (Shanghai Sangon, China).

2.7. Confirming the markers in cDNA from individual Carthamus tinctorius L. cDNA by RT-PCR

To confirm sequenced fragments, total RNA was extracted from fresh florets using Plant RNA Mini Kit (Watson, China)according to themanufacturer’s handbook, and then treated with DNase I (RNAfree, TaKaRa, Japan). RNA concentrations were

Table 2Primers used in SMART cDNA synthesis, PCRs, and sequencing.

Experiment Primer name Sequence (50–30)

SMARTcDNA synthesis SMART II� A Oligo AAG CAG TGG TAT CAA CGC AGA ATA CGC GGG50- RACE CDS primer A (T)25 V N30- RACE CDS primer A AAG CAG TGG TAT CAA CGC AGA ATA C (T)30 V NUniversal primer A Mix (UPM) Long: CTAATACGACTCACTATAGGGCAA GCA GTG TAT CAA CGC AGC GT

RACE PCR Nested universal primer A (NUP) Short: CTA ATA CGA CTC ACT ATA GGG CAAG CAG TGG TAT CAA CGC AGA GT

50- RACE GSP_anti5Race AAA CCA TTG ATA GCG GTG TCC AGATNGSP_anti5Race ATAGCGGTGTCCAGATCTACCTCAT

30- RACE GSP_sense3Race GGTAGATCTGGACACCGCTATCAATGGNGSP_sense3Race GACACCGCTATCAATGGTTTGGAAA

Fig. 2. HPLC chromatogram of the HSYA assay from Carthamus tinctorius populations. A. standard sample; B. No. 3–118, F2 individual with HSYA; C No. 3–93, F2individual without HSYA.


estimated spectrophotometrically at 260 nm. Single-stranded cDNAwas synthesized using a Reverse Transcriptase XL (AMV,TaKaRa, Japan). Specific primers were designed by Primer Premier 5.0 (Primer Biosoft International, USA) software. The RT-PCR thermo-cycling conditions and reaction systemwere as follows: an initial denaturation at 94 �C for 3minwas followed by30 cycles of 35 s at 94 �C, 35 s at 58 �C, and 1min at 72 �C with a final extension for 5 min at 72 �C. PCRwas conducted in 25 mLvolume containing 100 ng template cDNA, 0.2 mM primer each, 0.2 mM dNTPs, 1 � Taq buffer, and 1.5 mM MgCl2. Theproducts were analyzed by 2% agarose gel electrophoresis.

2.8. Rapid amplification of cDNA ends (RACE)

To obtain complete sequences of TDFs, 50 and 30 RACEs (rapid amplification of cDNA ends) were performed using anSMART RACE cDNA Amplification Kit (Clontech, USA) according to the supplier’s instructions. But the complete cDNA of


TDF-8 was only achieved in these TDFs. SMART cDNA synthesis was performed on total RNA extracts of the fresh floretsaccording to the manufacturer’s instructions (Clontech, USA), in two parallel steps. These reactions produced 50- RACE-ready cDNA and 30- RACE-PCR cDNA, respectively. Primers for each cDNA synthesis are listed in Table 2. Gene-specificprimers (GSP) and nested universal primer (NUP) were designed from the known TDF-8 domain. RACE PCR were performedusing the Advantage� 2 PCR System (Clontech, USA). PCR conditions for RACE PCR comprised of 30 s at 94 �C, 30 s at 68 �C,3 min at 72 �C for 25 cycles. The program of PCR conditions for nested RACE PCR was the same as the former for 20 cycles.RACE PCR products were analyzed by agarose gel electrophoresis. Selected bands were purified, and cDNA fragments werecloned into PMD-18T vector (TaKaRa, Japan) according to manufacturer’s recommendations. Both strands were sequencedby Invitrogen Biological Technology Company, Shanghai, China.

2.9. Nucleotide and protein sequence analysis

Database searches were performed using the BLAST Network service [NCBI (National Center for Biotechnology Informa-tion); http://www.ncbi.nlm.nih.gov/BLAST]. The sequence of each TDF was searched against all sequences in the databasesusing the BLASTN and BLASTX programs (Altschul et al., 1997). And the deduced amino acid (aa) sequences of the full length ofthe TDF-8 were compared with the homologous sequences from other species in the databases.

3. Results

3.1. cDNA-AFLP analysis

Two hundred and sixty-six F2 segregating plants were obtained by selfing a single F1 plant. F2 segregating plants wereclassified into two groups: 203 plants present in HSYA and 63 absent in HSYA. A representative HPLC chromatogram revealedthe present and absent HSYA in safflower extracts (Fig. 2). H and H0 pools were established from F2 for BSA. Each poolcontained individuals that were identical to a particular HSYA trait but arbitrary at all unlinked regions. cDNA-AFLP analysisbetween the two pools and F2 individuals verification based on BSA made it easier to find the polymorphism on theexpression level.

To investigate different expressions between present and absent HSYA in safflower, cDNA-AFLP was used as the first steptoward identifying candidate genes. Reproducibility of the technique was verified with several primer combinations onindependent cDNA synthesis and PCR amplification. Poly (Aþ) RNAwas extracted for each sample and cDNAwas amplified toscreen 132 out of the 256 possible EcoRI/MseI (Nþ2) selective primer combinations on the two pools. Themajority of the bandswere monomorphic and no significant variation in intensity was observed between the two pools. 6751 fragments rangingfrom 50 to 750 bp were surveyed in H and H0 pools, with a mean of about 51 bands per pair. A total of 33 differentiallyaccumulated TDFs from genes were identified that were present only in one pool and absent in the other. They were regardedas candidate fragments linked to HSYA. In addition, to make a further selection, silver stained cDNA-AFLP analysis was per-formed on the two parental lines and 266 individuals in the F2 segregating population to screen for the presence or absence ofTDFs and further characterize the differentially expressed genes. Figs. 3 and 4 indicated the representative amplification

Fig. 3. Silver-stained cDNA-AFLP gel showing the differential expression of the TDF-8 and TDF-9 between present and absent HSYA in Carthamus tinctoriuspopulations by primer combination EcoRI-GA/MseI-CA; Arrows designate TDFs that differ significantly in expression. M: maker; 1: female parent; 2: H pool; 3–12:F2 populations with HSYA; 13: male parent; 14: H0 pool; 15–18: F2 populations without HSYA.

http://www.ncbi.nlm.nih.gov/BLAST

Fig. 4. Silver-stained cDNA-AFLP gel showing the differential expression of the TDF-27 between present and absent HSYA in Carthamus tinctorius populations byprimer combination EcoRI-TT/MseI-AC; Arrow designates the TDF that differ significantly in expression. M: maker; 1: female parent; 2: H pool; 3–12: F2 pop-ulations with HSYA; 13: male parent; 14: H0 pool; 15–18: F2 populations without HSYA.


profiles after polyacrylamide gel electrophoresis. In addition to these presence/absence polymorphisms, polymorphisms ofless pronounced intensity were also observed within the presence/absence polymorphisms. These fragments were notcharacterized for further research. 7 TDFs showed consistent difference between each member of the two gene pools.

3.2. Validation of differential expression patterns by RT-PCR

To further characterize the differentially expressed genes, 7 of the selected differentially accumulated TDFs were checkedby RT-PCR. The RT-PCR analysis is sensitive, highly reproducible and able to reflect the complexity and relative abundance ofthe original RNA sample (Vernon et al., 2000). Suitable primer combinations were designed for 7 TDFs to test 12 random F2populations based on the TDF sequence itself, of which 3 RT-PCR products were validated. The resulting amplified productsare shown in Fig. 5.

The three TDFs that matched in the segregation analysis based on cDNA-AFLP patterns were termed as TDF-8, TDF-9 andTDF-27, whose GenBank accession number and sequence are listed below. In the 6 F2 plants, RT-PCR fragments of theexpected length were present in only 6 plants with HSYA.

TDF-8 (GenBank accession number: EU567303) 118bp.CGATGAGTCCTGAGTAAGCAAGTGTGTTCAGGAATTGTTGAGATATGGGAGGATGCATCAGCAGATTTCCCTATGGATGAGGTAGATC

TGGACACCGCTATCAATGGTTTGGAAAATG.TDF-9 (GenBank accession number: EU567305) 450bp.GCCAAAGTTCCCAGCTCCTTGCGGSSCATGAATGCTGGGGCATGCTCCAAAGTTGCTATTTGTTTGGGTAACACAATGGAAGGCTCAT

AGTAAATTGCAAAGCTAATTCTAGCATCAACTTTTGGAGCGTTTAGCCACTTGGACAATGTCTGTATAACCACCACAGGAGCATATTTGAAAGATCCTAGGTAATGCATATTCCACCAATCTGCACAAGAAAAGGGCTTGAAAACAAATTCCACGAACGGTTCTATGGCCGGATTCCACTTGTAGTGTTGAATGCCTAACAAACGTCCCAAACTTGAGCCCAAATTTGCGCTTTCATTACCCTCAACGTAACAGACTGCCAACCCTATGCCACATGTTGGAGCTACCTGACAATTGATCTTACTCAGGACTCATCAGTCATGATGAGTCCTGAGTAAGATCAGGTCCAGAATTGGTACGCTA.

TDF-27 (GenBank accession number: EU567304) 282bp.GGAGGATAAAGAGGAGGATCAGGAACTACCAATTGGGGAAGGTCATGTGGAAGAGATTGTTGACGAGTTTTTAACTAATTGCAATAT

TTCTGAGCGGAATGATCAACTATCCATTGTGGGAAACGCCAATTACCCATTTGGCCAGGGATTGTATGAGTACGCAACTCGGGTCAGTGACTCATTACTTGCAGTGATTTCGGGATCAATCAAGAAAGGCATAAATGACTTTTTGGATAAAGTGTACGCAGCTGTGAATCAGATTTTTGCAGCGTGGATGCCCAA.

Fig. 5. The confirmed results of three TDFs in Carthamus tinctorius individuals by RT-PCR. TDF-8, 9, 27 were confirmed in individuals with HSYA. 1–6: results ofHSYA present individuals; 7–12: results of HSYA absent individuals.

Fig. 6. The full length of TDF-8 was presumed to contain a 1257bp open reading frame (ORF), starting with an GTG codon at position 366–368 and terminatingwith an TAA codon at position 1620–1622, encoding a protein of 419 amino acids.


3.3. The full length of WV-prl obtained by RACE

RT-PCR analysis indicated that 3 TDFs were closely associated with HSYA, so the full length of 3 TDFs was cloned, only toachieve TDF-8. The 429 bp and 1858 bp cDNA for TDF-8 were obtained by 50 and 30 RACE, respectively. The full length of TDF-8


obtained 2315 bp cDNA and was designated asWV-prl (GenBank accession no. GU380344). The sequence of this cDNA and itsputative derived protein are shown in Fig. 6.

3.4. Analysis of nucleotide and protein sequence

The putative gene function for each sequence was investigated by a similarity search using BLAST Network service. BLASTsearches in the NCBI database indicated that 3 sequences were highly homologous (>80%) with known genes. Nucleotidesequence analysis showed that TDF-8 shared high homology with BBWV-2 RNA1 putative RNA polymerase, and that TDF-9was a homologue of BBWV-2 mRNA. TDF-27 showed great homology with Patchouli Mild Mosaic Virus RNA1 for polyprotein.The full length cDNA of WV-prlwas presumed to contain a 1257 bp open reading frame (ORF), starting with an GTG codon atposition 366–368 and terminating with an TAA codon at position 1620–1622, encoding a protein of 419 amino acids witha calculated molecular mass of 48011.34D (pI 7.07). Homologous analysis at the protein level showed that WV-prl carrieda highly homology (97%) to Broad bean wilt virus. These results indicated that WV-prl was a member of the genus Fabavirus.Broad bean wilt virus is a member of the genus Fabavirus of the family Comoviridae (Fauquet et al., 2005), and containsa cofactor required for proteinase (Co-pro), putative helicase (Hel), genome-linked protein (VPg), proteinase (Pro), andRNA-dependent RNA polymerase (RdRp) conserved domains. Alignments of WV-prl and Broad bean wilt virus2 indicated thatWV-prl is of high identity to RdRp, ranging from 1349 bp to 1638 bp (Fig. 7).

4. Discussion

Our previous studies showed that sHSP only expressed in HSYA-absent lines and it might be directly or indirectly disturbthe HSYA biosynthetic pathway (Tang et al., 2009). The present study further investigated differentially expressed TDFs of

Fig. 7. A. Lines and large boxes represent non-coding sequence and long open reading frames, respectively. Vertical lines through the boxes indicate putativecleavage sites. Calculated relative molecular mass values for each protein and positions of consensus sequences for cofactor required for proteinase (Co-pro),helicase(Hel), genome-linked protein(VPg), proteinase (Pro), and RNA-dependent RNA polymerase(RdRp) are indicated. B. Alignments of CT-cpl and Broad beanwilt virus2.


interest on the basis of BSA-AFLP analysis, using RACE to get the full-length gene of TDF-8. We compared the differential geneexpression patterns between HSYA present and absent segregating bulks. 266 F2 individual identification and RT-PCR vali-dation were also processed. The results showed that the three TDFs were present only in the female parent and in HSYA-present lines, implying that proteins encoded by these fragments may be involved in regulation of HSYA.

Homologous analysis of the TDFs sequences generated significant matches to sequence databases. Interestingly, the TDFswere highly homologous with the gene coding protein of Broad beanwilt virus and Patchouli mild mosaic virus. Broad bean wiltvirus 1 (BBWV-1), BBWV-2, Patchouli mild mosaic virus (PatMMV) and Lamium mild mosaic virus (LMMV) are four recognizedspecies that compose the genus Fabavirus of the family Comoviridae (Wellink et al., 2000). Fabaviruses have icosahedralvirions composed of two coat proteins and bipartite, infecting a wide range of host plants worldwide, including economicallyimportant horticultural and ornamental species, and aphid-transmitted in a nonpersistent mode (Vittoria and Guido, 1996).BBWV, in particular, infested a lot of beans, complicated with ring spot, stunting, wilting or withering. Besides, secondarymetabolites such as flavonoids could be mobilized to protect the plant from pathogen attacks. Flavonoids are a diverse groupof compounds with a wide range of biological effects, especially anti-viral activity against a range of plant viruses, forexample, high concentrations of flavonoids in fruits often go parallel with a low incidence by pathogens (Lattanzio et al., 1994;Lattanzio, 2003). Tobacco mosaic virus infectivity was reduced by a range of flavonoids. Quercetin and morin were alsoreported to prevent the formation of lesion in quinoa effected by potato virus X in a low concentration (1g$mL�1) (French andTowers,1992). Beckman reviewed the possible role of preformed phenolics in periderm formation inwilt disease resistance ina time–space model of host–parasite interactions (Beckman, 2000). The connection between the amount of flavonoids andthe degree of wilt-resistance of the plants such as cotton, kenaf was also observed (Navrezova et al., 1986). Flavonoids couldinactivate recognition sites on the viral coat proteinwhich interact with host recognition sequences required for the initiationof infection (French and Towers, 1992). However, the replication of viruses was not inhibited by flavonoids treated such as inTobacco mosaic virus (TMV) situations (Chen et al., 2003). In China, after Chinese soybeans were infested by soybean mosaicvirus, the content of flavonoids was significant higher in resistant species than susceptible species (Zhu et al., 2001). All theopinions were supported by Ryder et al. (1987) with the similar conclusion that the CHS gene could be induced by fungusinfested and mechanical wounding. It also happened in CHS gene of Phaseolus vulgaris (Mehdy and Lamb, 1987).

All the evidence implies that safflower might be infested by BBWV, mosaic virus or other virus or fungus long time ago,which induced the production of HSYA with antivirus activity to inhibit the virus at the moment, but cannot prevent thereplication of virus. Finally, safflower allowed the microbe to enter the symbiotic modus and caused systemic acquiredresistance (SAR). More interestingly, we also obtained a full length of TDF-8 (WV-prl gene) by RACE that carried a highlyhomologous sequence (97% identity) to the Broad bean wilt virus from safflower.

In conclusion, the study clearly shows various genes involved in HSYA production. Although further clues are needed tounderstand physiological roles of these genes, the findings obtained suggest that these three genes are absolutely involved ina process of response to some virus infection and functioning in HSYA production. Our workmay help elucidate themolecularbasis of this pathway and identify more genes closely related to this pathway.

Acknowledgments

This study was supported by the National Natural Science Foundation of China (30772734), “863” project (2008AA02Z137)grants from the Ministry of Science and Technology of P. R. China.

References

Albertini, E., Marconi, G., Barcaccia, G., Raggi, L., Falcinelli, M., 2004. Isolation of candidate genes for apomixis in Poa pratensis L. Plant Mol. Biol. 56, 879–894.Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein

database search programs. Nucleic Acids Res. 25, 3389–3402.Bachem, C.W.B., Van der Hoeven, R.S., de Bruijn, S.M., Verudenhil, D., Zabeau, M., Visser, R.G.F, 1996. Visualization of differential gene expression using

a novel method of RNA fingerprinting based on AFLP analysis of gene expression during potato tuber development. Plant J 9, 745–753.Bachem, C.W.B., Oomen, R.J.F.J., Visser, R.G.F., 1998. Transcript imaging with cDNA-AFLP: a step-by- step protocol. Plant Mol. Biol. Rep. 16, 157–173.Barcaccia, G., Varotto, S., Meneghetti, S., Albertini, E., Porceddu, A., Parrini, P., Lucchin, M., 2001. Analysis of gene expression during flowering in apomeiotic

mutants of Medicago spp: cloning of ESTs and candidate genes for 2n eggs. Sex Plant Reprod. 14, 233–238.Barnes, S., Peterson, T.G., Grubbs, C., Setchell, K.D.R., 1994. Potential role of dietary isoflavones in the prevention of cancer. In: Jacobs, M.M. (Ed.), Diet and

Cancer: Markers, Prevention, and Treatment. Plenum Press, New York, pp. 135–147.Beckman, C.H., 2000. Phenolic-storing cells: keys to programmed cell death and periderm formation in wilt disease resistance and in general defence

responses in plants. Physiol. Mol. Plant Pathol. 57, 101–110.Breyne, P., Dreesen, R., Cannoot, B., Rombaut, D., Vandepoele, K., Rambauts, S., Vanderhaeghen, R., Inze, D., Zabeau, M., 2003. Quantitative cDNA-AFLP

analysis for genome-wide expression studies. Mol. Genet. Genomics 269, 173–179.Chen, Q.J., Liu, G.K., Wu, Z.J., Lin, Q.Y., Xie, L.H., 2003. The inhibition effect of flavonoids extracted from Bidens pliosa L. on TMV. Journal of Fujian Agriculture

and Forestry University 32, 181–184.Dixon, R.A., 2001. Natural products and plant disease resistance. Nature 411, 843–847.Dixon, R.A., Paiva, N.L., 1995. Stress-induced phenylpropanoid metabolism. Plant Cell 7, 1085–1097.Dixon, R.A., Steel, C.L., 1999. Flavonoids and isoflavonoids-a gold mine for metabolic engineering. Trends Plant Sci. 4, 394–400.Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A., 2005. Virus Taxonomy, Eighth Report of the International Committee on Taxonomy of

Viruses. Elsevier Academic Press, San Diego.French, C.J., Towers, G.H.N., 1992. Inhibition of infectivity of potato virus X by flavonoids. Phytochemistry 31, 3017–3020.Guo, J., Jiang, R.H., Kamphuis, L.G., Govers, F., 2006a. A cDNA-AFLP based strategy to identify transcripts associated with avirulence in Phytophthora infestans.

Fungal Genet. Biol. 43, 111–123.


Guo, M.L., Jiang, W., Zhang, Z.Z., Zhang, G., Mao, J.F., Yin, M., Su, Z.W., 2003. Randomly amplified polymorphic DNA technique in molecular identification ofgermplasms of Carthamus tinctorius L. Acad. J. Sec Mil Med. Univ. 24, 1116–1119.

Guo, M.L., Zhang, G., Zhang, W., Zhang, H.M., Su, Z.W., 2006b. Determination of Safflor yellow A by RP-HPLC and Resources quality comparison in safflower.China J. Chin. Materia Med. 31, 1234–1236.

Hang, L.J., Tang, Y.X., 1995. Study on the chemical component of Cartharmus timctorious. Mod. Appl. Pharm 12, 19–21.Jin, M., Li, J.R., Wu, W., et al., 2004. Study on the antioxidative effect of Safflor Yellow. China J. Chin. Materia Med. 29, 447–449.Krakauer, T., Li, B.Q., Young, H.A., 2001. The flavonoid baicalin inhibits superantigen-induced inflammatory cytokines and chemokines. FEBS Lett. 500,

52–55.Lattanzio, V., 2003. Bioactive polyphenols: their role in quality and storability of fruit and vegetables. J. Appl. Bot. 77, 128–146.Lattanzio, V., Cardinali, A., Palmieri, S., 1994. The role of phenolics in the potsharvest physiology of fruits and vegetables: browning reactions and fungal

diseases. Ital J. Food Sci. 1, 3–22.Li, F., He, Z.S., 2002. Flavonoids from Carthamus tinctorius. Chin. J. Chem. 20, 699–702.Mehdy, M.C., Lamb, C.J., 1987. Chalcone isomerase cDNA cloning and mRNA induction by fungal elicitor, wounding and infection. EMBO J. 6, 1527–1533.Meselhy, M.R., Kadota, S., Momose, Y., Hatakeyama, N., Kusai, A., Hattori, M., Namba, T., 1993. Two new quinochalcone yellow pigments from Carthamus

tinctorius and Ca2þ antagonistic activity of tinctormine. Chem. Pharm. Bull. 41, 1796–1802.Michelmore, R.W., Paran, I., Kesseli, R.V., 1991. Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to

detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. USA 88, 9828–9832.Murata, J., Bienzle, D., Brandle, J.E., Sensen, C.W., De, Luca V, 2006. Expressed sequence tags from Madagascar periwinkle (Catharanthus roseus). FEBS Lett.

580, 4501–4507.Navrezova, N., Agzamova, M., Stepanichenko, N.N., Makhsudova, B., 1986. Action of the flavonoids quercetin 3-rutinoside and kaempferol 3, 7-dirhamnoside

on the biosynthesis of melanin in Verticillium dahliae. Chem. Nat. Comp. 22, 229–230.Ryder, T.B., Hedrick, S.A., Bell, J.N., Liang, X.W., Clouse, S.D., Lamb, C.J., 1987. Organization and differential activation of a gene family encoding the plant

defense enzyme chalcone synthase in Phaseolus vulgaris. Mol. Genet. Genomics. 210, 219–233.Sarosh, B.R., Meijer, J., 2007. Transcriptional profiling by cDNA-AFLP reveals novel insights during methyl jasmonate, wounding and insect attack in Brassica

napus. Plant Mol. Biol. 64, 425–438.Sato, S., Nojiri, T., Onodera, J.I., 2005. Studies on the synthesis of safflomin-A, a yellow pigment in safflower petals: oxidation of oxidation of 3-C-beta-D-

glucopyranosyl-5-methylphloroacetoPhenone. Carbohydr. Res. 340, 389–393.Takahashi, K., Morikawa, A., Kato, Y., Sugiyama, T., Koide, N., Mu, M.M., Yoshida, T., Yokochi, T., 2001. Flavonoids protect mice from two types of lethal shock

induced by endotoxin. FEMS Immunol. Med. Microbiol. 3l, 29–33.Tanaka, Y., Tsuda, S., Kusumi, T., 1998. Metabolic engineering to modify flower color. Plant Cell Physiol 39, 1119–1126.Tang, J., Lou, Z.Y., Wang, Y., Guo, M.L., 2009. Expression of a small heat shock protein (CTL-hsyapr), screened by cDNA-AFLP approach, correlated with

hydroxysafflor yellow A in Safflower (Carthamus tinctorius L.). BIOCHEM SYST ECOL. Accepted.Vernon, S.D., Unger, E.R., Rajeevan, M., Dimulescu, I.M., Nisenbaum, R., Campbell, C.E., 2000. Reproducibility of alternative probe synthesis approaches for

gene expression profiling with arrays. J. Mol. Diagn. 2, 124–127.Vittoria, L., Guido, B., 1996. Fabaviruses: Broad bean wilt virus and allied viruses. In: Harrison, B.H., Murant, A.F. (Eds.), The Plant Viruses. Polyhedral Virions

and Bipartite RNA Genomes, vol. 5. Plenum Press, New York, pp. 229–250.Vom Endt, D., Kijne, J.W., Memelink, J., 2002. Transcription factors controlling plant secondary metabolism: what regulates the regulators. Phytochemistry

61, 107–114.Wellink, J., Le Gall, O., Sanfacon, H., Ikegami, M., Jones, A.T., 2000. Family Comoviridae. In: Van Regenmortal, M.H.V., Fauquet, C.M., Bishop, D.H.L.,

Carstens, E.B., Estes, M.K., Lemon, S.M., Maniloff, J., Mayo, M.A., McGeoch, D.J., Pringle, C.R., Wickner, R.B. (Eds.), Virus Taxonomy: Seventh Report of theInternational Committee on Taxonomy of Viruses. Academic Press, San Diego, pp. 695–697.

Yu, O., Jung, W., Shi, J., Croes, R.A., Fader, G.M., McGonigle, B., Odell, J.T., 2000. Production of the isoflavones genistein and daidzein in non-legume dicot andmonocot tissues. Plant Physiol. 124, 781–794.

Zang, B.X., Jin, M., Si, N., Zhang, Y., Wu, W., Piao, Y.Z., 2002. Antagonistic effect of hydroxysafflor yellow A on the platelet activating factor receptor. ActaPharm. Sin. 37, 696–699.

Zhang, L., Huang, B.B., Yin, K.G., Guo, M.L., 2006. Analysis of intraspecific variation of Chinese Carthamus tinctorius L. using AFLP markers. Acta Pharm. Sin. 41,91–96.

Zhang, Z.Z., Guo, M.L., Zhang, J.D., 2009. Identification of AFLP fragments linked to hydroxysafflor yellow A in Flos Carthami and conversion to a SCAR markerfor rapid selection. Mol. Breed. 23, 229–237.

Zhu, H.B., Teng, B., Gao, F.L., Wu, Z.P., 2001. Changes of some biochemical characters of soybean with different resistant levels infected by SMV1. ActaAgriculturae Boreali-occidentalis Sinica 10, 38–40.

Zhu, H.B., Wang, Z.H., Ma, C., Tian, J., Fu, F., Li, C., Guo, D., Roeder, E., Liu, K., 2003. Neuroprotective effects of hydroxysafflor yellow A: in vivo and in vitrostudies. Planta Med. 69, 429–433.

Documents

CDNA-AFLP Analysis on Transcripts Associated With