cBot User Guide - FANTOM · 2019. 2. 20. · cBot User Guide iii Notice This document and its contents are proprietary to Ill umina, Inc. and its affiliates ("Ill umina"), and are

ILLUMINA PROPRIETARYCatalog # SY-920-1001Part # 15006165 Rev C

FOR RESEARCH USE ONLY

cBotUser Guide

GT

GAAAAAAACAAAAAAACCCAAAAAAAA

GCCGGGGGT

ATGCATGCATGCATGCATCAT

GCATGCATGCA

G

TAG

CC

cBot User Guide iii

Notice

This document and its contents are proprietary to Illumina, Inc. and its affiliates ("Illumina"), and

are intended solely for the contractual use of its customer in connection with the use of the

product(s) described herein and for no other purpose. This document and its contents shall not

be used or distributed for any other purpose and/or otherwise communicated, disclosed, or

reproduced in any way whatsoever without the prior written consent of Illumina. Illumina does

not convey any license under its patent, trademark, copyright, or common-law rights nor similar

rights of any third parties by this document.

The instructions in this document must be strictly and explicitly followed by qualified and

properly trained personnel in order to ensure the proper and safe use of the product(s)

described herein. All of the contents of this document must be fully read and understood prior

to using such product(s).

FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS

CONTAINED HEREIN MAY RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS,

INCLUDING TO USERS OR OTHERS, AND DAMAGE TO OTHER PROPERTY.

ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE

PRODUCT(S) DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE) OR ANY USE

OF SUCH PRODUCT(S) OUTSIDE THE SCOPE OF THE EXPRESS WRITTEN LICENSES OR

PERMISSIONS GRANTED BY ILLUMINA IN CONNECTION WITH CUSTOMER'S ACQUISITION

OF SUCH PRODUCT(S).

FOR RESEARCH USE ONLY

© 2009–2010 Illumina, Inc. All rights reserved.

Illumina, illuminaDx, Solexa, Making Sense Out of Life, Oligator, Sentrix, GoldenGate, GoldenGate Indexing, DASL, BeadArray, Array of Arrays, Infinium, BeadXpress, VeraCode, IntelliHyb, iSelect, CSPro, GenomeStudio, Genetic Energy, HiSeq, and HiScan are registered

trademarks or trademarks of Illumina, Inc. All other brands and names contained herein are the

property of their respective owners.

Phusion is a trademark of Finnzymes Oy. Notice to Purchaser: Limited license (proofreading DNA polymerases). The purchase price of this

product includes a limited, non-transferable license under U.S. and foreign patents (5,500,363

and 5,352,778) owned by New England Biolabs, Inc. to use this product. No other license under

these patents is conveyed expressly or by implication to the purchaser by the purchase of this

product. The purchase price of this product includes a limited, non-transferable license under

U.S. and foreign patents owned by BIO-RAD Laboratories, Inc., to use this product. No other

license under these patents is conveyed expressly or by implication to the purchaser by the

purchase of this product.

Revision History v

cBot User Guide

Revision History

Revision history for part # 15006165:

Revision Date Description of Change

C May 2010 Updated software descriptions to cBot v1.1, which includes on-screen indicators for flow cell type and the option to bypass sensors.

Added flow cell storage recommendation.

Increased water wash volume to 12 ml and DECON to 10 ml.

B March 2010 Added instructions for loading the HiSeq flow cell, and associated templates and primers.

Added instructions for installing the HiSeq flow cell adapter plate.

Added HiSeq Cluster Generation Kit catalog numbers and kit descriptions.

Added reagent preparation instructions for Small RNA Sequencing Primer.

Corrected centrifuge instructions for thawing cBot reagent plate.

Added instructions for setting local date and time using the Time tab.

Added monthly maintenance wash procedure.

Removed safety labeling section. See the cBot Safety and Compliance Booklet for important cautions and warnings.

A October 2009 Initial release

cBot User Guide vii

Table of Contents

Notice. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . iii

Revision History . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v

Table of Contents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . vii

List of Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

Chapter 1 Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2

Audience and Purpose. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2

cBot Components . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3

Technical Assistance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5

Chapter 2 Getting Started . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7

Preparing Your Site . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8

Installing the cBot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11

Configuring the cBot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15

Changing the Adapter Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20

Chapter 3 Using the Software Interface . . . . . . . . . . . . . . . . . . 21

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22

Start Screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23

Run Setup Screens . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24

Run Status Screen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27

Shutting Down the cBot. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29

Remote Monitoring Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30

Chapter 4 Using the cBot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

cBot Cluster Generation Kits . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

Flow Cell Adapter Plates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33

cBot Cluster Generation Workflow . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34

Preparing DNA Template for Cluster Generation . . . . . . . . . . . . . . . . . . . . 35

96-Well Reagent Plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38

Thawing cBot Reagents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39

viii Table of Contents

Catalog # SY-920-1001

Part # 15006165 Rev. C

Prepare Small RNA Primer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40

Setting Up the Run. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41

Monitoring the Run . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58

Performing Post-Run Procedures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59

Chapter 5 Maintenance and Troubleshooting . . . . . . . . . . . . . 63

Performing Periodic Maintenance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64

Performing a Monthly Maintenance Wash . . . . . . . . . . . . . . . . . . . . . . . . . . 65

Troubleshooting. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68

Appendix A Cluster Generation Chemistry . . . . . . . . . . . . . . . . . 69

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70

Adapter Ligation and Selection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70

Cluster Generation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71

Appendix B Manual Settings . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73

Manual Commands . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74

Resetting the Barcode Scanner . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77

Protocol Editor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83

cBot User Guide ix

List of Tables

Table 1 Illumina General Contact Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5

Table 2 Illumina Customer Support Telephone Numbers . . . . . . . . . . . . . . . . . . . . . 5

Table 3 Shipping Container Dimensions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8

Table 4 cBot Dimensions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8

Table 5 Environmental Constraints . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10

Table 6 Sensor Status Icons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26

Table 7 cBot Cluster Generation Kits . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32

Table 8 Adjustments to the Protocol for High Final DNA Concentrations . . . . . . . . 36

Table 9 cBot Periodic Maintenance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64

Table 10 Troubleshooting Run Problems . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68

Table 11 Protocol Editor Icons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81

x List of Tables


Part # 15006165 Rev. C

cBot User Guide 1

Chapter 1

Overview

Topics2 Introduction

2 Audience and Purpose

3 cBot Components

5 Technical Assistance

2 CHAPTER 1

Overview


Part # 15006165 Rev. C

Introduction

The Illumina cBot Cluster Generation System provides complete automation of a complex process. With very little hands-on time and no reagent preparation, the cBot uses bridge amplification to create over 100 million DNA templates simultaneously in less than five hours.

The cBot dispenses reagents from a pre-aliquoted 96-well plate, and controls reaction times, flow rates, and temperatures. The run is set up using the cBot software interface, which simplifies operation and provides a visual report of run status. An on-instrument barcode reader records the reagents and flow cell used for each experiment.

Figure 1 Illumina cBot

The cBot User Guide provides information about installing, operating, and maintaining the Illumina cBot. Additionally, this guide describes site requirements, instrument components, and software features.

Audience and Purpose

This guide is for laboratory personnel and other individuals responsible for:

Operating the Illumina cBot

Performing instrument maintenance

Training personnel on the cBot

cBot Components 3

cBot User Guide

cBot Components

cBot features include an on-instrument touch screen monitor and barcode scanner. The thermal stage and reagent stage are located under the cBot lid. The waste bottle is conveniently stored in the waste bottle compartment.

Touch screen monitor—The touch screen monitor displays the software

interface, which guides you through each step of the cluster generation

process. For more information, see Using the Software Interface on

page 21.

Barcode scanner—The on-instrument barcode scanner records the

unique ID numbers of the reagent plate and flow cell used with the run.

The cBot uses this information to verify the compatibility of the selected

protocol and loaded reagents.

Thermal stage—The thermal stage holds the flow cell and controls its

temperature throughout the run. For more information, see Thermal Stage on page 4.

Reagent stage—The reagent stage holds the 96-well reagent plate, the

templates, and any custom or specialty primers. For more information,

see Reagent Stage on page 4.

Waste bottle compartment—The waste bottle compartment holds a

sensor-controlled 250 ml waste bottle that collects reagents after they

have passed through the flow cell and manifold.

Figure 2 cBot Components

Reagent Stage

Barcode Scanner

Waste Bottle Compartment

Thermal Stage

Touch Screen Monitor

cBot Lid

4 CHAPTER 1

Overview


Part # 15006165 Rev. C

Thermal Stage The thermal stage holds the flow cell and the manifold is seated over the flow cell. The flow cell clamp locks the flow cell and manifold in place.

Figure 3 Thermal Stage

The manifold is a single-use component used to perform all chemistry steps of a cluster generation run. The inlet end of the manifold, positioned toward the front of the cBot, contains a series of sippers called the sipper comb. The sipper comb pierces the foil-sealed reagent tubes seated in the reagent plate and delivers the appropriate reagents to the flow cell. cBot sensors detect if the sipper comb is correctly snapped into place before allowing a run to proceed.

The outlet end of the manifold, positioned toward the rear of the cBot, receives the liquid flowing out of the flow cell, and then transfers it to the waste container. The outlet clamp locks the outlet end in place.

Reagent Stage The reagent stage holds a 96-well reagent plate, a 0.2 ml eight-tube strip containing the template, and an optional 0.2 ml eight-tube strip containing any additional primers required for applications that do not use the standard primers included in the reagent plate.

The reagent plate is loaded onto the stage and locked into position by the white reagent plate lever.

Figure 4 cBot Reagent Stage

Flow Cell Clamp

Flow Cell and Manifold

Sipper Comb

Thermal Stage

Outlet Clamp

96-Well Reagent Plate

Reagent Plate Lever

Templates

Custom Primers

Technical Assistance 5

cBot User Guide

Technical Assistance

For technical assistance, contact Illumina Customer Support.

MSDSs

Material safety data sheets (MSDSs) are available on the Illumina website at http://www.illumina.com/msds.

Product Documentation

If you require additional product documentation, you can obtain PDFs from the Illumina website. Go to http://www.illumina.com/documentation. When you click on a link, you will be asked to log in to iCom. After you log in, you can view or save the PDF.

If you do not already have an iCom account, then click New User on the iCom login screen and fill in your contact information. Indicate whether you wish to receive the iCommunity newsletter (a quarterly newsletter with articles about, by, and for the Illumina Community), illumiNOTES (a monthly newsletter that provides important product updates), and announcements about upcoming user meetings. After you submit your registration information, an Illumina representative will create your account and email login instructions to you.

Table 1 Illumina General Contact Information

Illumina Website http://www.illumina.com

Email [email protected]

Table 2 Illumina Customer Support Telephone Numbers

Region Contact Number

North America toll-free 1.800.809.ILMN (1.800.809.4566)

United Kingdom toll-free 0800.917.0041

Germany toll-free 0800.180.8994

Netherlands toll-free 0800.0223859

France toll-free 0800.911850

Other European time zones +44.1799.534000

Other regions and locations 1.858.202.ILMN (1.858.202.4566)

http://www.illumina.com

http://www.illumina.com/msds

http://www.illumina.com/documentation

6 CHAPTER 1

Overview


Part # 15006165 Rev. C

cBot User Guide 7

Chapter 2

Getting Started

Topics8 Preparing Your Site

11 Installing the cBot

15 Configuring the cBot

20 Changing the Adapter Plate

8 CHAPTER 2

Getting Started


Part # 15006165 Rev. C

Preparing Your Site

This section describes the cBot physical dimensions, electrical requirements, and environmental constraints.

Lab Space Reserve sufficient laboratory space to unpack your cBot. The cBot shipping container has the following dimensions:

Reserve sufficient laboratory space and a lab bench that is capable of safely holding the weight of the cBot. The cBot has the following dimensions:

Figure 5 cBot Dimensions, Lid Open

Power Connections

Place the instrument at least six inches away from the wall so that you can easily reach the power connections on the back of the cBot.

Table 3 Shipping Container Dimensions

Width Height Depth Weight

52 cm (20.5 in.) 51 cm (20.25 in.) 75 cm (29.5 in.) 34 kg (75 lbs.)

Table 4 cBot Dimensions

WidthHeight (Lid Closed)

Height (Lid Open)

Depth Weight

38 cm (15 in.) 39 cm (15.5 in.) 70 cm (27.5 in.) 71 cm (25.5 in.) 31 kg (68 lbs.)

70 cm (27.5 in.)

71 cm (25.5 in.)

39 cm (15.5 in.)

Preparing Your Site 9

cBot User Guide

Electrical Requirements

Power Consumption

The line voltage of the cBot is 100–240 volts AC, running at 50/60 Hz. The cBot typically consumes approximately 300 watts and has a maximum of 500 watts. It should be connected to an uninterruptible power supply (UPS) to protect your cBot in the event of a power surge or loss.

The cBot requires a 6–10 amp grounded, dedicated line with proper voltage (100–240 volts AC) and an electrical ground.

Electrical Standards

The cBot is certified to these standards:

Conforms to UL STD 61010-1

Certified to CSA STD C22.2 No 61010-1

Low Voltage Directive (Product Safety) IEC 61010-1

EMC Directive IEC 61326-1

Power Cords

The cBot comes with an international standard IEC 60320 receptacle and is shipped with a region-specific power cord. Allow a maximum of 2 m (6 ft.) between the instrument AC power inlet and facility power.

Fuses

Use only the manufacturer’s recommended fuse specification, as described below.

Littelfuse: part # 218008.HXP

Time Lag (SLO BLO) Type

250 VAC, 5A

5×20 mm

Do not replace any fuses. Contact Illumina Technical Support for preventative maintenance.

Coin Cell Battery

The coin cell battery on the instrument computer motherboard is not a user-replaceable part.

The coin cell battery is not rechargeable. Under no circumstances attempt to recharge the battery.

CAUTIONNever use an extension cord to connect your cBot.

10 CHAPTER 2

Getting Started


Part # 15006165 Rev. C

Environmental Constraints

Consult your facilities department regarding environmental constraints before installing your cBot.

Table 5 Environmental Constraints

Condition Acceptable Range

Temperature 22°C ±3°C

Humidly Relative humidity between 20–80%, non-condensing

Ventilation Maximum thermal output is approximately ~2550 Btu/h (~750 W)

Installing the cBot 11

cBot User Guide

Installing the cBot

Installing the Illumina cBot takes approximately 15 minutes. It is shipped in one box with the following contents:

cBot instrument

HiSeq flow cell adapter plate

Power cord

Waste bottle

Quick setup poster

User guide

Exterior Components

Lid—Covers the thermal stage, reagent stage, and wash reservoir.

Waste bottle compartment—Holds the sensor-controlled waste bottle.

Barcode scanner—Scans barcodes of run components.

Monitor—Displays the cBot user interface.

Power switch—Turns on your instrument.

Start switch—Launches the cBot software. The start switch is located to

the left of the waste bottle compartment.

Figure 6 cBot Exterior Components

NOTEIf your cBot was stored in a cold location, allow it to reach room temperature before proceeding.

NOTESave the packing material and shipping box for use in case you ever need to ship your cBot to Illumina for servicing.

Power Switch

Monitor

Barcode Scanner

Lid

Waste Bottle Compartment

12 CHAPTER 2

Getting Started


Part # 15006165 Rev. C

Unpack and Inspect

1. Snip the shipping straps wrapped around the shipping box.

2. Lift the top of the shipping box straight up using the cutout handles on

each end.

3. Locate the power cord and waste bottle, and set them aside.

4. With one person standing in front of the instrument and one person

standing behind it, lift the instrument from the packaging by placing your

hands under the long side panels. Cutouts in the foam packing mark the

best positions for lifting.

5. Place the cBot on a lab bench or suitable location, positioning it so you

can inspect all sides of the instrument.

6. Inspect the condition of the following components:

• Make sure the instrument panels are intact.

• Inspect the touch screen for cracks or scratches.

• Ensure that coolant did not leak during shipment. Check for moisture

inside the box.

If any of the above items are unsatisfactory, immediately contact Illumina Technical Support for further instructions.

Figure 7 cBot Rear Panel Components

NOTEDo not cut the shipping tape on top of the box. The top of the shipping box is designed to lift off of the instrument.

NOTE

Never lift the cBot from the front or rear panels, barcode scanner, or any location other than the long side panels. These panels are not designed to support the weight of the instrument.

Coolant Level

Coolant Reservoir Cap

AC Power Inlet

Ethernet Connection

Installing the cBot 13

cBot User Guide

7. Check the coolant level through the view port on the rear panel of the

instrument. The green liquid coolant level should be just below the

coolant reservoir cap.

Figure 8 Coolant Level

If the coolant level is low, top up the coolant. Use the same coolant provided with the Illumina sequencing instrument (part # 1003709).

a. Use a wide coin or flat screwdriver to remove the reservoir cap.

b. Fill the reservoir with Illumina-supplied coolant to just below the

reservoir fill port.

c. Replace the reservoir cap.

Position and Connect

1. Remove the protective foam block from the barcode scanner.

2. Lift the cBot lid.

3. Remove the protective foam block from the reagent area.

4. Press the top-right corner of the waste compartment door, then quickly

release to open the door.

5. Remove the protective foam block from the waste bottle compartment.

6. Lift the waste bottle lever and position the waste bottle under the lever,

slightly tipping the mouth of the bottle to clear the spout.

Figure 9 Install the Waste Bottle

Coolant Level Low

Coolant Level Good

Waste Bottle

Waste Bottle Lever

14 CHAPTER 2

Getting Started


Part # 15006165 Rev. C

7. Lower the lever to secure the waste bottle into position. The spout

should sit inside the mouth of the wash bottle.

8. Remove the protective sheet from the cBot monitor.

9. Connect the power cord to the AC power inlet on the rear panel, and

then connect to facility power.

Figure 10 Power Inlet and Ethernet Connection

10. If you are planning to configure your cBot for a network connection,

connect a user-supplied RJ45 Ethernet cable to the Ethernet port.

11. Position your cBot on the lab bench at least 15.25 cm (6 in.) away from

the wall or other obstruction. Ensure it is sitting level on the bench.

12. Locate the power switch on the right side of the instrument and toggle

the switch to the ON position.

13. Locate the start button to the left of the waste bottle compartment door

and press to start the cBot software.

Figure 11 cBot Start Button

The software initiates a start-up routine. When the start-up routine is complete, the Start screen appears on the monitor.

14. Proceed to Configuring the cBot on page 15.

NOTE

Always use the Illumina-supplied waste bottle. Do not use any other waste bottle in the cBot waste compartment or the electronic sensors that detect the presence and fill level of the waste bottle will not function properly.

AC Power Inlet

Ethernet Connection

Start Button

Power Switch

Configuring the cBot 15

cBot User Guide

Configuring the cBot

You can configure the cBot using the touch screen monitor. Configuration steps include naming your instrument, determining run requirements, and selecting input types. Using a network connection, you can enable remote monitoring and email alerts.

Start Screen Menu

1. Touch Menu in the upper-left corner of the screen, and select Configure.

The keyboard appears.

Figure 12 Start Screen Menu

2. Enter the default password using the keyboard:

a. Touch the Shift key to display lower case letters.

b. Type the default password, admin. The default password must be

entered using lower case letters.

Figure 13 Keyboard

c. Touch Enter. The configuration screen appears.

Start Screen Menu

16 CHAPTER 2

Getting Started


Part # 15006165 Rev. C

Configure Run Requirements

The configuration screen contains three tabs: the Run Setup tab, the Remote tab, and the Alerts tab.

From the Run Setup tab, you can name your instrument, configure wash and sensor bypass options, and indicate which fields are required input before each run can begin. These settings can be modified as needed before the start of each run.

Figure 14 Run Setup Tab

1. Touch StationName to name your cBot. The keyboard appears.

2. Type the name of your instrument using the touch screen keyboard, and

touch Enter.

3. Touch the radial buttons to select pre-run and post-run wash options.

4. To provide the option to allow a run to proceed even if an invalid sensor

reading occurs during the pre-run check, touch the checkbox Allow Sensor Bypass. This option is disabled by default.

If this feature is enabled, the option appears on the pre-run check screen if the pre-run check fails due to sensor failure. You must visually confirm that the run components are loaded correctly before bypassing sensors and proceeding to the fluidics check. For more information, see Perform Pre-Run Check on page 55.

5. Touch the checkbox to select which fields are required input at the start

of each run.

Fields include user name, experiment name, reagent kit ID, flow cell ID, primer name, and template name.

Required Fields

Station Name

Wash and Sensor Bypass Options

NOTETouch the Shift key to activate lower case letters.

Touch the Alt key to activate symbol keys.

NOTEFor optimal performance, Illumina recommends an instrument water wash before and after each run.


cBot User Guide

Enable Remote Monitoring

From the Remote tab, you can configure the system to monitor your run remotely using the remote monitoring feature. A network connection is required.

1. Touch the Remote tab.

2. Touch the checkbox next to Allow Remote Access.

The IP address of the instrument appears on the screen.

Figure 15 Remote Tab

3. Use your web browser from another computer to access the remote

monitoring feature. For more information, see Remote Monitoring Overview on page 30.

Set Up Email Alerts

From the Alerts tab, you can configure the system to send an email alert if a system issue occurs or when a run is complete. A network connection is required.

1. Touch the Alerts tab.

Figure 16 Alerts Tab

2. Touch SMTP Server. The keyboard appears.

Notification Events

Email Addresses

Email Server

18 CHAPTER 2

Getting Started


Part # 15006165 Rev. C

3. Using the keyboard, enter the smtp server name, and then touch Enter.

4. Touch Server Path. The keyboard appears.

5. Using the keyboard, enter the email smtp server port, and then touch

Enter.

6. Enter the email address for each intended alert recipient:

a. Touch Add to add the email address of alert recipients. The

keyboard appears.

b. Using the keyboard, enter an email address, and then touch Enter.c. Touch Add again to enter an additional email address.

d. To test an email address, highlight the address and touch Test.

7. In the Notification Events area, touch the checkbox to identify which

events trigger an email alert.

Set Date and Time

From the Time tab, you can set your instrument to the current date and your local time.

1. Touch the Time tab.

2. Touch Edit Date/Time. The Windows Date and Time Properties dialog

box appears.

Figure 17 Time Tab

3. Select the appropriate time zone for your area, the current date, and the

current time.

4. Touch OK to close the Windows Date and Time Properties dialog box.

The changes appear on the Time Tab.

NOTEConsult your network administrator for the name of your smtp server and email smtp port.


cBot User Guide

Close Configuration

Screen

When you have finished configuring the setup options, touch Save and Exit.

Figure 18 Save and Exit

The cBot Start screen appears. You are ready to start a cluster generation run.

Save and Exit

20 CHAPTER 2

Getting Started


Part # 15006165 Rev. C

Changing the Adapter Plate

You can cluster a Genome Analyzer flow cell v4 or a HiSeq flow cell on the cBot. Each flow cell type requires that a specific adapter plate is installed on the cBot prior to starting the run. Icons on the start page indicate which adapter plate is currently installed on the instrument.

Use the following instructions to change the flow cell adapter plate for the flow cell you are using:

1. Open the cBot lid by gently lifting from the top-right corner.

2. Lift the flow cell clamp.

3. Loosen the two captive Phillips head screws securing the adapter plate.

Figure 19 Flow Cell Adapter Plate

4. Lift the existing adapter plate from the thermal stage and set aside.

5. Make sure the thermal stage is clean. If any salt build up is present, wipe

the stage with a lint-free cleaning tissue slightly moistened with water.

6. Position the new adapter plate on the thermal stage, aligning the sensor

arm with the corresponding slot on the right side of the thermal stage.

Figure 20 Sensor Arm Location

7. Tighten the two Phillips head screws to secure the adapter plate.

8. For optimal heat transfer, ensure that the adapter plate is sitting flat and

the screws are tightened evenly.

9. Wipe the installed adapter plate with a lint-free cleaning tissue

moistened with water, and then wipe dry with a clean tissue. Do not allow

fluids to drip inside the instrument.

Adapter PlateCaptive Screws

Sensor Arm

on Genome Analyzer

Adapter Plate

Sensor Arm

on HiSeq

Adapter Plate

cBot User Guide 21

Chapter 3

Using the Software Interface


23 Start Screen

24 Run Setup Screens

27 Run Status Screen

29 Shutting Down the cBot

30 Remote Monitoring Overview

22 CHAPTER 3



Part # 15006165 Rev. C

Introduction

The cBot software interface provides ease of use in setting up your run, confirming installation of run components, and monitoring the run as it progresses. The following software screens are used to perform a run:

Start screen—See Start Screen on page 23.

Run Setup screens—See Run Setup Screens on page 24.

Run Status screen—Run Status Screen on page 27.

Using the cBot software interface, you can configure input requirements, wash preferences, email notifications, and remote monitoring. For more information, see Configuring the cBot on page 15.

Additional features include tools for customizing protocols and setting manual controls for troubleshooting. For more information, see Manual Commands on page 74 and Protocol Editor on page 79.

Start Screen 23

cBot User Guide

Start Screen

The cBot Start screen appears when the system power is on and the software is running. You can leave your cBot sitting idle on the Start screen between runs.

This section describes each area of the Start screen:

Menu Button—The Start screen menu contains options for accessing the

configuration screen, manual command settings, protocol editor, and

viewing the About screen.

User Name—Touch User Name to enter the name of the person

performing the run. You can configure the user name to be optional

input or required input. For more information, see Configuring the cBot on page 15.

Start Button—Touch Start to proceed to the Run Setup screen. Be sure

you have made any necessary changes to run configurations before

proceeding.

Error Messages—Error messages appear if required input is missing or if

the system is not responding. For example, if you touch Start without

entering a user name, and user name is required input, a message

appears. For more information, see Troubleshooting on page 68.

Sensor Status—Provides status of cBot components. Sensors read the

status of the cBot lid, waste bottle, coolant system, and sipper comb. For

more information, see Sensor Status Icons on page 26.

Figure 21 cBot Start Screen

Touch Start to proceed to the Run Setup screen.

Menu Button

User Name

Start Button

Error Messages

Sensor Status

24 CHAPTER 3



Part # 15006165 Rev. C

Run Setup Screens

The Run Setup screens guide you through the pre-run setup steps. For detailed instructions, see Setting Up the Run on page 41.

Wash—Perform a pre-run wash. You can configure wash requirements on

the configuration screen. For more information, see Configuring the cBot on page 15.

Protocol—Name your experiment and select a protocol.

Reagents—Record the reagent kit ID and load reagents.

Flow Cell—Record the flow cell ID and load the flow cell.

Manifold—Load the manifold and secure the sipper comb.

Tube Strips—Enter a templates name and load the eight-tube strip

containing templates. If you use a protocol that requires additional

primers, enter the primers name and load the eight-tube strip containing

primers.

Pre-Run Check—The software automatically checks the run readiness of

each component and performs a flow check. The flow check uses a set of

eight integrated bubble sensors to test the fluidics before each run.

Upon completion of the pre-run check, you are ready to start a cluster generation run.

Run Setup Screen Features

Each Run Setup screen contains instructional messages, sensor status, and input fields. If run components are missing or installed incorrectly, the cBot system provides a warning. These warnings must be corrected before you can begin the run.

Required input, such as reagent ID and flow cell ID may be scanned using the barcode scanner, or you can touch the keyboard icon to activate the touch screen keyboard and type your component ID.

Figure 22 Run Setup Screen

Required Input

Next Button (Inactive)

Run Setup Steps

Previous Button

Keyboard Input

(Optional)

Run Setup Screens 25

cBot User Guide

Some steps require you to manually enter input, while other input is entered by the system using instrument sensors.

System Input—Input entered by the system is indicated by a half

checkbox. On the Wash screen, for example, sensors detect if the

manifold is installed or removed.

Manual Input—Input you enter manually is indicated by a full checkbox.

On the Wash screen, for example, you must manually touch the

checkbox to indicate that the reservoir is filled with water.

Figure 23 Run Setup Screen Features

Sensor icons at the bottom of the screen indicate when run components are properly loaded, when the waste bottle is full, or if there is a problem in the cooling system. For more information, see Sensor Status Icons on page 26.

At any time during run setup, you can view the run data summary or access the Help screen. Run data summary lists the input you have entered so far. The Help screen provides detailed descriptions and instructional videos.

The Next button becomes active when you have provided the required input for each run setup step. If a component is missing or the system is waiting for input, an instructional message prompts you to the next step.

Manual Input

Sensor Icons

Instructional Messages

Help Screen

System Input

Run Summary

26 CHAPTER 3



Part # 15006165 Rev. C

Sensor Status Icons

The sensor status icons indicate if a component is properly installed and ready for the run. The following table describes the various states of the system status icons.

Table 6 Sensor Status Icons

Component Icon Indication/Meaning

cBot lid cBot lid is open. You must close the lid during operation.

cBot lid is closed.

Waste Bottle Waste bottle is present and ready for use.

Waste bottle is full.

Waste bottle is missing.

Coolant Coolant is flowing and coolant level is good.

Warning: Coolant is flowing, but coolant level is low.

Error: Coolant is not flowing, but coolant level is good.

Error: Coolant is not flowing and coolant level is low.

Manifold and Sipper Comb

Manifold is loaded and sipper comb is secure.

Manifold is missing or sipper comb is not secure.

Flow Cell Genome Analyzer flow cell adapter plate installed.

HiSeq flow cell adapter plate installed.

Flow cell adapter plate type unknown.

Run Status Screen 27

cBot User Guide

Run Status Screen

The Run Status screen provides an at-a-glance status of the current cluster generation run and includes the following run details:

Status bar showing run progress

Start date and time, end date and time, and time remaining

Cluster generation protocol steps with status bar for each step

Reagent currently in use

Current temperature (°C)

Status of the command in the current step

Figure 24 Run Status Screen

During the run, a screensaver appears showing the run countdown time and status bar. Touch the countdown to toggle through view options: status bar only, countdown only, or both countdown and status bar. Touch the lower portion of the screensaver to return to the Run Status screen.

Figure 25 Run Status Screensaver

Visual Status Bar

Protocol Steps

Sensor Icons

Start Date/Time

End Date/Time

Time Remaining

Reagent

Temperature

Command Time

Command Status

Toggle Between Run Steps and Temp Graph

28 CHAPTER 3



Part # 15006165 Rev. C

Pausing or Aborting a Run

During a run, you can pause or abort the run using buttons on the Run Status screen.

Pause—Completes the current command in the protocol, and then

pauses the run. The run may take a few minutes before it pauses. When

the run is paused, the Pause button changes to the Resume button.

• When the run is active, touch Pause to pause the run.

• When the run is paused, touch Resume to resume the run.

Figure 26 Run Status Screen in Pause Mode

Abort Run—Aborts the run without the option of resuming. At this point

you are prompted to unload the run components.

Pause/Resume RunAbort Run

NOTEAborting a run is final. You cannot resume the run from this point. Touch Unload and unload run components.

Shutting Down the cBot 29

cBot User Guide

Shutting Down the cBot

It is not necessary to shut down your cBot between runs. It is designed to continue running in an idle state on the Start screen.

In the case you need to shut down your cBot, you can access the command from the configuration screen.

1. Touch Menu and select Configure. The keyboard appears.

2. Enter the default password using the keyboard:

a. Touch the Shift key to display lower case letters.

b. Type the default password, admin. The default password must be

entered using lower case letters.

c. Touch Enter. The configuration screen appears.

3. From the configuration screen, touch Menu and select Shut Down Station. The cBot software shuts down.

Figure 27 Shut Down Station

4. To power down your cBot, toggle the power switch on the right side

panel to the OFF position.

Reboot in FSE Mode

The option to reboot in FSE Mode is for use by a trained Illumina Field Application Scientist or Field Service Engineer to update software or service the instrument.

30 CHAPTER 3



Part # 15006165 Rev. C

Remote Monitoring Overview

Remote monitoring is a feature that allows you to monitor the status of your cBot from another computer via your internal network. To take advantage of the remote monitoring feature, make sure the following requirements are met:

Your cBot must be connected to a network.

Allow Remote Access is selected on the Remote tab. For more

information, see Enable Remote Monitoring on page 17.

The next step is to go to the remote monitoring IP address listed on the Remote tab of your cBot, and add your cBot to the remote monitoring site.

Add Your cBot 1. Use your web browser to navigate to the remote monitoring IP address

listed on the Remote tab of the cBot configuration screen.

2. In the text box next on the remote monitoring screen, enter the IP

address of your cBot. This is the same IP address listed on the Remote

tab of your cBot. For more information, see Enable Remote Monitoring

on page 17.

3. Click Add Instrument.

An image that represents your instrument appears on the screen.

Figure 28 Remote Monitoring Screen

The remote monitoring screen shows each of the instruments you have added by instrument name. At a glance, this screen allows you to monitor the progression of the run and see the current state of the instrument. There are four possible states: running, paused, stopped, or error.

Enter cBot IP Address

31

cBot User Guide

Chapter 4

Using the cBot


32 cBot Cluster Generation Kits

33 Flow Cell Adapter Plates

34 cBot Cluster Generation Workflow

38 96-Well Reagent Plate

35 Preparing DNA Template for Cluster Generation

39 Thawing cBot Reagents

41 Setting Up the Run

58 Monitoring the Run

59 Performing Post-Run Procedures

32 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

Introduction

This chapter lists the kits required for cluster generation on the cBot, and explains how to properly thaw the cBot reagent plate, load run components, and perform a cluster generation run.

If you are planning to alter the protocol in any way, you must do so before setting up the run. For more information, see Protocol Editor on page 79.

cBot Cluster Generation Kits

cBot cluster generation kits are shipped on dry ice. When you receive your kit, store kit components at temperatures specified in Table 7.

Single-read kits and paired-end kits are available for the Genome Analyzer and the HiSeq™ sequencing system. Each kit contains the required components for performing one cluster generation run on the cBot.

Table 7 cBot Cluster Generation Kits

Cluster Generation Kit Kit Components Storage Requirements

Genome Analyzer Single-Read Cluster Generation Kit

Catalog # GD-300-1001

Single-read Genome Analyzer Flow Cell v4 2° to 8°C

cBot manifold for Flow Cell v4 Room temperature

Single-read 96-well reagent plate

(For more information, see 96-Well Reagent Plate on page 38)

-15° to -25°C

HT1 (Hybridization Buffer) for diluting templates and primers

-15° to -25°C

Small RNA Sequencing Primer (optional) -15° to -25°C

Genome Analyzer Paired-End Cluster Generation Kit

Catalog # PE-300-1001

Paired-End Genome Analyzer Flow Cell v4 2° to 8°C

cBot manifold for Flow Cell v4 Room temperature

Paired-end 96-well reagent plate


-15° to -25°C


-15° to -25°C

Paired-End Reagent Kit (used with sequencing protocols on the Genome Analyzer)

(For more information, see the Genome Analyzer User Guide)

-15° to -25°C

Flow Cell Adapter Plates 33

cBot User Guide

For troubleshooting purposes, a cBot Rehybridization Kit (part # 15011039) is available through Illumina Technical Support or your Field Application Scientist (FAS). This kit is used on the cBot with protocols titled Repeat_Hyb_v<#> or Repeat_TubeStripHyb_v<#> included with the cBot software.

Flow Cell Adapter Plates

The HiSeq flow cell and Genome Analyzer flow cell require specific adapter plates. Adapter plates are provided with the instrument. If you do not have the appropriate adapter plate for the flow cell you are using, contact Illumina Technical Support for ordering information.

HiSeq Single-Read Cluster Generation Kit

Catalog # GD-401-1001

Single-read HiSeq flow cell 2° to 8°C

cBot manifold for HiSeq flow cell Room temperature

Single-read 96-well reagent plate


-15° to -25°C


-15° to -25°C

Small RNA Sequencing Primer (optional) -15° to -25°C

HiSeq Accessories Kit (contains gaskets, bottle caps, and ICR instrument bottle used with sequencing protocols on the HiSeq)

(For more information, see the HiSeq 2000 User Guide)

Room temperature

HiSeq Paired-End Cluster Generation Kit

Catalog # PE-401-1001

Paired-end HiSeq flow cell 2° to 8°C

cBot manifold for HiSeq flow cell Room temperature

Paired-end 96-well reagent plate


-15° to -25°C


-15° to -25°C

Read 2 Cluster Resynthesis Kit (used with sequencing protocols on the HiSeq)


-15° to -25°C

HiSeq Accessories Kit (contains gaskets, bottle caps, and ICR instrument bottle used with sequencing protocols on the HiSeq).


Room temperature

Table 7 cBot Cluster Generation Kits (Continued)

Cluster Generation Kit Kit Components Storage Requirements

34 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

cBot Cluster Generation Workflow

A cluster generation run on the cBot requires very little preparation. Cluster generation reagents are provided in an easy to use 96-well plate containing pre-mixed reagents. After thawing and vortexing, the reagents are ready for use on the instrument. For more information, see Thawing cBot Reagents on page 39.

To prepare for a run, you first need to select a protocol and then load four run components. A run requires the flow cell, one single-use manifold, the cBot reagent plate, and your templates. Additional primers may also be loaded on the cBot should you wish to customize your experiment.

Following run preparation, a cluster generation run on the cBot takes about four hours to complete.

Figure 29 Cluster Generation Workflow

Thaw & Mix Reagents

Perform a Pre-Run Wash

Unload Run Components

Perform a Post-Run Wash

Confirm Reagent Delivery

Perform a Pre-Run Check

& Start the Run

Select a Protocol

& Load Run Components

Prepare DNA Template

Preparing DNA Template for Cluster Generation 35

cBot User Guide

Preparing DNA Template for Cluster Generation

This section explains how to prepare your DNA template for cluster generation. An alternate template preparation method is describe in the qPCR Quantitation Protocol, part # 11322363 (Appendix B).

There are two steps involved in preparing the DNA template. The first step is to denature with 2 N NaOH, and then dilute DNA into hybridization buffer.

Consumables Illumina-SuppliedHT1 (Hybridization Buffer)

User-Supplied2 N NaOH

Tris-Cl 10 mM, pH 8.5

0.2 ml eight-tube strip

DNA Template DNA Template Storage

Illumina recommends storing prepared DNA template at a concentration of 10 nM.

For single-read libraries, 10 nM is ~1.9 ng/μl for 290 bp fragments

including adapter length.

For paired-end libraries, 10 nM is ~2.0 ng/μl for 310 bp fragments

including adapter length.

Adjust the concentration for your prepared DNA samples to 10 nM using Tris-Cl 10 mM, pH 8.5.

For long-term storage of DNA samples at a concentration of 10 nM, add Tween 20 to the sample to a final concentration of 0.1% Tween. This helps to prevent adsorption of the template to plastic tubes upon repeated freeze-thaw cycles, which would decrease the cluster numbers over time.

DNA Concentration

The flow cell has eight parallel lanes for processing up to eight different DNA samples. The first time you process a sample, it is useful to try a concentration range to optimize the number of clusters formed.

If the DNA concentration is too low, too few clusters will be generated

and the sequencing yield will be low.

If the DNA concentration is too high, the clusters will be too dense and

can overlap, complicating sequencing data analysis.

Procedure Denature DNA Template

Use the following instructions to denature the template DNA with 2 N NaOH to a final DNA concentration of 1 nM. This is suitable for performing the hybridization step on the cBot at a DNA concentration up to 8 pM.

If you require a higher DNA concentration, see Denaturing High Concentrations of DNA on page 36 for suggested adjustments.

36 CHAPTER 4

Using the cBot

Part # 15006165 Rev. C

1. Combine template DNA, Tris-Cl, and 2 N NaOH in the following

volumes:

• 10 nM Template DNA (2 μl)

• Tris-Cl 10 mM, pH 8.5 (17 μl)

• 2 N NaOH (1 μl)

The total volume should be 20 μl (template final concentration 1 nM).

2. Vortex briefly to mix the template solution.

3. Pulse centrifuge the solution.

4. Incubate for five minutes at room temperature to denature the template

into single strands.

5. Place the template on ice until you are ready to proceed to final dilution.

Denaturing High Concentrations of DNA

Use the following table only if you require a DNA concentration higher than 4 pM; otherwise, follow the protocol Denature DNA Template on page 35.

Dilute Denatured DNA

Use the following instructions to dilute the denatured DNA with pre-chilled HT1 to a total volume of 1,000 μl. Illumina recommends that you perform a titration of your DNA template to determine a good density of clusters.

1. Remove HT1 (Hybridization Buffer) from -15° to -25°C storage and thaw

at 2° to 8°C overnight or in a beaker of room temperature deionized

water.

2. To reach the desired final concentration for the hybridization step, dilute

denatured DNA as follows:

CAUTION

Excess NaOH concentrations (greater than 800 μM) in diluted samples inhibits the formation of clusters, an effect which occurs if you add more than 8 μl of the NaOH denaturated DNA sample to 1 ml of hybridization buffer.

Table 8 Adjustments to the Protocol for High Final DNA Concentrations

Desired Final DNA Concentration in 1 ml

Template DNA (10 nM)

Tris-Cl 10 mM, pH 8.5 2 N NaOH Concentration of

Denatured Template DNA

4–8 pM 2 μl 17 μl 1 μl 1.0 nM

8–12 pM 3 μl 16 μl 1 μl 1.5 nM

12–16 pM 4 μl 15 μl 1 μl 2.0 nM

16–20 pM 5 μl 14 μl 1 μl 2.5 nM

20–24 pM 6 μl 13 μl 1 μl 3.0 nM

Preparing DNA Template for Cluster Generation 37

cBot User Guide

3. Invert several times to mix the template solution.

4. Pulse centrifuge the solution.

5. Label the tubes of an eight-tube strip 1–8.

6. Dispense 120 μl of the control library into tube 4 of the eight-tube strip.

This will place the control sample in lane 4 on the flow cell.

7. Add 120 μl of diluted, denatured sample DNA template into the

remaining tubes of an eight-tube strip. Take careful note of which

template goes into which numbered tube.

8. Record each sample position and concentration on the lab tracking form.

9. Set aside on ice until you are ready to load it onto the instrument.

Required Final Concentration

5 pM 6 pM 7 pM 8 pM

1.0 nM Denatured DNA 5 μl 6 μl 7 μl 8 μl

Pre-chilled HT1 995 μl 994 μl 993 μl 992 μl

NOTECluster generation on the cBot results in a higher cluster density than the same DNA library on the Cluster Station.

NOTE

The Multiplexing Sequencing Primers and PhiX Control Kit contains a PhiX174 library amplified using PCR Primer Index 3. Illumina recommends using this control library on lane 4 of the flow cell.

38 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

96-Well Reagent Plate

To ensure proper performance, it is very important to promptly store the cBot reagents at -15° to -25°C until you are ready to use them.

The 96-well reagent plate contains 11 rows of foil-sealed eight-tube strips filled with cluster generation reagents. Row 12 of the reagent plate is empty.

Figure 30 cBot 96-Well Reagent Plate

Each reagent tube strip is labeled with the reagent name followed by a number. The number indicates the row it occupies on the reagent plate. Should any tube strips become dislodged from the reagent plate holder, use the row number on the label to return the tube strip to the appropriate position on the plate.

Reagent Plate Contents

Row 1–HT1 (Hybridization Buffer)

Row 2–HFE (1X Phusion™ Master Mix, Finnzymes Oy)

Row 3–APM1 (AMX1 Premix)

Row 4–AMX1 (Amplification Mix)

Row 5–AT1 (100% Formamide)

Row 6–AMX1 (Amplification Mix)

Row 7–HT2 (Wash Buffer)

Row 8–Single-Read Kit: LS1 (Linearization Solution)

Row 8–Paired-End Kit: LMX1 (Linearization Mix)

Row 9–BMX (Blocking Mix)

Row 10–HP5 (0.1 N NaOH)

Row 11–HP1 (Sequencing Primer)

Row 12–Empty

Row 1

Row 11

NOTE

HP1 (Sequencing Primer) is compatible with all applications except small RNA and experiments that require a custom primer for Read 1. For more information, see Prepare Small RNA Primer on page 40.

WARNINGWARNING

This set of reagents contain an aliphatic amide that is a probable reproductive toxin. Personal injury can occur through inhalation, ingestion, skin contact, and eye contact. Dispose of containers and any unused contents in accordance with the governmental safety standards for your region. For more information, see the MSDS for this kit, at http:\\www.illumina.com\msds.

Thawing cBot Reagents 39

cBot User Guide

Thawing cBot Reagents

Use the following instructions to thaw cBot reagents.

Consumables Illumina-Supplied96-well reagent plate from a cBot Cluster Generation Kit

Best Practices Wear a fresh pair of gloves when setting up a run.

Hold the 96-well reagent plate by the plate base to avoid dislodging any

reagent tubes.

Always check that the tubes are securely seated in the reagent plate

before and after vortexing or inverting reagents. Loose reagent tubes

can damage the cBot manifold and stop the run.

Procedure Reagents take a minimum of 60 minutes to thaw using a water bath. Alternatively, you can thaw the reagents at 2° to 8°C overnight or approximately 16 hours.

1. Remove the reagent plate from -15° to -25°C storage.

2. Press down on each row of tubes in the reagent plate to ensure that they

are securely seated in the plate.

3. Place the reagent plate in an ice bucket or water bath containing only

enough room temperature tap water to submerge the reagent plate

base. To prevent contamination, do not allow the water to touch the foil

seals. Allow the reagents to thaw in the water bath for at least

60 minutes.

4. Remove the thawed reagent plate from the water bath and gently pat dry

with paper towels.

5. Hold the reagent plate by the base and place your other hand on top of

the tubes, then invert the reagent plate five times to mix the thawed

reagents.

6. Hold the reagent plate by the base and place your other hand on top of

the tubes, then vortex the plate for approximately 10 seconds to

dislodge any trapped air bubbles.

7. Tap the reagent plate on a hard surface 5–10 times to collect any reagent

droplets to the bottom of the tubes. Alternatively, pulse centrifuge the

reagent plate to collect reagent droplets.

8. Proceed to setting up the run. Do not allow reagents to sit at room

temperature for an extended period of time.

NOTE

The clear plastic lid on the reagent plate protects the foil seals from being damaged or punctured during thawing. Remove the protective lid only when necessary, such as when you are checking that tubes are securely seated.

NOTEReagent tubes in the center of the plate take longer to thaw. Inspect the reagents to ensure they have completely thawed.

40 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

Prepare Small RNA Primer

If you are preparing a single-read flow cell with small RNA or gene expression libraries, you need to prepare Small RNA Sequencing Primer prior to your run. The prepared primer is loaded onto the cBot in the eight-tube strip holder labeled Primers at the front of the reagent stage. For more information, see Load Primers on page 53.

Consumables Illumina-SuppliedSmall RNA Sequencing Primer (provided in the cBot Single-Read Cluster Generation Kit)

HT1 (Hybridization Buffer)

Procedure 1. Remove HT1 (Hybridization Buffer) from -15° to -25°C storage and thaw

at 2° to 8°C overnight or in a beaker of room temperature water.

2. Thaw the tube containing 10 μl Small RNA Sequencing Primer at room

temperature. This will take only a few minutes.

3. When the Small RNA Sequencing Primer is thawed, vortex for a few

seconds and briefly centrifuge.

4. Add 5 μl of Small RNA Sequencing Primer to 995 μl of HT1.

5. Vortex for a few seconds, and then briefly centrifuge.

6. Label the tubes of an eight-tube strip 1–8.

7. Aliquot 120 μl of the diluted sequencing primer into each tube of the

eight-tube strip.

8. Proceed directly to Setting Up the Run on page 41. When prompted,

load the eight-tube strip containing primer on the cBot as described in

Load Primers on page 53.

Setting Up the Run 41

cBot User Guide

Setting Up the Run

This section describes how to set up a run and load run components on the cBot. You may configure some steps to be optional, such as user name or experiment name, for example. For more information, see Configure Run Requirements on page 16.

Enter User Name

1. Touch User Name. The keyboard appears.

2. Using the keyboard, type your name and then touch Enter.

3. Touch Start to proceed to the pre-run wash.

Figure 31 Start Screen

Perform a Wash The cBot software checks the system to ensure that the flow cell and manifold have been removed before beginning a wash.

1. Confirm that the checkbox next to Manifold Removed is selected. If it is

not selected, you must remove the manifold before proceeding. For

more information, see Unload Run Components on page 59.

If the pre-run wash has been configured as optional, you can touch Skip to bypass the pre-run wash.

Figure 32 Perform a Wash

42 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

2. Raise the cBot lid by gently lifting from the top-right corner.

3. Fill the wash reservoir, located behind the thermal stage, with

approximately 12 ml deionized water.

Figure 33 Fill the Wash Reservoir

4. Close the cBot lid.

5. Touch the checkbox on the screen to indicate that water is present. The

Wash button becomes active.

6. Touch Wash. After the wash is finished, the Wash Reservoir Dry button

becomes active.

7. Blot out any excess water remaining in the wash reservoir with a low-lint

wipe, taking care not to rub the outlet ports as this can cause fibers to

clog the holes.

Wash Reservoir


cBot User Guide

Figure 34 Dry the Wash Reservoir

8. Touch the checkbox on the screen to indicate that the wash reservoir is

dry. The Next button becomes active.

9. Touch Next to proceed to selecting the protocol.

Select a Protocol 1. Touch Experiment Name. The keyboard appears.

2. Using the touch screen keyboard, type your experiment name and then

touch Enter.

3. Select the appropriate protocol for your experiment from the list of

protocols. Touch the scroll bar to scroll through available protocols.

Figure 35 Select a Protocol

4. Touch Next to proceed to the reagents step.

NOTEcBot cluster generation protocols perform a complete cluster generation run, including steps for amplification, linearization, blocking, and primer hybridization.

44 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

Load Reagents 1. Remove the clear plastic lid from the cBot reagent plate.

2. Gently press down on the thawed and vortexed tubes in the reagent

plate to make sure they are securely seated in the plate.

3. Touch Scan Reagent ID to activate the barcode scanner.

Alternatively, you can enter the reagent ID using the keyboard. Touch the keyboard icon to activate the keyboard option.

Figure 36 Load Reagents

4. Hold the reagent plate level with the barcode label facing the

instrument, and move the reagent plate into the light path of the

barcode scanner.

Figure 37 Scan Reagent ID

You will hear a beep when the scanner has successful read the barcode. The reagent ID appears on the screen.

5. Raise the cBot lid.

6. With the reagent plate in one hand, use the other hand to pull the

spring-loaded reagent plate lever towards you to release the clamp.

7. Place the reagent plate onto the reagent stage, positioned with row 1

facing towards the front of the instrument directly behind the eight-tube

strip holder. Ensure the beveled corner of the plate is positioned in the

front-right corner.

Keyboard Option


cBot User Guide

Figure 38 Position the Reagent Plate

Figure 39 Position of Row 1

8. Push the reagent plate lever back to the secure the reagents in place.

9. Touch the checkbox on the screen to indicate that the reagent plate is

loaded.

Figure 40 Reagent Plate Loaded

10. Touch Next to proceed to loading the flow cell.

Reagent Lever

Row 1

46 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

Load Flow Cell

1. Lift the flow cell clamp.

2. Wash the adapter plate on the thermal stage with a small amount of

deionized water, and wipe dry with a lint-free cleaning tissue. Do not

allow fluids to drip inside the instrument.

3. Remove the flow cell from the storage tube using plastic forceps or metal

forceps with tips wrapped tightly in parafilm.

4. Holding the flow cell by the edges, rinse the flow cell with deionized

water.

5. Gently dry the flow cell with a lint-free cleaning tissue using a sweeping

motion. Repeat until the flow cell is completely clean and dry.

6. Touch Scan Flow Cell ID to activate the barcode scanner.

Alternatively, you can enter the reagent ID using the keyboard. Touch the keyboard icon to activate the keyboard option.

Figure 41 Load the Flow Cell

7. Hold the flow cell close to the scanner tray with the barcode positioned

toward the instrument.

The white background of the barcode scanner tray is necessary for successful scanning.

8. Slowly slide the flow cell into the light path of the barcode scanner so the

entire barcode crosses the scan light at the same time.

CAUTION

Lane orientation for the HiSeq flow cell is opposite of the Genome Analyzer flow cell. The Genome Analyzer flow cell lane orientation is lane 1–8, left to right, while the HiSeq flow cell lane orientation is lane 8–1, left to right. Use the following instructions to correctly load the flow cell.

NOTEIf you plan to store the flow cell after completing cluster generation, make sure you retain the storage tube and storage buffer.

Keyboard Option


cBot User Guide

Figure 42 Scan Flow Cell ID

You will hear a beep when the scanner has successfully read the barcode. The flow cell ID appears on the screen.

Figure 43 On-Screen Loading Instructions

9. Do one of the following depending on the flow cell you are using:

• Genome Analyzer—Place the flow cell on the thermal stage with the

holes facing upward, lane 1 on the left side, and lane 8 and the

barcode on the right side. If your flow cell has black masking, the

barcode may not be visible.

Figure 44 Position Genome Analyzer Flow Cell

Instructions for proper flow cell orientation

(Genome Analyzer shown)

Lane 8

Barcode on Right Side

48 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

• HiSeq—Place the flow cell on the thermal stage with holes facing

upward, lane 1 on the right side, and lane 8 and the barcode on the

left side. With holes facing up, the barcode on the HiSeq flow cell is

facing down and not visible when the flow cell is positioned correctly.

Figure 45 Position HiSeq Flow Cell

10. Touch the checkbox to indicate that you have loaded the flow cell.

11. Touch Next to proceed to loading the manifold.

Load Manifold Make sure that you use the manifold provided in the same cluster generation kit as the flow cell. Manifolds are specific to the size of the flow cell.

1. Remove the manifold from the packaging and inspect the sippers on the

sipper comb.

• Ensure the sippers are straight and have not been bent or damaged.

• Ensure the black rubber gaskets are evenly seated.

2. Position the manifold over the flow cell with the sipper comb pointing

toward the front of the cBot.

NOTE

When the HiSeq flow cell is loaded onto the cBot, the lanes are oriented lane 8 to lane 1 from left to right. You must load your samples and additional primers in the same orientation. For more information, see Load Templates on page 51 and Load Primers on page 53.

Lane 8

Barcode on Left Side

(shown for reference only)


cBot User Guide

Figure 46 Position the Manifold

3. Align the manifold with the guide pins on the thermal stage, and set the

manifold into place on top of the flow cell.

4. Wiggle the manifold to ensure it is evenly seated over the flow cell. The

manifold must be evenly seated to form a tight seal.

5. Touch the checkbox to indicate that the manifold is seated.

Figure 47 Load the Manifold

6. Close the flow cell clamp to lock the manifold in position, ensuring that

the bracket snaps securely under the white clip.

7. Touch the checkbox to indicate that the flow cell clamp is closed.

50 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

8. Connect the outlet end of the manifold to the outlet port in the wash

reservoir, and ensure it is evenly seated.

Figure 48 Secure Outlet End

9. Snap the outlet clamp closed to secure the outlet end of the manifold.

10. Touch the checkbox to indicate that you have connected the manifold to

the outlet port and the rear clamp is secured.

11. Align the sipper comb with the two metal guide pins on the front edge of

the thermal stage.

12. Snap the sipper comb into place using the plastic tabs on either side of

the sipper comb.

Flow Cell Clamp

Outlet Clamp

Outlet Port


cBot User Guide

Figure 49 Secure the Sipper Comb

When the sipper comb is secure, the system checks the final checkbox and the Next button is activated.

13. Ensure that the sipper comb sippers are straight and perpendicular to

the reagent plate.

14. Touch Next to proceed to loading the tube strips.

Load Templates

1. Touch Enter Template Name. The keyboard appears.

2. Using the keyboard, type the template ID and then touch Enter.

Metal Guide Pins

CAUTION

Lane orientation for the HiSeq flow cell is opposite of the Genome Analyzer flow cell. The Genome Analyzer flow cell lane orientation is lane 1–8, left to right, while the HiSeq flow cell lane orientation is lane 8–1, left to right. Use the following instructions to correctly load the eight-tube strip containing templates for the flow cell you are using.

52 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

Figure 50 Load Tube Strips

Figure 51 Load Templates and Primers

3. Load the eight-tube strip containing the template into the second row of

the tube strip holder in one of the following orientations depending on

the flow cell you are using:

• Genome Analyzer—Position the eight-tube strip containing the

template into the tube strip holder with the tube labeled #1 on the

left side and the tube labeled #8 on the right side.

Figure 52 Tube Strip Orientation for Genome Analyzer Flow Cell

Reagent Plate

Templates

Primers

Tube #8Tube #1


cBot User Guide

• HiSeq—Position the eight-tube strip containing the template into

the tube strip holder with the tube labeled #8 on the left side and the

tube labeled #1 on the right side. This orientation aligns with the

lanes on the HiSeq flow cell when correctly loaded onto the cBot.

Figure 53 Tube Strip Orientation for HiSeq Flow Cell

4. Touch the checkbox to indicate that you have loaded templates.

5. If you are using additional primers, proceed to Load Primers. Otherwise,

close the cBot lid. The Next button becomes active.

Figure 54 Close cBot Lid to Continue

Load Primers The option to load the primer strip tube appears if the protocol you have selected uses custom or specialty primers. Use the following steps to load custom or specialty primers. Otherwise, close the cBot lid and touch Next to proceed to the pre-run check.

1. Touch Enter Primer Name. The keyboard appears.

2. Using the keyboard, type the primer ID and then touch Enter.

Tube #1Tube #8

CAUTION

Lane orientation for the HiSeq flow cell is opposite of the Genome Analyzer flow cell. The Genome Analyzer flow cell lane orientation is lane 1–8, left to right, while the HiSeq flow cell lane orientation is lane 8–1, left to right. Use the following instructions to correctly load the eight-tube strip containing primers for the flow cell you are using.

54 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

3. Load the eight-tube strip containing primers into the first row of the tube

strip holder in one of the following orientations depending on the flow

cell you are using:

• Genome Analyzer—Position the eight-tube strip containing primers

into the tube strip holder with the tube labeled #1 on the left side

and the tube labeled #8 on the right side.

Figure 55 Tube Strip Orientation for Genome Analyzer Flow Cell

• HiSeq—Position the eight-tube strip containing primers into the

tube strip holder with the tube labeled #8 on the left side and the

tube labeled #1 on the right side. This orientation aligns with the

lanes on the HiSeq flow cell when correctly loaded onto the cBot.

Figure 56 Tube Strip Orientation for HiSeq Flow Cell

4. Touch the checkbox to indicate that you have loaded additional primers.

Tube #8Tube #1

Tube #1Tube #8


cBot User Guide

Figure 57 Close cBot Lid to Continue

5. Close the cBot lid. The Next button becomes active.

6. Touch Next to proceed. The system automatically performs a pre-run

check.

Perform Pre-Run Check

The pre-run check reads the instrument sensors to detect the correct installation of run components, and then performs a flow check using bubble sensors to detect air in the lines. The pre-run check takes approximately three minutes.

Successful Pre-Run Check

The Start button becomes active if the pre-run check is successful.

Figure 58 Perform Pre-Run Check

1. Touch Start. The Run Status screen opens and the run begins.

2. Proceed to Monitoring the Run on page 58.

56 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

Pre-Run Check Run Component Errors

Figure 59 Pre-Run Check Failure, Run Component Errors

If the pre-run check fails due to errors related to run components, perform the following steps:

1. Check any run component with an indicated error to ensure it is present

and loaded correctly.

2. Touch Rerun Check to repeat the sensor check.

3. If the check continues to fail and your system is configured to allow

sensor bypass, do the following:

a. Visually inspect run components to ensure corrected orientation.

b. Touch Bypass Sensor Check and Rerun Check. The system

proceeds to the flow check.

If the Bypass Sensor Check option is not visible, your system is not configured to allow sensor bypass. For more information, see Configure Run Requirements on page 16.

Pre-Run Flow Check Failure

Figure 60 Pre-Run Check Failure, Flow Check Fails


cBot User Guide

If the flow check fails, perform the following steps:

1. Ensure the flow cell is positioned correctly with the ports facing upward

and the barcode on the right side.

2. Inspect the manifold to ensure it is evenly seated over the flow cell, and

the flow cell clamp is closed.

3. Ensure the outlet end of the manifold is evenly seated in the outlet port

and the clamp is closed.

4. Ensure row #1 of the reagent plate is fully thawed and contains reagent.

5. Ensure the sippers are straight and that the foil-sealed tubes in row #1 of

the reagent plate are pierced.

6. Touch Rerun Check to repeat the check. For more information, see

Troubleshooting on page 68.

7. If the flow check fails repeatedly, the option to bypass the flow check

becomes active. Touch Bypass Flow Check to proceed with the run.

Figure 61 Bypass Flow Check

8. After the run, check reagent delivery from all tubes. For more

information, see Confirm Reagent Delivery on page 62.

NOTEYou can rerun the check up to three times before you risk running out of reagent.

NOTEIf you choose to bypass the flow check, Illumina does not guarantee that the failed lanes will cluster successfully.

58 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

Monitoring the Run

The Run Status screen allows you to monitor the run in progress. For more information, see Run Status Screen on page 27.

During the run, watch for error messages, either on the screen or in the form of email alerts. For more information, see Set Up Email Alerts on page 17.

Figure 62 Run Status Screen

Allow approximately four hours for the run to complete. After the run is complete, the cBot holds the flow cell at 20°C. The flow cell may remain on the instrument at this temperature overnight.

If you need to store the flow cell, store it in storage buffer in the flow cell tube at 4°C. The flow cell is stable after primer hybridization for up to ten days when properly stored at 4°C in storage buffer in the flow cell tube.

Run Data Report The run data report provides a summary of the run in progress. You can view the report at any time during the run or at the end of the run. Touch Menu and then select Run Data.

Performing Post-Run Procedures 59

cBot User Guide

Performing Post-Run Procedures

Post-run procedures confirm that the run successfully completed. Post-run procedures include viewing the run data report, unloading run components, performing an instrument wash, and checking reagent delivery.

View the Run Data Report

At the end of the run, the run data report automatically appears to alert you that the run is complete. The run data report lists the following information:

Protocol name

Flow cell ID

Reagent ID

Template name

Start time and finish time

Unload Run Components

1. When the run is complete, touch Unload to proceed.

Figure 63 Run Complete, Unload Components

2. Raise the cBot lid by gently lifting from the top-right corner.

Figure 64 Unload Manifold

Unload

60 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

3. Release the outlet clamp securing the outlet end of the manifold.

4. Disconnect the outlet end of the manifold from the outlet port in the

wash reservoir.

5. Release the flow cell clamp.

6. Remove the sipper comb from the metal guide pins using the plastic tabs

on either side of the sipper comb.

When the sipper comb is removed, the system selects the checkbox indicating that the manifold is removed.

Figure 65 Manifold Removed

7. Remove the manifold from the cBot.

8. Carefully lift the flow cell from the thermal stage.

9. Pull the reagent plate lever toward you to release the reagent plate.

10. Remove the reagent plate from the reagent stage. Set aside until you are

ready to check reagent delivery.

11. Remove the eight-tube strip containing the templates. Set aside until you

are ready to confirm reagent delivery.

12. If applicable, remove the eight-tube strip containing additional primers.

Set aside until you are ready to confirm reagent delivery.

13. Touch the checkbox to indicate that you have unloaded the reagents,

templates, and primers. The Wash button becomes active when all

components have been removed.

a. If a component is not removed and an error appears, remove the

component and touch Rerun Check.

b. If the component has been removed and the error persists, select

Bypass Sensor Check to proceed to the post-run wash.

If the Bypass Sensor Check option is not visible, your system is not configured to allow sensor bypass. For more information, see Configure Run Requirements on page 16.

14. Touch Wash to proceed to the post-run wash.

If you have configured the post-run wash as optional, you can touch Exit to bypass the wash.

Performing Post-Run Procedures 61

cBot User Guide

Flow Cell Storage

If you need to store the flow cell, store it in storage buffer in the flow cell tube at 4°C. The flow cell is stable after primer hybridization for up to ten days when properly stored at 4°C in storage buffer in the flow cell tube.

Perform a Post-Run Wash

1. Wash the plate on the thermal stage with deionized water to remove any

salt residue, and dry with a lint-free cleaning tissue.

2. Fill the wash reservoir with approximately 12 ml deionized water. You

must have a sufficient volume of water to prevent air from entering the

lines.


3. Close the cBot lid.

4. Touch the checkbox on the screen to indicate that water is present. The

Wash button becomes active.

Figure 67 Perform a Post-Run Wash

5. Touch Wash.

6. When the wash is complete, blot out any excess water remaining in the

wash reservoir, taking care not to rub the outlet ports as this can cause

fibers to clog the holes.

7. Touch the checkbox on the screen to indicated that the wash reservoir is

dry. The Exit button becomes active.

8. Touch Exit. The Start screen appears. Your cBot is ready for another run.

Wash Reservoir

Wash

62 CHAPTER 4

Using the cBot


Part # 15006165 Rev. C

Confirm Reagent Delivery

1. Visually inspect the foil-sealed tops of each tube strip and confirm that

each reagent tube seal was pierced by the sipper comb.

2. Remove each tube strip from the reagent plate base:

a. Hold the reagent plate base firmly with two hands.

b. With your finger tips under the reagent plate base, gently press

upward on the center tubes of the tube strip, releasing the tube strip

from the base.

c. Lift the tube strip out of the base.

3. Visually inspect each tube to confirm that reagent delivery was successful

from all tubes. Successful delivery is indicated by an approximately equal

remaining volume in each tube.

Figure 68 Successful Reagent Delivery

Figure 69 Unsuccessful Reagent Delivery

4. If reagent delivery was not successful from all tubes and the foil-sealed

tops of each tube is pierced, take a picture of the tube strip and contact

Illumina Technical Support.

5. Inspect the eight-tube strips containing templates.

6. If you used custom primers with your run, inspect the eight-tube strips

containing primers.

NOTEVery small differences in delivery per lane are normal and do not affect performance.

cBot User Guide 63

Chapter 5

Maintenance and

Troubleshooting

Topics64 Performing Periodic Maintenance

65 Performing a Monthly Maintenance Wash

68 Troubleshooting

64 CHAPTER 5

Maintenance and Troubleshooting


Part # 15006165 Rev. C

Performing Periodic Maintenance

The cBot is easy to maintain. Perform the basic maintenance steps described in this section to ensure optimal performance.

Table 9 cBot Periodic Maintenance

Maintenance Frequency Description

Instrument wash At least one water wash between every run and if the instrument is idle for more than a day.

Always perform an instrument wash after each run to clear salts and enzymes from the instrument hardware and to prevent clogs.

If the instrument has been idle for more than 24 hours, a pre-run wash is recommended. For more information, see Perform a Wash on page 41.

Empty waste bottle Between every run. To ensure that your run is not interrupted, empty the waste bottle between runs.

Clean surfaces Once a week. Use deionized water and a lint-free cleaning tissue to clean the surface of the thermal stage and the reagent stage. Clean the surface of the template and primer tube strip holders.

Clean barcode scanner window

Once a week. Use deionized water and a lint-free cleaning tissue to clean the barcode scanner window.

Maintenance Wash Once a month. Use 5% DECON (or 100 mM NaOH) to remove traces of reagents from internal cBot components and inhibit the growth of microorganisms. For more information, see Performing a Monthly Maintenance Wash on page 65.

Check coolant level Every three months. Ensure that the green coolant is visible through the coolant window on the rear panel of the instrument. If necessary, use a mirror to view the coolant window.

If the coolant is low, use a wide coin or standard screwdriver to remove the coolant reservoir cap, and fill the reservoir to just below the reservoir cap.

Use only Illumina-supplied coolant (part # 1003709). If you need additional coolant, contact your Illumina Field Application Scientist or Field Service Engineer.

Performing a Monthly Maintenance Wash 65

cBot User Guide

Performing a Monthly Maintenance Wash

Perform a monthly maintenance using 5% DECON to remove traces of reagents from internal cBot components and inhibit microbial growth. In regions where DECON is not available, 100 mM NaOH may be substituted.

The maintenance wash requires approximately ten minutes of hands-on time and consists of four wash steps:

1. A water wash.

2. A 5% DECON wash.

3. A water wash to rinse the system.

4. A second water wash to thoroughly rinse the system.

Consumables User-SuppliedDeionized water

5% DECON or 100 mM NaOH

Low-lint lab tissues

Procedure Perform a Water Wash

1. Confirm that all run components are removed before proceeding. For

more information, see Unload Run Components on page 59.

2. From the Start screen, touch Menu and select Manual Commands. The

Manual Commands screen opens.

3. Touch Commands to open the Commands tab.

Figure 70 Manual Commands, Commands Tab

66 CHAPTER 5



Part # 15006165 Rev. C

4. Fill the wash reservoir with approximately 12 ml deionized water.


5. Touch Wash on the Commands tab.

6. After the wash is finished, blot out any excess water remaining in the

wash reservoir with a low-lint wipe, taking care not to rub the outlet ports

as this can cause fibers to clog the holes.

Figure 72 Dry the Wash Reservoir

7. Proceed to the DECON or NaOH wash.

Perform a DECON (or NaOH) Wash

1. Fill the wash reservoir with 10 ml of 5% DECON or 100 mM NaOH.

2. Touch Wash.

CAUTION

DECON is a highly alkaline wash solution. Be sure to wear gloves when blotting 5% DECON to protect your skin.

Do not allow DECON to sit in the wash reservoir for long periods of time as the high pH may corrode the metal pins over repeated, extended contact.

Wash Reservoir

Performing a Monthly Maintenance Wash 67

cBot User Guide

3. After the wash is finished, blot out any excess 5% DECON remaining in

the wash reservoir with a low-lint wipe, taking care not to rub the outlet

ports as this can cause fibers to clog the holes.

4. Immediately proceed to the water wash to prevent DECON from drying

and clogging the wash reservoir holes.

Perform a Water Wash (First Rinse)

1. Fill the wash reservoir with approximately 12 ml deionized water.

2. Touch Wash.




4. Proceed to the final water wash to remove all remaining traces of the 5%

DECON from the wash reservoir and internal cBot components.

Perform a Water Wash (Final Rinse)

1. Fill the wash reservoir with approximately 12 ml of clean, deionized

water.

2. Touch Wash.




4. Close the cBot lid and empty the waste bottle. The cBot is ready for the

next cluster generation run.

68 CHAPTER 5



Part # 15006165 Rev. C

Troubleshooting

Use the following table to troubleshoot possible problems encountered during a cluster generation run.

Table 10 Troubleshooting Run Problems

Problem Possible Cause Action

Flow check failure Flow cell is installed upside down. Check positioning of the flow cell. Ensure ports are facing upward.

Poor seal between the manifold and the flow cell.

Poor seal between the outlet end of the manifold and the outlet port.

Ensure the manifold is evenly seated over the flow cell.

Ensure the outlet end of the manifold is evenly seated in the outlet port.

Sippers did not pierce reagent tubes in row 1.

Ensure the sippers are straight and the reagent plate is positioned with row 1 facing towards the front of the instrument, directly behind the eight-tube strip holder.

Ensure the clear plastic lid has been removed from the reagent plate.

Reagents are still frozen. Ensure reagents are completely thawed.

Problem with manifold flow. Remove the manifold and ensure the black rubber gaskets are evenly seated in the clear plastic.

If one lane consistently fails, the manifold may be clogged and require a replacement.

Alternatively, you can bypass the flow check. However, the lanes indicated in the on-screen message may not cluster successfully.

See Pre-Run Flow Check Failure on page 56 for more information.

Temperature out of range Potential Peltier or Peltier control board failure.

Contact Illumina Technical Support.

Coolant is flowing and coolant level is low

Coolant has slowly evaporated to a low level.

Add Illumina-supplied coolant (part # 1003709) to the coolant reservoir.

Coolant is not flowing and coolant level is low

Coolant level may be too low to generate flow.

Add Illumina-supplied coolant (part # 1003709) to the coolant reservoir.

Coolant is not flowing and coolant level is not low

Potential coolant pump failure. Contact Illumina Technical Support.

System is in a locked state Potential software error. Contact Illumina Technical Support.

cBot User Guide 69

Appendix A

Cluster Generation Chemistry


70 Adapter Ligation and Selection

71 Cluster Generation

70 APPENDIX A



Part # 15006165 Rev. C

Introduction

During cluster generation, template molecules are attached to a flow cell and then amplified locally to form clonal clusters. The flow cells containing the clusters can then be sequenced on an Illumina sequencing instrument.

This section gives an overview of the chemistry of cluster generation.

Adapter Ligation and Selection

Before cluster generation can occur, the template fragments need to contain the right 5’ and 3’ adapters, and have the proper length. This is done during sample preparation using the following steps:

1. In most protocols, samples are fragmented to get proper sized

fragments.

2. Samples that consist of RNA are reverse transcribed to get a DNA

template.

3. Two different Y-shaped adapters are ligated to the DNA fragments

(Figure 73).

4. The fragments are PCR-amplified with primers annealing to the Y-shaped

adapters. The Y-shaped adapters have been devised to generate

fragments containing two non-homologous 5’ and 3’ ends (Figure 73).

Figure 73 Ligation of Y-shaped Adapters and PCR

5. Fragments are size-fractionated on a gel.

The sample is now ready for cluster generation.

Non-Homologous 3’ and 5’ Ends

Cluster Generation 71

cBot User Guide

Cluster Generation

Cluster generation is performed on the cBot using the following steps:

1. The DNA fragment library is diluted, denatured and introduced into the

lanes of the flow cell. The flow cell is a silica slide with eight lengthwise

lanes containing a dense lawn of oligonucleotides.

2. The templates are captured by the oligonucleotides attached to the

surface of the flow cell.

Figure 74 Capture and Extension of Template

3. Templates bound to the primers are 3’-extended producing covalently-

attached discrete single molecules.

4. The double-stranded molecule is denatured, and the original template is

washed away.

5. Free ends of the bound templates hybridize to adjacent lawn primers to

form U-shaped bridges.

Figure 75 Bridge Formation

6. The DNA bridge is copied from the primer to create a double-stranded

DNA bridge.

7. The resulting dsDNA is denatured, hybridized to lawn-primers to form

new bridges and extended again.

72 APPENDIX A



Part # 15006165 Rev. C

Figure 76 Further Amplification of Template

8. This process of iso-thermal bridge amplification is repeated 35 times to

create a dense cluster of over 2000 molecules.

Figure 77 Clonal Cluster

9. The reverse strands in the cluster are removed by cleavage at the reverse

strand-specific lawn primers, leaving a cluster with forward strands only.

10. The free 3’-OH ends are blocked to prevent non-specific priming.

11. Sequencing primers are hybridized to the free ends of the DNA

templates.

The flow cell with the synthesized clonal clusters is now ready to be sequenced on the Illumina sequencing instrument.

cBot User Guide 73

Appendix B

Manual Settings

Topics74 Manual Commands

77 Resetting the Barcode Scanner

79 Protocol Editor

74 APPENDIX B

Manual Settings


Part # 15006165 Rev. C

Manual Commands

Manual commands are used for troubleshooting purposes and confirm that the instrument is responding.

You can access the Manual Commands screen from the Start screen menu. Touch Menu and select Manual Commands. The Manual Commands screen opens.

Figure 78 Start Screen Menu

The Manual Commands screen contains four tabs: Commands, Temp, Pump, and General.

Commands Tab From the Commands tab, you can initialize the system, prime reagents through the system, or return the reagent stage to the home position. If the run is stopped unexpectedly, use this feature to release the reagent plate from the sipper comb. Use the Commands tab to perform a monthly maintenance wash. For more information, seePerforming a Monthly Maintenance Wash on page 65.

Figure 79 Manual Commands, Commands Tab

Manual Commands

Manual Commands 75

cBot User Guide

Temp Tab From the Temp tab, you can confirm that the Peltier heater is performing correctly.

If you change the temperature setting to other than 20°C, you must manually return the setting to 20°C before leaving the Manual Commands screen.

Figure 80 Manual Commands, Temp Tab

Pump Tab From the Pump tab, you can manually pump reagents to confirm reagent delivery and troubleshoot fluidics lines. For most purposes, a flow rate of 500 μl/minute is appropriate.

Figure 81 Manual Commands, Pump Tab

WARNINGNever set the temperature lower than 20°C. Condensation may occur and damage the instrument.

76 APPENDIX B

Manual Settings


Part # 15006165 Rev. C

General Tab From the General tab, you can confirm that the barcode scanner is responding. Use the settings on this tab to reset the scanner to the default configuration. For more information, see Resetting the Barcode Scanner on page 77.

Figure 82 Manual Commands, General Tab

Resetting the Barcode Scanner 77

cBot User Guide

Resetting the Barcode Scanner

The cBot barcode scanner is ready for use when you receive your instrument. However, in the event that the barcode scanner is reset to an incorrect configuration, use the following instructions to restore it to the default configuration.

1. From the Manual Commands screen, touch General.

2. Touch Turn On to turn on the barcode scanner.

Figure 83 Turn On Barcode Scanner

3. Scan the following barcodes in the order shown:

Figure 84 Reset Barcode #1




Turn on Barcode Scanner

78 APPENDIX B

Manual Settings


Part # 15006165 Rev. C


\







Protocol Editor 79

cBot User Guide

Protocol Editor

You can edit protocols according to your needs using the Protocol Editor. For example, you may want to repeat steps in a protocol, or change the number of amplification cycles in the chemistry section.

Each protocol consists of two main sections:

Chemistry section—Contains instructions for pumping reagents,

temperature changes, and wait durations. The chemistry section of the

protocol appears in upper portion of the Protocol Editor screen.

Protocol section—Contains a series of steps made up of chemistry

definitions. The protocol section appears in the lower portion of the

Protocol Editor screen.

If you edit an existing protocol, remember to rename your protocol.

1. From the Start screen, touch Menu and select Protocol Editor. The

Protocol Editor opens.

2. From the Protocol Editor, touch Menu and select one of the following

commands from the menu:

• Select Open to open an existing protocol.

• Select Load from Library to load an existing chemistry definition or

protocol step stored in the cBot library.

• Select New Chemistry Definition or New Protocol Step to create a

new definition or step and store it in the cBot library.

Figure 95 Protocol Editor Menu

80 APPENDIX B

Manual Settings


Part # 15006165 Rev. C

Figure 96 Protocol Editor, Expanded Steps

3. Use the down arrow to the left of the step to expand the commands

in the step or the up arrow to collapse the commands (Figure 96).

4. To edit a step in a chemistry definition, highlight the step. Selections

appear in the right-hand panel to change the pump, temperature ramp,

or wait commands.

5. To edit a step in the protocol, highlight the step. Selections appear in the

right-hand panel to change to the number of cycles for the selected

chemistry definition.

6. Use the Protocol Editor icons to the right of the step name to rearrange,

delete, or copy steps and commands. See Protocol Editor Icons on

page 81 for more information.

Figure 97 Protocol Editor, Editing Panel

Expanded Chemistry Steps

Chemistry Section

Protocol Section

Protocol Editor 81

cBot User Guide

Protocol Editor Icons

The following table describes the icons used in the Protocol Editor.

Table 11 Protocol Editor Icons

Icon Description

Moves the highlighted step below the following step in the protocol.

Moves the highlighted step above the preceding step in the protocol.

Deletes the highlighted step.

Repeats the highlighted step.

Saves your changes to the protocol library.

82 APPENDIX B

Manual Settings


Part # 15006165 Rev. C

cBot User Guide 83

Index

A

aborting a run 28

adapter plate 20, 33

alerts tab 17

B

barcode scanner 3, 11

cleaning 64

resetting 76, 77

best practices 39

bypass flow check 57

C

cluster generation

chemistry 70

workflow 34

cluster generation kits 32

components

overview 3unloading 60

configuration screens 15

configuring run requirements 15–19

confirming reagent delivery 62

consumables 32

coolant

inspection 12

level 64

troubleshooting flow 68

customer support 5

D

dimensions, cBot 8DNA template, preparing and storing 35

documentation 5

E

email alerts 17

error messages 17, 23

F

flow cell

adapter plate 20, 33

cleaning 46

loading, Genome Analyzer 47

loading, HiSeq 48

scanning barcode 46

storage 58, 61

flow check

about 24

bubble sensors 55

failure 57, 68

manually 74

FSE mode 29

G

Genome Analyzer flow cell 47

Genome Analyzer kits 32

H

help, online 25

help, technical 5HiSeq adapter plate 20, 33

HiSeq flow cell 48

HiSeq kits 32

I

installation 11

K

keyboard, touch screen 15, 24, 29

L

lab requirements 8

84 Index


Part # 15006165 Rev. C

M

maintenance

periodic care 64

post-run washes 61

pre-run wash 41

manifold

inspection 48

loading 48

outlet clamp 50

sipper comb 4, 50

troubleshooting 68

unloading 60

manual commands 74

N

network connection 14

P

pausing a run 28

post-run wash 61, 64

power requirements 9preparing DNA 35

pre-run check

about 24

performing 55

pre-run wash 41, 64

primers, custom 40

loading 53

tube strip orientation 53

protocol

editing 79

selecting 43

protocol editor 79

pumping reagents, manually 75

R

reagent plate 4reagent stage 3, 4, 44

reagent stage, manually homing 74

reagents

cluster generation kits 32

confirming delivery 62

ID, entering 44

loading 44

positioning 44

reagent plate 38

small RNA sequencing primer 40

thawing 39

remote monitoring 17, 30

remote tab 17

required fields 16

Run Setup screens 24, 58

run setup, required fields 16

Run Status screen 27

run summary 59

S

screensaver 27

sensor bypass option 56, 60

sensor bypass option, configuring 16

sensors, icons 25, 26

servicing 29

set local date and time 18

small RNA sequencing primer 40

Start screen 15, 23

station name 16

stopping a run 28

system status 26

T

technical assistance 5temperature out of range 68

temperature, manually setting 75

templates

ID, entering 51

loading 51

tube strip orientation 51

thermal stage 3, 4time tab 18

touch screen monitor 3troubleshooting

error messages 68

flow check failure 57, 68

fluidics 75

manual commands for 74

U

user name 23, 41

W

wash reservoir 42, 66

washes

configuring 16

frequency 64

post-run 61

pre-run 41

waste bottle 3, 11, 13, 64

Illumina, Inc.

9885 Towne Centre Drive

San Diego, CA 92121-1975

+1.800.809.ILMN (4566)

+1.858.202.4566 (outside North America)

[email protected]

www.illumina.com

Documents

cBot User Guide - FANTOM · 2019. 2. 20. · cBot User Guide iii Notice This document and its contents are proprietary to Ill umina, Inc. and its affiliates ("Ill umina"), and are