Canonical WNT Signaling Promotes Osteogenesis by Directly Stimulating Runx2 Gene Expression

Canonical WNT Signaling Promotes Osteogenesis by DirectlyStimulating Runx2 Gene Expression*

Received for publication, January 18, 2005, and in revised form, June 3, 2005 Published, JBC Papers in Press, July 25, 2005, DOI 10.1074/jbc.M500608200

Tripti Gaur‡, Christopher J. Lengner‡, Hayk Hovhannisyan‡, Ramesh A. Bhat§, Peter V. N. Bodine§, Barry S. Komm§,Amjad Javed‡, Andre J. van Wijnen‡, Janet L. Stein‡, Gary S. Stein‡, and Jane B. Lian‡1

From the ‡Department of Cell Biology and the Cancer Center, University of Massachusetts Medical School, Worcester,Massachusetts 01655-0106 and the §Women’s Health Research Institute, Wyeth Research, Collegeville, Pennsylvania 19426

Both activating and null mutations of proteins required forcanonical WNT signaling have revealed the importance of thispathway for normal skeletal development. However, tissue-specifictranscriptional mechanisms through which WNT signaling pro-motes the differentiation of bone-forming cells have yet to be iden-tified. Here, we address the hypothesis that canonical WNT signal-ing and the bone-related transcription factor RUNX2/CBFA1/AML3 are functionally linked components of a pathway requiredfor theonset of osteoblast differentiation.Our findings show that, inbone of the SFRP1 (secreted frizzled-related protein-1)-nullmouse,which exhibits activatedWNT signaling and a high bonemass phe-notype, there is a significant increase in expression of T-cell factor(TCF)-1, Runx2, and the RUNX2 target gene osteocalcin. We dem-onstrate by mutational analysis that a functional TCF regulatoryelement responsive to canonical WNT signaling resides in the pro-moter of the Runx2 gene (�97 to �93). By chromatin immunopre-cipitation, recruitment of �-catenin and TCF1 to the endogenousRunx2 gene is shown. Coexpression of TCF1 with canonical WNTproteins resulted in a 2–5-fold activation of Runx2 promoter activ-ity and a 7–8-fold induction of endogenous mRNA in mouse pluri-potent mesenchymal and osteoprogenitor cells. This enhancementwas abrogated by SFRP1. Taken together, our results provide evi-dence for direct regulation of Runx2 by canonical WNT signalingand suggest that Runx2 is a target of �-catenin/TCF1 for the stim-ulation of bone formation. We propose that WNT/TCF1 signaling,like bone morphogenetic protein/transforming growth factor-�signaling, activatesRunx2 gene expression inmesenchymal cells forthe control of osteoblast differentiation and skeletal development.

During development of the skeleton and formation of bone tissue,several morphogenic growth factor and hormone signaling pathwaysimpinge upon transcriptional regulators to induce the osteogenic phe-notype (1, 2). The challenge is to identify how developmental cues andregulatory factors are integrated to accommodate the requirements forbiological control of cell differentiation and tissue formation. Here, wehave addressed the interaction of two key signals for osteogenesis: theWNT pathway, which contributes to the development of skeletal struc-tures (3, 4), and the transcription factor RUNX2 (CBFA1/AML3), whichis required for embryonic bone formation (5, 6).WNT signaling comprises a family of 19 secreted glycoproteins that

have functions related to cell specification, formation of the body plan,cell growth, differentiation and apoptosis (7, 8).WNTproteins functionthrough Frizzled receptors, which transduce the signal through eitherthe canonical �-catenin pathway or non-canonical pathway (7, 8). Acti-vation of the Frizzled receptor complex results in inhibition of a phos-phorylation cascade that stabilizes intracellular �-catenin levels.�-Catenin is subsequently translocated to the nucleus to form a tran-scriptionally active heterodimeric �-catenin TCF2 lymphoid enhancerfactor (LEF) DNA-binding complex. Both gain- and loss-of-functionmutations in canonical and non-canonicalWNT signaling componentshave revealed critical requirements of WNT proteins for normal skel-etogenesis (3, 4). Altered expression of severalWNT proteins (WNT3a,WNT4, WNT5a, WNT7a, and WNT14/9a) causes defects in somiteformation, chondrogenesis, limb development, and endochondral boneformation (9–13). Recently, a rare human genetic disorder (tetra-amae-lia) characterized by absence of all limbs has been linked to mutation inWnt3 (14).More direct effects mediated through canonical WNT signaling on

formation and turnover of the mature skeleton have been revealed. Anactivating mutation in theWNT coreceptor LRP5 (low density lipopro-tein receptor-related protein-5) results in the high bone mass trait inhumans (15, 16), a phenotype that is reproduced in the mouse model(17, 18). Consistent with this phenotype, the LRP5 loss-of-functionmutation exhibits osteopenia and decreased bone mass in humans (19)and in a mouse model (20). Targeted disruption of axin-2 (a negativeregulator of the canonical WNT pathway) in mice leads to increasedosteoblast differentiation and matrix mineralization (21). Embryoniclethality of the �-catenin-null mouse (22), lack of skeletal structuresderived from the cranial neural crest (23), and arrest of osteoblast dif-ferentiation (24–26) in conditional �-catenin mutants as well as trans-genic mouse models (27) demonstrate the importance of the canonicalWNT pathway during early developmental stages and for boneformation.The WNT pathway is negatively regulated by several modulators,

including secreted frizzled-related proteins (SFRPs), which contain acysteine-rich domain for interaction with WNT proteins, thereby pre-venting them from interacting with the membrane-bound receptorFrizzled and/or coreceptor LRP5/6 (28). A null mutation of the WNTantagonist SFRP1 in mouse also results in high bone mass between theages of 7 and 9 months (29), suggesting very selective effects exhibitedby either SFRP1 or specificWNTproteins inmaintaining the bonemassof the adult skeleton.RUNX2, amember of the runt homology domain transcription factor

family, is essential for osteoblast differentiation (5, 6, 30, 31). Mutations* This work was supported by National Institutes of Health Grants AR39588, P01

AR48818, and P30 DK32520. The costs of publication of this article were defrayed inpart by the payment of page charges. This article must therefore be hereby marked“advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom correspondence should be addressed: Dept. of Cell Biology and the CancerCenter, University of Massachusetts Medical School, 55 Lake Ave. North, Worcester,MA 01655-0106. Tel.: 508-856-5625; Fax: 508-856-6800; E-mail: [email protected].

2 The abbreviations used are: TCF, T-cell factor; LEF, lymphoid enhancer factor; BMP,bone morphogenetic protein; MEF, mouse embryonic fibroblast; WT, wild-type; RT,reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 280, NO. 39, pp. 33132–33140, September 30, 2005© 2005 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

33132 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 280 • NUMBER 39 • SEPTEMBER 30, 2005

in the Runx2 gene in mouse and human are associated with cleidocra-nial dysplasia and critical defects in bone formation (32–36). RUNX2functions as a master regulatory factor, in part by interacting with avariety of coregulatory proteins and formingmultimeric complexes thatdetermine whether RUNX2 will act as a transactivator or repressor ontarget genes during cell differentiation (6, 37, 38). RUNX factors alsointegrate signaling responses from morphogenetic signals and theextracellular matrix by forming coregulatory complexes, for example,with Smad proteins, mediators of bone morphogenetic protein (BMP)/transforming growth factor-� signaling, and with intracellular adaptorproteins such as Yes-associated protein that transduce c-Src kinase sig-naling (39–41).Several significant observations led us to consider that Runx2may be

a target of WNT signaling for early specification of the osteoblast line-age. First, the Runx2 gene is expressed early in the embryo in mesen-chyme that gives rise to skeletal elements prior to the formation of bonetissue (31, 33, 42). Second, although BMP2 induction of bone formationand osteoblast differentiation is accompanied by Runx2 gene expres-sion, 3-kb Runx2 promoter-lacZ transgene expression in vivo isrestricted to prechondrogenic mesenchyme (42). These findings sug-gest that signals other than the osteogenic BMP2 pathway are operativeon the promoter for expression of Runx2 in early mesenchyme duringembryonic development.In this study, we show that the Runx2 gene is a direct target of the

canonical WNT signaling pathway. Activation of the Runx2 promoterthrough a TCF site was observed in mouse embryonic fibroblasts andpluripotent mesenchymal and osteoprogenitor cells in vitro. Notably,endogenous Runx2 and TCF1 were up-regulated in the SFRP1-nullmouse, which exhibits increased WNT signaling and osteoblast differ-entiation. We propose that direct regulation of Runx2 gene expressionin vivo by canonical WNT signaling is a contributing factor for earlyskeletal development and for sustaining bone mass in the adult.

EXPERIMENTAL PROCEDURES

Mice—Transgenic mice containing the lacZ gene under the controlof the 3-kbRunx2 P1 promoter (42) and SFRP1 knockout (sfrp1�/�) andwild-type (sfrp1�/�) mice (29) were used for in vivo analysis. Animalswere maintained at the University of Massachusetts following proce-dures approved by the Institutional Animal Care and Use Committees.Genotyping was carried out as described previously for both mousemodels (29, 42).

Cell Culture—Mouse embryonic fibroblasts (MEFs) were isolatedfrom postcoitus day 12.5 mice as described previously (43). Briefly, eachembryo was sheared in an 18-gauge syringe in the presence of 1 ml0.25% trypsin and 1 mM EDTA (Invitrogen). After a 15-min incubationat 37 °C, Dulbecco’s modified Eagle’s medium with 15% fetal bovineserum was added to inactivate trypsin. The cells were plated and incu-bated for 24 h at 37 °C. The adherent cells were used as MEF cells. Theexperiments were initiated after replating the adherent cells in 6-wellplates, followed by treatment for 48 h with recombinant human BMP2(kindly provided by Dr. John Wozney, Wyeth Research, Cambridge,MA) in WNT3-conditioned medium (collected from WNT3a-overex-pressing L-cells obtained from American Type Culture Collection).Cells were harvested either for histochemical detection of �-galactosid-ase activity after fixation in 0.5% glutaraldehyde (29) or for biochemicalassay by addition of 300 �l of 1� reporter lysis buffer (Promega Corp.).A 50-�l aliquot of the lysates was incubated with 100 �l of 1� reporterlysis buffer and 150 �l of substrate solution (80mM phosphate-bufferedsaline (pH 7.3), 102 mM 2-mercaptoethanol, 9 mM MgCl2, and 8 mM

o-nitrophenyl �-galactopyranoside) for 30 min at 37 °C. The reaction

was stopped by addition of 500 �l of 1 M sodium carbonate, and absorb-ance was read at 410 nm.Mouse osteoprogenitor MC3T3 clone E1, pluripotent C3H10T1/2,

and fibroblastic NIH3T3 cells were used in this study. Cells were cul-tured in 6-well plates in �-minimal essential medium (for MC3T3 E1cells) or in Dulbecco’s modified Eagle’s medium (for C3H10T1/2 cells)supplemented with 10% fetal bovine serum (Hyclone Laboratories), 1mM L-glutamine, and 1% penicillin/streptomycin (Invitrogen). For dif-ferentiation studies, MC3T3 E1 cells were fed every 2nd day at conflu-ence with the above medium containing 10 mM �-glycerol phosphateand 50 �g/ml ascorbic acid.

Expression Constructs, Transfection, and Luciferase Assay—Fortransfection studies, MC3T3-E1, C3H10T1/2, and NIH3T3 cells at60–70% confluence were treated with FuGENE 6 transfection reagent(Roche Applied Science) at a 1:3 ratio of DNA to reagent following themanufacturer’s instructions. The 3-kb mouse proximal Runx2 pro-moter or the 0.6-kb proximal promoter of mouse and rat (upstream P1promoter; MASNS isoform) fused to the firefly luciferase reporter wasused in transfection assays (44). The mutation in the TCF1-binding sitewas created using the QuikChange site-directed mutagenesis kit (Strat-agene) following the manufacturer’s instructions. The expression con-structs for hemagglutinin-tagged WNT proteins and TCF1 wereobtained from Upstate Biotechnology, Inc. sfrp1 was amplified andcloned into pcDNA3.1(�) as an EcoRI/KpnI fragment. The cytomega-lovirus promoter-driven �-galactosidase reporter gene (pCMV�) wasobtained from BD Biosciences, and the plasmid (100 ng/well in a 6-wellplate) was cotransfected to normalize the transfection efficiency. Thetotal amount of transfectedDNAwas kept constant by using the respec-tive empty vectors as filler DNA. The cells were harvested after 24 h in1� reporter lysis buffer for promoter activity studies. The luciferaseactivity was measured using a luciferase assay kit (Promega). Luciferaseactivities were normalized for transfection efficiency to �-galactosidaseactivity in a colorimetric assay of the same cell lysates as describedabove. The mean values (n � 6) for each transfection experiment (per-formed at least twice) were plotted for relative luciferase values alongwith S.D. shown as error bars.

Western Blot Analysis—Cells were harvested in direct lysis buffer (10mM Tris (pH 7.5), 2% SDS, 10 mM dithiothreitol, 10% glycerol, 2 M urea,1� protease inhibitor, 0.2 M phenylmethylsulfonyl fluoride, and 2mg/ml bromphenol blue), and equal amounts of total protein wereresolved on 10% SDS-polyacrylamide gel to confirm the expression lev-els of the expressed constructs by detecting hemagglutinin-tagged pro-tein (data not shown). The primary antibodies used were as follows:mouse monoclonal anti-RUNX2 (1:2000) (45) and horseradish peroxi-dase-conjugated hemagglutinin (1:2000), anti-TCF1 (1:1000), and anti-�-actin (1:2000) (Santa Cruz Biotechnology, Inc.). Blots were incubatedfor 1 h at room temperature with primary antibody in 2% milk andsubsequently with horseradish peroxidase-conjugated anti-mouse sec-ondary antibody. The signal was detected using a Luminescence detec-tion kit (PerkinElmer Life Sciences). Femur bones fromwild-type (WT)and sfrp1�/� mice at 7 months of age were harvested. The marrow wasfirst flushed from the bone, and the diaphysis region was crushed in thefrozen state in a metal plate tissue homogenizer and then boiled insample buffer for western analysis essentially as described above.

RNA Isolation and Quantitative Reverse Transcription (RT)-PCR—MC3T3 cells were harvested in 300 �l of TRIzol reagent (Invitrogen),and total RNA was isolated from the cells following the manufacturer’sinstructions. Marrow-free femur bones from 1- and 7-month-old micewere frozen in liquid nitrogen, pulverized, and resuspended in 5 ml ofTRIzol, and total RNA was extracted following the manufacturer’sinstructions. Any potential DNA contamination was removed by

WNT Signaling Regulates Runx2 Gene Expression

SEPTEMBER 30, 2005 • VOLUME 280 • NUMBER 39 JOURNAL OF BIOLOGICAL CHEMISTRY 33133

RNase-free DNase treatment. The RT reaction was performed on 1 �gof total RNA using a first strand synthesis kit (Invitrogen). Relativetranscript levels were measured by real-time PCR in a 50-�l reactionvolume on 96-well plates using an ABI PRISM 7000 sequence detectionsystem (Applied Biosystems) following the recommended protocol forSYBR Green (Bio-Rad). Transcript levels were normalized to glyceral-dehyde-3-phosphate dehydrogenase (GAPDH) levels using primersfrom Applied Biosystems and SYBR Green Master Mix (Bio-Rad). Theprimers used for amplification are listed in TABLE ONE.

ElectrophoreticMobility Shift Assay—Nuclear extracts were preparedby hypotonic cell lysis and high salt nuclei extraction as described pre-viously (46). Oligonucleotides from the rat Runx2 promoter containingthe binding site for LEF/TCF (WT andmutated at the TCF site, referredto as mTCF) were synthesized. The upper strand oligonucleotide (200ng) was labeled with 32P for 1 h at 37 °C using T4 polynucleotide kinase(New England Biolabs Inc.) following the manufacturer’s instructions.Annealing was performed in the presence of a 3-fold excess amount ofthe lower strand oligonucleotide. Labeled oligonucleotides were puri-fied using a quick-spin SephadexG-25 column (RocheApplied Science)following the manufacturer’s protocol. Reaction mixtures for gel shiftassay were prepared using 10 fmol of probe, 50 mMKCl, 12 mMHEPES,1 mM EDTA, 1 mM dithiothreitol, 12% glycerol, 12.5 �g/ml salmonsperm DNA, and 5 �g of nuclear extracts. After a 20-min incubation atroom temperature, 100-fold unlabeled double-stranded WT competi-tor oligonucleotide or nonspecific AP1 oligonucleotidewas added to thereaction mixtures. For immunoshift assays, nuclear extract was incu-bated with either anti-TCF1 antibody (2 �g) or nonspecific controlantibody (Sp1) at 37 °C for 1 h before addition of the probe. The sampleswere electrophoresed on a 4% nondenaturing polyacrylamide gel, dried,and autoradiographed on Biomax MR film (Eastman Kodak Co.).

Chromatin Immunoprecipitation—Chromatin immunoprecipitationstudies were performed as described previously (47) with the followingmodifications. Formaldehyde cross-linking was quenched by additionof glycine to a final concentration of 125mM at room temperature for 10min, followed by washing once with ice-cold 1� phosphate-bufferedsaline before resuspension in lysis buffer. Sonication was performedeight times at setting 3 for 15 s. The precleared cell lysate was incubatedovernight at 4 °Cwith 5�g of anti-�-catenin antibody (Upstate Biotech-nology, Inc.), 4 �g of anti-TCF1 and anti-LEF1 antibodies, or 3 �g ofanti-RUNX2 antibody M-70 (Santa Cruz Biotechnology, Inc.). Thecross-linking reaction was reversed by overnight incubation of the solu-tions at 65 °C, and the DNA was recovered by phenol/chloroformextractions. DNA was ethanol-precipitated and dissolved in 40 �l of

Tris/EDTA. Four �l of DNA was used for quantitative RT-PCR todetect the presence of specific DNA segments with the following primerpairs: Set 1, CAGTGGTAGGCAGTCCCACTTTAC (forward) andGGCTGGTAGTGACCTGCAGAGAT (reverse); and Set 2, GAG-CAAGGGGGAAGCCACAGTG (forward) and GTGAGGCGAAT-GAAGCATTCACAC (reverse).

RESULTS

Runx2 Expression Is Induced by EnhancedWNT Signaling in Vivo—Abiological linkage of Runx2 andWNT signaling was first established byexamining the bone tissue of WT and sfrp1�/� mice. Inactivation ofSFRP1 results in a highly significant increase in the mineral appositionrate and decreased apoptosis in 7–9-month-old sfrp1�/� mice, leadingto higher bone density (29). Total RNA from two independent litters of7-month-oldWTand sfrp1�/�micewas isolated from the cortical boneof the diaphysis. We observed that Runx2mRNA levels at this age were6–9-fold higher in sfrp1�/� versusWTmice (Fig. 1A, upper panel). Thisinduction in transcript levels was accompanied by a 2–3-fold increase inRUNX2 protein levels in sfrp1�/� versus WT mice (Fig. 1A, lowerpanel). This observation suggests that RUNX2-mediated osteoblast dif-ferentiation is a contributing factor to the high bone mass phenotype at7 months.To ascertain the significance of elevated Runx2 expression in reflect-

ing enhancedWNT signaling and osteoblast activity, we examined bonesamples from growing 1-month-oldmice.We found that Runx2mRNAlevels were elevated from 10- to 20-fold in sfrp1�/� mice (Fig. 1B). The2–7-fold increase inTCF1 (a known target of canonicalWNT signaling)in the sfrp1�/� bones suggests that the WNT pathway functions at ahigher level than in the wild-type bones. The induction of Runx2 levelswas paralleled by 1.3–3-fold higher levels of osteocalcin (a RUNX2 tar-get gene) and a 2–8-fold suppression of alkaline phosphatase insfrp1�/� mice (Fig. 1B). These modifications in gene expression (highosteocalcin and low alkaline phosphatase levels) reflect the stage of amature osteoblast/osteocyte in a mineralizedmatrix (37). Furthermore,histone H4 gene expression, which is coupled to DNA synthesis (48),was significantly lower in sfrp1�/� cells (Fig. 1B), indicating a morerapid exit from the cell cycle, consistent with increased osteoblast dif-ferentiation. We observed no difference in expression of the apoptoticmarker bcl2 (Fig. 1B). Considering the small sample size (three mice/group), the significance of the differences in gene expression betweenWT and sfrp1�/� mice reached p � 0.05. Normalization of these mark-ers to GAPDH expression (or 18 S RNA) (data not shown) providedevidence that the increase in Runx2 occurred on a per cell basis, there-

TABLE ONE

Nucleotide sequences of primers used for quantitative RT-PCR detection

Gene Primer sequence

Runx2 5�-CGC CCC TCC CTG AAC TCT-3� (forward)

5�-TGC CTG CCT GGG ATC TGT A-3� (reverse)

TCF1 5�-CAG AAT CCA CAG ATA CAG CA-3� (forward)

5�-CAG CCT TTG AAA TCT TCA TC-3� (reverse)

LEF1 5�-AGT GCA GCT ATC AAC CAG AT-3� (forward)

5�-TTC ATA GTA TTT GGC CTG CT-3� (reverse)

Osteocalcin 5�-CTG ACA AAG CCT TCA TGT CCA A-3� (forward)

5�-GCG CCG GAG TCT GTT CAC TA-3� (reverse)

Alkaline phosphatase 5�-TTG TGC GAG AGA AAG GAG A-3� (forward)

5�-GTT TCA GGG CAT TTT TCA AGG T-3� (reverse)

Histone H4 5�-CCA GCT GGT GTT TCA GAT TAC A-3� (forward)

5�-ACC CTT GCC TAG ACC CTT TC-3� (reverse)

bcl2 5�-AAG CTG TCA CAG AGG GGC TA-3� (forward)

5�-CAG GCT GGA AGG AGA AGA TG-3� (reverse)



fore suggesting an increased representation of more mature osteoblastsin sfrp1�/� bone. Therefore, the changes observed in osteoblasts thatreflect stimulated osteogenesis appear to be the result of increasedRunx2 expression. The increase in Runx2 expression and osteoblastmaturation inmouse sfrp1�/� bone is consistent with our earlier reportof accelerated osteoblast differentiation of bone marrow stromal cellsfrom sfrp1�/� mice (29). Thus, our findings show that, in the absence ofSFRP1-mediated antagonism of WNT signaling, Runx2 expression iselevated and promotes osteoblast differentiation. We conclude that, invivo, SFRP1 regulates bone formation by inhibiting WNT-mediatedincreases in Runx2 gene expression.

Canonical WNT Signaling Increases Runx2 Promoter Activity—Di-rect regulation of Runx2 transcription by WNT signaling was initiallyaddressed inMEFs isolated from a transgenicmouse harboring the lacZgene under the control of the 3-kbRunx2 P1 promoter. The transgene isexpressed in mesenchyme early in development prior to formation ofmineralized tissue (42). Because the WNT/�-catenin pathway is linkedto bone formation (15–20, 49, 50), we focused on regulation of theRunx2 gene by canonical WNT signaling. Runx2 promoter responsive-ness to WNT proteins was evaluated by monitoring �-galactosidaseactivity in MEF cells treated with WNT3a-conditioned medium. Lowbasal Runx2 promoter activity was detected by lacZ staining in a sub-population of the cells at confluence. Quantitation of Runx2 promoteractivity by spectrophotometric determination of �-galactosidase activ-ity showed a 3–4-fold increase in response to canonicalWNT signaling(Fig. 2A). InMEF cells, alkaline phosphatase and osteocalcin (markers ofthe osteoblast phenotype) were not induced after 48 h of treatment(data not shown). We used the pre-osteoblastic MC3T3 cell model toexamine Runx2 promoter activity in response to transfected WNT1 inMC3T3 cells. We observed a 1.8-fold induction of 3-kb mouse pro-

moter activity by WNT1. Although the basal activity of the 0.6-kbRunx2 promoter was �2-fold lower compared with that of the 3-kbpromoter, WNT1 treatment resulted in the same -fold induction (1.7-fold) (Fig. 2B). These findings indicate that WNT signaling can up-reg-ulate Runx2 transcription in both committed osteoprogenitor cells andembryonic mesenchymal cells prior to the induction of osteoblast phe-notypic genes.On the basis of the similar responses of the 3- and 0.6-kb promoter

fragments toWNT1 and several studies demonstrating that key regula-tory elements are confined to the 0.6-kb fragment (44, 51), we focusedon the 0.6-kb promoter for further characterization of WNT respon-siveness. As LEF/TCF family proteins interact with �-catenin to regu-late expression of target genes for the canonical WNT signaling path-way (52), we examined the effect of coexpressing TCF1 with a panel ofWNT proteins on the Runx2 promoter in MC3T3 cells (Fig. 2C). In theabsence of TCF1, WNT1 stimulated Runx2 promoter activity by 1.7-fold. However, the presence of TCF1 and either WNT1, WNT3,WNT3a, orWNT6 increased Runx2 promoter activity from 3- to 4-foldover basal activity (i.e. no treatment control).WNT7a andWNT7bwithTCF1 resulted in a modest but statistically significant 1.5-fold (p �0.005) stimulation of Runx2 transcription. Thus, TCF1 potentiates acti-vation of the Runx2 promoter by canonical WNT proteins in osteopro-genitor cells.We next addressed whether the observed WNT/TCF1 activation of

Runx2 is regulated by the secreted antagonist forWNTproteins, SFRP1.We found that SFRP1 modestly decreased (�20%, p � 0.05) the basalactivity of the Runx2 promoter in the absence of exogenousWNT pro-teins. This result indicated that SFRP1 can antagonize endogenousWNT signaling in MC3T3 cells (53), which regulates the Runx2 pro-moter (Fig. 2D). Activation of the Runx2 promoter byWNT1 and TCF1

FIGURE. 1. In vivo regulation of osteogenic differentiation by the WNT pathway. A, analysis of RUNX2 expression in the long bones (marrow-free cortical bones) of 7-month-oldWT and sfrp1�/� mice by quantitative RT-PCR (three mice/group) (upper panel) or by Western blot analysis (two mice/group) (lower panel). The transcript levels were normalized toGAPDH values. See “Experimental Procedures” for RNA and protein lysate preparations and antibody dilution. B, quantitative RT-PCR analysis of Runx2, TCF1, osteocalcin (OC), alkalinephosphatase (AP), histone H4, and bcl2 mRNA levels in the long bones (marrow-free cortical bones) of 1-month-old WT (E) and sfrp1�/� (● ) mice (three mice/group). The transcriptlevels of each gene were normalized to GAPDH values.



was completely blocked by SFRP1.We also found that SFRP1 abolishedactivation of Runx2 by the other canonical WNT proteins (WNT3,WNT3a, and WNT6, for example, are shown). Taken together, thesefindings demonstrate that canonical WNT/TCF signaling positivelyregulatesRunx2 promoter activity and that this regulation can be antag-onized by SFRP1.

The Proximal Runx2 Promoter Contains a Functional TCF DNA-binding Site and aWNT-responsive Element—Within the 0.6-kb Runx2promoter, a single putative TCF site, characterized by the core CTTTG,is located at �97 to �93 (Fig. 3A). We examined this element for theformation of a specific TCF1 DNA-binding complex. For electro-phoretic mobility shift assays, we used nuclear extracts from MC3T3cells in which TCF1 protein was expressed at detectable levels as deter-mined by western blot analysis (data not shown). One major complexwas formed with the WT Runx2 oligonucleotide, but not with the oli-gonucleotide containing a mutation in the TCF consensus sequence(mTCF) (Fig. 3B, left panel). This protein�DNA complex specificallycompeted with the unlabeled WT oligonucleotide, whereas a nonspe-cific oligonucleotide (AP1) had no effect on binding (Fig. 3B, middlepanel). Furthermore, addition of anti-TCF1 antibody to the nuclearextract prevented formation of the complex, whereas a nonspecific anti-body showed no effect (Fig. 3B, right panel).We did not observe RUNX2binding in the electrophoreticmobility shift assay, even though a RUNXconsensus site is located in the probe. Thus, these results suggest thatTCF1 interacts with the consensus TCF1-responsive element in theproximal Runx2 promoter that is conserved between mouse and rat.

To directly address the role of the TCF-binding site in WNT-medi-ated regulation of the Runx2 promoter, the TCF element was mutated(Fig. 3A). Transient transfection studies revealed that mutation of theTCF-binding site resulted in loss of activation by WNT and TCF1 (Fig.3C). These results together confirm that theWNT-mediated inductionof the 0.6-kb Runx2 promoter occurs through the TCF-binding site at�97 to �93.

We next determined whether the enhanced promoter activity istranslated into induced gene expression under the same conditions inMC3T3 cells. We transfected these cells withWNT1 and/or TCF1 andfound that endogenous Runx2 mRNA was induced by 7–8-fold byWNT1 and TCF1 together (Fig. 4A). Because these cells are transfectedwith 30% efficiency, modifications in Runx2 levels by either WNT1 orTCF1 alone were not detected by significant changes in mRNA, as weobserved in promoter assays (see Fig. 2C). However, the observation ofendogenous Runx2 gene expression increased directly by WNT1 andTCF1 was further validated by the in vivo occupancy of the TCF1 reg-ulatory site in the Runx2 gene promoter (Fig. 4B). Chromatin immuno-precipitation studies were performed in MC3T3 cells expressing basallevels of TCF1 andLEF1 as determined by quantitative RT-PCR (Fig. 4B,left panel). Two sets of primer pairs were designed to encompass theTCF element within the Runx2 promoter (Fig. 4B, right panel). Theresults show that TCF1 and�-catenin are associatedwith the promoter.The LEF1 transcription factor, although expressed in these cells, wasnot detected in the Runx2 promoter. Notably, RUNX2 has also beenfound associated with the promoter region of the Runx2 gene, which

FIGURE. 2. Induction of the Runx2 P1 promoter by canonical WNT signaling. A, activation of the lacZ transgene under the control of the 3-kb Runx2 P1 promoter in MEFs inresponse to WNT3a. MEFs were isolated from postcoitus day 12.5 mouse embryos and cultured as described under “Experimental Procedures.” Because MEFs are not transfected withsignificant efficiency, cells at confluence were treated for 48 h with 10% conditioned medium containing WNT3a. A representative area of a well is shown (magnification �2.5) (upperpanels). �-Galactosidase activity in cell lysates after the indicated treatment was quantified (lower panel). A representative experiment shows means � S.D. of 2 wells in a 6-well plate.B, activation of the Runx2 P1 promoter by WNT proteins. MC3T3 cells were transiently transfected with the 3- or 0.6-kb Runx2 promoter reporter (1 �g/well) and WNT1 or the emptyvector pUSEAmp (50 ng/well). The means � S.D. of 6 wells are shown. C, synergistic activation of the Runx2 promoter by canonical WNT proteins and TCF1. MC3T3 cells weretransiently transfected with the 0.6-kb Runx2 promoter reporter (1 �g/well) along with the expression construct for TCF1 (250 ng/well) and the indicated WNT proteins (50 ng/well).pGL3 is the empty vector control for the Runx2 P1 promoter-luciferase reporter. The means � S.D. of 6 wells are shown. The straight line represents basal Runx2 promoter activity. D,SFRP1 suppresses Runx2 promoter activity induced by several WNT proteins. Transient transfection studies were performed in MC3T3 cells with 1 �g of the 0.6-kb Runx2 promoter,50 ng of the indicated WNT proteins, and 300 ng of SFRP1. Error bars indicate the means � S.D. (n � 6).



FIGURE. 4. In vivo regulation of the Runx2 gene by components of WNT signaling and RUNX2. A, relative levels of endogenous Runx2 transcripts in MC3T3 cells transfected withthe WNT1 (50 ng), TCF1 (250 ng), and/or SFRP1 (300 ng) expression construct. Cells were harvested after 24 h for RNA isolation and subsequent analysis by quantitative RT-PCR. TheRunx2 levels were normalized to GAPDH transcript levels. B, in vivo occupancy of the proximal Runx2 promoter by RUNX2 and WNT regulatory factors �-catenin, TCF, and LEF1. Therelative expression levels of TCF1 and LEF1 as detected by quantitative RT-PCR analysis are shown (left panel). Formaldehyde-cross-linked chromatin samples from MC3T3 cells wereused for immunoprecipitation reaction with antibodies against TCF1, LEF1, RUNX2, and �-catenin. The cross-linking was reversed overnight at 65 °C, and DNA was purified andquantified by quantitative RT-PCR using two different sets of primers as indicated. Two primer pairs (as indicated) were used to amplify the immunoprecipitated DNA. Normal rabbitIgG was used as a control. The values are plotted as a fraction of the input precipitated (right panel). C, WNT and RUNX2 effects on Runx2 promoter activity. Osteoprogenitor MC3T3,fibroblastic NIH3T3, and pluripotent mesenchymal C3H10T1/2 cells were transfected at 50 – 60% confluence with the Runx2 P1 promoter (1 �g) and the WNT1 (50 ng), TCF1 (250 ngfor MC3T3 cells and 100 ng for other cell lines), and/or RUNX2 (250 ng) expression construct. The means � S.D. for promoter activities (n � 6 wells) are shown.

FIGURE. 3. A functional TCF site resides in the Runx2 P1 promoter. A, schematic illustration of the Runx2 promoter showing the relative positions of binding sites for the indicatedtranscription factors. The LEF/TCF consensus sequence is presented, showing the proximity to a RUNX regulatory site. The sequences of oligonucleotides (oligo) for the WTTCF-binding site and the mTCF site are shown. B, binding of TCF1 to the Runx2 promoter DNA is demonstrated by electrophoretic mobility shift assay using nuclear extracts fromMC3T3 cells. Five �g of nuclear extracts was incubated with 10 fmol of labeled WT probe or mTCF. A protein�DNA complex formed with the WT oligonucleotide, but not with themutant oligonucleotide (left panel). 100-Fold unlabeled WT oligonucleotide and nonspecific (n/s) AP1 oligonucleotide were used as competitors, demonstrating the specificity of thecomplex indicated by the arrow (middle panel). Anti-TCF1 antibody or nonspecific control antibody (Sp1) was incubated with the nuclear extract at 37 °C for 1 h before addition ofprobe (right panel). C, loss of WNT/TCF-mediated activation in the mutant Runx2 P1 promoter. MC3T3 cells were transiently transfected with either the 0.6-kb WT Runx2 promoterreporter or the mutant TCF1 promoter (mTCF) (1 �g/well) along with the expression construct for TCF1 (250 ng/well) and WNT1 (50 ng/well). The means � S.D. of 6 wells are shown.



includes several RUNX2 sites. Thus, both �-catenin/TCF1 and RUNX2occupy the proximal promoter to control physiological levels ofRUNX2.The proximity of the RUNX regulatory elements to the TCF site and

the known autoregulation of the Runx2 gene (44) led us to examine apotential interaction between RUNX2- and WNT-mediated effects onRunx2 transcription. We examined osteoprogenitor MC3T3 cells andalso non-osseous fibroblast NIH3T3 and pluripotent mesenchymalC3H10T1/2 cells. We observed that WNT1 and TCF1 together sup-ported a 2–3-fold increase in Runx2 promoter activity in each cell type(Fig. 4C). A modest RUNX2 repression of its own promoter was alsoobserved in the cell types. Coexpression of RUNX2 protein withWNT1/TCF1 reduced the activation to the same extent as RUNX2alone (0.7–0.8-fold). This result suggests that WNT/TCF activationand RUNX2 autosuppression act as two independent events for regula-tion of Runx2 gene expression. In conclusion, definitive evidence ofWNT and TCF1 activation of the Runx2 gene promoter has been pro-vided by (a) site-directedmutagenesis of theTCF1-binding site (Fig. 3C)and (b) specific recruitment of TCF1 to the Runx2 promoter in vivo.

DISCUSSION

In this study, using both in vitro and in vivo approaches, we found thatWNT signaling results in activation of the Runx2 promoter and inducesendogenous Runx2 gene expression in pluripotent mesenchymal andosteoprogenitor cells. Our study has identified a critical TCF1-respon-sive element in the 0.6-kb promoter that mediates WNT activation,which is abrogated uponmutagenesis of this regulatory element locatedat �97 to �93. We have shown direct activation of Runx2mediated bymultiple canonicalWNT proteins together with TCF1 in transient pro-moter assays and by in vivo chromatin immunoprecipitation studies.Our chromatin immunoprecipitation studies also revealed selectiveassociation of TCF1 (but not LEF1) with the Runx2 promoter. Further-more, we found that the WNT antagonist SFRP1 blocks canonicalWNT activation of the Runx2 promoter as well as endogenous geneexpression. The in vivo importance of WNT-induced bone formationmediated in part through RUNX2 is further demonstrated by a 10–20-fold activation of TCF1 and Runx2 in the SFRP1-null mouse. Our find-ing of WNT activation of endogenous gene expression and Runx2 pro-moter activity in MEFs and osteoprogenitor cells suggests that WNTsignaling in mesenchymal progenitor cells may be an important activa-tor of Runx2 gene expression in the embryo prior to BMP2-inducedosteogenesis and formation of a mineralized skeleton.Our study provides compelling evidence for a mechanism by which

the canonicalWNTpathway promotes bone formation through�-cate-nin/TCF1-mediated activation of the master osteogenic transcriptionfactor RUNX2, which drives mesenchymal cells to the osteogenic line-age. Thismechanism accounts for in vivo observations inmousemodelsthat the extent of bone formation, as a result of either increased orinhibited �-catenin signaling, correlates with modifications in Runx2expression (24, 25, 54). Higher levels of �-catenin enhance bone forma-tion with concomitant increases in expression of osteoblast-specificgenes (24, 54), whereas conditional knockdown of the �-catenin gene atearly developmental stage causes ectopic chondrogenesis and abnormalosteoblast differentiation (24–26). Furthermore, it has been shown thatWNT10b shifts a mesenchymal cell toward the osteoblast lineage withconcomitant induction of the bone-related transcription factors(including a 5-fold increase in Runx2) and suppression of adipogenictranscription factors (CCAAT/enhancer-binding protein-� and perox-isome proliferator-activated receptor-�) (54). A similar induction of theRunx2 genewas also observed inWNT14 transgenicmice (24).Wehaveidentified a critical regulatory element in the Runx2 gene promoter that

selectively interacts with the TCF1 transcription factor in osteogeniccells. Our finding of a striking increase in TCF1 mRNA levels uponenhancedWNT signaling in vivo in the SFRP1-null mouse supports therequirement of TCF1 for induction of Runx2 gene expression andosteogenesis.The mouse sfrp1�/� model has uncovered a positive feed-forward

regulation of canonicalWNT signaling through the TCF1 transcriptionfactor thatmediates�-catenin activity in target genes. The regulation ofLEF/TCF by WNT/�-catenin signaling is not unprecedented (55–57).Constitutive activation of WNT signaling in colon cancers resultingfrom stabilization of �-catenin that precedes colon cancer results inactivation of full-length LEF1 (55, 56). Inappropriate activation result-ing from mutations in adenomatous polyposis coli or �-catenin acti-vates the TCF4 transcription factor, and one of its target genes is TCF1in epithelial cells (57). Our finding that canonical WNT proteinsincrease both the TCF1 and Runx2 genes in osteoblasts supports thehypothesis that RUNX2 is the molecular switch by which WNT pro-motes osteogenesis instead of chondrogenesis (Fig. 5).The expression of various secreted WNT antagonists (Wif1 and

SFRPs) has been proposed for regulation of osteoblast differentiation(53). Our observation of elevated Runx2 and osteocalcin expression inbone of the SFRP1 knockout mouse provides evidence for SFRP1 inregulating WNT/TCF1/RUNX2-mediated osteoblast maturation. Theeffect of increased RUNX2 is to promote the osteogenic differentiation

FIGURE. 5. Illustration of WNT/TCF1 activation and SFRP1 attenuation of Runx2gene expression for control of bone formation. A, summary of our findings of WNT/TCF1 activation of Runx2 and integration of known BMP2 stimulation of Runx2 for osteo-genesis. Activation of the canonical WNT pathway results in multiple signaling eventsthat lead to induction of TCF1 expression as well as translocation of �-catenin into thenucleus to form a complex with TCF1 on the Runx2 promoter for its induction. Theinduced levels of TCF1 in the sfrp1�/� mouse are also indicated. In parallel, BMP2 alsoleads to Runx2 expression and formation of a RUNX2�Smad coregulatory complex essen-tial for osteogenesis. Cross-talk between WNT and BMP2 signaling for skeletal develop-ment is suggested from the literature, but mechanisms are not clearly defined. B, canon-ical WNT signaling regulates lineage commitment of undifferentiated mesenchymalcells to osteoblasts through RUNX2. The extent of canonical WNT signaling can deter-mine the lineage progression of mesenchymal progenitor cells expressing RUNX2toward chondrogenesis or osteogenesis (24, 25). Induced canonical WNT signaling canup-regulate Runx2 expression, leading to osteoblast differentiation. However, lower lev-els of canonical WNT signaling result in chondrogenesis. Further progression to chon-drocyte differentiation occurs by suppression of RUNX2 by Nkx3.2 (69).



of progenitor cells, and this effect is reflected by increased osteocalcin.The decrease in proliferation (histone H4 expression) and in alkalinephosphatase (an earlymarker of differentiated osteoblasts) also suggestsa mature osteoblast phenotype in sfrp1�/� bone. In the period of rapidgrowth at 1 month of age, we found no change in bone mineral density(data not shown) or in markers of apoptosis betweenWT and sfrp1�/�

mice. By 7months of age, a high bonemass phenotypewas observed andattributed to decreased apoptosis as well as an increased mineral appo-sition rate (29). At both 1 and 7 months of age, Runx2 was increased,indicating that the increased WNT signaling is a positive regulator ofbone formation in young and adult sfrp1�/�mice.However, a high bonemass phenotype may not be observed until after the period of rapidgrowth and bone turnover. In the 7-month-old sfrp1�/� mouse, aslower rate of bone loss was characterized, revealing the anabolic effectsof WNT signaling mediated by Runx2 (29). Our data suggest thatincreased canonical WNT signaling contributes to increased bone for-mation not only by inhibition of osteoclast formation by osteoprote-gerin (58), but also by elevation of RUNX2, contributing to osteoblastmaturation.WNTsignals are operative in primordial structures that lead to devel-

opment of skeletal tissues (9, 21, 23, 59–63). It is now appreciated thatcanonical WNT signaling can govern the lineage commitment and dif-ferentiation of progenitor cells into chondrocytes and osteoblasts (25,58). Runx2 is expressed as early as embryonic day 9.5 in the notochordand then in regions of condensing mesenchyme that will become carti-lage and bone (5, 42). Thus, Runx2 activation by WNT signaling inundifferentiated mesenchymal cells may be required for differentiationinto the osteogenic lineage. The identification of the bone-relatedRUNX2 transcription factor as a target gene of WNT/TCF1 in MEFsand pluripotent and committed osteoprogenitor cells suggests a regu-latory pathway that contributes to defining cell specification and toproviding the option for entry of mesenchymal cells into the osteogeniclineage for both endochondral and intramembranous bone formation.We propose that canonical WNT signaling contributes to bone forma-tion through activation of the RUNX2 transcription factor, which drivesosteoblast differentiation. WNT regulation of Runx2 appears to be assignificant a pathway as BMP signaling, which also induces Runx2 geneexpression. However, a direct Smad regulatory element in the Runx2promoter has never been identified. Rather, it is known that BMPhome-odomain target genes (e.g. dlx5 andmsx2) regulateRunx2 indirectly (64)and that RUNX2-Smad coregulatory protein interactions supportosteogenesis (39, 40), as illustrated in Fig. 5. There is recent evidencethat a complex genetic interaction betweenWNT/�-catenin and BMP/transforming growth factor-� receptor signaling occurs for the devel-opment of many tissues, including the skeleton (65–68). Fig. 5 furtherillustrates how the BMP2 and WNT pathways converge via RUNX2 topromote osteoblast differentiation. Our findings contribute novelinsight into the transcriptional events in early embryonic developmentthat specify the formation of bone tissue.

Acknowledgment—We thankHelga Ponce de Leon for technical assistance andJudy Rask and Charlene Baron for manuscript preparation.

REFERENCES1. Karaplis, A. (2002) in Principles of Bone Biology (Bilezikian, J. P., Raisz, L. G., and

Rodan, G. A., eds) pp. 33–58, Academic Press, Inc., San Diego, CA2. Lian, J. B., Stein, G. S., andAubin, J. E. (2003) in Primer on theMetabolic BoneDiseases

and Disorders of Mineral Metabolism (Favus, M. J., ed) pp. 13–28, American Societyfor Bone and Mineral Research, Washington, D. C.

3. Church, V. L., and Francis-West, P. (2002) Int. J. Dev. Biol. 46, 927–9364. Westendorf, J. J., Kahler, R. A., and Schroeder, T. M. (2004)Gene (Amst.) 341, 19–395. Komori, T. (2005) J. Cell. Biochem. 95, 445–4536. Kobayashi, T., and Kronenberg, H. (2005) Endocrinology 146, 1012–1017

7. Pandur, P., Maurus, D., and Kuhl, M. (2002) BioEssays 24, 881–8848. Logan, C. Y., and Nusse, R. (2004) Annu. Rev. Cell Dev. Biol. 20, 781–8109. Ikeya, M., and Takada, S. (2001)Mech. Dev. 103, 27–3310. Hartmann, C., and Tabin, C. J. (2001) Cell 104, 341–35111. Hartmann, C., and Tabin, C. J. (2000) Development (Camb.) 127, 3141–315912. Yamaguchi, T. P., Bradley, A., McMahon, A. P., and Jones, S. (1999) Development

(Camb.) 126, 1211–122313. Adamska, M., MacDonald, B. T., Sarmast, Z. H., Oliver, E. R., and Meisler, M. H.

(2004) Dev. Biol. 272, 134–14414. Niemann, S., Zhao, C., Pascu, F., Stahl, U., Aulepp, U., Niswander, L.,Weber, J. L., and

Muller, U. (2004) Am. J. Hum. Genet. 74, 558–56315. Boyden, L. M., Mao, J., Belsky, J., Mitzner, L., Farhi, A., Mitnick, M. A., Wu, D.,

Insogna, K., and Lifton, R. P. (2002) N. Engl. J. Med. 346, 1513–152116. Little, R. D., Recker, R. R., and Johnson, M. L. (2002) N. Engl. J. Med. 347, 943–94417. Akhter, M. P., Wells, D. J., Short, S. J., Cullen, D. M., Johnson, M. L., Haynatzki, G. R.,

Babij, P., Allen, K.M., Yaworsky, P. J., Bex, F., and Recker, R. R. (2004) Bone (N. Y.) 35,162–169

18. Babij, P., Zhao, W., Small, C., Kharode, Y., Yaworsky, P. J., Bouxsein, M. L., Reddy,P. S., Bodine, P. V., Robinson, J. A., Bhat, B., Marzolf, J., Moran, R. A., and Bex, F.(2003) J. Bone Miner. Res. 18, 960–974

19. Gong, Y., Slee, R. B., Fukai, N., Rawadi, G., Roman-Roman, S., Reginato, A.M.,Wang,H., Cundy, T., Glorieux, F. H., Lev, D., Zacharin, M., Oexle, K., Marcelino, J., Suwairi,W., Heeger, S., Sabatakos, G., Apte, S., Adkins, W. N., Allgrove, J., Arslan-Kirchner,M., Batch, J. A., Beighton, P., Black, G. C., Boles, R. G., Boon, L. M., Borrone, C.,Brunner, H. G., Carle, G. F., Dallapiccola, B., De Paepe, A., Floege, B., Halfhide, M. L.,Hall, B., Hennekam, R. C., Hirose, T., Jans, A., Juppner, H., Kim, C. A., Keppler-Noreuil, K., Kohlschuetter, A., LaCombe, D., Lambert, M., Lemyre, E., Letteboer, T.,Peltonen, L., Ramesar, R. S., Romanengo,M., Somer, H., Steichen-Gersdorf, E., Stein-mann, B., Sullivan, B., Superti-Furga, A., Swoboda, W., van den Boogaard, M. J., vanHul, W., Vikkula, M., Votruba, M., Zabel, B., Garcia, T., Baron, R., Olsen, B. R., andWarman, M. L. (2001) Cell 107, 513–523

20. Kato, M., Patel, M. S., Levasseur, R., Lobov, I., Chang, B. H., Glass, D. A., Hartmann,C., Li, L., Hwang, T. H., Brayton, C. F., Lang, R. A., Karsenty, G., and Chan, L. (2002)J. Cell Biol. 157, 303–314

21. Yu, H. M., Jerchow, B., Sheu, T. J., Liu, B., Costantini, F., Puzas, J. E., Birchmeier, W.,and Hsu, W. (2005) Development (Camb.) 132, 1995–2005

22. Haegel, H., Larue, L., Ohsugi, M., Fedorov, L., Herrenknecht, K., and Kemler, R.(1995) Development (Camb.) 121, 3529–3537

23. Brault, V., Moore, R., Kutsch, S., Ishibashi, M., Rowitch, D. H., McMahon, A. P.,Sommer, L., Boussadia, O., and Kemler, R. (2001) Development (Camb.) 128,1253–1264

24. Day, T. F., Guo, X., Garrett-Beal, L., and Yang, Y. (2005) Developmental Cell 8,739–750

25. Hill, T. P., Spater, D., Taketo, M. M., Birchmeier, W., and Hartmann, C. (2005)Developmental Cell 8, 727–738

26. Holmen, S. L., Zylstra, C. R., Mukherjee, A., Sigler, R. E., Faugere, M. C., Bouxsein,M. L., Deng, L., Clemens, T. L., and Williams, B. O. (2005) J. Biol. Chem. 280,21162–21168

27. Tamamura, Y., Otani, T., Kanatani, N., Koyama, E., Kitagaki, J., Komori, T., Yamada,Y., Costantini, F.,Wakisaka, S., Pacifici, M., Iwamoto,M., and Enomoto-Iwamoto,M.(2005) J. Biol. Chem. 280, 19185–19195

28. Kawano, Y., and Kypta, R. (2003) J. Cell Sci. 116, 2627–263429. Bodine, P. V., Zhao,W., Kharode, Y. P., Bex, F. J., Lambert, A. J., Goad,M. B., Gaur, T.,

Stein, G. S., Lian, J. B., and Komm, B. S. (2004)Mol. Endocrinol. 18, 1222–123730. Banerjee, C., McCabe, L. R., Choi, J.-Y., Hiebert, S. W., Stein, J. L., Stein, G. S., and

Lian, J. B. (1997) J. Cell. Biochem. 66, 1–831. Ducy, P., Zhang, R., Geoffroy, V., Ridall, A. L., and Karsenty, G. (1997) Cell 89,

747–75432. Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., Shimizu, Y.,

Bronson, R. T., Gao, Y.-H., Inada,M., Sato,M., Okamoto, R., Kitamura, Y., Yoshiki, S.,and Kishimoto, T. (1997) Cell 89, 755–764

33. Otto, F., Thornell, A. P., Crompton, T., Denzel, A., Gilmour, K. C., Rosewell, I. R.,Stamp,G.W.H., Beddington, R. S. P.,Mundlos, S., Olsen, B. R., Selby, P. B., andOwen,M. J. (1997) Cell 89, 765–771G. W. H.R. S. P.

34. Choi, J.-Y., Pratap, J., Javed, A., Zaidi, S. K., Xing, L., Balint, E., Dalamangas, S., Boyce,B., van Wijnen, A. J., Lian, J. B., Stein, J. L., Jones, S. N., and Stein, G. S. (2001) Proc.Natl. Acad. Sci. U. S. A. 98, 8650–8655

35. Otto, F., Kanegane, H., and Mundlos, S. (2002) Hum. Mutat. 19, 209–21636. Yoshida, T., Kanegane, H., Osato, M., Yanagida, M., Miyawaki, T., Ito, Y., and Shige-

sada, K. (2003) Blood Cells Mol. Dis. 30, 184–19337. Lian, J. B., Javed, A., Zaidi, S. K., Lengner, C., Montecino, M., vanWijnen, A. J., Stein,

J. L., and Stein, G. S. (2004) Crit. Rev. Eukaryot. Gene Expr. 14, 1–4138. Paredes, R., Arriagada, G., Cruzat, F., Villagra, A., Olate, J., Zaidi, K., vanWijnen, A. J.,

Lian, J. B., Stein, G. S., Stein, J. L., and Montecino, M. (2004) Mol. Cell. Biol. 24,8847–8861

39. Afzal, F., Pratap, J., Ito, K., Ito, Y., Stein, J. L., vanWijnen, A. J., Stein, G. S., Lian, J. B.,and Javed, A. (2005) J. Cell. Physiol. 204, 63–72



40. Zaidi, S. K., Sullivan, A. J., van Wijnen, A. J., Stein, J. L., Stein, G. S., and Lian, J. B.(2002) Proc. Natl. Acad. Sci. U. S. A. 99, 8048–8053

41. Zaidi, S. K., Sullivan, A. J., Medina, R., Ito, Y., vanWijnen, A. J., Stein, J. L., Lian, J. B.,and Stein, G. S. (2004) EMBO J. 23, 790–799

42. Lengner, C. J., Drissi, H., Choi, J.-Y., vanWijnen, A. J., Stein, J. L., Stein, G. S., and Lian,J. B. (2002)Mech. Dev. 114, 167–170

43. Lengner, C. J., Lepper, C., van Wijnen, A. J., Stein, J. L., Stein, G. S., and Lian, J. B.(2004) J. Cell. Physiol. 200, 327–333

44. Drissi, H., Luc, Q., Shakoori, R., Chuva de Sousa Lopes, S., Choi, J.-Y., Terry, A., Hu,M., Jones, S., Neil, J. C., Lian, J. B., Stein, J. L., vanWijnen, A. J., and Stein, G. S. (2000)J. Cell. Physiol. 184, 341–350

45. Zhang, Y. W., Yasui, N., Ito, K., Huang, G., Fujii, M., Hanai, J., Nogami, H., Ochi, T.,Miyazono, K., and Ito, Y. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 10549–10554

46. Javed, A., Barnes, G. L., Jassanya, B.O., Stein, J. L., Gerstenfeld, L., Lian, J. B., and Stein,G. S. (2001)Mol. Cell. Biol. 21, 2891–2905

47. Hovhannisyan, H., Cho, B., Mitra, P., Montecino, M., Stein, G. S., van Wijnen, A. J.,and Stein, J. L. (2003)Mol. Cell. Biol. 23, 1460–1469

48. Kockx, M., McCabe, L., Stein, J. L., Lian, J. B., and Stein, G. S. (1994) J. Cell. Biochem.54, 47–55

49. Holmen, S. L., Giambernardi, T. A., Zylstra, C. R., Buckner-Berghuis, B. D., Resau,J. H., Hess, J. F., Glatt, V., Bouxsein, M. L., Ai, M.,Warman,M. L., andWilliams, B. O.(2004) J. Bone Miner. Res. 19, 2033–2040

50. Kokubu, C., Heinzmann, U., Kokubu, T., Sakai, N., Kubota, T., Kawai, M., Wahl,M. B., Galceran, J., Grosschedl, R., Ozono, K., and Imai, K. (2004) Development(Camb.) 131, 5469–5480

51. Zambotti, A., Makhluf, H., Shen, J., and Ducy, P. (2002) J. Biol. Chem. 277,41497–41506

52. Clevers, H., and van de Wetering, M. (1997) Trends Genet. 13, 485–48953. Vaes, B. L., Dechering, K. J., van Someren, E. P., Hendriks, J. M., van de Ven, C. J.,

Feijen, A., Mummery, C. L., Reinders, M. J., Olijve, W., Van Zoelen, E. J., and Stee-genga, W. T. (2005) Bone (N. Y.) 36, 803–811

54. Bennett, C. N., Longo, K. A., Wright, W. S., Suva, L. J., Lane, T. F., Hankenson, K. D.,and MacDougald, O. A. (2005) Proc. Natl. Acad. Sci. U. S. A. 102, 3324–3329

55. Hovanes, K., Li, T. W., Munguia, J. E., Truong, T., Milovanovic, T., Lawrence, M. J.,Holcombe, R. F., and Waterman, M. L. (2001) Nat. Genet. 28, 53–57

56. Filali, M., Cheng, N., Abbott, D., Leontiev, V., and Engelhardt, J. F. (2002) J. Biol.Chem. 277, 33398–33410

57. Roose, J., Huls, G., van Beest, M., Moerer, P., van der Horn, K., Goldschmeding, R.,Logtenberg, T., and Clevers, H. (1999) Science 285, 1923–1926

58. Glass, D. A., Bialek, P., Ahn, J. D., Starbuck, M., Patel, M. S., Clevers, H., Taketo,M. M., Long, F., McMahon, A. P., Lang, R. A., and Karsenty, G. (2005) Dev. Cell 8,751–764

59. Augustine, K., Liu, E. T., and Sadler, T.W. (1993)Developmental Genet. 14, 500–52060. Zakany, J., and Duboule, D. (1993) Nature 362, 546–54961. Hoang, B. H., Thomas, J. T., Abdul-Karim, F. W., Correia, K. M., Conlon, R. A.,

Luyten, F. P., and Ballock, R. T. (1998) Dev. Dyn. 212, 364–37262. Aulehla, A., Wehrle, C., Brand-Saberi, B., Kemler, R., Gossler, A., Kanzler, B., and

Herrmann, B. G. (2003) Developmental Cell 4, 395–40663. Hu, H., Hilton, M. J., Tu, X., Yu, K., Ornitz, D. M., and Long, F. (2005) Development

(Camb.) 132, 49–6064. Lee, M. H., Kim, Y. J., Kim, H. J., Park, H. D., Kang, A. R., Kyung, H. M., Sung, J. H.,

Wozney, J. M., Kim, H. J., and Ryoo, H. M. (2003) J. Biol. Chem. 278, 34387–3439465. Soshnikova,N., Zechner,D.,Huelsken, J.,Mishina, Y., Behringer, R. R., Taketo,M.M.,

Crenshaw, E. B., III, and Birchmeier, W. (2003) Genes Dev. 17, 1963–196866. Gazzerro, E., Pereira, R. C., Jorgetti, V., Olson, S., Economides, A. N., and Canalis, E.

(2005) Endocrinology 146, 655–66567. Derfoul, A., Carlberg, A. L., Tuan, R. S., and Hall, D. J. (2004) Differentiation 72,

209–22368. Zhou, S., Eid, K., and Glowacki, J. (2004) J. Bone Miner. Res. 19, 463–47069. Lengner, C. J., Hassan, M. Q., Serra, R. W., Lepper, C., van Wijnen, A. J., Stein, J. L.,

Lian, J. B., and Stein, G. S. (2005) J. Biol. Chem. 280, 15872–15879



Documents

Canonical WNT Signaling Promotes Osteogenesis by Directly Stimulating Runx2 Gene Expression