BMC Microbiology BioMed Central - eprints.whiterose.ac.ukeprints.whiterose.ac.uk/108123/1/YsxC, an essential protein in... · proteins S2, S10 and L17, as well as the β' subunit

BioMed CentralBMC Microbiology

ss
Open AcceResearch articleYsxC, an essential protein in Staphylococcus aureus crucial for ribosome assembly/stabilityElizabeth L Cooper†, Jorge García-Lara† and Simon J Foster*
Address: Department of Molecular Biology and Microbiology, University of Sheffield, Sheffield S10 2TN, UK

Email: Elizabeth L Cooper - [email protected]; Jorge García-Lara - [email protected]; Simon J Foster* - [email protected]

* Corresponding author †Equal contributors

AbstractBackground: Bacterial growth and division requires a core set of essential proteins, several ofwhich are still of unknown function. They are also attractive targets for the development of newantibiotics. YsxC is a member of a family of GTPases highly conserved across eubacteria with apossible ribosome associated function.

Results: Here, we demonstrate by the creation of a conditional lethal mutant that ysxC isapparently essential for growth in S. aureus. To begin to elucidate YsxC function, a translationalfusion of YsxC to the CBP-ProteinA tag in the staphylococcal chromosome was made, enablingTandem Affinity Purification (TAP) of YsxC-interacting partners. These included the ribosomalproteins S2, S10 and L17, as well as the β' subunit of the RNA polymerase. YsxC was then shownto copurify with ribosomes as an accessory protein specifically localizing to the 50 S subunit. YsxCdepletion led to a decrease in the presence of mature ribosomes, indicating a role in ribosomeassembly and/or stability in S. aureus.

Conclusions: In this study we demonstrate that YsxC of S. aureus localizes to the ribosomes, iscrucial for ribosomal stability and is apparently essential for the life of S. aureus.

BackgroundStaphylococcus aureus colonises the nares and skin ofapproximately one-third of the healthy global population[1] and is responsible for a wide variety of infections bothin hospitals and the community [2-4]. The increasingantibiotic resistance of S. aureus has led to the search foralternative drug targets. Amongst them, proteins indis-pensable for cellular viability are optimal candidates.There are currently about 15 essential proteins from bac-terial genomes used as antibiotic targets encompassing arestricted set of microbial processes, including DNA repli-cation and repair, fatty acid and protein biosynthesis, andcell wall synthesis [5]. A large number of essential proteins

remain to be investigated for novel antimicrobial devel-opment.

In a genome-wide study in Bacillus subtilis the IPTG-induc-ible Pspac conditional expression system was used to deter-mine gene essentiality [6]. A subset of 15 genes identifiedin this screening had no significant homology to any geneof known function, and included the well-conserved Era/Obg family of GTP binding proteins [6]. The latterbelongs to a diverse superfamily of the often referred to aslow molecular weight GTPases, which act as molecularswitches in the regulation of crucial cellular processesacross all domains of life, including: intracellular and

Published: 18 December 2009

BMC Microbiology 2009, 9:266 doi:10.1186/1471-2180-9-266

Received: 20 March 2009Accepted: 18 December 2009

This article is available from: http://www.biomedcentral.com/1471-2180/9/266

© 2009 Cooper et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Page 1 of 12(page number not for citation purposes)

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=20021644

http://www.biomedcentral.com/1471-2180/9/266

http://creativecommons.org/licenses/by/2.0

http://www.biomedcentral.com/

http://www.biomedcentral.com/info/about/charter/

BMC Microbiology 2009, 9:266 http://www.biomedcentral.com/1471-2180/9/266

membrane signalling, vesicular transport, cell division,chromosome partitioning, protein targeting and ribos-omal function [7].

Although very few of the bacterial low molecular weightGTPases have well characterised roles, there is increasingevidence that members of the Era/Obg family of GTPasesare involved in ribosome function, assembly or stability.Work on Era, Obg, YjeQ/YloQ, YlqF, YphC, and YsxC in E.coli and B. subtilis has indicated associations of these pro-teins with ribosomal subunits and changes in ribosomalprofiles [8-10]. Ribosome profiles, created by separationof ribosome constituents on a sucrose gradient, show adecrease in whole 70 S ribosomes with an concomitantincrease in 30 S and 50 S ribosomal subunits after deple-tion of the protein of interest [9,11-15].

YsxC in B. subtilis (YihA in E. coli) is an ortholog of the Era/Obg family of GTP-binding protein that has been reportedto be essential in B. subtilis, E. coli, S. pneumoniae, H. influ-enzae, and M. genitalium [9,16,17]. We have previouslysolved the crystal structure of the B. subtilis YsxC in itsopen and closed conformations, proven its ability to com-plex with GDP and GTP, and shown the conformationalchanges occurring upon nucleotide binding and GTPhydrolysis [18].

A B. subtilis mutant with ysxC under the control of the reg-ulatable Pspank promoter has revealed that depletion of the

protein led to the accumulation of intermediate 50 S sub-units (described as 44.5 S subunits) different from thoseseen upon depletion of similar GTPases YphC and YlqF[9]. However, as with YlqF and YphC depletion, interme-diates lacked ribosomal proteins L16, L36 and possiblyL27. Other putative ribosomal interacting partners ofYsxC have been suggested by Wicker-Planquart and co-authors [10]. YsxC is likely to be essential across eubacte-ria.

In this study we demonstrate that YsxC of S. aureus local-izes to the ribosomes, is crucial for ribosomal stability andis essential for the life of S. aureus.

ResultsYsxC is essential in S. aureusTo test whether ysxC was essential in S. aureus, a straincontaining a single chromosomal copy of ysxC under thecontrol of a regulatable promoter (Pspac), repressed by LacIand requiring the inducer IPTG for expression was con-structed as indicated in Material and Methods (See alsoFigure 1). Growth of LC109 (SH1000 Pspac~ysxC/pGL485)at several IPTG concentrations (0 μM, 5 μM, 10 μM and500 μM) was analysed on BHI agar plates supplementedwith chloramphenicol to ensure maintenance of the lacI-containing plasmid (Figure 2A). Strong growth can beseen on the plate containing 500 μM IPTG with distinctivesingle colonies, which are absent on the plate withoutIPTG. The phenotype on solid medium was further con-

Detailed scale representation of the P spac~ysxC (LC108/LC109) and ysxC::TAP-tag (LC103) chromosomal constructsFigure 1Detailed scale representation of the P spac~ysxC (LC108/LC109) and ysxC::TAP-tag (LC103) chromosomal con-structs. λred recombination allowed highly specific chimera construction resulting in the Tet-T-Pspac or TAP-tag-kan cassette insertions. The relevant sequence junctions are shown for both constructs. Chromosomal sequence is shown in italics and rel-evant features generated by λred recombination are underlined.

Pspac-oid

t0 t1 t2tet

RBS ysxCgtggaattgtgagccgctcacaattaa gtgagg atataaaatgaaagttaatcctaataatattgaattaatPspac oid

LC108/LC109

LC103

ataataaacaacaacaaatatggaatttaattgaaccgtatatttca atggaaaagagaagatgg

ysxC

CBP

A

B

500 bp

ysxCclpX hemA

ysxCclpX CBP-A kan hemA



firmed in liquid medium (Figure 2B). In a different exper-iment it was shown that the presence or absence of IPTGdoes not affect growth of the wild type SH1000 strain(data not shown), while growth of LC109 (SH1000Pspac~ysxC/pGL485) is IPTG concentration dependent(Figure 2B). No distinguishable alterations were observedon YsxC-depleted cells under light or transmission elec-tron microscopy (data not shown). The number of viablecounts on LC109 incubated in the absence of IPTGremained virtually unchanged, while in the presence of 1mM IPTG it increased by 2 logs. Interestingly, even at 1mM IPTG, LC109 (SH1000 Pspac~ysxC/pGL485) had agrowth defect when compared to the wild type SH1000strain (2.8×108 and 7.3×109 CFU after 7 h, respectively).These results demonstrate that ysxC is apparently essentialfor growth of S. aureus in these conditions.

To study if the reduction in growth rate seen using the ysxCconditional lethal strain LC109 (SH1000 Pspac~ysxC/pGL485) correlated with a concomitant depletion ofYsxC, protein levels after growth without IPTG were ana-lysed. As indicated above, cells showed a severe growthdefect when IPTG was lacking, thus limiting the yield forbiochemical analysis. To overcome this, a higher initialinoculum (OD600 = 0.01) was used and cultures weregrown with choramphenicol and IPTG (with 500 μM orwithout). At this inoculum density, without IPTG thegrowth rate of LC109 (SH1000 Pspac~ysxC/pGL485) wasstill approximately 1 log below that of SH1000 after 5hours of growth (data not shown). Equal amounts ofmaterial purified by ultracentrifugation were analysed bySDS-PAGE (data not shown) and Western blotting, prob-ing with anti-YsxC polyclonal antibody (See Methods; Fig-ure 2C). In SH1000 there is a major YsxC cross-reactiveband of ~26 kD and a minor band of ~25 kD, correspond-ing to a size similar to the predicted molecular weight, i.e.,23 kD. Both bands show lower intensity in LC109(SH1000 Pspac~ysxC/pGL485) grown without IPTG.Hence, ysxC downregulation is accompanied by a decreasein YsxC concentration in the cell.

Purification of YsxC interacting partnersOne method used to elucidate the function of a protein ofinterest is to search for protein partners with which itinteracts in the cell. In order to identify proteins interact-ing with YsxC, the protein was TAP-tagged [strain LC103(SH1000 spa::tet ysxC::TAP)] and an interactive complexpurified as described in Materials and Methods. Theresulting proteins were separated by SDS PAGE and silverstained (Figure 3). 16 distinctive protein bands found inthe eluted YsxC complex were trypsin digested and theamino acid sequence of the resulting fragments deter-mined by mass spectrometry. Subsequently, a MASCOTsearch for proteins in the database containing thesesequences was carried out. Table 1 shows the most proba-ble identity of each of the bands as per its Mowse score. 10of the 16 bands were identified as proteins from S. aureus,one band was not identified, and four of them (casein andkeratin) corresponded to preparation contaminants.

The band that had the highest probability of a match wasBand 13. Its Mowse score for 30 S ribosomal protein S5was 246 with a threshold level of 38. Since 5 fragmentsfrom this band matched to this protein the identificationis highly probable. Other bands with high match identi-ties were Band 5 (aerobic glycerol-3-phosphate dehydro-genase), Band 8 (30 S ribosomal protein S2), Band 15 (50S ribosomal protein L17) and Band 16 (30 S ribosomalprotein S10) (Table 1). YsxC, the protein originallytagged, was also identified as a high match band (Band 9,227(36)). All these proteins matched at least 2 fragmentsfrom the band. For 2 parent ions with a score of 95% or

YsxC requirement for S. aureus growthFigure 2YsxC requirement for S. aureus growth. A) Strain LC109 (SH1000 Pspac~ysxC/pGL485) was grown on BHI agar plates containing 20 μg ml-1 Cam and 500 μM, 10 μM, 5 μM or 0 μM IPTG overnight. B) Exponentially growing cultures of strains SH1000 (●) and LC109 (SH1000 Pspac~ysxC/pGL485) (❍,τ,ρ) were washed and resubcultured to approx-imately 1×106 CFU ml-1 in BHI (●) or in BHI supplemented with 20 μg ml-1 Cam plus different concentration of IPTG: 0 (❍), 10 μM (▼) or 1 mM (�). Growth was monitored as CFU/ml. c) Western blot using anti-YsxC polyclonal antibod-ies. Strains SH1000 and LC109 (SH1000 Pspac~ysxC/pGL485) were grown to an OD600 = 0.5 in BHI and BHI plus 20 μg ml-1 Cam, respectively. Cells were harvested by centrifugation, the membrane protein fraction extracted and samples were separated by 12% (w/v) SDS-PAGE. Lane: 1, the size of molecular weight markers separated on the same gel is indi-cated; 2, SH1000; 3, LC109.

0 M

A B

C

28.2

kDa 2 31

5 M

10 M

500 M

IPTG



better, one can assume that the proteins has been identi-fied.

Other interacting bands identified with a score indicativeof extensive homology (i.e., 36, See Methods) were bands2 and 7, and corresponded to the DNA-directed RNApolymerase beta' chain protein and putative elongationfactor Tu. However, although the former matched 2 frag-ments, the latter, like SecA and PflB, were one hit matches,which would require further validation to be consideredas legitimate YsxC partners. Similarly, Bands 3 and 4 cor-responded to casein, a protein not present in S. aureus buta common preparation contaminant.

TAP tagging has not previously been reported in S. aureustherefore it was important to eliminate the possibility thatany of the proteins identified, corresponded to purifica-tion artefacts. An independent purification of an unre-lated TAP-tagged protein of S. aureus most likelyparticipating in phospholipid metabolism and also puri-fying with the membrane fraction was carried out (YneS/PlsY; García-Lara and Foster, unpublished). It revealedinteractions with proteins also encountered in our searchfor YsxC partners: 30 S ribosomal protein S5, elongationfactor Tu and aerobic glycerol-3-phosphate dehydroge-nase (data not shown). Although these data do notexclude the corresponding proteins as legitimate interact-

ing partners of YsxC and YneS/PlsY, the involvement ofthese two proteins in different aspects of bacterial physiol-ogy suggests the common partners as likely artefacts of thepurification procedure. Overall, the protein partnersresulting from our experiments suggest YsxC as a ribos-ome-interacting protein.

Subcellular localisation of YsxCThe TAP tagging experiment identified several ribosome-associated proteins as YsxC interacting partners. To exam-ine the putative association of YsxC with ribosomes, a co-purification experiment was carried out. Staphylococcalribosomes were extracted from other cellular materials byseveral ultracentrifugation and washing steps, and coreribosomes were depleted of accessory ribosomal proteinsby ammonium chloride extraction. Equivalent samplesfrom different stages of the purification process were sep-arated by SDS-PAGE, Western blotted and immuno-detected with anti-YsxC antibodies (Figure 4). YsxC is inthe insoluble fraction following the initial ultracentrifuga-tion of a total cell extract (lane 3) and remains in theinsoluble fraction after solubilisation of the membraneswith Triton X-100 (lane 5). When this insoluble fractionwas resuspended in 1 M NH4Cl, YsxC was solubilised(lane 6). These results suggest that YsxC is associated withthe ribosome but is not a core ribosomal protein.

Association of YsxC with specific ribosomal subunitsIn order to elucidate the nature of the YsxC-ribosomeassociation, material from S. aureus SH1000 containingribosomes was separated by ultracentrifugation in asucrose gradient. This separates the ribosome into its con-stituents, i.e., 30 S and 50 S subunits, as well as the whole70 S ribosome. The association of YsxC with a particularribosomal fraction was determined by Western blotimmunodetection with anti-YsxC antibodies. As shown inFigure 5 the extract contained the three expected ribos-omal fractions and YsxC was primarily located in samples8-14 corresponding to the 50 S subunit.

Role of YsxC in the ribosomeYsxC may play a role in ribosome assembly, activity or sta-bility. Ribosome profiles of wild type and YsxC-depletedcultures were compared. Cells from both cultures werebroken in the presence of two different buffers: Ribosome(associating) buffer and S (dissociating) buffer. Ribosomebuffer gives conditions where tightly coupled ribosomeswill remain intact whereas loosely coupled ribosomes willdissociate into subunits ([19]; Figure 6A, C). In S buffer,the magnesium levels are reduced and the monovalentions increased which leads to full dissociation of theribosomes ([20]; Figure 6B, D). After breakage, sampleswere ultracentrifuged and the pellet containing the ribos-omes resuspended and loaded onto 10-30% (w/v) sucrosegradients in the relevant buffer and centrifuged. 1 ml sam-

Identification of YsxC interacting proteinsFigure 3Identification of YsxC interacting proteins. Proteins were separated on a 4-12% (w/v) SDS-PAGE gradient gel and silver stained. Lane: 1, molecular mass markers of sizes shown; 2, YsxC complex proteins from 15 l of original cul-ture. The band numbers correspond to those that were ana-lysed by mass spectrometry.

20

75

kDa 21250150

50

37

15

10

100

25

1234567

89 10

1112

1314

1516



ples were taken from the base of the gradient and testedfor RNA levels (Figure 6).

The ribosome profile of the YsxC-depleted strain (LC109grown in the absence of IPTG) in associating buffer (Fig-ure 6C) shows a change in ratio of subunits (50 S and 30S) to whole (70 S) ribosomes when compared to wild type(Figure 6A). The 30 S and 50 S peaks in the depleted strainwere larger than that of the 70 S. In contrast, the wild typeprofile reveals a much larger peak for the whole ribosomethan for either of the two subunits. When the ribosome is

Table 1: MASCOT search results for YsxC partners

Band no. Gene name Protein Mowse score (threshold level) * No. of fragments

1 not identified2 rpoC DNA-directed RNA polymerase beta' chain 40 (36) 23 secA preprotein translocase secA subunit 20 (35) 14 pflB formate acetyltransferase 27 (36) 15 glpD aerobic glycerol-3-phosphate dehydrogenase 167 (37) 66 Casein7 tuf putative elongation factor Tu 39 (36) 18 rpsB 30 S ribosomal protein S2 121 (36) 39 ysxC putative GTP-binding protein 227 (36) 210 Keratin11 Casein12 Casein13 rpsE 30 S ribosomal protein S5 246 (38) 514 Casein15 rplQ 50 S ribosomal protein L17 98 (41) 316 rpsJ 30 S ribosomal protein S10 173 (39) 3

1 Mowse score = -10*Log(P), where P is the probability that the observed match is a random event. The higher the number, the better the match. Individual ions with scores greater than the threshold level (in brackets) indicates identity or extensive homology (p < 0.05).

Subcellular localisation of YsxCFigure 4Subcellular localisation of YsxC. The ribosome-contain-ing fraction of S. aureus SH1000 was made by ultracentrifuga-tion after cell breakage and removal of cellular debris. Lane: 1, pre-stained molecular mass markers; 2, supernatant after ultracentrifugation; 3, pellet resuspended in buffer, containing 0.5% (v/v) Triton X-100, equal to that of the original suspen-sion; 4, supernatant after the ultracentrifugation step was repeated; 5, pellet resuspended in buffer containing 1 M ammonium chloride (NH4Cl); 6, supernatant after further ultracentrifugation; 7, pellet resuspended in an equal amount of buffer containing 1 M NH4Cl. Samples were resolved by 12% (w/v) SDS-PAGE and A) Coomassie Blue stained, or B) Western blotted with antibodies against YsxC. Each lane contains the equivalent of 1 ml of original culture.

AkDa 21

106.993.652.3

37.228.2

18.8

3 4 6

28.2B

5 7

Association of YsxC with ribosomal subunitsFigure 5Association of YsxC with ribosomal subunits. A) A260 of a ribosome containing fraction of S. aureus SH1000 sepa-rated by a 10-30% (w/v) sucrose gradient centrifugation. 1 ml samples were taken and analysed for RNA content (A260). B) Western blot of gradient samples probed with anti-YsxC.

70S

50S30S

Direction of sedimentation

~26

kDa

A

B

Samples 8-14



fully dissociated into its constituent subunits (in S buffer)the levels in wild type and LC109 (SH1000 Pspac~ysxC/pGL485) are virtually identical (Figure 6B, D). However,the peak for the 50 S subunits is slightly broader than inthe wild type potentially indicating the presence of aber-rant 50 S subunits.

DiscussionConditional lethal constructs based on the replacement ofthe cognate promoters of chromosomal genes by promot-ers that can be exogenously controlled have been usedsuccessfully to identify essential genes in several organ-isms. For instance, the Pspac promoter was used in thecomprehensive genome wide study of B. subtilis, whereysxC was proven to be indispensable [6]. Identification ofessential genes in S. aureus has also taken advantage of thissystem and a number of them have been identifiedincluding genes involved in cell wall biosynthesis [21,22],a glycoprotease [23] and a two-component system [24]. Inthis study, we have engineered the chromosomal copy ofS. aureus ysxC under the control of Pspac. Growth of LC109(SH1000 Pspac~ysxC/pGL485) depended on the presenceof the inducer IPTG in the medium, thereby proving thatysxC is apparently essential in S. aureus. Our results are inagreement with data from an antisense study by Forsythand co-workers suggesting the essentiality of ysxC in S.aureus [25]. In the absence of inducer, the strain is unableto form single colonies on plate and only residual growthis detected in liquid medium. The latter is most likely dueto the YsxC remaining in the cell at the time of inducerremoval and/or the minor leaky nature of Pspac alsoobserved in the Pspank expression of ysxC by Schaefer andco-workers [9]. Interestingly, even maximum IPTG con-centrations are unable to restore the growth rate of themutant to the SH1000 wild type values. Thus, YsxC could

potentially be an interesting target for novel drug develop-ment.

Galperin and Koonin cite YsxC in the top 10 list of 'knownunknowns' of highly attractive targets for experimentalstudy of conserved hypothetical proteins in S. aureus [26].Nevertheless, it is extremely important to verify essential-ity and analyse gene function in relevant pathogens as notall genes essential in one species maybe so in another.

Tandem affinity purification was originally developed inyeast [27] and has been extensively used in other organ-isms [28-31], however, not previously in S. aureus. TAPtagging of YsxC and subsequent purification indicatedinteractions with a number of proteins, the majority ofwhich had functions related to or were integral parts of theribosome. These were 30 S ribosomal proteins S2 andS10, and 50 S ribosomal protein L17. This indicates thatthe function of YsxC is likely to be related to the ribosome.However, the ribosome is a complex structure and a largenumber of processes are required for its correct function,including the construction of subunits from ribosomalproteins and RNA and the assembly of the subunits intothe whole ribosome before the translation process. Muchof the exact details of these processes and which addi-tional factors are required are unknown. S2 and S10 arenot located together on the assembled ribosome butinvolved in the later stages of 30 S assembly [32]. In con-trast, 50 S ribosomal protein L17, which is localized onthe surface of the subunit, binds to 23S rRNA, and evenafter extensive treatment to dissociate proteins can befound in the core of the 50 S subunit [33-35]. Impor-tantly, B. subtilis L17 over-expression in E. coli results inabnormal cell division and nucleoid segregation becom-ing ultimately lethal [36]. Similarly, in B. subtilis, a muta-tion altering L17 was reported to cause temperaturesensitivity and a sporulation defect [37]. Interestingly,depletion of YsxC in B. subtilis results in cell elongation,abnormal cell curvature and nucleoid condensation [38].Similarly, depletion of YihA in E. coli also impairs celldivision [16]. Importantly, deficiency of other smallmolecular weight GTPases in various species, includingObgE in E. coli, and Bex in B. subtilis also appear to affectcytokinesis and chromosome partitioning [39,40].Whether these phenotypes are due to the absence of YsxC(and/or L17) or other P-loop GTPases directly impingingon the cell division-related apparatus or a downstreampleiotropic effect remains to be studied. Our light andtransmission electron microscopy studies of the cellularmorphology of S. aureus YsxC-depleted cultures did notreveal a conspicuous deviation from that wild type cells(data not shown).

Recent reports based on the ribosomal intermediatesaccumulated following YsxC depletion or Far-Westernblotting analysis of purified ribosomal proteins have sug-

Role of YsxC in ribosomal profile determinationFigure 6Role of YsxC in ribosomal profile determination. Sucrose gradient profiles were established for extracts from SH1000 (A, B) and LC109 (SH1000 Pspac~ysxC/pGL485) grown with no IPTG (C, D). 10-30% (w/v) sucrose gradients were run in either associating (A, C) or dissociating (B, D) buffers and ribosomes analysed by A260 levels in gradient samples.

70S50S 30S

50S 30S

70S 50S30S

50S 30S

A B

C D



gested other YsxC interacting partners in E. coli and/or B.subtilis. A few are essential for viability (L6, L7/L12, L10,L23, and perhaps L16) while others, although required foroptimal growth, are dispensable (L1, L27 and L36) [9,10].The L7/L12 stalk (which binds L10 at its base) has beensuggested to participate in 23S RNA binding and on therecruitment of peripheral ribosomal factors [41]. Struc-tural studies on the topology of several proteins includingL7/12, L1, L6 and S5 has led to postulate a role for themas RNA binders probably stabilizing rRNA tertiary struc-ture by fixing the positions of pairs of rRNA sequences[42]. The possible YsxC contribution to, RNA stabilizationremains to be determined. Although the bulk of L7/L12resides within the 50 S region, evidence of its interactionwith the 30 S subunit, including S2 has been provided bycross-linking studies (See Review [43]). In addition,immuno-EM observations provide supportive evidencefor different locations within the ribosome for the L7/L12carboxy-terminal end including the 30 S subunit. It is alsoworth noting that most of the proteins shown to interactwith YsxC are well exposed on the surface of the E. coliribosome: S1 (which requires S2 for binding to the 30 Ssubunit), S5, L7/L12, L10, L17 [44]. Thus providing cluesas to the location of YsxC within the ribosome.

Butland and co-authors found YihA (the E. coli YsxChomolog) to associate with itself [28]. In our study suchinteraction would not be detectable as only the taggedcopy of the ysxC was present in the chromosome. How-ever, our experimental design enabled us to confirm thatthe YsxC-TAP-tag protein was functional, excluding thepossibility of inactive protein artefacts.

The interaction we have observed between YsxC and the β'subunit of RNA polymerase, has also been previouslyreported for ObgE [14,28]. Further work needs to be doneto first confirm this interaction in S. aureus and then estab-lish whether it relates to ribosomal or extra-ribosomalfunctions as reported for L24 of B. subtilis [45].

P-loop GTPases, such as YsxC, show an association mainlywith one or other subunit of the ribosome. For instance,Era and YjeQ with the 30 S subunit [46,47], and Obg, YlqFand YphC with the 50 S subunit [9,13,48]. We haveshown here that YsxC also associates with the 50 S subu-nit, a similar behaviour to its ortholog in B. subtilis [10].Since our co-fractionation experiments revealed the inter-action of YsxC with proteins from the small and largeribosome subunits, its absence from the 30 S fractioncould be due to lower affinity and/or stability of YsxCtowards its partners in that subunit. The specific role ofYsxC and other P-loop GTPases in the assembly or stabil-ity of the 50 S subunit remains to be determined.

After YsxC depletion, the amount of 70 S ribosomedecreases with concomitant subunit increase. This could

be due to an error in the assembly of the subunits them-selves or their assembly into the whole ribosome. As thelevels of individual subunits after full dissociation staysapproximately the same between wild type and YsxCdepleted cells it is possible that the subunits are not beingfully assembled. This was observed in B. subtilis wheredepletion of YsxC results in a number of proteins missingfrom the 50 S subunit, ultimately resulting in the accumu-lation of aberrant large subunits [10]. It has been reportedby these authors that YsxC in B. subtilis binds the 44.5 Spreribosomal particle. The depletion conditions used toenable the harvesting of sufficient biomass for ribosomalextraction required some growth of the culture, prior tocessation, which could have partially masked the presenceof distinctive intermediates.

YsxC could also act at the level of ribosomal stability; oncethe ribosome is assembled it may require transient exter-nal proteins for stabilization, as it has been postulated forEra [49]. This could explain the interaction of ObgE, oneof the P-loop GTPases, with both of the ribosomal subu-nits observed by Sato and co-workers in E. coli [14]. Thedual interaction could be mediated by the presence ofribosomal constitutents modulating YsxC GTPase activity,by GTPases activating proteins (GAPs) or guanineexchange factors (GEFs) [50], or the intracellular guaninepool [51]. However, additional evidence of ObgE associa-tion with the small ribosomal particle is needed sinceother authors have only reported the co-fractionation ofObg homologs with the 50 S fraction in E. coli and otherspecies [48,52,53].

ConclusionsIn this article we have successfully used conditional lethalgenetic constructs and implemented Tandem AffinityPurification technology in S. aureus to show that YsxC inS. aureus is an apparently essential protein that associateswith the large ribosomal subunit and plays a role in ribos-omal assembly or ribosomal stability. Ribosomal compo-nents have been a proven target for successful antibiotics,the elucidation of the role of additional essential andhighly conserved ribosomal proteins such as YsxC wouldopen a new avenue to the discovery of novel antimicrobialdrugs.

MethodsMedia and growth conditionsStrains and plasmids are listed in Table 2. E. coli wasgrown in Luria-Bertani (LB) medium and S. aureus in BHI(Oxoid). Growth was carried out at 37°C, with shaking at250 rpm for liquid media. To verify essentiality, cultureswere inoculated to OD600~0.0001. When required, antibi-otics were added at the following concentrations: ampicil-lin (Amp), 100 mg l-1; chloramphenicol (Cam), 20 mg l-1; erythromycin (Ery), 5 mg l-1; lincomycin (Lin), 25 mg l-

1; kanamycin (Kan), 50 mg l-1 and neomycin (Neo), 50



mg l-1; tetracycline (Tet), 5 mg l-1. Selection of S. aureusstrains containing the ery or kan genes was made on Ery/Lin and Kan/Neo, respectively. The S. aureus NCTC8325(SH1000 parental strain) gene homolog of the B. subtilisysxC is SAOUHSC0177.

Construction of S. aureus SH1000 containing a chromosomal single copy of ysxC under the control of a regulatable promoterOligonucleotide primers used are listed in Table 3 and amap of the final chromosomal construct is shown in Fig-ure 1A. pELC6 was created by cloning the Tet-T-Pspac cas-sette from pGL400 into a vector containing the ysxC generegion from S. aureus SH1000 (pGL411). pGL400 wasconstructed in a 3-way ligation reaction into the HindIIIsite of pOB [54] of the following PCR-amplified frag-ments: a) the tet resistance gene from plasmid pDG1513[55] (670 bp fragment; primers: 5'GLUSh6B1 and3'GLUSh6B); and, b) a 2236 bp fragment (primers:5'GLUSh6A1 and 3'GLUSh6A) from pMUTIN [56] con-taining the t0t1t2 transcriptional terminators, the Pspacpromoter and the oid regulatory region. pGL411 is a pOBderivative containing the S. aureus ysxC region including1397 bp upstream and 1354 bp downstream of this genewhich was produced using primers 5'GLUSh3I and3'GLUSh3I. The Tet-T-Pspac cassette was amplified frompGL400 using primers 5'GLUSh16H and 3'GLUSh16Hand inserted upstream of ysxC in pGL411 (strain E. coliGL1299) by λred recombination [57]. The resulting plas-mid was named pELC6. Purified pELC6 was electropo-rated into S. aureus RN4220 [58] to create, by suicidalrecombination, an intermediate strain (LC107) contain-ing two copies of ysxC: a wild type and a Pspac~ysxC. Usingφ11 phage transduction [59] from LC107 into SH1000 theresident ysxC gene in SH1000 was replaced by a singlecopy of ysxC under the control of Pspac by selecting fortransductants resistant to tetracycline and sensitive toerythromycin. The resulting strain was named LC108(SH1000 Pspac~ysxC). Replacement was confirmed bySouthern blot analysis (results not shown). A multicopyplasmid containing lacI was constructed (pGL485) andtransduced into LC108 to generate LC109 (SH1000Pspac~ysxC/pGL485). pGL485 is a pMJ8426 [21] derivativewhere the tetracycline resistance gene between the ClaIand SalI sites has been replaced by the chloramphenicolacetyl transferase gene (cat) from pSK5630 [60]. The latterfragment was obtained by PCR amplification using prim-ers, 5'GLUSh103A and 3'GLUSh103A.

Construction of an in vivo YsxC-Tandem Affinity Purification (TAP) tagged construct in S. aureusA plasmid containing the TAP-tag cassette (pGL433)linked to kanamycin resistance was constructed as fol-lows. Two PCR-amplified fragments (ReadyMix ABgene)were ligated together at the NotI site: a) a fragment from

pBS1479 [27] containing the Calmodulin Binding Protein(CBP)/Protein A tag (TAP-tag cassette) [30]; and, b) thekanamycin resistance gene from Streptococcus faecalis (kan)present in plasmid pMAL7 [61]. The resulting TAP-tag-kancassette fragment was cloned in the A-overhang site ofpCRII TOPO (Invitrogen) to give pGL433. The TAP-tag-kan cassette was PCR-amplified from pGL433 andinserted into pGL411 (in strain E. coli GL1299) by λ redrecombination as a TAP-tag translational fusion to ysxC(plasmid pELC1). The resulting ysxC::TAP-tag-kan frag-ment was flanked by the chromosomal upstream (1397bp) and downstream (1354 bp) regions surrounding ysxCpresent in pGL411. pELC1 was electroporated into S.aureus RN4220, which generated by single cross-over sui-cidal recombination a strain with two copies of ysxC, onewild type and one TAP-tagged, LC101. A strain was con-structed with the Protein A-encoding gene (spa) deleted. S.aureus 8325-4 spa::tet [62] was lysed with φ 11 and the spamutation transduced into SH1000 to give LC102(SH1000 spa::tet). Resolution of the two copies of ysxC inLC101 into only a ysxC::TAP-tagged copy was achieved byρ 11-mediated transduction [59] of a LC101 lysate intoLC102. Transductants resistant to kanamycin (ysxC::TAP-tag) and tetracycline (spa::tet) but sensitive to erythromy-cin (antibiotic marker linked to the wild type copy of ysxCin pELC1) would have only ysxC~TAP-tag in a spa-back-ground, LC103 (SH1000 spa::tet ysxC::TAP-tag-kan). Thisstrain was verified by Southern blot analysis (results notshown). Figure 1B shows the final chromosomal inser-tion, with the relevant DNA junction sequence.

Tandem affinity purificationCultures of LC103 were grown in BHI to mid-exponentialphase (OD600~3.0), placed immediately onto ice slurryfor 10 min, harvested by centrifugation (6,000 rpm, 10min, 4°C, Jouan CR3i rotor AC50.10), frozen in liquidnitrogen and stored at -80°C. Subsequently, a cell extractwas obtained from cells broken with a Braun homoge-niser. The fraction containing membranes and ribosomeswas isolated by centrifugation at 50,000 rpm for 2.5 h ina Beckman 70.1 Ti rotor. This fraction was subsequentlypurified using a method based on that previously reportedby Puig et al. (2001) [27]. All binding and elution stepswere performed in 0.8 × 4 cm Poly-prep columns (Bio-Rad). 200 μl of IgG-Sepharose bead suspension (Amer-sham Biosciences) was transferred into the column andthe beads were washed with 10 ml IPP150 (10 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.1% v/v Nonidet NP-40). 10ml of extract in IPP150, corresponding to 2.5 l of originalculture, was transferred into the column, sealed androtated for 4 h at 4°C to allow binding of Protein A to theresin. Multiple purifications were run in parallel toincrease protein yield. Elution to remove unbound pro-tein was performed by gravity flow washing the beadsthree times with 10 ml IPP150 supplemented with Noni-



det (NP40) at a final concentration of 1.5% (v/v). ProteinA-bound complexes were excised from the resin by TEVprotease cleavage, performed by addition of 1 ml of TEVcleavage buffer and 100 units of AcTEV protease (Invitro-gen). The beads were rotated for 16 h at 4°C. The TEVcleavage eluate containing the protein complex CBP-YsxC-protein partners was recovered by gravity flow and 1 mlwas mixed with 3 ml of Calmodulin Binding Buffer (10mM Tris-HCl pH 8.0, 10 mM 2-mercaptoethanol, 150mM NaCl, 1 mM magnesium acetate, 1 mM imidazole, 2mM CaCl2, 0.1% v/v Nonidet NP-40) and 3 μl 1 M CaCl2.The resulting solution was applied to a column contain-ing 200 μl of Calmodulin-Sepharose beads (Stratagene)that had been washed with 10 ml of Calmodulin BindingBuffer. The column was then rotated for 1 h at 4°C. Elu-tion was performed by gravity flow and the beads washedthree times with 10 ml Calmodulin Binding Buffer. Thebound proteins were eluted with Calmodulin ElutionBuffer (10 mM Tris-HCl pH 8.0, 10 mM 2-mercaptoetha-nol, 150 mM NaCl, 1 mM magnesium acetate, 1 mM imi-dazole, 2 mM EGTA, 0.1% v/v Nonidet NP-40) in 10×200μl fractions. Proteins purifed as described from the equiv-

alent of 15 l of original culture were TCA precipitated andseparated using a gradient of 4-12% (w/v) SDS-PAGE andsilver stained. Two independent and equivalent experi-ments were undertaken Distinctive bands were in-gel tryp-tic digested, and prepared for positive-ion MALDI massspectra (Applied Byosystems 4700 Proteomics Analyzer),MS spectra were acquired, and the strongest peaks with asignal to noise greater than 40 were selected for CID-MS/MS analysis (Technology Facility, University of York).Mass spectral data were submitted to database searchingusing the MASCOT program (Matrix Science Ltd.) TheMowse scoring algorithm uses empirically determinedfactors to assign a statistical weight to each individual pep-tide match. The threshold level indicates that a match issignificant if it would be expected to occur at random witha frequency of less than 5%. Therefore, individual ionswith scores greater than the calculated threshold levelindicate identity or extensive homology.

Subcellular localisationS. aureus SH1000 (2 l culture) was grown to an OD600~3and immediately transferred to an ice slurry for 10 min.

Table 2: Strains and plasmids used in this study

Strain Relevant genotype/markers Source

Escherichia coliEL250 F- mcr Δ(mrr-hsdRMS-mcrBC) ϕ 80 lacZ ΔM15 Δlac×74 recA1 deoR araD139 Δ(ara-leu) 7697 galU galK

rpsL (StrR) endA1 nupG [λcl857 araC-PBADflpe][57]

GL1299 EL250/pGL411 This studyTunerTM(DE3) pLacI F- ompT hsdSB(rB- mB-) gal dcm lacY1 (DE3) pLacI (Cam) Novagen

Staphylococcus aureusLC101 RN4220 ysxC::TAP-tag This studyLC102 SH1000 spa This studyLC103 SH1000 spa ysxC::TAP-tag This studyLC107 RN4220 Pspac ~ysxC ysxC+ This studyLC108 SH1000 Pspac ~ysxC ysxC+ This studyLC109 SH1000 Pspac ~ysxC ysxC+/pGL485 This studyRN4220 Restriction deficient transformation recipient [58]SH1000 Functional rsbU+ derivative of 8325-4 [63]SJF590 8325-4 spa::tet [62]

Plasmid Relevant genotype Source

pBS1479 CBP/Protein A tag [27]pDG1513 Tetracycline resistance gene (tet) [55]pELC1 pGL411 derivative with TAP-kan cassette in frame with 3' end of SH1000 ysxC This studypELC4 pETBlue-1-based ysxC His6 tag translational fusion This studypELC6 Tet-T-Pspac cassette upstream ysxC gene in pGL411 This studypETBlue-1AccepTor

3'-dA overhang cloning plasmid vector for protein overexpression; ColE1 ori Novagen

pGL400 Tet-T-Pspac cassette This studypGL411 pOB derivative containing SH1000 ysxC and flanking regions This studypGL433 TAP-tag-kan cassette This studypGL485 pMJ8426-based lacI pE194ori cat This studypMAL7 Kanamycin resistance gene (kan) [61]pMJ8426 lacI pE194ori [26]pOB Erythromycin/lincomycin resistance gene (ery); ColE1 ori [54]



Cells were harvested (6,000 rpm, 10 min, 4°C), brokenusing a Braun homogeniser, and the membrane/ribosomefraction purified by ultracentrifugation at 50,000 rpm for2.5 h in a 70.1 Ti rotor (Beckman). The resulting pelletwas resuspended in 7 ml of 0.01 M Tris-HCl pH 8.2, 14mM magnesium acetate, 60 mM potassium acetate, 1 mMDTT containing 0.5% (v/v) Triton X-100 to solubilisemembranes. The ultracentrifugation step was repeatedand the pellet resuspended in 6 ml of the above buffercontaining 1 M NH4Cl. The sample was ultracentrifugedagain and the resulting pellet was resuspended in 5 ml ofthe above buffer.

YsxC overexpression, purification and production of antiseraA His(6)tagged version of YsxC was constructed by clon-ing the ysxC gene PCR-amplified from S. aureus SH1000(using primers 5'elc4 and 3'elc4, and ReadyMix, ABgene)into the 3'-dA overhang site of the overexpression vectorpETBlue-1 AccepTor vector (Novagen). The resulting plas-mid (pELC4) was subsequently electroporated into E. coliTunerTM (DE3) pLacI (Novagen). Cells were grown in LB50 μg ml-1 Amp on a rotary shaker (250 rpm) at 37°C toan OD600 = 0.5. Then expression was induced by the addi-tion of 0.5 mM IPTG and further incubation undertakenfor 3 hrs. Cells were harvested by centrifugation at 5,500rpm for 10 min (Jouan CR3i rotor AC50.10), and the pel-let was stored at -20°C. The pellet was resuspended in 20ml of Buffer C (50 mM Tris-HCl pH 8.0). Cells were dis-

rupted by sonication (Sanyo MSE Soniprep 150; 16micron amplitude, 2 × 20 sec treatments). Inclusion bod-ies were recovered by centrifugation at 10,000 rpm in aBeckman JA-20 rotor for 10 min and were subsequentlywashed three times via resuspension in 10 ml of buffer C,10 ml buffer C plus 1 M NaCl, and 10 ml buffer C, andcentrifugation. Each time pellets were suspended in thebuffer and then collected by centrifugation at 10,000 rpmfor 5 min (Beckman JA-20 rotor). Washed inclusion bod-ies were suspended in 20 ml of buffer C plus 8 M Urea, leftto dissolve for 20 min with stirring and then remaininginsoluble material was removed by centrifugation in aBeckman JA-20 rotor at 19,000 rpm for 15 min at 4°C.The sample was applied on a 12 ml Ni-column (imino-diacetic acid as a chelator immobilized on Sepharose 6BFF, Sigma). The column was washed with 25 ml of 8 MUrea in buffer C, then with 25 ml 8 M urea in 50 mM 2-(N-morpholino)ethane sulphonic acid (MES)/NaOHbuffer pH 6.3 and finally with 25 ml of 8 M Urea in 50mM sodium acetate buffer pH 4.6. The pH 6.3 wash con-tained the recombinant protein and was concentratedusing a VivaSpin concentrator 100000 MWCO (Viva Sci-ence). Samples were applied on a Hi-Load Superdex 20016 × 60 cm (Amersham) equilibrated with 6 M Urea inbuffer C. Proteins were eluted from the column in thesame buffer and 2 ml fractions were collected and ana-lysed for protein content. The resulting protein was dia-lysed against PBS. 1 mg of the purified protein was then

Table 3: Oligonucleotide primers used in this study

Primer Sequence (5' ∅ 3')

5'GLUSh3I ataaGGATCCtggcctgtttaataggatct1

3'GLUSh3I ataaGGATCCaacttgtagcaggaagtggt1

3'GLUSh6A taaatAAGCTTaattgtgagcggctcacaattccac1

5'GLUSh6A1 tattaaGCGGCCGCtcattgcttccaaggagctaaagaggtccctag1

3'GLUSh6B atattAAGCTTagaaatccctttgagaatgttt1

5'GLUSh6B1 tattaaGCGGCCGCcggattttatgaccgatgatgaag1

5'GLUSh16H attaattcaatattattaggattaactttcattttatatcctcacttaattgtgagcggctcacaattccac2

3'GLUSh16H ttcaaatattatataatggtagagttgaaagagaatataaaattagaaatccctttgagaatgtt2

5'GLUSh65B cttacattatttttaaaatttttgtataagttttgtcgtacaaaaaatcgatacaaattcctcg2

3'GLUSh65B ataataaacaacaacaaatatggaatttaattgaaccgtatatttcaatggaaaagagaagatgg2

5'GLUSh27A aattgGGCGCGCCatggaaaagagaagatgg1

3'GLUSh27A atttGCGGCCGCtcaggttgacttccccgcgg1

5'GLUSh27B atttGCGGCCGCgataaacccagcgaaccattg1

3'GLUSh27B atttGGCCGGCCatcgatacaaattcctcg1

5'GLUSh103A taatgtATCGATaataatggtttcttagacg1

3'GLUSh103A tattatGTCGACagtcggcattatctc1

5'elc4 atgaaagttaatcctaataatattg3

3'elc4 ttacaccaccaccaccaccactgaaatatacggttcaattaaattc3

1 upper case bases indicate restriction sites engineered within the oligonucleotide2 italics indicate the fragment of the oligonucleotide designed for λred recombination, whilst non-italics indicate the portion of the primer designed to amplify the insert; blackboxes indicate the location of the RBS and the START of ysxC in the complementary strand (5'GLUSh16H) or the 3' end of the ysxC sequence (3'GLUSh65B).3 for 3'-dA overhang ligation



used for production of polyclonal antibodies against YsxC(Antibody Resource Centre, University of Sheffield).

Sucrose gradient centrifugationSH1000 and LC109 (SH1000 Pspac~ysxC/pGL485) inocu-lated to an starting OD600~0.01 and grown to anOD600~0.5 in BHI and BHI plus 20 μg ml-1 Cam, respec-tively. Growth of LC109 in the absence of IPTG results innoticeable but partial YsxC depletion. After breakage witha Braun homogeniser, cell extracts were centrifuged at50,000 rpm for 2.5 h in a Beckman 70.1 Ti rotor at 4°C.The supernatant was removed and the pellet resuspendedin 2 ml of either S buffer [20] or Ribosome buffer [19].Both buffers were supplemented with protease inhibitors(Complete, Roche; 1 tablet in 25 ml and added at a 1:25dilution to the reaction mixture). 30 ml 10-30% (w/v)sucrose gradients were formed using a Hoefer gradientmaker. Samples corresponding to 2 l of original culturewere layered on top of the gradient and centrifuged at19,000 rpm for 16 h at 4°C in a Beckman SW28 rotor. 1ml fractions were removed from the base of the gradientand RNA levels were assayed by diluting each sample1:100 in Tris-HCl pH 7.8 and measuring absorbance at260 nm.

List of AbbreviationsTAP: tandem affinity purification; CBP: calmodulin bind-ing protein.

Authors' contributionsELC, JGL and SJF contributed in the design of the studyand in the writing of the manuscript. ELC and JGL carriedout the genetic constructs necessary for the work and thedeterminations of ysxC essentiality. ELC performed thepurification of YsxC partners, its subcellular localization,and its association with the ribosome. All authors readand approved manuscript.

AcknowledgementsWe would like to thank Chia Y. Lee for kindly providing plasmid pMJ8426. TAP plasmid pSB1479 was obtained from Euroscarf http://web.uni-frank furt.de/fb15/mikro/euroscarf/ord_tpla.html. This work was supported by the Biotechnology and Biological Sciences Research Council (United King-dom).

References1. Shopsin B, Mathema B, Martinez J, Ha E, Campo ML, Fierman A, Kra-

sinski K, Kornblum J, Alcabes P, Waddington M, et al.: Prevalence ofmethicillin-resistant and methicillin-susceptible Staphylococ-cus aureus in the community. J Infect Dis 2000, 182:359-362.

2. National Nosocomial Infections Surveillance (NNIS) SystemReport, data summary from January 1992 through June2004, issued October 2004. Am J Infect Control 2004, 32:470-485.

3. Tiemersma EW, Bronzwaer SL, Lyytikainen O, Degener JE, Schrijne-makers P, Bruinsma N, Monen J, Witte W, Grundman H: Methicil-lin-resistant Staphylococcus aureus in Europe, 1999-2002.Emerg Infect Dis 2004, 10:1627-1634.

4. Zetola N, Francis JS, Nuermberger EL, Bishai WR: Community-acquired meticillin-resistant Staphylococcus aureus: anemerging threat. Lancet Infect Dis 2005, 5:275-286.

5. Hutchison CA, Peterson SN, Gill SR, Cline RT, White O, Fraser CM,Smith HO, Venter JC: Global transposon mutagenesis and aminimal Mycoplasma genome. Science 1999, 286:2165-2169.

6. Kobayashi K, Ehrlich SD, Albertini A, Amati G, Andersen KK, ArnaudM, Asai K, Ashikaga S, Aymerich S, Bessieres P, et al.: Essential Bacil-lus subtilis genes. Proc Natl Acad Sci USA 2003, 100:4678-4683.

7. Caldon CE, March PE: Function of the universally conservedbacterial GTPases. Curr Opin Microbiol 2003, 6:135-139.

8. Comartin DJ, Brown ED: Non-ribosomal factors in ribosomesubunit assembly are emerging targets for new antibacterialdrugs. Curr Opin Pharmacol 2006, 6:453-458.

9. Schaefer L, Uicker WC, Wicker-Planquart C, Foucher AE, Jault JM,Britton RA: Multiple GTPases participate in the assembly ofthe large ribosomal subunit in Bacillus subtilis. J Bacteriol 2006,188:8252-8258.

10. Wicker-Planquart C, Foucher AE, Louwagie M, Britton RA, Jault JM:Interactions of an essential Bacillus subtilis GTPase, YsxC,with ribosomes. J Bacteriol 2007, 190:681-690.

11. Campbell TL, Daigle DM, Brown ED: Characterization of theBacillus subtilis GTPase YloQ and its role in ribosome func-tion. Biochem J 2005, 389:843-852.

12. Datta K, Skidmore JM, Pu K, Maddock JR: The Caulobacter crescen-tus GTPase CgtAC is required for progression through thecell cycle and for maintaining 50 S ribosomal subunit levels.Mol Microbiol 2004, 54:1379-1392.

13. Matsuo Y, Morimoto T, Kuwano M, Loh PC, Oshima T, OgasawaraN: The GTP-binding protein YlqF participates in the latestep of 50 S ribosomal subunit assembly in Bacillus subtilis. JBiol Chem 2006, 281:8110-8117.

14. Sato A, Kobayashi G, Hayashi H, Yoshida H, Wada A, Maeda M,Hiraga S, Takeyasu K, Wada C: The GTP binding protein Obghomolog ObgE is involved in ribosome maturation. GenesCells 2005, 10:393-408.

15. Uicker WC, Schaefer L, Koenigsknecht M, Britton RA: The essen-tial GTPase YqeH is required for proper ribosome assemblyin Bacillus subtilis. J Bacteriol 2007, 189:2926-2929.

16. Dassain M, Leroy A, Colosetti L, Carole S, Bouche JP: A new essen-tial gene of the 'minimal genome' affecting cell division. Bio-chimie 1999, 81:889-895.

17. Pragai Z, Harwood CR: YsxC, a putative GTP-binding proteinessential for growth of Bacillus subtilis 168. J Bacteriol 2000,182:6819-6823.

18. Ruzheinikov SN, Das SK, Sedelnikova SE, Baker PJ, Artymiuk PJ, Gar-cia-Lara J, Foster SJ, Rice DW: Analysis of the open and closedconformations of the GTP-binding protein YsxC from Bacil-lus subtilis. J Mol Biol 2004, 339:265-278.

19. Blaha G, Stelzl U, Spahn CM, Agrawal RK, Frank J, Nierhaus KH:Preparation of functional ribosomal complexes and effect ofbuffer conditions on tRNA positions observed by cryoelec-tron microscopy. Methods Enzymol 2000, 317:292-309.

20. Champney WS, Burdine R: Macrolide antibiotics inhibit 50 Sribosomal subunit assembly in Bacillus subtilis and Staphylo-coccus aureus. Antimicrob Agents Chemother 1995, 39:2141-2144.

21. Jana M, Luong TT, Komatsuzawa H, Shigeta M, Lee CY: A methodfor demonstrating gene essentiality in Staphylococcus aureus.Plasmid 2000, 44:100-104.

22. Sobral RG, Ludovice AM, de Lencastre H, Tomasz A: Role of murFin cell wall biosynthesis: isolation and characterization of amurF conditional mutant of Staphylococcus aureus. J Bacteriol2006, 188:2543-2553.

23. Zheng L, Yang J, Landwehr C, Fan F, Ji Y: Identification of an essen-tial glycoprotease in Staphylococcus aureus. FEMS Microbiol Lett2005, 245:279-285.

24. Dubrac S, Msadek T: Identification of genes controlled by theessential YycG/YycF two-component system of Staphylococ-cus aureus. J Bacteriol 2004, 186:1175-1181.

25. Forsyth RA, Haselbeck RJ, Ohlsen KL, Yamamoto RT, Xu H, TrawickJD, Wall D, Wang L, Brown-Driver V, Froelich JM, et al.: A genome-wide strategy for the identification of essential genes in Sta-phylococcus aureus. Mol Microbiol 2002, 43:1387-1400.

26. Galperin MY, Koonin EV: 'Conserved hypothetical' proteins:prioritization of targets for experimental study. Nucleic AcidsRes 2004, 32:5452-5463.

27. Puig O, Caspary F, Rigaut G, Rutz B, Bouveret E, Bragado-Nilsson E,Wilm M, Seraphin B: The tandem affinity purification (TAP)


http://web.uni-frankfurt.de/fb15/mikro/euroscarf/ord_tpla.html

http://web.uni-frankfurt.de/fb15/mikro/euroscarf/ord_tpla.html











































Publish with BioMed Central and every scientist can read your work free of charge

"BioMed Central will be the most significant development for disseminating the results of biomedical research in our lifetime."

Sir Paul Nurse, Cancer Research UK

Your research papers will be:

available free of charge to the entire biomedical community

peer reviewed and published immediately upon acceptance

cited in PubMed and archived on PubMed Central

yours — you keep the copyright

Submit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.asp

BioMedcentral

method: a general procedure of protein complex purifica-tion. Methods 2001, 24:218-229.

28. Butland G, Peregrin-Alvarez JM, Li J, Yang W, Yang X, Canadien V,Starostine A, Richards D, Beattie B, Krogan N, et al.: Interactionnetwork containing conserved and essential protein com-plexes in Escherichia coli. Nature 2005, 433:531-537.

29. Estevez AM, Kempf T, Clayton C: The exosome of Trypanosomabrucei. Embo J 2001, 20:3831-3839.

30. Rohila JS, Chen M, Cerny R, Fromm ME: Improved tandem affinitypurification tag and methods for isolation of protein hetero-complexes from plants. Plant J 2004, 38:172-181.

31. Westermarck J, Weiss C, Saffrich R, Kast J, Musti AM, Wessely M,Ansorge W, Seraphin B, Wilm M, Valdez BC, Bohmann D: TheDEXD/H-box RNA helicase RHII/Gu is a co-factor for c-Jun-activated transcription. Embo J 2002, 21:451-460.

32. Held WA, Ballou B, Mizushima S, Nomura M: Assembly mappingof 30 S ribosomal proteins from Escherichia coli. Furtherstudies. J Biol Chem 1974, 249:3103-3111.

33. Homann HE, Nierhaus KH: Ribosomal proteins. Protein compo-sitions of biosynthetic precursors and artifical subparticlesfrom ribosomal subunits in Escherichia coli K 12. Eur J Biochem1971, 20:249-257.

34. Marquardt O, Roth HE, Wystup G, Nierhaus KH: Binding ofEscherichia coli ribosomal proteins to 23 S RNA under recon-stitution conditions for the 50 S subunit. Nucleic Acids Res 1979,6:3641-3650.

35. Stoffler-Meilicke M, Noah M, Stoffler G: Location of eight ribos-omal proteins on the surface of the 50 S subunit fromEscherichia coli. Proc Natl Acad Sci USA 1983, 80:6780-6784.

36. Zouine M, Beloin C, Ghelis C, Le Hegarat F: The L17 ribosomalprotein of Bacillus subtilis binds preferentially to curvedDNA. Biochimie 2000, 82:85-91.

37. Sharrock RA, Leighton T: Intergenic suppressors of tempera-ture-sensitive sporulation in Bacillus subtilis are allele non-specific. Mol Gen Genet 1981, 183:532-537.

38. Morimoto T, Loh PC, Hirai T, Asai K, Kobayashi K, Moriya S, Ogasa-wara N: Six GTP-binding proteins of the Era/Obg family areessential for cell growth in Bacillus subtilis. Microbiology 2002,148:3539-3552.

39. Kobayashi G, Moriya S, Wada C: Deficiency of essential GTP-binding protein ObgE in Escherichia coli inhibits chromo-some partition. Mol Microbiol 2001, 41:1037-1051.

40. Minkovsky N, Zarimani A, Chary VK, Johnstone BH, Powell BS, Tor-rance PD, Court DL, Simons RW, Piggot PJ: Bex, the Bacillus sub-tilis homolog of the essential Escherichia coli GTPase Era, isrequired for normal cell division and spore formation. J Bac-teriol 2002, 184:6389-6394.

41. Diaconu M, Kothe U, Schlunzen F, Fischer N, Harms JM, TonevitskyAG, Stark H, Rodnina MV, Wahl MC: Structural basis for thefunction of the ribosomal L7/12 stalk in factor binding andGTPase activation. Cell 2005, 121:991-1004.

42. Moore PB: The three-dimensional structure of the ribosomeand its components. Annu Rev Biophys Biomol Struct 1998,27:35-58.

43. Chandra Sanyal S, Liljas A: The end of the beginning: structuralstudies of ribosomal proteins. Curr Opin Struct Biol 2000,10:633-636.

44. Agafonov DE, Kolb VA, Spirin AS: Proteins on ribosome surface:measurements of protein exposure by hot tritium bombard-ment technique. Proc Natl Acad Sci USA 1997, 94:12892-12897.

45. Zouine M, Beloin C, Deneubourg AM, Hirschbein L, Le Hegarat F:Overproduction, purification and characterization of theHPB12-L24 ribosomal protein of Bacillus subtilis. FEMS Micro-biol Lett 1996, 145:41-48.

46. Daigle DM, Brown ED: Studies of the interaction of Escherichiacoli YjeQ with the ribosome in vitro. J Bacteriol 2004,186:1381-1387.

47. Sayed A, Matsuyama S, Inouye M: Era, an essential Escherichia colismall G-protein, binds to the 30 S ribosomal subunit. BiochemBiophys Res Commun 1999, 264:51-54.

48. Scott JM, Ju J, Mitchell T, Haldenwang WG: The Bacillus subtilisGTP binding protein obg and regulators of the sigma(B)stress response transcription factor cofractionate with ribos-omes. J Bacteriol 2000, 182:2771-2777.

49. Sharma MR, Barat C, Wilson DN, Booth TM, Kawazoe M, Hori-Take-moto C, Shirouzu M, Yokoyama S, Fucini P, Agrawal RK: Interaction

of Era with the 30 S ribosomal subunit implications for 30 Ssubunit assembly. Mol Cell 2005, 18:319-329.

50. Trahey M, McCormick F: A cytoplasmic protein stimulates nor-mal N-ras p21 GTPase, but does not affect oncogenicmutants. Science 1987, 238:542-545.

51. Lin B, Covalle KL, Maddock JR: The Caulobacter crescentus CgtAprotein displays unusual guanine nucleotide binding andexchange properties. J Bacteriol 1999, 181:5825-5832.

52. Jiang M, Datta K, Walker A, Strahler J, Bagamasbad P, Andrews PC,Maddock JR: The Escherichia coli GTPase CgtAE is involved inlate steps of large ribosome assembly. J Bacteriol 2006,188:6757-6770.

53. Sikora AE, Zielke R, Datta K, Maddock JR: The Vibrio harveyiGTPase CgtAV is essential and is associated with the 50 Sribosomal subunit. J Bacteriol 2006, 188:1205-1210.

54. Horsburgh MJ, Wharton SJ, Cox AG, Ingham E, Peacock S, Foster SJ:MntR modulates expression of the PerR regulon and super-oxide resistance in Staphylococcus aureus through control ofmanganese uptake. Mol Microbiol 2002, 44:1269-1286.

55. Guerout-Fleury AM, Shazand K, Frandsen N, Stragier P: Antibiotic-resistance cassettes for Bacillus subtilis. Gene 1995,167:335-336.

56. Vagner V, Dervyn E, Ehrlich SD: A vector for systematic geneinactivation in Bacillus subtilis. Microbiology 1998, 144(Pt11):3097-3104.

57. Lee EC, Yu D, Martinez de Velasco J, Tessarollo L, Swing DA, CourtDL, Jenkins NA, Copeland NG: A highly efficient Escherichia coli-based chromosome engineering system adapted forrecombinogenic targeting and subcloning of BAC DNA.Genomics 2001, 73:56-65.

58. Kreiswirth BN, Lofdahl S, Betley MJ, O'Reilly M, Schlievert PM, Berg-doll MS, Novick RP: The toxic shock syndrome exotoxin struc-tural gene is not detectably transmitted by a prophage.Nature 1983, 305:709-712.

59. Novick RP: Genetic systems in staphylococci. Methods Enzymol1991, 204:587-636.

60. Grkovic S, Brown MH, Hardie KM, Firth N, Skurray RA: Stable low-copy-number Staphylococcus aureus shuttle vectors. Microbi-ology 2003, 149:785-794.

61. Horsburgh MJ, Clements MO, Crossley H, Ingham E, Foster SJ: PerRcontrols oxidative stress resistance and iron storage pro-teins and is required for virulence in Staphylococcus aureus.Infect Immun 2001, 69:3744-3754.

62. Hartleib J, Kohler N, Dickinson RB, Chhatwal GS, Sixma JJ, HartfordOM, Foster TJ, Peters G, Kehrel BE, Herrmann M: Protein A is thevon Willebrand factor binding protein on Staphylococcusaureus. Blood 2000, 96:2149-2156.

63. Horsburgh MJ, Aish JL, White IJ, Shaw L, Lithgow JK, Foster SJ: sig-maB modulates virulence determinant expression and stressresistance: characterization of a functional rsbU strainderived from Staphylococcus aureus 8325-4. J Bacteriol 2002,184:5457-5467.








































































http://www.biomedcentral.com/info/publishing_adv.asp


Documents

BMC Microbiology BioMed Central - eprints.whiterose.ac.ukeprints.whiterose.ac.uk/108123/1/YsxC, an essential protein in... · proteins S2, S10 and L17, as well as the β' subunit