BLOOD $ URINE COLLECTIONSet of blood collection tubes

2 x 9 ml. EDTA vacutainer

DNA isolation and EDTA-plasma

2 x 9 ml. Heparin vacutainer

RNA isolation

1 x 9 ml. Heparin vacutainer

Isolation of Leucocytes and heparin plasma

1 x 4.5 ml. Citrate vacutainer

Citrated plasma

1 x 2 ml. EDTA vacutainer

Measurement of HbA1c, hemoglobin and hematocrit

Urine collection set

2 x vacutainers, 1 x adaptorCollection of urine

BLOOD & URINE COLLECTION

2 x 9 ml. EDTA

vacutainer

2 x 9 ml. Heparin

vacutainer

1 x 9 ml. Heparin

vacutainer

1 x 4.5 ml.Citrate

vacutainer

1 x 2 ml.EDTA

vacutainer

Store in meltingice during transport

Store in meltingice during transport

Store at roomtemperature

during transport

Tube A:Freeze within 1 hr.Store in dry-ice during transport

Tube B:Add challenger within 1 hr.Store at 37°C duringtransport

2 x 10 ml.Urine

BLOOD HANDLING 2 x 9 ml. EDTA vacutainer

Store in melting iceduring transport

Within 6 hr.

Centrifuge:20 min. 2000 G and 4°C

Collect plasma inplastic tube

Vortexshortly

Division of plasma

18 Subsamples of ~500 µl

Snap-freezen

Methanol / Dry-ice

<1 hr RT

Store at <-30 °C

Vacutainer with

red cells, buffy-

coat and rest plasma

<1 hr RT

Store at -20 °C

EDTA: DNA & PLASMA

BLOOD HANDLING 2 x 9 ml. Heparine vacutainer

TUBE A

Snap-freezen

Methanol / Dry-ice

Add challenger

<1 hr RT

Store in dry-iceduring transport

After arrival at TNOStore at<-60 °C

TUBE B<1 hr RT

Store at 37°Cduring transport

Snap-freezen

Methanol / Dry-ice

After 6 hr. (exactly)

Store at<-60 °C

3 subsamples of ~ 3 ml

3 subsamples of ~ 3 ml

Heparine: RNA (rest & challenge)

The Queensland Institute of Medical ResearchThe Queensland Institute of Medical Research

The Total Number of Bloods Processed Each Year

4362

3439

73007566

3842

4318

3364

71747379

0

1000

2000

3000

4000

5000

6000

7000

8000

Year 2000 Year 2001 Year 2002 Year 2003 Year 2004**

Year

Num

ber o

f Blo

ods

Total LMReturned

Bloods/BuccalsProcessed

** Year 2004 to Nov only

The Sentrix Whole-Genome Genotyping BeadChip 100,000 SNPs25,000 in transcripts70,000 within 10kb of exons

Array Based GenotypingArray Based GenotypingCosts must reduce furtherCosts must reduce further

Affymetrix 100K SNP Chips

AGRF Affymetrix Chip Genotyping

Concordance and fail rates

Concord Discord Fail58423 3 53499.09% 0.01% 0.91%57948 38 97498.28% 0.06% 1.65%58345 13 60298.96% 0.02% 1.02%58252 16 69298.80% 0.03% 1.17%58345 9 60698.96% 0.02% 1.03%58247 10 70398.79% 0.02% 1.19%58239 26 69598.78% 0.04% 1.18%58249 41 67098.79% 0.07% 1.14%466048 156 547698.81% 0.03% 1.16%

S3 Genomic – S3 Genomic MDA

S4 Genomic – S4 Genomic MDA

Combined Totals

MZ 1 Genomic – MZ 2 Genomic

MZ 1 Genomic – MZ 1 Buccal

MZ 1 Genomic – MZ 2 Buccal1

MZ 1 Genomic – MZ 2 Buccal2

MZ 2 Genomic – MZ 2 Buccal1

MZ 2 Genomic – MZ 2 Buccal2

Concordance comparison of samples with SNP fail rate of < 3%

Samples tested were an MZ twin pair, plus parents (S3 and S4).

Genomic, Buccal and MDA Genomic replicates were tested for each individual.

Sample MZ 2 Buccal was tested twice.

Fail - no call for one or both samples

Association AnalysisAssociation Analysis

Sharing between Sharing between unrelatedunrelated individuals individuals Disease alleles originate in common ancestorDisease alleles originate in common ancestor High resolutionHigh resolution

Recombination since common ancestorRecombination since common ancestor Large number of independent testsLarge number of independent tests

Powerful if assumptions are metPowerful if assumptions are met Same disease haplotype shared by many Same disease haplotype shared by many

patientspatients Sensitive to population structureSensitive to population structure

Single Nucleotide Single Nucleotide Polymorphisms Polymorphisms

(SNP)(SNP)

• Single base changes• Human SNPs = 9,856,125

- Validated SNPs 4,540,241 • Frequency ~ 1 every 400 bp • Can cause functional changes

GGCTTCAGAATGGCCGGCTTCAAAATGGCC

QIMR’s Sequenom MassARRAY Installation(CCRC-E floor)

Multiplex AnalysisMultiplex Analysis

* A G

* A G

* T C

* A G

* C T

SNP GenotypingSNP Genotyping Minimum Finished Genotypes Minimum Finished Genotypes

(>99%)(>99%) Quality of DNAQuality of DNA

Measure concentrationsMeasure concentrations Dispense in large volumesDispense in large volumes

Quality of AssaysQuality of Assays Even peak heightsEven peak heights Test for Hardy-Weinberg Test for Hardy-Weinberg

equilibriumequilibrium Analysis of SNP data is Analysis of SNP data is

particularly sensitive to assay particularly sensitive to assay problems problems

Genotype failures are not random Genotype failures are not random Heterozygous individuals fail most Heterozygous individuals fail most

oftenoften all SNP typing platformsall SNP typing platforms

Error frequency of 0.11%Error frequency of 0.11% 3268 DNA samples typed twice3268 DNA samples typed twice 159 pairs of MZ twins - No 159 pairs of MZ twins - No

discordant genotypesdiscordant genotypes

Twelve-Plex GenotypingTwelve-Plex Genotyping

Whole Genome AssociationWhole Genome Association Use DNA pooling to greatly reduce Use DNA pooling to greatly reduce

amount of genotypingamount of genotyping Possible now but reduced power Possible now but reduced power

Use haplotypes to reduce number of Use haplotypes to reduce number of SNPs that have to be genotypedSNPs that have to be genotyped Haplotype blocks – HapMap projectHaplotype blocks – HapMap project

Massive parallel genotypingMassive parallel genotyping Costs must reduce furtherCosts must reduce further