Blackwell Publishing Ltd A mitogenomic study on the ...aerg.canberra.edu.au/library/sex_general/2006... · 1998; Coates & Ruta 2000; Tchernov et al. 2000; Greene & Cundall 2000; Zaher

© 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters • Zoologica Scripta,

35

, 6, November 2006, pp545–558

545

Douglas, D. A., Janke, A. & Arnason, U. (2006). A mitogenomic study on the phylogeneticposition of snakes. —

Zoologica Scripta, 35,

545–558.Phylogenetic relationships of squamates (lizards, amphisbaenians and snakes) have receivedconsiderable attention, although no consensus has been reached concerning some basal diver-gences. This paper focuses on the Serpentes (snakes), whose phylogenetic position within theSquamata remains uncertain despite a number of morphological and molecular studies. Somemitogenomic studies have suggested a sister-group relationship between snakes and varanidlizards, while other studies have identified snakes and lizards as sister groups. However, recentstudies using nuclear data have presented a different scenario, with snakes being more closelyrelated to anguimorph and iguanian lizards. In this mitogenomic study we have examined theabove hypotheses with the inclusion of amphisbaenians, one gekkotan and one acrodontlizard, taxa not represented in previous mitogenomic studies. To this end we have alsoextended the representation of snakes by sequencing five additional snake genomes: twoscolecophidians (

Ramphotyphlops australis

and

Typhlops mirus

) two henophidians (

Eunectesnotaeus

and

Boa constrictor

) and one caenophidian (

Elaphe guttata

). The phylogenetic analysisrecovered snakes and amphisbaenians as sister groups, thereby differing from previoushypotheses. In addition to a discussion on previous morphological and molecular studies inlight of the results presented here, the current study also provides some details regardingfeatures of the new snake mitochondrial genomes described.

Desirée Douglas, ,Division of Evolutionary Molecular Systematics, Department of Cell and OrganismBiology, University of Lund, Sölvegatan 29, 22362 Lund, Sweden. E-mail:

[email protected] Janke, Division of Evolutionary Molecular Systematics, Department of Cell and OrganismBiology, University of Lund, Sölvegatan 29, 22362 Lund, Sweden. E-mail: [email protected] Arnason, Division of Evolutionary Molecular Systematics, Department of Cell and OrganismBiology, University of Lund, Sölvegatan 29, 22362 Lund, Sweden. E-mail: [email protected]

Blackwell Publishing Ltd

A mitogenomic study on the phylogenetic position of snakes

D

ESIRÉE

A. D

OUGLAS

, A

XEL

J

ANKE

& U

LFUR

A

RNASON

Accepted: 16 August 2006 doi:10.1111/j.1463-6409.2006.00257.x

Introduction

The position of Serpentes (snakes) within the Squamata hasbeen debated since the 19th century (e.g. Cope 1869). Thetraditional view is that snakes arose from within the lizards,although Underwood (1970) suggested that lizards and snakescould have separate origins. While the traditional view hasgained almost universal acceptance, opinion has differed as towhich group of lizards is most closely related to snakes. Onehypothesis posits that the closest living relatives of snakes arevaranid (monitor) lizards, which belong to the infraorderAnguimorpha. Some morphological studies have, with theinclusion of fossil data, placed snakes within the Mosasauroidea— a group of large, marine, extinct varanoids that lived duringthe Cretaceous period. This grouping is supported by skeletalcharacters common to both mosasauroids and fossil snakespurported to have been marine (Caldwell & Lee 1997, Lee &

Caldwell, 2000; Lee

et al

. 1999; Caldwell and dal Sasso 2004).On the grounds that these fossils possess hindlimbs, and aretherefore taken to be primitive, they have been placed as thesister group to all living snakes (Caldwell & Lee 1997; Lee &Caldwell 2000; Scanlon & Lee 2000).

An alternative hypothesis is that snakes evolved fromterrestrial lizards (Greene 1997; Greene & Cundall 2000;Rieppel

et al

. 2003), more specifically those with a nocturnaland/or burrowing habit resembling that of blind snakes(scolecophidians), which are traditionally thought to be themost basal of living snakes (Bellairs & Underwood 1951;Underwood 1970; Pough

et al

. 2005). Some authors have arguedthat fossil snakes also possessed more advanced characters(e.g. in the skull), and that this justifies a more derived placementthan that of scolecophidians, which would mean that fossilsnakes do not have any bearing on snake origins (Zaher

Phylogenetic position of snakes

•

D. A. Douglas

et al.

546

Zoologica Scripta,

35

, 6, November 2006, pp545–558 • © 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters

1998; Coates & Ruta 2000; Tchernov

et al

. 2000; Greene &Cundall 2000; Zaher & Rieppel 2002; Rieppel

et al

. 2003).Previous molecular studies based on mitochondrial (mt)

gene data (Forstner

et al

. 1995; Rest

et al

. 2003) have placedvaranid lizards as the sister group of snakes, in support of thesnake

−

mosasauroid hypothesis. Other molecular studiesbased on one or two nuclear genes (c-mos and RAG-1) haveall recovered a group containing snakes, anguimorphs andiguanians (Saint

et al

. 1998; Harris 2003; Vidal & Hedges2004; Townsend

et al

. 2004). In addition, a study by Vidal &Hedges (2005), based on nine nuclear genes, also producedthe same result, with snakes as the sister group to anguimorphsand iguanids. In comparison, two recent studies based on allmt genes (Kumazawa 2004; and Dong & Kumazawa 2005)have placed snakes as the sister group of lizards. However, noamphisbaenians, gekkotans or acrodonts were included inthese studies.

In this study we aimed to test the above hypotheses on theposition of snakes using heavy-strand protein-coding mtgenes for phylogenetic analysis. The sampling included five

new snake genomes that include representatives from allthree major lineages of snakes: two scolecophidians ( Jan’sblind snake,

Typhlops mirus

and the southern blind snake,

Ramphotyphlops australis

), two henophidians (the yellowanaconda,

Eunectes notaeus

and the Columbian red-tailedboa,

Boa constrictor imperator

), and one caenophidian (the cornsnake,

Elaphe guttata

) (see Table 1). This was done to increasethe taxon sampling across Serpentes for which, prior to thisstudy, only two mt genomes —

Leptotyphlops dulcis

and

Dinodonsemicarinatus

— had been sequenced.Six additional alethinophidian (i.e. all snakes with the

exception of scolecophidians) snake genomes were recentlydescribed (Dong & Kumazawa 2005). This included another

Boa constrictor

. However, for the purposes of this study it wasimportant to increase the sampling of the most basal group —the Scolecophidia — as it was apparent from this, and previous,studies (Kumazawa 2004; Dong & Kumazawa 2005) thatsnake mt genes have a much faster rate of evolution thanthose of other squamates. Although the mt genomes of somelizard families have not been sequenced, the current study

Table 1 The names and GenBank accessionnumbers of mt sequences of all species usedin this study.

Taxon (scientific name) Common name Accession

Snakes Elaphe guttata guttata* Corn snake AM 236349Dinodon semicarinatus Ryukyu odd-tooth snake NC 001945Boa constrictor imperator* Boa constrictor AM 236348Eunectes notaeus* Yellow anaconda AM 236347Ramphotyphlops australis* Southern blind snake AM 236346Typhlops mirus* Jan’s blind snake AM 236345Leptotyphlops dulcis Texas blind snake NC 005961

Lizards Varanus komodoensis Komodo dragon AB080275 and AB080276Abronia graminea Green arboreal alligator lizard NC 005958Shinisaurus crocodilurus Crocodile lizard NC 005959Cordylus warreni Warren’s spiny-tail lizard NC 005962Eumeces egregius Mole skink NC 000888Sceloporus occidentalis Western fence lizard NC 005960Iguana iguana Common iguana NC 002793Pogona vitticeps Central bearded dragon NC 006922Teratoscincus keyserlingii Giant frog-eyed gecko NC 007008

Amphisbaenians Bipes biporus Five-toed worm lizard NC 006287Amphisbaena schmidti Schmidt’s worm lizard NC 006284Diplometopon zarudnyi Zarudnyi’s worm lizard NC 006283Rhineura floridana Florida worm lizard NC 006282

Shpenodontidans Sphenodon punctatus Tuatara NC 004815Crocodilians Caiman crocodylus Spectacled caiman NC 002744

Alligator mississippiensis American alligator NC 001922Birds Gallus gallus Chicken NC 001323

Struthio camelus Ostrich NC 002785Turtles Chelonia mydas Green turtle NC 000886

Chrysemys picta Painted turtle NC 002073Mammals Mus musculus House mouse NC 005089

Didelphis virginiana North American opossum NC 001610Amphibians Ranodon sibiricus Siberian salamander NC 004021

Xenopus laevis African clawed frog NC 001573

*Taxa sequenced in this study.

D. A. Douglas

et al.

•


© 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters • Zoologica Scripta,

35

, 6, November 2006, pp545–558

547

allows examination of recent hypotheses on snake origin asit includes taxa purported to be their closest living sistergroups, anguimorphs and iguanians.

We also aimed to investigate mitogenomic features inthe new genomes sequenced. The mt genomes of snakes areinteresting in that they contain gene duplications andrearrangements. Kumazawa (2004) reported a novel positionof the tRNA-Gln gene in the mt genome of the Texas blindsnake (

L. dulcis

) and the absence of the origin of light strandreplication (O

L

) that could be characteristic of all scole-cophidian genomes. Duplicated control regions have beenreported in all alethinophidian snakes (Kumazawa

et al

.1998; Dong & Kumazawa 2005). Gene rearrangements andduplication events have been used as potential phylogeneticmarkers in previous analyses (e.g. Macey

et al

. 1997, 2000,2004) and are discussed in this study.

Materials and methods

Mitochondrial genome sequencing

Total DNA was extracted from liver or muscle tissue of fivesnakes (see Table 1). Large fragments were amplified by PCRusing Taq plus Long (Stratagene), Ex Taq and Z-Taq (Takara)polymerases. The majority of the conserved PCR primersused to amplify these fragments were designed for this study(see Table 2). Previously published primers (Kumazawa &Endo 2004) were used to amplify some regions of the scole-cophidian genomes. Fragments were sequenced from bothends using the primer walking method. Specific primers weredesigned from the end regions of each fragment, ensuringthat fragments overlapped one another. Sequencing wascarried out using the ABI automated sequencing system. Oneof the two control regions (CRI, see Fig. 1) found in the

E. notaeus

mt genome was cloned using standard procedures(Sambrook & Russell 2001). Twelve clones were sequenced —six in each orientation — using the LICOR automated

sequencing system. The program Tandem Repeat Finder(Benson 1999) was used to scan control regions for anytandem repeats. All sequences were edited and assembledusing EditView 1.0.1 (Perkin-Elmer).

Phylogenetic analysis

The sequences of the 12 heavy-strand protein-coding mtgenes of species not sequenced in this study were taken fromGenBank (see Table 1). The NADH6 gene was omitted fromthe analysis as its nucleotide (nt) composition differs from thatof all other protein-coding mt genes. As

Sphenodon punctatus

lacks the

≈

1800 nt long NADH5 gene (Rest

et al

. 2003), andthe cyt

b

gene of the gecko

Teratoscincus keyserlingii

is only 854nt in length (roughly 150 nt shorter than in other taxa usedin this study), these sites were coded as missing data. Thealignment is available on request. Alignment-ambiguous sitesand third codon positions (3 cp) were removed from thealignment prior to the phylogenetic analysis (Kumazawa &Nishida 1993; Kumazawa

et al

. 2004). The total number of ntand amino acid (aa) sites used was 6116 (minus 3 cp) and3058, respectively. Homogeneity of nt and aa compositionwas analysed using the

χ

2

test implemented in the programTREE-PUZZLE (Schmidt

et al

. 2002). The general-time-reversible model (Lanave

et al

. 1984) with invariable sites anda gamma model of rate heterogeneity (Gu

et al

. 1995) witheight classes of variable sites (GTR + I + 8

Γ

) was chosen byModeltest ver. 3.06 (Posada & Crandall 1998) as the bestfitting model for nt analysis. Amino acid sequences were

Table 2 Conserved PCR primers and sequences.

Primer Sequence (5′–3′) Description

Position of 5′ ends in E. notaeus

34 CCCGACTGTTTACCAAAAACAT Universal primer 16SL 184235 GGACTTTAATCGTTGAACAAACG Universal primer 16SH 237576 GGGATTAGATACCCCACTAT Universal primer 12SL 474531-03 ACGTCAGGTCAAGGTGTA Snake 12SL 723532-03 TCACAGGGTCTTCTCGTC Snake 16SH 2088418-03 GCTATTGGGCCCATACCC Methionine LMet 5110419-03 CATTTTYGGGGTATGGG Methionine HMet 5135421-03 TTKGGGRCTTTGAAGG Tryptophan HTrp 6228424-03 CCAKCTTTGGTTTACAAG Threonine HThr 16504483-03 TATTCCACTGGTCTTAG Leucine (CUN) LLeu 12912

L, light strand. H, heavy strand.

Fig. 1 The mitochondrial genome map of the anaconda, E. notaeusnotaeus. The tRNAs are indicated by their single-letter amino acidcode. L1, tRNA-Leu (UUR); L2, tRNA-Leu (CUN); S1, tRNA-Ser(AGY); S2, tRNA-Ser (UCN). CRI and II, control regions I and II.


•

D. A. Douglas

et al.

548

Zoologica Scripta,

35

, 6, November 2006, pp545–558 • © 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters

analysed using the mtREV-24 model of sequence evolution(Adachi & Hasegawa 1996b) assuming a gamma model of rateheterogeneity among sites with one class of invariable sitesand eight classes of variable sites (mtREV-24 + I + 8

Γ

).Phylogenetic analyses on nt data were performed using

maximum parsimony (MP), minimum evolution using theneighbour-joining algorithm (NJ), maximum likelihood(ML) and Bayesian analysis. MP and NJ analyses wereperformed using PAUP (Swofford 1998). In NJ analysesboth the GTR + I +

Γ

model and logDet distances were used.The logDet option is available in PAUP and run using theNJ algorithm. Statistical support for internal branches wastested using the bootstrap method with 1000 replicates. MLanalyses were performed using the program TREEFINDER(Jobb 2005). Bayesian analyses were performed usingMrBayes ver. 3.1 (Ronquist & Huelsenbeck 2003), each analysisbeing run for 1 000 000 generations. Tree sampling did notbegin until 100 000 generations, after which the logL valuesappeared to stabilize. Amino acid data was analysed using MPand ML methods. As with nt data, MP and ML analyses wereperformed using PAUP and TREEFINDER, respectively.Additional analyses were done in which synonymous sites atleucine 1 cps were ignored.

Further analyses were carried out to test for long-branchattraction (LBA) artefacts. MP, NJ and ML analyses wereperformed on three datasets with either birds, turtles or

S. punctatus

as outgroup taxa. Both nt and aa data wereanalysed. In addition, exhaustive ML tree searches were runusing the MOLPHY (Adachi & Hasegawa 1996a) programpackage. Exhaustive tree searches were made possible byfirst constraining invariable parts of the tree as one OTU.The resulting 100 best trees were then further evaluatedby TREE-PUZZLE using differences in log-likelihoodvalues (

δ

ln L) and their standard errors (S.E. under the abovementioned rate heterogeneity models. The probability of thedifferent topologies was estimated by the Kishino–Hasegawa(KH; Kishino & Hasegawa 1989) and Shimodaira–Hasegawa

(SH; Shimodaira & Hasegawa 1999) tests as implementedin TREE-PUZZLE. Both KH and SH tests were also usedto compare the favoured topology found in this study withalternative topologies relating to previous hypotheses onsnake origins (see Results).

Results

Snake mt genomes

The organization of the

E. notaeus

mt genome, 17 970 nt inlength, is shown in Fig. 1. CRI is located in-between thetRNA-Pro and tRNA-Phe genes, which is the typical positionfor the control region in vertebrate genomes. CRII, a duplicateof CRI, is located within the IQM cluster of tRNA genesbetween tRNA-Ile and tRNA-Gln. Duplicate control regionsare a feature of all alethinophidian snake mt genomesdescribed to date (Kumazawa

et al

. 1998; Dong & Kumazawa2005). Also consistent with other alethinophidian genomes,the tRNA-Leu (UUR) gene in

E. notaeus

is located down-stream of CRII instead of between the 16S rRNA andNADH1 genes, the typical location of this gene in vertebrategenomes (Fig. 1).

Genomes of

B. constrictor

and

E. guttata

are completeexcept for portions within one or both of the duplicatedcontrol regions. The gene order of both genomes is thesame as that of

E. notaeus

. The genes tRNA-Thr, tRNA-Pro,CRI, tRNA-Phe and the 5

′

end of 12S rRNA gene in themt genome of

T. mirus

have not been sequenced. In the

R. australis

genome the genes tRNA-Pro, CRI, tRNA-Pheand the 5

′

end of 12S rRNA gene have not been sequenced.Within the scolecophidian genomes, the tRNA-Leu (UUR)gene is located at the typical position and there is no duplicateCR located within the IQM cluster. The gene order in thescolecophidian genomes thus conforms in general to thetypical vertebrate gene order. However, the origin of

L

-strandreplication (O

L

), typically found between the tRNA-Asn andtRNA-Cys genes, is absent. In comparison, the O

L

is presentin

E. notaeus

,

B. constrictor

and

E. guttata

(Fig. 2A–C), each

Fig. 2 A–C. Secondary structure of the OLsin alethinophidian snakes sequenced in thisstudy. —A. E. notaeus. Repeats are indicatedin bold. —B. B. constrictor. —C. E. guttata.The boxes indicate the endings of the tRNA-Asn sequence and beginning of tRNA-Cyssequence in each case.

D. A. Douglas

et al. • Phylogenetic position of snakes

© 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters • Zoologica Scripta, 35, 6, November 2006, pp545–558 549

having stems that are 12 bp in length. In E. notaeus there is arepeat of 2 × 8 nt in the OL sequence (Fig. 2A).

Within the scolecophidian genomes, the tRNA-Leu(UUR) gene has unusual secondary structure as there appearto be two nucleotides separating the D- and A/C stemsinstead of one (Fig. 3), which is usually the case in vertebratetRNAs. The tRNA-Gln gene is found in its typical positionwithin the IQM cluster and not the WANCY region, as hasbeen reported for L. dulcis (Kumazawa 2004).

The mt genomes of E. notaeus, B. constrictor and E. guttataall contain duplicated control regions that are orientated inthe same direction. In E. notaeus each region is approximately1335 nt in length. They are nearly identical (98% similarity)and contain five repeats, each 96 nt long (the last one is trun-cated). Partial control regions of B. constrictor also confirmseveral repeats of about the same length (see also Kumazawaet al. 1996; Dong & Kumazawa 2005). Repeats of this kindhave also been reported in Varanus komodoensis (Kumazawa &Endo 2004). Alignments of the partial CR sequences fromboth B. constrictor and E. guttata revealed that the duplicatesare identical, which is also the case for other alethinophidian mtgenomes (Kumazawa et al. 1998; Dong & Kumazawa 2005).The cloning of CRI in E. notaeus revealed two heteroplasmicregions; in each region a single base differed between clones.The one control region of the E. guttata mt genome that wascompletely sequenced — CRI (see Fig. 1) — did not containany repeats. No repetitive elements were identified in theCRs of E. guttata and D. semicarinatus.

The control regions of all snakes in which at least onecomplete control region had been sequenced were alignedusing ClustalW in the program Gene Jockey II (Biosoft).Where two duplicate genomes were available, both were

used. In addition to this, control regions of two viperids anda partial sequence from a python were aligned. The controlregions of the two viperids showed 33% distance, whereasthose of D. semicarinatus and E. guttata, both belonging to thefamily Colubridae, showed 23% distance. CR sequences ofall snakes with the exception of L. dulcis show remarkableconservation for at least 600 nt downstream of the C-rich regionto the first conserved sequence block (CSBI — Kumazawa1996; Kumazawa et al. 1998). Amphisbaenian, lizard andS. punctatus control regions were also aligned, but did notshow the same degree of similarity, either with snakes or witheach other. CSBIs of V. komodoensis and S. punctatus werehighly similar to that of snakes. There was no similaritybetween CSBIIs or CSBIIIs (Kumazawa et al. 1998) amongany of the squamate groups.

Phylogenetic analysisThe Bayesian tree based on nt data and the ML tree based onaa data are shown in Fig. 4A and B, respectively. Supportvalues for nodes labelled A to H in Fig. 4A are listed inTable 3. The Bayesian and ML nt trees were identical, andthe aa ML tree differs only in the placing of T. keyserlingii. Ananalysis in which synonymous changes at leucine 1st cps wereignored recovered a topology identical to Fig. 4A. All analysesrecovered a sister-group relationship between snakes and theacrodont lizard Pogona vitticeps with strong support. Therewas also good support for a sister-group relationship betweenSerpentes−P. vitticeps and amphisbaenians in ML and Bayesiananalyses. A clade containing anguimorphs, iguanids andscincomorphs was well supported by the Bayesian tree andML analysis based on aa data, but only weakly by the MLanalysis based on nt data and NJ analyses. With the exception

Fig. 3 tRNA-Leu (UUR) sequences of Typhlopsand Ramphotyphlops, with possible matchingin the D-stem and two free nucleotidesbetween D- and A/C stems.

Phylogenetic position of snakes • D. A. Douglas et al.

550 Zoologica Scripta, 35, 6, November 2006, pp545–558 • © 2006 The Authors. Journal compilation © 2006 The Norwegian Academy of Science and Letters

of the MP nt tree, a clade recovering scincomorphs andiguanids was well supported. The MP tree based on aa datasupported a clade containing Eumeces egregius and Iguanidaewith a bootstrap value of 88%, while the placing of Cordyluswarreni was unresolved (data not shown).

Squamate relationships were poorly resolved in MP andNJ analyses. MP was unable to resolve relationships of thethree major squamate groups. The NJ tree differed from theML and MB trees in that the Serpentes−P. vitticeps clade was

sister to all other squamates, with amphisbaenians branchingoff next, both with low (< 50%) bootstrap support (datanot shown). As there was a significant difference in basecomposition in the dataset, logDet distances were also applied.However, relationships between Serpentes, Amphisbaeniaand lizards were not resolved in the logDet tree, whichindicated that the position of Serpentes−P. vitticeps in the NJtree is tentative. Lizard relationships were identical in bothtrees. Of the ingroup taxa, the aa composition of snakes and

Fig. 4 A, B. Results of the phylogenetic analysis using 12 mt genes. Support for labelled nodes from trees produced by different methods areshown in Table 3. —A. Bayesian tree based on nt data. —B. Best ML tree based on aa data.

D. A. Douglas et al. • Phylogenetic position of snakes


Bipes biporus differed significantly from all other species.However, these taxa grouped together as expected in all trees.Thus composition heterogeneity was thought to play a minorrole in influencing the topology.

It is probable that the joining of snakes and P. vitticeps isdue to long-branch attraction (LBA). A study of pairwisedistances among squamate taxa revealed that P. vitticeps hadthe largest distances relative to all other squamate taxa. Thelong branches leading to P. vitticeps in the trees shown inFig. 4 are indicative of this. As snakes also have a long branch,

it is conceivable that these branches may have attracted eachother. ML tree evaluations showed that the sister-grouprelationship between snakes and P. vitticeps was dependenton the inclusion of S. punctatus; the position of P. vitticepswas unstable when the S. punctatus was absent, in whichcase it also clustered within the amphisbaenians or withcrocodilians. The difference in logL between these treeswas only slight and not significantly worse relative to thetree recovering snakes and P. vitticeps as sister groups (datanot shown). However, as this relationship was stable when

Fig. 4 Continued



S. punctatus was included, further evaluations were done with thesnakes excluded. In this case, P. vitticeps consistently clusteredwithin amphisbaenians, which also possess relatively longbranches. This rather points towards LBA, as P. vitticeps isclearly an agamid lizard. As the long branch leading to P. vitticepsmay have affected support for other ingroup relationships,P. vitticeps was removed from subsequent analyses.

We tested for further LBA artefacts by evaluating therobustness of ingroup relationships. This was carried out byrooting using three different outgroups in turn: birds, turtlesand S. punctatus. Only ML analyses yielded fully resolvedsquamate relationships, the resulting topologies consistentwith those shown in Fig. 4. Additional analysis was carriedout to find out which taxa were responsible for the lack ofresolution in MP and NJ analyses. The positions of two taxa— T. keyserlingii and Rhineura floridana — were unresolved inMP and NJ analyses and differed in ML analyses: in nt MLand Bayesian analyses, T. keyserlingii is placed at the base of theingroup whereas in the aa ML analysis it is the sister group tosnakes, P. vitticeps and amphisbaenians (see Fig. 4A,B). Whereasall other amphisbaenians grouped together consistently inall trees, R. floridana is either sister to other amphisbaenians,P. vitticeps and snakes (Fig. 4A) or the basal taxon withinAmphisbaenia (Fig. 4B). MP and NJ trees were only fullyresolved with both taxa removed, and tree topologies in thiscase were consistent with those from ML analyses withT. keyserlingii and R. floridana included. Bootstrap values ofclades recovered in trees produced by all three methods areshown in Table 4.

When either birds or turtles were chosen as outgroups,snakes and amphisbaenians formed a clade, with supportranging from 77% to 100% (Table 4). The trees were alsolargely congruent with respect to lizard relationships.Scincomorphs and iguanids grouped together in all trees,either as sister groups or with scincomorphs paraphyletic toiguanids, with good support in the majority of cases (seeTable 4). Anguimorphs formed a clade with scincomorphsand iguanids, with T. keyserlingii sister to all other squamates

(as in Fig. 4A) in the majority of trees. However, MP supportvalues for lizard relationships in general were not compellingdue to a difference in the position of C. warreni.

When S. punctatus was chosen as the outgroup this taxonjoined with the Serpentes. As S. punctatus was found to bethe closest outgroup to the squamates in previous molecularanalyses (e.g. Rest et al. 2003; Townsend et al. 2004; Vidal &Hedges 2005), we wanted to test whether or not ingrouptopology was affected by its removal. ML and Bayesiananalyses were carried out on nt and aa data. The nt Bayesiantree and aa ML tree are shown in Fig. 5A and B, respectively.Trees show no change in ingroup topology, even with theexclusion of S. punctatus. Again, the only discrepancy was theposition of T. keyserlingii. This may have affected the supportof the (Anguimorpha (Iguanidae + Scincomorpha)) clade inthe aa tree (Fig. 5B), where support had decreased comparedto the earlier aa analysis (Fig. 4B).

Exhaustive ML tree searches were run with either birds orturtles as outgroups. The best 100 trees were evaluated asdescribed in Materials and Methods. The trees with thehighest likelihood in each case had the same topology as thatshown in Fig. 5B. In trees rooted with turtles, all 100 best treesgrouped together amphisbaenians and snakes, with lizardrelationships differing only in the placing of T. keyserlingiiand R. floridana. When only birds were used as outgroup,topologies differed considerably, with likelihood scoresdiffering by only a few log L units. This lack of signal may bedue to the long branch leading to the ingroup, such that

Table 3 Bootstrap support values for nodes (labelled A–H in Fig. 4A)on trees produced by different methods from analyses using all taxa.

Data Methods

Node support

A B C D E F G H

Nucleotides MP 100 92 — — 90 57 — —NJ 100 100 — 54 100 95 — 86NJ logDet 100 100 — 62 99 85 — 64ML 100 100 100 61 100 80 65 99Bayesian 100 100 100 99 100 100 96 100

Amino acids MP 100 92 — — 82 — — —ML 100 100 72 71 100 77 — 99

Table 4 Bootstrap support values from various nodes recovered fromtrees produced when analysing the effect of ingroup topology usingdifferent outgroups.

Data Method Outgroup taxa

Node support

S−A S−I Ang SI−Ang

Nucleotides MP S. punctatus — 77 97 71Turtles 89 59 94 58Birds 77 63 93 55

NJ S. punctatus 71 75 97 98Turtles 100 91 95 73Birds 99 89 97 70

ML S. punctatus — 91 100 —Turtles 99 94 100 —Birds 94 88 100 55

Amino acids MP S. punctatus — 90 82 61Turtles 87 84 81 —Birds 82 88 81 54

ML S. punctatus — 85 100 55Turtles 96 92 100 60Birds 87 96 100 75

Key for nodes: S−A, snakes−amphisbaenians; S−I, scincomorphs−iguanids; Ang, anguimorphs; SI−Ang, scincomorphs−iguanids plus anguimorphs.



relationships in the latter may have become randomized. Anadditional ML analysis on nt and aa data was performed withonly ingroup taxa included. The resulting unrooted treesin both cases were consistent with other analyses, also withregards to the labile positions of T. keyserlingii and R. floridana.This thus showed that no matter where the root is placed inthe tree, ingroup relationships are not affected.

Two further tests were carried out to investigate whetheror not the long branch of the snakes affected lizard and

amphisbaenian relationships. ML analyses on nt and aa datawere performed with all snakes excluded. Lizard and amphis-baenian relationships were consistent with previous analyses.As amphisbaenians also have long branches, additionalML analyses were done with this group removed. In bothnt and aa analyses S. punctatus joined with the snakes. WithS. punctatus removed snakes and lizards were recovered assister-groups. It is possible that this result could be influencedby the difference in sampling.

Fig. 5 A, B. Results of phylogenetic analysis using 12 mt genes, P. vitticeps and S. punctatus excluded (see text). —A. Bayesian tree based on ntdata. —B. Best ML tree based on aa data.



Alternative topologiesThe current results do not credibly support any of the recenthypotheses being tested, as snakes have grouped consistentlywith amphisbaenians (with P. vitticeps removed) and never withany of the anguimorphs or both anguimorphs and iguanidstogether. The trees shown in Fig. 5A and B (the only differencebeing the position of T. keyserlingii) were tested statisticallyagainst previous hypotheses regarding the placing of snakes usingboth nt and aa data. Results are shown in Tables 5 and 6.

Tree 1 in the nt-based comparisons refers to the topologyshown in Fig. 5A; likewise, tree 1 in the aa-based comparisons

refers to the topology shown in Fig. 5B. In tree 2, snakesare sister to all other squamates, as suggested in studies byKumazawa (2004) and Dong & Kumazawa (2005). This wasalso recovered by the NJ analysis in this study, albeit tenta-tively. In tree 3, snakes and varanid lizards (i.e. V. komodoensisin this study) are sister groups, the topology being based onthat shown by Lee & Caldwell (2000). In trees 4 and 5, snakesare sister to iguanians and anguimorphs, respectively. Theserelationships were tentatively suggested in Saint et al. (1998),Vidal & Hedges (2004) and Townsend et al. (2004). In tree 6,snakes are sister to a clade containing both iguanians and

Fig. 5 Continued



anguimorphs, as tentatively suggested in Harris (2003) andby Vidal & Hedges (2005).

Tree 1 was the preferred tree regardless of whether nt oraa data was used. The KH test rejected all other trees with theexception of tree 2 when using aa data (see Table 6). In ntcomparisons the SH test rejected trees 3 and 5 but did notreject trees 2, 4 and 6, despite these trees being more than 2 S.E.worse relative to tree 1. In aa comparisons, SH only rejectedtree 3 despite the fact that again, three other trees (4, 5 and6) were almost equal to or greater than 2 S.E. worse relativeto the best tree. In the case of aa data, tree 2 was not rejectedby either test and the difference in logL relative to tree 1 wasless than 2 S.E.

DiscussionMitogenomic featuresKumazawa (2004) reported that the OL was absent from thegenome of L. dulcis, suggesting that it may be absent from allscolecophidian snakes. As the two scolecophidian genomessequenced in the current study also do not have an OL, thissuggestion appears to be corroborated. It has previously beenproposed that some feature within the tRNA genes functionsas the OL when the latter is missing or alternatively, that theorigin lies in the control region as is the case for OH (Clayton1991).

As other studies have shown, gene rearrangements foundamong certain squamate lineages could be useful with

regards to inferring relationships (Kumazawa & Nishida1995; Kumazawa et al. 1996; Macey et al. 1997, 2000, 2004)and can be used here to determine support for a particularhypothesis on snake origin. The snake−varanoid hypothesis(i.e. snake−mosasauroid hypothesis; see Introduction) does notappear to be supported by gene rearrangements. Althoughboth V. komodoensis and alethinophidian snakes have duplicatecontrol regions (Kumazawa 2004; Kumazawa & Endo 2004;Dong & Kumazawa 2005), they are found in different regions ofthe genome, suggesting independent evolution rather than a syn-apomorphy. There is also no evidence in scolecophidians, themost basal living snakes, that the same duplication has takenplace. However, some iguanians (P. vitticeps) and amphisbae-nians also have mt genomes that contain rearrangements,whereas, with the data sequenced in this study, no evidence isyet apparent that scolecophidians possess the same rearrange-ments. Therefore, it seems more likely that gene rearrangementsarose independently in the different lineages mentioned. Generearrangements may only be useful as phylogenetic markerswithin different squamate lineages especially in snakes,where the duplicated control regions within and betweenspecies appear to be remarkably conserved (see also Dong &Kumazawa 2005).

The phylogenetic position of snakesOur results place snakes as the sister group to amphisbaenians,suggesting a closer relationship to the latter than to angui-morphs or iguanians. This was supported by ML andBayesian analyses, the majority of exhaustive tree searchesand tests on ingroup topology using different outgroups.Initial analyses in the current study, however, did place theacrodont lizard P. vitticeps with snakes (Fig. 4A,B). Thissurprising result was also recovered by Townsend et al. (2004)when using mitochondrial data and when combining thiswith nuclear data. This was also put down to LBA. Also, aswas mentioned previously, tree evaluations revealed that theposition of P. vitticeps varied considerably in trees thatdiffered by only a few logL units, attaching to other taxa thatalso had fast evolutionary rates. Apart from that provided byTownsend et al. (2004), there has not been any evidence,molecular or morphological, linking snakes with acrodontlizards. In addition, this taxon was never recovered with therelatively slow-evolving iguanids, so the Serpentes−P. vitticepsgrouping cannot be taken at this stage as support for a sister-group relationship between snakes and the Iguania (Iguanidae+ Acrodonta), especially as a snake−iguanid grouping was notstatistically supported. More acrodont taxa need to beincluded to properly test this relationship.

MP and NJ analyses were unable to resolve ingrouprelationships in this study. This was most likely due to thegreater susceptibility to LBA of these methods than ML andBayesian analyses (Page & Holmes 1998; Nei & Kumar 2000).

Table 5 Log likelihood and pKH and pSH values taken from anevaluation of trees with alternative topologies (see text) based on ntdata.

Tree log L Difference S.E. pKH pSH

1 −58423.64 0 best 1.000 1.0002 −58455.27 31.63 15.06 0.016 0.1663 −58510.79 87.15 23.59 0.000 0.0004 −58466.51 42.86 19.09 0.021 0.0735 −58472.59 48.95 18.74 0.004 0.0336 −58464.96 41.32 17.87 0.008 0.080

Table 6 Log likelihood and pKH and pSH values taken from anevaluation of trees with alternative topologies (see text) based on aadata.

Tree log L Difference S.E. pKH pSH

1 −53316.85 0 best 1.000 1.0002 −53345.32 28.47 17.23 0.059 0.4193 −53402.53 85.68 24.39 0.001 0.0004 −53359.14 42.29 23.45 0.042 0.2545 −53363.81 46.95 23.32 0.023 0.1946 −53360.45 43.60 23.09 0.028 0.234



Trees were fully resolved only when testing ingroup topologyusing the outgroups closest to squamates (i.e. S. punctatus,birds and turtles). Related to this point, it is evident thatthere are short branches grouping the lizard taxa (see Figs 4and 5), and that support for lizard relationships was not com-pelling in some analyses (Tables 3 and 4). This may reflectrapid cladogenesis among some lizard lineages, which mayhave taken place in a short evolutionary time period as hasbeen suggested in previous molecular studies (Rest et al. 2003;Vidal & Hedges 2005) and palaeontological data (Evans 2003).

Our results were inconsistent with previous studies basedon all mt genes (Kumazawa 2004; Dong & Kumazawa 2005)that suggest that snakes are sister to all other squamates.However, statistical tests could not exclude this hypothesis,which indicates that it requires further consideration. Whentesting whether LBA accounted for the snake−amphisbaenianrelationship, analyses were run with the amphisbaenian taxaremoved (see Results). As stated, snakes were placed as thesister group of lizards, consistent with Kumazawa (2004) andDong & Kumazawa (2005). However, differential samplingmay have caused this. In Kumazawa (2004) and Dong &Kumazawa (2005), scincomorphs are basal to anguimorphsand iguanids, a grouping inconsistent with our results.

Previous studies that support a sister-group relationshipbetween varanid lizards and snakes were based on one protein-coding mt gene (NADH4) and three tRNA genes (Forstneret al. 1995) and two protein-coding mt genes (NADH1 and2) and eight tRNAs (Rest et al. 2003). The small datasets inthese studies, in combination with large distances observedbetween squamate lineages, may have influenced the topologyso as to force together long branches (V. komodoensis also haslarge distances), especially when taxon sampling is limited(Nei & Kumar 2000). In the current study the long branch ofthe snakes did not affect lizard and amphisbaenian relation-ships. Several morphological studies, with the inclusion offossil taxa, have supported a relationship between varanoidlizards (mosasauroids) and snakes (Caldwell & Lee 1997 andreferences therein). However, a sister-group relationshipbetween varanids and snakes was rejected in statisticaltests.

Studies based on nuclear genes support a close relationshipbetween snakes, anguimorphs and iguanians (Saint et al. 1998;Harris 2003; Townsend et al. 2004; Vidal & Hedges 2004,2005). Our results do not support this grouping; affinitiesbetween snakes and anguimorphs and/or iguanians wererejected statistically by the KH test. In nuclear analyses, thescincomorphs are positioned basal to all squamates withthe exclusion of gekkotans, which is inconsistent with ourresults. The snake−anguimorph−iguanian clade appears to besupported by a recent finding by Fry et al. (2006), whichsuggests that venom toxins thought previously only to havebeen present in snakes are also present in anguimorphs and

iguanians. However, phylogenetic studies based on each ofnine toxin proteins (supplementary data) do not allow con-clusive evidence of a relationship between snakes, iguaniansand anguimorphs, as no other squamates were present in theanalyses. It was not clear whether other lizards or amphisbae-nians had been examined for the presence of these toxins.

With the exclusion of P. vitticeps, snakes invariably groupedwith amphisbaenians, which means that one cannot rule outthe possibility of a sister-group relationship between them.This would be consistent with a fossorial (i.e. burrowing)origin of snakes. A close relationship between snakes andamphisbaenians had been suggested by some morphologicalanalyses (Kearney 2003; Rieppel & Zaher 2000). In thesestudies, the dibamids — a group of fossorial lizards — wereincluded and were found to be the immediate sister group ofamphisbaenians, followed by snakes. Lee (1998) also recoveredthis relationship after the removal of fossil taxa from thedataset. A snake−amphisbaenian clade has been dismissed asbeing the result of convergent characters associated witha burrowing lifestyle (Lee 1998; Vidal & Hedges 2005).However, both Kearney (2003) and Rieppel & Zaher (2000)removed characters associated with burrowing and stillrecovered a clade containing snakes, amphisbaenians anddibamids. In previous analyses, amphisbaenians were recoveredin a clade together with lacertid, teiid and gymnopthalmidlizards (Townsend et al. 2004; Vidal & Hedges 2005). Ofcourse, our results do not rule out this possibility, or thatother squamate taxa not included in this study are moreclosely related to either snakes or amphisbaenians.

ConclusionsThe present mitogenomic study does not support a closerelationship between snakes, anguimorphs and/or iguanians.It supports a fossorial origin of snakes (snakes and amphis-baenians), but does not rule out the possibility that snakesmay be sister to all other squamates. It would be interestingto test this relationship with the inclusion of more squamatetaxa that have yet to be represented by mt genomes. Theinclusion of more acrodonts would be important in breakingup the long branch of P. vitticeps, as would be the inclusionof more gekkotans in helping to establish the position ofthis group. In most analyses in this study, T. keyserlingii wasrecovered basally, which is consistent with nuclear analyses.

AcknowledgementsWe would like to thank David Gower at the Natural HistoryMuseum, London, for providing the T. mirus sample and DrSteve Donnellan at the South Australian Museum for pro-viding the R. australis sample. We thank Morgan Kullbergfor his help with running phylogenetic analyses and MariaNilsson for making helpful comments on an earlier version ofthis manuscript.



ReferencesAdachi, J. & Hasegawa, M. (1996a). MOLPHY version 2.3: programs

for molecular phylogenetics based on maximum likelihood.Computer Science Monographs, 28, 1–150.

Adachi, J. & Hasegawa, M. (1996b). Model of amino acid substitutionin proteins encoded by mitochondrial DNA. Journal of MolecularEvolution, 42, 459–468.

Bellairs, A. D. & Underwood, U. (1951). The origin of snakes.Biological Reviews of the Cambridge Philosophical Society, 26,193–237.

Benson, G. (1999). Tandem repeats finder: a program to analyzeDNA sequences. Nucleic Acid Research, 27 (2), 573–580.

Caldwell, M. W. & del Sasso, C. (2004). Soft-tissue preservation ina 95 million year old marine lizard: form, function and aquaticadaptation. Journal of Vertebrate Palaeontology, 24 (4), 980–985.

Caldwell, M. W. & Lee, M. S. Y. (1997). A snake with legs from themarine Cretaceous of the Middle East. Nature, 386, 705–709.

Clayton, D. (1991). Replication and transcription of vertebratemitochondrial DNA. Annual Reviews of Cell Biology, 7, 453–478.

Coates, M. & Ruta, M. (2000). Nice snake, shame about the legs.Trends in Ecology and Evolution, 15 (12), 503–507.

Cope, E. D. (1869). On the reptilian order Pythonomorpha andStreptosauria. Proceedings of the Boston Society of Natural History, 12,250–261.

Dong, S. & Kumazawa, Y. (2005). Complete mitochondrial DNAsequences of six snakes: phylogenetic relationships and molecularevolution of genomic features. Journal of Molecular Evolution, 61(1), 12–22.

Evans, S. (2003). At the feet of dinosaurs: the early history andradiation of lizards. Biological Reviews, 78, 513–551.

Forstner, M. R. J., Davis, S. K. & Arévalo, E. (1995). Support for thehypothesis of anguimorph ancestry for the suborder Serpentesfrom phylogenetic analysis of mitochondrial DNA sequences.Molecular Phylogenetics and Evolution, 4 (1), 93–102.

Fry, B. G., Vidal, N., Norman, J. A., Vonk, F. J., Scheib, H., Ramjan,S. F. R., Kuruppu, S., Fung, K., Hedges, S. B., Richardson, M. K.,Hodgson, W. C., Ignjatovic, V., Summerhayes, R. & Kochva, E.(2006). Early evolution of the venom system in lizards and snakes.Nature, 439, 584–588.

Greene, H. (1997). Snakes, the Evolution of Mystery in Nature. Berkleyand Los Angeles, California: University of California Press.

Greene, H. & Cundall, D. (2000). Limbless tetrapods and snakeswith legs. Science, 287, 1939–1941.

Gu, X., Fu, Y. & Li, W. (1995). Maximum Likelihood estimation ofthe heterogeneity of substitution rate among nucleotide sites.Molecular Biology and Evolution, 12 (4), 546–557.

Harris, D. J. (2003). Codon bias variation in c-mos betweensquamate families might distort phylogenetic inferences. MolecularPhylogenetics and Evolution, 27, 540–544.

Jobb, G. (2005). TREEFINDER, version of October 2005. [Computermanual]. Munich, Germany. Distributed by the author atwww.treefinder.de.

Kearney, M. (2003). Systematics of the Amphisbaenia (Lepidosauria,Squamata) based on morphological evidence from recent andfossil forms. Herpetological Monographs, 17, 1–74.

Kishino, H. & Hasegawa, M. (1989). Evaluation of the maximumlikelihood estimate of the evolutionary tree topologies from DNAsequence data, and the branching order in Hominoidea. Journal ofMolecular Evolution, 29, 170–179.

Kumazawa, Y. (2004). Mitochondrial DNA sequences of five squamates,phylogenetic affiliation of snakes. DNA Research, 11, 137–144.

Kumazawa, Y. & Endo, H. (2004). Mitochondrial genome of theKomodo dragon, efficient sequencing method with reptile-oriented primers and novel gene rearrangements. DNA Research,11, 115–125.

Kumazawa, Y. & Nishida, M. (1993). Sequence evolution of mito-chondrial tRNA genes and deep-branch animal phylogenetics.Journal of Molecular Evolution, 37, 380–398.

Kumazawa, Y. & Nishida, M. (1995). Variations in mitochondrialtRNA gene organization of reptiles as phylogenetic markers.Molecular Biology and Evolution, 12 (5), 759–772.

Kumazawa, Y., Ota, H., Nishida, M. & Ozawa, T. (1996). Generearrangements in snake mitochondrial genomes, highly concertedevolution of control-region-like sequences duplicated and insertedinto a tRNA gene cluster. Molecular Biology and Evolution, 13 (9),1242–1254.

Kumazawa, Y., Ota, H., Nishida, M. & Ozawa, T. (1998). Thecomplete nucleotide sequence of a snake (Dinodon semicarinatus)mitochondrial genome with two identical control regions. Genetics,150, 313–329.

Kumazawa, Y., Azuma, Y. & Nishida, M. (2004). Tempo of mito-chondrial gene evolution: can mitochondrial DNA be used to dateold divergences? Endocytobiosis Cell Research, 15, 136–142.

Lanave, C., Preparata, G., Saccone, C. & Serio, G. (1984). A newmethod for calculating evolutionary substitution rates. Journal ofMolecular Evolution, 20 (1), 86–93.

Lee, M. S. Y. (1998). Convergent evolution and character correlationin burrowing reptiles, towards a resolution of squamate relation-ships. Biological Journal of the Linnean Society., 65, 369–453.

Lee, M. S. Y. & Caldwell, M. W. (2000). Adriosaurus and the affinitiesof mosasaurs, dolichosaurs and snakes. Journal of Palaeontology, 74(5), 915–937.

Lee, M. S. Y., Bell, G. L. Jr & Caldwell, M. W. (1999). The originof snake feeding. Nature, 400, 655–659.

Macey, J. R., Larson, A., Ananjeva, N. B. & Papenfuss, T. J. (1997).Evolutionary shifts in three major structural features of themitochondrial genome among iguanian lizards. Journal of MolecularEvolution, 44, 660–674.

Macey, J. R., Schulte, J. A. I. I. & Larson, A. (2000). Evolution andphylogenetic information content of mitochondrial genomicstructural features illustrated with acrodont lizards. SystematicBiology, 49 (2), 257–277.

Macey, J. R., Papenfuss, T. J., Kuehl, J. V., Fourcade, H. M. &Boore, J. L. (2004). Phylogenetic relationships among amphis-baenian reptiles based on complete mitochondrial genomicsequences. Molecular Phylogenetics and Evolution, 33 (1), 22–31.

Nei, M. & Kumar, S. (2000). Molecular Evolution and Phylogenetics.Oxford: Oxford University Press.

Page, R. D. M. & Holmes, E. C. (1998). Molecular Evolution, aPhylogenetic Approach. Oxford: Blackwell Scientific.

Posada, D. & Crandall, K. A. (1998). Modeltest, testing the modelof DNA substitution. Bioinformatics, 14 (9), 817–818.

Pough, F. H., Janis, C. M. & Heiser, J. B. (2005). Vertebrate Life, 7thedn. Upper Saddle River, New Jersey: Pearson Education Inc.

Rest, J. S., Ast, J. C., Austin, C. C., Waddell, P. J., Tibbetts, E. A.,Hay, J. M. & Mindell, D. P. (2003). Molecular systematics ofprimary reptilian lineages and the tuatara mitochondrial genome.Molecular Phylogenetics and Evolution, 29 (2), 289–297.



Rieppel, O. & Zaher, H. (2000). The intramandibular joint insquamates, and the phylogenetic relationships of the fossil snakePachyrachis problematicus Haas. Fieldiana (Geology), 43, 1–69.

Rieppel, O., Zaher, H., Tchernov, E. & Polcyn, M. J. (2003). Theanatomy and relationships of Haasiophis terrasanctus, a fossil snakewith well-developed hind limbs from the mid-Cretaceous of theMiddle East. Journal of Palaeontology, 77 (3), 536–558.

Ronquist, F. & Huelsenbeck, J. P. (2003). MRBAYES 3, Bayesianphylogenetic inference under mixed models. Bioinformatics, 19,1572–1574.

Saint, K. M., Austin, C. C., Donnellan, S. C. & Hutchinson, M. N.(1998). C-mos, a nuclear marker useful for squamate phylogeneticanalysis. Molecular Phylogenetics and Evolution, 10 (2), 259–263.

Sambrook, J. & Russell, D. W. (2001). Molecular Cloning, a LaboratoryManual. Cold Spring Harbor, NY: Cold Spring Harbor Press.

Scanlon, J. D. & Lee, M. S. Y. (2000). The Pleistocene serpentWonambi and the early evolution of snakes. Nature, 403, 416–420.

Schmidt, H. A., Strimmer, K., Vingron, M. & von Haeseler, A.(2002). TREE-PUZZLE, maximum likelihood phylogeneticanalysis using quartets and parallel computing. Bioinformatics, 18,502–504.

Shimodaira, H. & Hasegawa, M. (1999). Multiple comparisons oflog-likelihoods with applications to phylogenetic inference.Molecular Biology and Evolution, 16, 1114–1116.

Swofford, D. L. (1998). Phylogenetic Analysis Using Parsimony (*andother methods), Version 4. [Computer software and manual].Sunderland, MA: Sinauer Associates.

Tchernov, E., Rieppel, O., Zaher, H., Polcyn, M. J. & Jacobs, L. L.(2000). A fossil snake with limbs. Science, 287, 2010–2012.

Townsend, T. M., Larson, A., Louis, E. & Macey, J. R. (2004).Molecular phylogenetics of Squamata, The position of snakes,amphisbaenians, and dibamids, and the root of the squamate tree.Systematic Biology, 53 (3), 735–757.

Underwood, G. (1970). The eye. In C. Gans & T. S. Parsons (Eds)Biology of the Reptilia (pp. 1–97). London: Academic Press.

Vidal, N. & Hedges, S. B. (2004). Molecular evidence for a terrestrialorigin of snakes. Proceedings of the Royal Society of London Series B(Suppl. 4), 271, 226–229.

Vidal, N. & Hedges, S. B. (2005). The phylogeny of squamate reptiles(lizards, snakes and amphisbaenians) inferred from nine nuclearprotein-coding genes. Comptes Rendus Biologies, 328, 1000–1008.

Zaher, H. (1998). The phylogenetic position of Pachyrachis withinsnakes (Squamata, Lepidosauria). Journal of Vertebrate Palaeontology,18 (1), 1–3.

Zaher, H. & Rieppel, O. (2002). On the phylogenetic relationshipsof the Cretaceous snakes with legs, with special reference toPachyrachis problematicus (Squamata, Serpentes). Journal ofVertebrate Palaeontology, 22 (1), 104–109.

Documents

Blackwell Publishing Ltd A mitogenomic study on the ...aerg.canberra.edu.au/library/sex_general/2006... · 1998; Coates & Ruta 2000; Tchernov et al. 2000; Greene & Cundall 2000; Zaher