Biofunctionalization of dispense-plotted hydroxyapatite scaffolds with peptides: Quantification and cellular response

Biofunctionalization of dispense-plotted hydroxyapatitescaffolds with peptides: Quantification andcellular response

Rainer Detsch,1 Irina Dieser,2 Ulrike Deisinger,3 Franziska Uhl,1 Sabine Hamisch,1

Gunter Ziegler,1,3 Georg Lipps21BioCer Entwicklungs-GmbH, Ludwig-Thoma-Str. 36 c, 95447 Bayreuth, Germany2Institute of Biochemistry, University of Bayreuth, Universitatsstraße 30, 95440 Bayreuth, Germany3Friedrich-Baur-Research Institute for Biomaterials, University Bayreuth, 95440 Bayreuth, Germany

Received 19 February 2008; revised 29 September 2008; accepted 9 November 2008Published online 11 February 2009 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/jbm.a.32386

Abstract: Hydroxyapatite (HA) ceramic is a widely usedsynthetic bone substitute material for the regeneration ofbone defects. We manufactured HA scaffolds with adjusta-ble pore sizes and pore geometry by dispense-plotting. Inaddition, we attached peptides covalently onto the HA sur-face and are able to simultaneously quantify the amount ofcovalently attached and adsorbed peptide down to the pico-molar range with a novel fluorescence-based detectionmethod. In cell culture assays with stromal bone marrow

cells, we observed a positive effect of biofunctionalization oncell differentiation after 21 days of culture when comparingthe scaffold functionalized with the RGD motif containingadhesion peptide to an unmodified scaffold. � 2009 WileyPeriodicals, Inc. J Biomed Mater Res 92A: 493–503, 2010

Key words: bone substitute; hydroxyapatite; rapid proto-typing; biofunctionalization; bone marrow cells; osteoblas-tic differentiation

INTRODUCTION

For the design of biomaterials, a detailed under-standing of how various cell types respond to thematerial is required. Insufficient or inappropriateinteraction of the organism with the biomaterial canlead to inflammation or other unwanted reactions. Inaddition, the implant might be encapsulated withfibrous tissue which could ultimately lead to implantloosening. For bone substitution a number of materi-als, e.g. titanium, TiAl6V4 alloy, and hydroxyapatite(HA) ceramic are commonly used.1,2 Titanium forexample is the preferred material in load-bearingapplications. In contrast, HA as a nonload-bearingimplant is also an excellent bone substitution mate-rial and has a long tradition as bone-graft substitute.This material is biocompatible and osteoconductive

as it is similar to the inorganic phase in naturalbone2 and, as a consequence this ceramic promotesformation and remodeling of bone.3 Nevertheless,HA-based implants with improved properties forlarge defects could help to resolve some of the immi-nent practical problems associated with boneimplants. To enable bone ingrowth and vasculariza-tion of the implant, the bone substitute materialneeds a three-dimensionally interconnecting porositywith pores between 200 and 900 lm.4–6 Thoserequirements can be met by producing scaffolds forexample by the rapid prototyping technique dis-pense-plotting.7

To improve HA as implant material it is possibleto modify its surface by immobilization of biomole-cules such as growth factors, extracellular matrix(ECM) components, or adhesion molecules.8 The ad-hesion of cells to the biomaterial is of primordial im-portance for biocompatibility as it is the prerequisiteto cell attachment, spreading, and reorganization ofthe cytoskeleton with the formation of focal adhe-sions. To promote these important series of processesby biomaterials ECM components can be immobi-lized or adsorbed on the surface of the substrate.The ECM components are supposed to acceleratecell adhesion and thus improve the biocompatibility

Correspondence to: G. Lipps, FHNW - University ofApplied Sciences Northwestern Switzerland, Institute ofChemistry and Bioanalytics, Grundenstr. 40, 4132 Muttenz,Switzerland; e-mail: [email protected] grant sponsor: DFG; contract grant number:

SPP 1100

� 2009 Wiley Periodicals, Inc.

of the biomaterial. As high-molecular weight ECMproteins might elicit unwanted immunologicalresponses and increase the infection risk9 there wasa high interest in identifying smaller biomoleculeswith adhesion promoting properties. The minimalbinding motif of fibronection, a major ECM protein,was discovered in 1984 by Ruoslahti.10 The tripep-tide RGD is found in a hairpin loop in fibronectinand is recognized by the integrins of the cells. TheRGD motif is also present in other ECM proteins,such as vitronection and laminin.9 In a seminalstudy, Massia et al. demonstrated that a surface con-centration of 1 fmol/cm2 of RGD containing adhe-sion peptide is sufficient for cell spreading and thatonly 10 fmol/cm2 promote the formation of focal ad-hesion contacts.11

In the present study we developed a strategy tocovalently attach and quantify RGD containing pep-tides onto HA to improve its osteoconductive prop-erties.12–15 HA has hydroxyl groups on its surface,which can be used to bring in more reactive cou-pling reagents, such as the silanization reagent 3-aminopropyltriethoxysilan (APTES) which introdu-ces amino groups. According to our experience, theverification and especially the quantification of thecovalent immobilization of biomolecules is techni-cally challenging, since only low amounts of biomo-lecules are usually immobilized. Therefore, theimmobilization is hardly detectable by spectroscopicmethods such as X-ray photoelectron spectroscopy(XPS) and Raman spectroscopy. These approachesalso have the disadvantage that they are generallynot able to distinguish between covalently attachedbiomolecules and molecules which are merelyadsorbed on the surface. In view of this difficulty,we developed a novel immobilization and detectionscheme: We do not directly detect the biomoleculeon the surface, but have rather chosen an immobili-zation route which enables us to selectively detachthe biomolecule for quantification purposes. Peptidesare immobilized with the aid of a homofunctionalcrosslinker p-phenylenediisothiocyanate (DITC). Forquantification the immobilized peptide can be selec-tively detached from the surface by the treatmentwith trifluoroacetic acid in an Edman-peptidesequencing like reaction (Fig. 1). In this reactionscheme the N-terminal amino acid remains at thesurface but the remaining peptide is released andcan be labeled with 9-Fluorenylmethylchlorformiat(Fmoc) which allows a highly sensitive detection ofthe peptide by HPLC.

This strategy has been applied to HA bone substi-tute materials. For improvement of the cell adhesionon dispense-plotted HA scaffolds, an adhesion pep-tide was immobilized on the surface. The covalentimmobilization of the adhesion peptides on HA scaf-folds could be quantified, as well as the amount of

adsorbed peptide. The successfully functionalizedHA scaffolds were then tested in cell culture experi-ments by using the murine bone marrow derivedcell line ST-2. The cultivation period was 21 dayswith an osteogenic cultivation medium. Cells wereanalyzed concerning cell proliferation, morphology,and differentiation stadium.

MATERIALS AND METHODS

HA scaffold fabrication

HA scaffolds were produced by the rapid prototypingtechnique dispense-plotting. Using this method, a paste-like ceramic slurry is extruded by air-pressure through afine nozzle and deposited computer-controlled onto abuilding platform (Fig. 2). Rod and pore diameter are con-trolled by nozzle diameter and computer-designed dis-tance between the rods. By changing the orientation of therods from layer to layer (six layers) by a certain angle (lay-down-pattern), a three dimensional scaffold with intercon-necting pores and a diameter of �15 mm was fabricated.In this work a 0/908 lay-down-pattern was used to pro-duce scaffolds with rectangular pores. After drying thescaffolds were sintered at 13008C for 1 h.

Scaffold characterization

Pore and rod diameter of the dispense-plotted scaffoldswere measured by an imaging software (analySIS, SoftImaging System GmbH, Germany) from light microscopicimages. Total porosity was determined by helium pycno-metry (AccuPyc 1330, Micromeritics, Germany). The surfaceof the scaffolds was characterized by SEM (Quanta 200, FEI,The Netherlands) and infrared spectroscopy (AVATAR 370FTIR, Thermo-Nicolet, Germany). The surface area of thescaffolds was calculated from CAD-models (SolidWorksSP0.0, 2007, SolidWorks).

Immobilization of peptides

The HA scaffolds were treated with trifluoroacetic acidsfor 30 min at 508C and for 20 min at room temperature.During this step, the surface of the HA is increased andresidual contaminations which could interfere with thehighly sensitive fluorescence detection are removed. Thenthe scaffolds were extensively washed with water anddried overnight at 508C. The next morning the scaffoldswere treated with 3% APTES solution in 95:5 (v/v) etha-nol/water for 1 h. After rinsing with ethanol to removeexcess of APTES, the scaffolds were incubated for 1 h at1158C in air in order to promote the covalent attachmentof the silanization reagent to the hydroxyl groups of theHA. After cooling, the scaffolds were washed four timeswith ethanol, dried and then stored in vacuum until use.The scaffolds were activated with 25 mM p-DITC in 10%pyridine in dimethylformamide (DMF) for 1 h at 508C.Excess reagent was removed by three washing steps with

494 DETSCH ET AL.

Journal of Biomedical Materials Research Part A

DMF and three washing steps with dichlormethane. Afterdrying, the scaffolds were incubated in the peptide solu-tion (50–1200 lM GRGDS, Polypetide) at 508C overnight.Subsequently, the scaffolds were extensively washed (threetimes with bidistilled water, once with 3M KCl and againfive times with bidistilled water) to remove noncovalentlybound peptides. After drying, the scaffolds were sterilizedby incubation with 70% ethanol for 2 h or used for quanti-fication.

Quantification of immobilized peptide

The biofunctionalized scaffolds were incubated in tri-fluoroacetic acid for 30 min at 508C leading to specific hy-drolysis of the first peptide bond with concomitant releaseof the peptide without the N-terminal amino acid (Fig.1B). Next, the supernatant containing the detached peptidewas withdrawn, spiked with the internal standard (e.g. 50pmol of arginine) and then dried under vacuum to removethe solvent. The pellet was dissolved in 60 lL H2O and the

pH adjusted to pH 8 with 0.5M sodium borate pH 10. 20lL of this solution was added to 20 lL 3 mM Fmoc in ace-tone. After two minutes 20 lL of 40 mM 1-amino-adaman-tane in 3:1 acetone/ddH2O were added to quench theexcess of Fmoc. After two further minutes 140 lL of 0.5Msodium acetate pH 4 were added to the reaction mixture.This solution was analyzed on an HPLC system (BeckmanGold Nouveau, Germany) equipped with a RF-10A XL flu-orescence detector (Shimadzu, Japan). The C18 column(Reprosil-Pur 120 C18 AQ 5 lm, Trentec, Germany) wasdeveloped with a gradient of buffer A (4:1 50 mM sodiumacetate pH 4.2 / acetonitrile) and buffer B (acetonitrile).The column was equilibrated with 11% B at 1 mL/min.The peptides are eluted in a gradient of 9 min up to16.8% B. Then the column was regenerated with 100% Band brought again to the starting conditions of 11% B. Thepeptides eluted at about 15% B. The peptides weredetected by their fluorescence (excitation: 260 nm, emis-sion: 310 nm) and the peak areas were used for quantifica-tion. The recovery of the internal standard was usuallybetween 90 and 110% indicating that the pellet after TFA

Figure 1. Reaction scheme for the immobilization of the peptide. (A) The amino groups are introduced on the surface ofhydroxyapatite with the reagent 3-aminopropyltriethoxysilane (APTES) and are then reacted with p-phenylenediisothio-cyanate (DITC), followed by immobilization of the peptide via its N-terminal amino group. The hydroxyl groups of hy-droxyapatite are reactive and can be covalently modified with coupling reagents.16 (B) Selective detachment of the peptideGRGDS under relatively mild reaction conditions, i.e. 20 min trifluoroacetic acid (TFA). The shortened peptide RGDS canbe highly sensitively detected by HPLC.

BIOFUNCTIONALISATION OF DISPENSE-PLOTTED HYDROXYAPATITE SCAFFOLDS WITH PEPTIDES 495


removal was completely dissolved and that the Fmoc deri-vatization was successful.

Cell culture

ST-2 cells (Deutsche Sammlung fur Mikroorganismenund Zellkultur, Germany), a clonal stromal cell line iso-lated from bone marrow of BC8 mice,17 were cultured onfunctionalized and nonfunctionalized dispense-plotted HAscaffolds. Cells were maintained in RPMI 1640 medium(Gibco, Germany) containing 10 vol % FBS (fetal bovine se-rum, Sigma-Aldrich, Germany), 1 vol % penicillin/strepto-mycin (Sigma-Aldrich, Germany) and 1 vol % Glutamax(Gibco, Germany). For osteogenic stimulation the culturemedium was supplemented with 50 lg/mL ascorbic acid(Sigma-Aldrich, Germany), 100 nM dexamethasone(Sigma-Aldrich, Germany) and 10 mM b-glycerophosphate(Sigma-Aldrich, Germany). The scaffolds were seeded with540,000 ST-2 cells and incubated for 21 days by exchangingthe whole medium every 2–3 days. The amount of cellswas measured indirectly by determining the lactate dehy-drogenase (LDH) activity after cell lysis with a commer-cially available kit (Sigma-Aldrich, Germany). As weseeded the same amount of cells on the different scaffolds,the total amount of LDH activity reflects the prior prolifer-ation of the cells during the cultivation period. Cell viabil-ity was analyzed using the WST-1 test (Roche, Germany)with a working concentration of WST-1 of 15 lL/mL.

Cell differentiation parameters

For determining the differentiation stadium of the ST-2cells collagen I content and alkaline phosphatase (ALP)activity, which is an important marker for osteoblastic dif-

ferentiation, were analyzed. After lysing the cells, ALP-activity was determined colorimetrically using an ALP kit(Sigma-Aldrich, Germany). The specific activity was calcu-lated by taking the protein concentration of the lysates intoaccount. The protein content was quantified with anBCA assay (BCA, Sigma-Aldrich, Germany). Content ofcollagen I of the ST-2 cells was determined by Sirius Redsolution (Chroma, Germany). Samples and collagen stand-ards were dried, fixed with Bouins fluid (Sigma-Aldrich,Germany) and incubated with Sirius Red solution. Sodiumhydroxide (Merck, Germany) was used to dissolve thestained collagen. The resulting solution was measured at560 nm in an ELISA-reader (BMG, Germany), and the col-lagen I content was calculated using the standard curve.Furthermore, expression of genes for collagen I, osteocalcin(OC) and bone sialoprotein (BSP) were examined by RT-PCR. After RNA isolation (Master-Pure RNA PurificationKit, Biozym, Germany) reverse transcription was carriedout before polymerase chain reaction was done to amplifythe gene products (GoTaq Green MasterMix, Promega,Germany, for primers see Table I).

Cell morphology

Cell morphology was analyzed by SEM. Samples werefixed in 3 vol % paraformaldehyde (Merck, Germany), 3vol % glutaraldehyde (Sigma-Aldrich, Germany) and 0.2Msodiumcacodylate (Sigma-Aldrich, Germany). After dehy-dration through a series of graded acetone, the sampleswere critical point dried with CO2 (Parr Instrument Com-pany, Moline, USA), sputtered with gold (Cressington,UK) and analyzed.

Statistical analysis

Each experiment was repeated four times. The resultsare presented as mean 6 standard deviation of four repli-cates with the values for unmodified HA ceramic set as100%. The differences in analysis parameters betweenunmodified (2) and modified HA scaffolds (þ) were eval-uated by one-way analysis of variance (ANOVA). Thelevel of the statistical significance was defined at p < 0.05.

Figure 2. Principle of the rapid prototyping technique dis-pense-plotting for the fabrication of hydroxyapatite scaf-folds. A ceramic hydroxyapatite slurry is extruded by pres-surized air through a fine nozzle and deposited as rods bya certain lay-down-pattern on the building platform. Scaf-folds with interconnecting pores and defined pore and strutdiameter as well as porosity can be fabricated.

TABLE IPrimers for PCR

Name SequenceAnnealingTemp. [8C]

GAPDH fw: ACCACAGTCCATGCCATCAC 48rv: TCCACCACCCTGTTGCTGTA

coll. I fw: GAACGGTCCACGATTGCATG 48rv: GGCATGTTGCTAGGCACGAAG

OC fw: AAGCAGGAGGGCAATAAGG 55rv: CAGAGTTTGGCTTTAGGGC

BSP fw: ACCGGCCACGCTACTTTCTTT 44rv: GACCGCCAGCTCGTTTTCA

496 DETSCH ET AL.


RESULTS

Fabrication and characterization ofthe HA scaffolds

With the rapid prototyping technique dispense-plotting HA scaffolds with an interconnectingmacroporosity were fabricated. The rods of the sin-tered scaffolds had a diameter of 590 6 15 lm, thepore size was 205 6 12 lm. A total porosity of 44vol % was determined by helium pycnometry. Fromthese data a CAD model was designed and the totalsurface was calculated as 19.5 cm2.

Analysis of the surface by SEM showed very lowsurface roughness for the scaffolds prior to biofunc-tionalization due to the fabrication process by extru-sion. Functionalized scaffolds had a higher surfaceroughness resulting from the treatment with TFA inthe peptide immobilization process (Fig. 3). HA isknown to be soluble at low pH.18 The treatmentwith the acid leads to dissolution of single grains,which was also observed by Wan et al. at low pHvalues.19 Infrared spectroscopy of the scaffoldsshowed OH-groups on the surface. Quantificationwas not possible by this method.

Peptide immobilization

In the first step, reactive amino groups were intro-duced by treatment of the HA scaffolds with APTES(3-aminopropyltriethoxysilane). Next, the crosslinkerDITC (p-phenylenediisothiocyanate) was allowed toreact with the surface amino groups and the peptideto be immobilized was subsequently attachedthrough the crosslinker at the surface. The reactionconditions for the latter two steps were carefullyoptimized (data not shown).

To quantify the peptide immobilized on the sur-face, the scaffolds were treated with TFA which spe-cifically releases the peptide. The detached peptidereacted with Fmoc and could be quantified with highsensitivity using HPLC with fluorescence detection.The HPLC method allows to simultaneously quantifythe adsorbed and the covalently bound peptideon the surface of the HA scaffolds (Fig. 4A). The co-valently bound peptide loses its N-terminal aminoacid, but the adsorbed peptide remains chemicallyunchanged. For this reason, the method allows a cleardifferentiation between the adsorbed and the cova-lently attached peptide. The detection limit for the ad-hesion peptide RGDS (Polypeptide) is about 1 pmol

Figure 3. SEM images of dispense-plotted HA scaffold ceramic surfaces after sintering (A–C) and after biofunctionaliza-tion (D–F). The higher surface roughness for the biofunctionalized scaffolds is due to the TFA treatment (acidic milieu)during the process of peptide immobilization.



which allows us to reliably detect even minoramounts of peptides on the scaffolds (Fig. 4B).

Control experiments showed that covalentlyattached peptide is only detected when the completeimmobilization procedure was carried out. Withoutsilanization and without crosslinker only the ad-sorbed protein could be detected (Table II).

Replicate immobilizations at different days withdifferent batches of scaffolds under identical experi-mental conditions showed that the variationsbetween the samples were quite high (Table III). Themain reason for the variation could be the heteroge-neity of the scaffolds which might differ in theirsurface area and/or porosity.

As we wished to investigate the properties ofthe biofunctionalization in cell culture assays, thescaffolds needed to be sterilized. For this purposethe scaffolds were submersed into 70% ethanol for2 h. This treatment should not destroy the biofunc-tionalization, and indeed, we were able to detectthe covalently bound peptide after this treatment(Table III).

Finally, we tested whether the amount of immobi-lized peptide could be adjusted by modifying theimmobilization conditions. Therefore, we changedthe concentration of the adhesion peptide during theimmobilization procedure within the range of 20–500lM. We found a clear dependency between theamount of immobilized peptide and the concentra-tion (Fig. 5).

Figure 4. Quantification of the adhesion peptide on surfaces. (A) Shown are the traces of a sample and a peptide stand-ard. The adhesion peptide was immobilized onto hydroxyapatite scaffolds and selectively detached with TFA. The peptidesolution was then spiked with 50 pmol of the internal standard arginine (R) derivatized with Fmoc and analyzed on areverse-phase C18 column with fluorescence detection. The upper trace represents a sample (diluted 1:15) containing 220pmol of RGDS and 55 pmol of GRGDS. The shortened peptide RGDS had been covalently attached to the p-DITC moiety,whereas the unshortened peptide GRGDS is indicative for noncovalently bound, adsorbed peptide. The recovery of the in-ternal standard arginine was 108%. The lower trace is standard run with 3 pmol of RGDS and GRGDS and 7.5 pmol of in-ternal standard arginine. The inset shows the complete HPLC run. The column is regenerated after twelve minutes. (B)Standard curve for the detection of the peptide Fmoc-RGDS.

TABLE IIImmobilization of GRGDS on Hydroxyapatite Scaffolds

RGDS (pmol)Covalent

GRGDS (pmol)Adsorbed

Without DITC 11 440Without APTES 17 103Complete 610, 930 250, 450

In the two control reactions without DITC (2DITC) andwithout silanization (2APTES), only minor amounts of co-valently bound peptide could be detected. In contrast, inboth samples which underwent the complete immobiliza-tion procedure with 200 lM GRGDS peptide solution 610and 930 pmol were detected on the scaffolds. Adsorbedpeptide could be detected in all samples regardless of thetreatment.

TABLE IIIVariability and Stability of Immobilization

RGDS [pmol]Mean 6 SD Range

Number ofSamples

Complete 63 6 39 14–162 15Sterilized 111 6 76 46–196 3

Replicate measurements (n 5 15) showed a rather highamount of variation. Nevertheless, it appears that theimmobilization withstands a treatment with 70% ethanolfor two hours which is required to sterilize the samples forcell culture experiments.

498 DETSCH ET AL.


Cell culture experiments

ST-2 cells originate from a stromal bone marrowcell line and they can differentiate into, for example,osteoblast cells after an osteogenic stimulation.20 Thecontrol scaffolds were only treated with TFA toobtain the same surface roughness as the biofunc-tionalized scaffolds. The amount of cells measuredindirectly via LDH activity in ST-2 cells cultured onfour functionalized and nonfunctionalized scaffoldswas similar. The cell viability in cells on functional-ized scaffolds increased when compared with thenonfunctionalized ones. However, the increase wasnot significant (Fig. 6). Quantification of the synthe-

sized collagen I also showed no significant differencebetween cells cultured on non and on functionalizedscaffolds (Fig. 7). The osteoblastic differentiation, an-alyzed by ALP activity, was significantly higher incells cultivated on the biofunctionalized than on thenonfunctionalized scaffolds (Fig. 7).

The gene expression analyzed by RT-PCR showedpositive expression for collagen I, OC and BSP forall scaffolds (Fig. 8) and, consequently, the osteo-genic stimulation of bone marrow stromal cells waseffective.

Figure 5. Concentration dependence of immobilization.The immobilization of the adhesion peptide (GRGDS) wascarried out at different concentrations in the range from 20to 500 lM. The amount of immobilized peptide (RGDS)increased to about 700 pmol per scaffold.

Figure 6. LDH- and mitochondrial activity for functional-ized vs. nonfunctionalized scaffolds. ST-2 cells were cul-tured on dispense-plotted HA scaffolds without (2) andwith biofunctionalization (þ) for 21 days (n 5 4). Cellswere harvested and their LDH and mitochondrial activitydetermined. Shown are the activities relative to theunmodified hydroxyapatite scaffold along with the stand-ard deviation. No significant difference was measured.

Figure 7. Cell differentiation parameters for functional-ized vs. nonfunctionalized scaffolds. ST-2 cells were cul-tured on dispense-plotted HA scaffolds without (2) andwith (þ) biofunctionalization for 21 days (n 5 4). Cellswere harvested and their collagen I synthesis and ALP-ac-tivity determined. Shown are the activities and concentra-tions relative to the unmodified hydroxyapatite scaffoldalong with the standard deviation. Only the ALP-activitydiffers significantly (p < 0.05).

Figure 8. Transcription of genes involved in osteogenicdifferentiation for functionalized vs. nonfunctionalizedscaffolds. Cells were grown for 21 days on the unmodified(2) and biofunctionalized (þ) scaffolds (n 5 4). RNA wasprepared and amplified with gene specific primer pairs.Transcript abundance is comparable with both samples forthe tested genes as well as for the house-keeping geneGAPDH which served as control.



Important for a bone substitute is the osteoblasticphenotype expression of the cultured cells. As canbe seen on the SEM images in Figure 9, cells culti-vated on scaffolds without functionalization showeda more fibroblastic morphology whereas ST-2 cellson functionalized ones were more osteoblastic. Cellswere distributed homogenously throughout the scaf-folds.

Summarizing, the cell culture experiments indicatethat cells on the functionalized scaffolds are moredifferentiated.

DISCUSSION

Scaffolds for tissue engineering should be custom-made to the defect, utilizing materials tailored forartificial organs. Challenges in constructing bonescaffolds are the realization of an interconnectingporosity, a high total porosity, and the optimizationof pore sizes to enable vascularization. Such tailored3D-constructs can ideally be realized with rapid

prototyping techniques.21 Using those processes,polymeric, ceramic, and polymer/ceramic compositematerials can be manufactured. The rapid prototyp-ing technique dispense-plotting was investigatedand successfully applied in our work to producenovel 3D-scaffolds with fully interconnected porenetworks and highly controllable porosity and poresize. Furthermore, we showed that these bone mar-row stromal cells cultured on dispense-plotted HAscaffolds can be used for tissue engineering applica-tions.7 In this study, we used a bioreactor systemand observed an osteoblastic differentiation after 17days of dynamic cultivation.

The chemical modification of the surface of porousmaterials is a very common strategy for modulatingtheir properties and performance in the desiredconditions. Some advanced biomaterials also sup-port tissue formation by delivering growth factorsthrough drug delivery.22 Such agents can be ad-sorbed or covalently bound onto surfaces. Duringcultivation they are desorbed or released fromporous materials, dissolving polymeric carriers or

Figure 9. Morphology of the cultured bone marrow stromal cells for functionalized versus nonfunctionalized scaffolds.SEM images of ST-2 cells cultured on dispense-plotted HA scaffolds without (2) and with biofunctionalization (þ) aftercultivation for 21 days (n 5 4). Images were taken in the center of the scaffolds. Cells cultured on the biofunctionalizedscaffolds are clearly more spread out - indicative for a differentiation into osteoblast-like cells. In contrast, the morphologyof the cells on the control substrate is fibroblastic.

500 DETSCH ET AL.


ceramic granules. In this field adhesion peptides,growth factors or antibiotics are used to induce bio-logical reactions.23

In previous studies the effect of adhesion peptidesand serum proteins immobilized on HA have beenstudied with respect to cell adhesion and osteoin-duction. The studies used different peptides, differ-ent immobilization strategies and different cell lines.Durrieu et al. immobilized a linear and a cyclic ad-hesion peptide by silanization of HA and crosslink-ing with 3-succinimidyl-3-maleimido propionate.24

Changes of the XPS spectra indicated successfulimmobilization. However, a quantification of theamount of absorbed and covalently linked peptide isnot possible by this technique. Cell attachment experi-ments with human osteoprogenitor cells showed that,after 3 h, cells attached better to an HA surfacetreated with the cyclic adhesion peptide whereas after24 h, the linear peptide performed better. Altogetherthe study indicated improved cell adhesion to HAsurfaces modified with adhesion peptides.

A different peptide immobilization strategy wasused by Itoh et al.25 They used a synthetic peptideconsisting of seven consecutive glutamic acids fol-lowed by the adhesion motif RGD. The oligogluta-mic acid peptide has a high affinity to HA andanchors the complete peptide with the RGD motifonto the HA surface. The authors observed a concen-tration-dependent increase of cell attachment andalso a stimulation of alkaline phosphatase activity aswell as increased osteocalcin, osteopontin and bonesialoprotein expression. In addition, they could showan increase in mineralization with a murine osteo-blastic cell line.

Another study by Woo et al. showed that PLLA/HA scaffolds (poly-L-lactate) provide a more favor-able microenvironment for osteoblast survival be-cause they adsorbed more adhesion proteins andsuppressed apoptosis better than plain PLLA scaf-folds.26 Highest cell numbers were achieved forRGD adsorption.

Schneiders et al. impregnated collagen I/HA (col-lagen/HA) composites with phosphoserine andphosphoserine þ RGD and implanted these cylin-ders into the tibia of Wistar rats.27 After 7 days, theydetected a significantly higher number of TRAP-pos-itive osteoclasts for both impregnations but highestin the case of RGD. The amount of direct bonecontact after 28 days was significantly higheraround the impregnated implants compared to un-treated collagen/HA. Therefore, RGD-impregnationof implant-surfaces seems to enhance bone remodel-ing at the early stages of bone healing.

These and other studies unequivocally demon-strate a positive effect of the adhesion peptides oncell attachment on HA. However, an improved celladhesion may also be caused by serum proteins

which quickly adsorb onto HA surfaces. The serumproteins could be originated from cell culture mediaor from patients’ blood and, therefore, describe aphysiological relevant event which should be takeninto account.

As could be shown by Sawyer et al., adhesionpeptides and serum proteins promote cell adhesionof mesenchymal stem cells onto HA.28,29 Most inter-estingly, there was a synergistic effect of adhesionpeptides and serum proteins at a low peptide con-centration. The reason for the synergism is currentlyunresolved and, in contrast to these earlier findings,a more recent study of the same group30 questionsthe utility of the adhesion peptides. Serum proteinswill quickly adsorb onto HA once the implant isbrought into the body and the adhesion reactiontriggered by the serum proteins appears to be supe-rior to the reaction caused by adhesion peptides.Nevertheless, it is suggested that adhesion peptideshave a positive effect on cell adhesion and, conse-quently, also on osteoblast differentiation. Since inten-sive cell-cell contacts are necessary for differentia-tion31–33 cells need to adhere and proliferate at first inorder to come in contact. By accelerating cell adhesion(and thereby proliferation) by RGD-biofunctionaliza-tion a confluent cell layer may form in a shorter timespan, and therefore, differentiation can take placefaster. In addition, the effect of the adhesion peptideson cell adhesion and/or differentiation is not only celltype specific but also concentration dependant. Forthat reason, we consider it important to preciselyquantify the amount of peptide immobilization.

In this study, we used HA scaffolds with con-trolled pore size and pore geometry. By a novelimmobilization route, we covalently attached a shortadhesion peptide to the ceramic surface. Using ahighly sensitive fluorescence assay, we were able todetect the immobilization of the adhesion peptidedown to the picomolar range. Our scaffolds con-tained about 110 pmol of peptide.

These scaffolds were studied in cell culture assayswith bone marrow stromal cells. The ST-2 cell prolif-eration analysis showed no significant difference inmitochondrial activity and LDH-activity (Fig. 6). Onboth scaffold types the same cell number was seededand after 21 days of cultivation the LDH-measure-ment finally indicated the same growth velocity onHA scaffolds with and without biofunctionalization.This was notable since the RGDS peptides improvedthe cell adhesion and we, therefore, expected a fastercell growth.

For a functional bone implant the differentiationof stem cells into osteoblast cells is crucial. We ana-lyzed the differentiation of the cultured bone mar-row stromal cell line into osteoblast-precursor cells(Figs. 7 and 8). Typical osteogenic markers, like col-lagen I, osteocalcin, and bone sialoprotein were



expressed by ST-2 cells after 21 days of cultivationon both substrates. However, a significantly in-creased alkaline phosphatase activity was observedon the biofunctionalized scaffolds when comparedwith the unmodified ones. Additionally, osteoblasticdifferentiation through biofunctionalized scaffoldswas evident from the cell morphology (Fig. 9). Cellson unmodified scaffolds revealed a spindle-shapedmorphology. In contrast, cells on RGDS-modifiedscaffolds were more spreaded and their cell shapewas dramatically changed when compared with thecells on the unmodified surfaces. These results maycontradict our findings that the osteogenic markerscollagen I, osteocalcin, and bone sialoprotein areequally well-expressed in cells on both substrates.However, it is not unlikely that the osteogenicmarkers raised earlier on the biofunctionalized sub-strate. Unfortunately, the limited time resolution ofour expression analysis did not allow us to furtherinvestigate this point. Despite of that the bone mar-row stromal cells cultured for 21 days on the ceramicscaffolds with immobilized adhesion peptide clearlydisplayed an osteoblast-like morphology.

Our study confirms that RGD peptides, which areattached to HA ceramic surfaces, support favorableinteractions between syntheticmaterial and target cells.

CONCLUSION

The methods described in this communicationallow the production of HA scaffolds with a physio-logical relevant porosity bone substitution. We alsoreported the covalent immobilization of peptides,e.g. RGD-containing adhesion peptides and thequantification of this immobilization. In agreementwith other studies, we found that adhesion peptideson HA appear to promote cell differentiation. Thestromal bone marrow cells displayed a significantlyincreased alkaline phosphatase activity and their cellmorphology was osteogenic after 21 days of cultiva-tion. The methods described in this work might helpto improve HA as bone substitute by manufacturingindividual scaffolds with adjustable pore size andporosity with covalently bound peptides. The porousscaffold can support an ideal vascularization, whilethe biofunctionalization of the implant can introducefaster cell attachment and, therefore, a better boneingrowth.

References

1. Kokubo T, Matsushita T, Takadama H. Titania-based bioac-tive materials. J Eur Ceram Soc 2007;27:1553–1558.

2. Tadic D, Epple M. A thorough physicochemical characterisa-tion of 14 calcium phosphate-based bone substitution materialsin comparison to natural bone. Biomaterials 2004;25:987–994.

3. Benhayoune H, Jallot E, Laquerriere P, Balossier G, Bon-homme P, Frayssinet P. Integration of dense HA rods intocortical bone. Biomaterials 2000;21:235–242.

4. Davies JE. Bone Engineering. Hong Kong: Rainbow Graphicand Printing; 2000.

5. Karageorgiou V, Kaplan D. Porosity of 3D biomaterial scaf-folds and osteogenesis. Biomaterials 2005;26:5474–5491.

6. Detsch R, Deisinger U, Ziegler G. In vitro-studies of cellgrowth on synthetic porous hydroxyapatite ceramic scaffoldsfabricated by dispense-plotting. In: Proc 10th ECerS ConfGoller Verlag, Baden-Baden; 2007. p 1014–1018.

7. Detsch R, Uhl F, Deisinger U, Ziegler G. 3D-Cultivation ofbone marrow stromal cells on hydroxyapatite scaffolds fabri-cated by dispense-plotting and negative mould technique.J Mater Sci Mater Med 2008;19:1491–1496.

8. Chua P-H, Neoh K-G, Kang E-T, Wang W. Surface function-alization of titanium with hyaluronic acid/chitosan polyelec-trolyte multilayers and RGD for promoting osteoblast func-tions and inhibiting bacterial adhesion. Biomaterials 2008;29:1412–1421.

9. Hersel U, Dahmen C, Kessler H. RGD modified polymers:Biomaterials for stimulated cell adhesion and beyond. Bioma-terials 2003;24:4385–4415.

10. Ruoslahti E. RGD and other recognition sequences for integ-rins. Annu Rev Cell Dev Biol 1996;12:697–715.

11. Massia SP, Hubbell JA. An RGD spacing of 440 nm is suffi-cient for integrin alpha V beta 3-mediated fibroblast spread-ing and 140 nm for focal contact and stress fiber formation.J Cell Biol 1991;114:1089–1100.

12. Habraken WJEM, Wolke JGC, Jansen JA. Ceramic compositesas matrices and scaffolds for drug delivery in tissue engineer-ing. Adv Drug Deliv Rev 2007;59:234–248.

13. Mastrogiacomo M, Scaglione S, Martinetti R, Dolcini L,Beltrame F, Cancedda R, Quarto R. Role of scaffold internalstructure on in vivo bone formation in macroporouscalcium phosphate bioceramics. Biomaterials 2006;27:3230–3237.

14. Burg KJL, Porter S, Kellam JF. Biomaterial developments forbone tissue engineering. Biomaterials 2000;21:2347–2359.

15. Bjerre L, Bunger CE, Kassem M, Mygind T. Flow perfusionculture of human mesenchymal stem cells on silicate-substi-tuted tricalcium phosphate scaffolds. Biomaterials 2008;29:2616–2627.

16. Liu Q, de Wijn JR, de Groot K, van Blitterswijk CA. Surfacemodification of nano-apatite by grafting organic polymer.Biomaterials 1998;19:1067–1072.

17. DSMZ: Data on ST-2 cells. Available at: http://www.dsmz.de/human_and_animal_cell_lines/info.php?dsmz_nr5333&term5ST-2&highlight; 2004.

18. Koerten H, van der Meulen J. Degradation of calcium phos-phate ceramics. J Biomed Mater Res 1999;44:78–86.

19. Wan H, Lee J-K, Moursi A, Lannutti J. Ca/P ratio effects onthe degradation of hydroxyapatite in vitro. J Biomed MaterRes A 2003;67A:299–608.

20. Koike M, Shimokawa H, Kanno Z, Ohya K, Soma K; Effectsof mechanical strain on proliferation and differentiation ofbone marrow stromal cell line ST2. J Bone Miner Metab2005;23:219–225.

21. Tellis BC, Szivek JA, Bliss CL, Margolis DS, VaidyanathanRK, Calvert P. Trabecular scaffolds created using micro CTguided fused deposition modeling. Mater Sci Eng C2008;28:171–178.

22. Vallet-Regi M, Balas F, Colilla M, Manzano M. Bioceramicsand pharmaceuticals: A remarkable synergy. Solid State Sci2007;9:768–776.

23. Shen J-W, Wu T, Wang Q, Pan H-H. Molecular simulation ofprotein adsorption and desorption on hydroxyapatite surfa-ces. Biomaterials 2008;29:513–532.

502 DETSCH ET AL.


24. Durrieu MC, Pallu S, Guillemot F, Bareille R, Amedee J,Baquey CH, Labrugere C, Dard M. Grafting RGD containingpeptides onto hydroxyapatite to promote osteoblastic cellsadhesion. J Mater Sci Mater Med 2004;15:779–786.

25. Itoh D, Yoneda S, Kuroda S, Kondo H, Umezawa A, Ohya K,Ohyama T, Kasugai S. Enhancement of osteogenesis on hydroxy-apatite surface coated with synthetic peptide (EEEEEEEPRGDT)in vitro. J BiomedMater Res 2002;62:292–298.

26. Woo KM, Seo J, Zhang R, Mac PX. Suppression of apoptosisby enhanced protein adsorption on polymer/hydroxyapatitecomposite scaffolds. Biomaterials 2007;28:2622–2630.

27. Schneiders W, Reinstorf A, Pompe W, Grass R, Biewener A,Holch M, Zwipp H, Rammelt S. Effect of modification ofhydroxyapatite/collagen composites with sodium citrate,phosphoserine, phosphoserine/RGD-peptide and calciumcarbonate on bone remodelling. Bone 2007;40:1048–1059.

28. Sawyer AA, Weeks DM, Kelpke SS, McCracken MS, Bellis SL.The effect of the addition of a polyglutamate motif to RGD onpeptide tethering to hydroxyapatite and the promotion of mes-enchymal stem cell adhesion. Biomaterials 2005;26:7046–7056.

29. Sawyer AA, Hennessy KM, Bellis SL. Regulation of mesen-chymal stem cell attachment and spreading on hydroxy-apatite by RGD peptides and adsorbed serum proteins.Biomaterials 2005;26:1467–1475.

30. Sawyer AA, Hennessy KM, Bellis SL. The effect of adsorbedserum proteins, RGD and proteoglycan-binding peptides onthe adhesion of mesenchymal stem cells to hydroxyapatite.Biomaterials 2007;28:383–392.

31. Bjerre L, Bunger CE, Kassem M, Mygind T. Flow perfusionculture of human mesenchymal stem cells on silicate-substi-tuted tricalcium phosphate scaffolds. Biomaterials 2008;29:2616–2627.

32. Jager M, Feser T, Denck H, Krauspe R. Proliferation andosteogenic differentiation of mesenchymal stem cells culturedonto three different polymers in vitro. Ann Biomed Eng2005;33:1319–1332.

33. Schiller PC, D’Ippolito G, Balkan W, Roos BA, Howard GA.Gap-junctional communication is required for the matura-tion process of osteoblastic cells in culture. Bone 2001;28:362–369.



Documents

Biofunctionalization of dispense-plotted hydroxyapatite scaffolds with peptides: Quantification and cellular response