Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,

Balestrini et al

1

Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse

Model

Alessia Balestrini1, Laura Nicolas2, Katherine Yang-lott3,4, Olga A. Guryanova5,

Ross L. Levine5, Craig H. Bassing3,4, Jayanta Chaudhuri2, John H.J. Petrini1 *

1Molecular Biology Program, Sloan-Kettering Institute, New York, NY, USA

2 Immunology Program, Memorial Sloan Kettering Cancer Center, New York, NY, USA

3 Department of Pathology and Laboratory Medicine, Center for Childhood Cancer

Research, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania, PA

4 Abramson Family Cancer Research Institute, Department of Pathology and Laboratory

Medicine, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA

5 Human Oncology and Pathogenesis Program, Leukemia Service, Department of

Medicine, Memorial Sloan-Kettering Cancer Center, New York, NY, USA

*Corresponding author: John H. J. Petrini, Memorial Sloan-Kettering Cancer Center,

1275 York Avenue, New York, NY 10065. Phone: 212-639-2927, Fax: 646-422-2062,

Email: [email protected]

Keywords:

Mre11 complex, ATM, ATR, DNA repair, lymphomagenesys, common fragile sites, DDR

network

Conflict of Interest

The authors disclose no potential conflicts of interest

on January 7, 2020. © 2015 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 4, 2015; DOI: 10.1158/1541-7786.MCR-15-0281

http://mcr.aacrjournals.org/

Balestrini et al

2

ABSTRACT

The Mre11 complex (Mre11, Rad50 and Nbs1) occupies a central node of the DNA

damage response (DDR) network, and is required for ATM activation in response to

DNA damage. Hypomorphic alleles of MRE11 and NBS1 confer embryonic lethality in

ATM deficient mice, indicating that the complex exerts ATM independent functions that

are essential when ATM is absent. To delineate those functions, a conditional ATM

allele (ATMflox) was crossed to hypomorphic NBS1 mutants (Nbs1∆B/∆B mice). Nbs1∆B/∆B

Atm-/- hematopoietic cells derived by crossing to vavcre were viable in vivo. Nbs1∆B/∆B

Atm-/- VAV mice exhibited a pronounced defect in double strand break (DSB) repair, and

completely penetrant early onset lymphomagenesis. In addition to repair defects

observed, fragile site instability was noted, indicating that the Mre11 complex promotes

genome stability upon replication stress in vivo. The data suggest combined

influences of the Mre11 complex on DNA repair, as well as the responses to DNA

damage and DNA replication stress.

Implications: A novel mouse model was developed, by combining a vavcre inducible

ATM Knock-out mouse with a NBS1 hypomorphic mutation, to analyze ATM-

independent functions of the Mre11 complex in vivo. These data show that the DNA

repair, rather then DDR signaling functions of the complex are acutely required in the

context of ATM deficiency to suppress genome instability and lymphomagenesis.




Balestrini et al

3

INTRODUCTION

The maintenance of genome stability and suppression of malignancy depend on

the DNA damage response (DDR), a network of pathways comprising signal

transduction, cell cycle regulation, and DNA repair (1). The Mre11 complex, composed

of Mre11, Rad50 and Nbs1, plays a central role in the DDR. In addition to sensing DNA

double strand breaks (DSB) and promoting DNA repair, the complex is required for

Ataxia-telangiectasia mutated (ATM) kinase activation and signaling to govern DNA

damage checkpoints and apoptosis (2).

Ataxia-telangiectasia (A-T) and Nijmegen breakage syndrome (NBS) are two

distinct, but related single gene disorders caused by mutation in ATM and NBS1,

respectively. A-T and NBS patients share several clinical and cellular phenotypes

characterized by immunodeficiency, sterility, radiosensitivity and cancer predisposition

(3, 4). These phenotypic similarities highlight the functional relationship between the

Mre11 complex and ATM.

ATM and the Mre11 complex are involved in specialized DSB-repair mechanisms

including V(D)J recombination, class-switching (2, 3, 5). Most of the studies concerning

the role of the Mre11 complex in these processes rely on effects observed upon

deletion of one of its subunits (6) (7). However, it is conceivable that abnormal cell

cycle progression, proliferation and increased mortality consequent to Mre11 complex

ablation have impeded an appropriate characterization of its influence, as well as its

relationship with ATM, in the repair of physiological breaks.

Despite phenotypic similarities between the Mre11 complex and ATM mutants,

and the requirement for the Mre11 complex to activate ATM, several lines of evidence




Balestrini et al

4

indicate that the Mre11 complex exerts ATM independent functions. First, ATM null

mice are viable, whereas loss of any subunit of the Mre11 complex is lethal in cultured

cells and in vivo (4). Second, ATM deficiency is synthetically lethal with Mre11 complex

hypomorphic mutations (Nbs1∆B and Mre11ATLD1 ) (8-10). We consider two non-

exclusive possibilities for the embyronic lethality observed. First, reduction of

checkpoint functions ensuing from ATM deficiency may be lethal in combination with

DNA repair defects associated with Nbs1 hypomorphism. Second, the Mre11 complex

may influence ATM independent DDR signaling. In this scenario, a decrement in ATR

or DNAPKcs activation may be incompatible with the viability of ATM deficient embryos.

Recent data suggest that the Mre11 complex may influence the activation of ATR

(11, 12). These data predict roles for the Mre11 complex in the cellular response to

DNA replication stress, which is mediated predominantly by ATR, in addition to its role

in activating ATM in response to DNA damage (13, 14). However, the significance of

Mre11 complex-dependent regulation of ATR has not been assessed in vivo. Here we

crossed a conditional ATM mutant, ATMflox (15) with Nbs1∆B/∆B mice to circumvent the

synthetic embryonic lethality of Atm-/- Nbs1∆B/∆B double mutants, and create a context in

which the ATM independent functions of the Mre11 complex could be assessed in vivo.

We used a vavcre mouse (16) to ablate ATM in hematopoietic stem cells of

Nbs1∆B/∆B Atmflox/- mice. Nbs1∆B/∆B Atm-/- VAV mice exhibited defects in lymphoid

development, with impaired developmental progression during class switching (CSR),

reflective of a severe defect in DSB repair during CSR. Double mutant mice also

displayed increased spontaneous chromosomal instability and completely penetrant

lymphomagenesis by eight months of age. These data support the view that the DNA




Balestrini et al

5

repair functions of the Mre11 complex are acutely required in the absence of ATM.

Conversely, the DDR signaling phenotype of Nbs1∆B/∆B Atm-/- mice is not consistent with

the Mre11 complex exerting a strong influence on ATR activation in vivo. The data

suggest that synergy of Mre11 complex hypomorphism and ATM deficiency primarily

reflects the importance of the Mre11 complex as an effector of DNA repair.




Balestrini et al

6

EXPERIMENTAL PROCEDURES Mice

Animal use protocols were approved by the Institutional Animal Care and Use

Committee of Memorial Sloan-Kettering Cancer Center. ATMflox and vavcre mice were

obtained from F. Alt and M. Stadfeld, respectively. Nbs1ΔB mouse was described (8).

Mice were housed in ventilated rack caging in a pathogen-free facility and genotyped by

PCR (details upon request).

Cell purification and culture

Murine embryo fibroblasts (MEFs) were generated, cultured and immortalized as

described (41). SV40 immortalized Nbs1∆B/∆B Atm-/- MEFs were generated from

Nbs1∆B/∆B Atmflox/- mice by infection with cre-green fluorescent protein vector-based

lentivirus. Lentiviral production, concentration, and titering were carried out using

previously described methods (42, 43). 5 × 104 cells were resuspended in 3 mL of

DMEM supplemented with 10% CCS containing 5 μg/mL polybrene and cre-lentivirus at

a multiplicity of infection (m.o.i.) of 10 followed by clonal selection. Positive clones were

identified by PCR and suppression of ATM gene product expression was confirmed by

western blot. Atm-/- genotyping was carried out with the following primers:

ATMgF86723 (5’ ATCAAATGTAAAGGCGGCTTC 3’), and ATM BAC7 (5’

GCCCATCCCGTCCACAATATCTCTGC 3’). The 903 bp product corresponding to

ATM deletion was detected by agarose gel electophoresis.

Murine splenic B cells were isolated using CD43 Microbeads (Miltenyi Biotec) and

cultured at a density of 1 × 106 cells/ml in RPMI 1640 supplemented with 15% (v/v) FBS,




Balestrini et al

7

100 U/ml of penicillin, and 0.1 mg/ml of streptomycin, 1% (v/v) glutamine and 10 mM β-

mercaptoethanol. Stimulation for CSR was achieved with 1 μg/ml anti-CD40 antibody

(eBioscience) and 12.5 μg/ml IL-4 (R&D Systems).

Lymphocyte analyses and flow cytometry

Lymphocyte populations were analysed by flow cytometry in single cell suspensions

from thymus and bone marrow. Cells were depleted of red blood cells by hypotonic

lysis and maintained in PBS. Labelled antibodies specific for CD45R/B220

(phycoerythrin), IgM (FITC), CD43 (FITC), Cd11b (phycoerythrin), Gr-1 (FITC), TER119

(FITC), CD8a (FITC), CD4 (phycoerythrin) were from BD Biosciences PharMingen.

Dead cells were excluded by DAPI staining. The data were collected on an LSR-

Fortessa flow cytometer (Becton Dickinson) and were analysed with FlowJo software

(TreeStar).

For flow cytometric analyses of CSR, cells were resuspended in PBS with 2% BSA and

stained with APC-conjugated-anti-IgG1 antibody (X56, BD Pharmingen).

Cell proliferation by SNARF labelling was performed as described (44).

Germline transcripts were analysed as described (45).

For the analysis of switch junctions, genomic DNA was prepared from B cells stimulated

with αCD40/IL-4 for 72 h. Sμ-Sγ1 junction DNA was amplified by PCR (38 cycles) using

Sμ and Sγ1 primers (46). The PCR products, which spanned from 1–2 kb, were gel-

extracted, cloned, sequenced and analyzed as previously described (44).

Immuno-FISH was carried out as previously described (47).




Balestrini et al

8

FISH probes

We detected the 3′ end of the IgH locus using BAC199 and the 5′ end using BAC207 (a

gift of Fred Alt lab, Howard Hughes Medical Institute, The Children's Hospital, Boston).

BAC 97L3 and BAC 307011 that mark either side of the CFS were used for Fra8E1.

Chromosome analysis and fluorescence in situ hybridization (FISH).

Chromosome spreads preparation from splenocytes and SV40 immortalized MEFs were

performed as previously described (41). Briefly, cells were incubated in 50 ng/ml

colcemid (KaryoMAX, GIBCO), harvested, hypotonically swelled with 0.075 M KCl for

15 min at 37°C, fixed, washed in ice-cold 3:1 methanol:acetic acid, and dropped on

slides. Slides were stained with 5% Giemsa (Sigma) for 10 min and rinsed with distilled

water, and coverslips were mounted with Permount (Fisher). Images were captured

using an Olympus IX60 microscope and imaged with a Hammamatsu CCD camera.

More than 50 spreads were scored for each sample. Two-Color FISH was performed

as described (23).

Spectral karyotyping

Metaphases from thymic lymphomas were obtained as described (48). Spectral

karyotyping was performed per instructions (Applied Spectral Imaging, ASI). Slides

were examined with a BX61 microscope (600x magnification) from Olympus controlled

by a LAMBDA 10-B Smart Shutter (Sutter Instrument). Images were captured using a

LAMBDA LS light source (Sutter) and a COOL-1300QS camera (ASI), and analyzed by

Case Data Manager Version 5.5 (ASI).




Balestrini et al

9

Thymocyte apoptosis

Thymi were harvested in 10 ml of RPMI/3% FCS from 6- to 9-week-old animals, and

washed twice before plating. For each genotype and treatment, 1 × 106 thymocytes

were plated in triplicate in 1 ml of supplemented RPMI. 20 h after the mock or 5 Gy IR

treatments, cells were harvested for AnnexinV-FITC staining (BD Biosciences). Cells

were analyzed within 3 h after staining on a LSR-Fortessa flow cytometer (Becton

Dickinson) and were analysed with FlowJo software (TreeStar).

Immunoblotting

Western blots were carried out on 40 μg of protein extracted with NTEN (20 mM Tris at

pH 8, 150 mM NaCl, 1 mM EDTA, 0.5% NP-40) plus protease and phosphatase

inhibitors. All of the antibodies were incubated overnight at 4°C in 2% milk. The

antibodies used were rabbit anti-Rad50 polyclonal, rabbit anti-Nbs1 polyclonal, and

rabbit anti-Mre11 polyclonal previously described (49), ATM (Cell Signaling), RPA32

pSer4/Ser8 (Bethyl Laboratories), Chk1 (C9358, Sigma), Chk1 pSer345 (Cell

Signaling), AID (50)), GAPDH (6C5, Millipore) and Smc1 (Cell Signaling).

RESULTS

To define ATM independent functions of the Mre11 complex, we established Nbs1∆B/∆B

Atmflox/- double mutant mice. Cre-mediated deletion of the residual wild type ATM allele

(ATMflox) was effected in immortalized fibroblasts in vitro via infection with cre-encoding

lentivirus, and in vivo by vavcre, the expression of which is restricted to hematopoietic

stem cells (Fig. 1A and Supplementary Fig. 1A).




Balestrini et al

10

DNA-repair defects in Nbs1∆B/∆B Atm-/- double mutant cells

Although Nbs1∆B/∆B Atm-/- embryos were inviable (8), we determined that viable

Nbs1∆B/∆B Atm-/- MEFs could be obtained. Immortalized Nbs1∆B/∆B Atmflox/- fibroblasts

were infected with a cre-expressing lentivirus and plated for colony formation. From

approximately 80 colonies, seven Nbs1∆B/∆B Atm-/- colonies were obtained and their

DDR function(s) characterized.

The response to ionizing radiation (IR) was examined first. The growth

properties of double mutant MEFs precluded a conventional colony forming assay;

double mutants cells were essentially unable to form colonies even without IR, whereas

they were readily obtained in the Atm-/- single mutant (Supplementary Fig. 1B). This

phenotype was not due to a defect in cell growth since both single and double mutant

cells showed a comparable growth profile (data not shown).

As an alternative, we monitored the appearance and disappearance of nuclear

foci formed by single-strand DNA binding proteins RPA and Rad51 as an index of DNA

repair capacity (Fig. 1Bi, Bii and 1Biii, Biv). Following exposure to IR (4 Gy), RPA and

Rad51 foci persisted longer in Nbs1∆B/∆B Atm-/- clones than any other genotype. An

average of 70% of Nbs1∆B/∆B Atm-/- cells exhibited RPA nuclear foci 5 h after treatment,

with a 10% reduction observed in Atm-/- cells. 16 h post IR-treatment RPA foci were

present in virtually 100% of two independent double mutant clones whereas the RPA

signal was reduced to 20% in WT and Nbs1∆B/∆B, and 34% of Atm-/- cells (Fig. 1C). A

similar result was obtained for Rad51 foci (Fig. 1D). These data suggest that DSB

repair is markedly defective in Nbs1∆B/∆B Atm-/- double mutants relative to Atm-/- or

Nbs1∆B/∆B single mutants.




Balestrini et al

11

The Mre11 complex is essential for lymphocyte development in the absence of

ATM

Vavcre mediated deletion of the ATMflox allele in the bone marrow of Nbs1∆B/∆B

Atmflox/- mice was carried out to examine the phenotype of Nbs1∆B/∆B Atm-/- double

mutants in a physiological setting. The bone marrow was chosen for this analysis

because the Mre11 complex and ATM influence developmental stages that rely upon

chromosome rearrangements initiated by programmed induction of DSBs—V(D)J

recombination and immunoglobulin class switching (CSR) (17, 18).

The development of T and B cells was examined. Five week old double mutant

mice showed approximately ten fold reduction in the cellularity of the thymus compared

to Atm-/- VAV (Fig. 2Ai and Supplementary Fig. 2A). Flow cytometric analysis also

revealed significant alterations in the developmental distribution of Nbs1∆B/∆B Atm-/- VAV

thymocytes. The stages of T cell development can be differentiated by the individual

presence or coincidence of CD4 and CD8 surface receptors; double negative (DN) are

most primitive, double positive (DP) intermediate, single positive (SP), most mature. A

three fold accumulation in the percentage of DN cells (15%) was observed in Nbs1∆B/∆B

Atm-/- VAV thymus compared to Atm-/- VAV (6%). This result was accompanied by a

concomitant reduction in the percentage (average reduction of 1.2 fold) and the cell

number of DP thymocytes, while no variation in the percentage of SP cells was evident

(Fig. 2B and Supplementary Fig. 2A). These data suggest a temporal effect on T cell

development at the transition from the DN to DP stages.

ATM inhibition in Mre11ATLD1/ATLD1 lymphocytes leads to the accumulation of

unrepaired DSBs ends induced during V(D)J recombination (19). We reasoned that the




Balestrini et al

12

developmental delays observed may reflect an analogous block in V(D)J recombination

in both T and B lineages. Thymocytes were stained for CD25 and CD44 surface

markers to pinpoint the DN stage at which maturation defect occurs. DN T-cell

maturation is further subdivided into four stages of differentiation (DN1, DN2, DN3 and

DN4) based on CD44 and CD25 expression. At this early developmental stage the

progression through DN2 to DN4 depends upon successful V(D)J recombination events

(20). We found that ATM deletion led to an accumulation at the DN3 stage in Nbs1∆B/∆B

cells (39% versus 13 % of Atm-/- VAV) with a concomitant attrition of the DN4 population

(44% versus 80%, double versus single mutant, respectively) (21) (Fig. 2C).

Similarly, flow cytometric analysis of bone marrow revealed a lag in B cell

development at the transition from pro- to pre-B cells, a point at which immunoglobulin

gene rearrangement is initiated; a two fold reduction in the number of pre-B cells in

Nbs1∆B/∆B Atm-/- VAV was observed (Fig. 2D). In contrast, no variation in cellularity, or the

relative numbers of erythroid and myeloid cells was observed in any of the mutants Fig.

2Aii. and Supplementary Fig. 2B-C). These data suggest an additive effect of Nbs1∆B/∆B

Atm-/- VAV mutants in resolution of programmed DSBs.

CSR defects in Nbs1∆B/∆B Atm-/- VAV

To further examine the effect Nbs1∆B/∆B Atm-/- VAV on programmed gene

rearrangement, CSR was analyzed in double mutant splenocytes. B cells isolated from

WT, single and double mutant spleens were stimulated ex vivo with antisera recognizing

CD40 (αCD40) in the presence or absence of interleukin 4 (IL-4). Co-administration of

IL-4 induces CSR to IgG1 in this setting (22). Analysis of cell surface IgG1 was

monitored by FACS following stimulation with αCD40 and IL-4. WT splenocytes




Balestrini et al

13

exhibited 18.3% IgG1 positivity at four days post stimulation, compared to 13.5% of

Nbs1∆B/∆B splenocytes. In contrast, Atm-/- VAV and Nbs1∆B/∆B Atm-/- VAV cultures were

markedly CSR defective, exhibiting approximately 4.5% IgG1 positivity (Fig. 3A). These

differences were not attributable to variation in proliferation rates, apoptotic index, or to

defects in switch region transcription and AID induction (17) (Supplementary Fig. 3A-

3D).

To examine DSB rejoining directly, we performed a two-color FISH analysis with

probes specific for sequences upstream of the Igh variable domain (5’ Igh, labeled for

green signal), and sequences immediately downstream of the Igh constant region exons

(3’ Igh, labeled for red signal) (23). In this experiment, unbroken chromosomes 12

exhibit closely spaced green and red signals, whereas unresolved or improperly

resolved DSBs appear as separated green and red “split signals” (Fig. 3D i, ii, iii)

manifest in three outcomes: liberation of a small telomeric fragment (green in Fig. 3

Diii); translocation between chromosome 12 telomeric fragment (that contains the 5’ Igh

green probe) and another chromosome (Fig. 3 Dii); translocation of a centric

chromosome 12 (carrying the red signal) with another centric chromosome to form a

dicentric chromosome (red signal between two fused chromosomes in Fig. 3 Diii).

Whereas a split Igh signal was rarely detected in WT and AID-/- control B cells (less than

4%), split signals, indicative of IgH locus breaks, were observed in 49% of Nbs1∆B/∆B

Atm-/- VAV cells, a significantly higher level than Atm-/- VAV (23.7%) or Nbs1∆B/∆B (8.8%)

(Fig. 3B, 3C and Supplementary Fig. 3E).

This apparent defect in DSB rejoining was accompanied by increased usage of

microhomology at the residual switch region junctions that did form. The majority (15%)




Balestrini et al

14

of the junctions in the double mutant had microhomology length of ten nucleotides or

more, roughly two fold higher than all other genotypes (Fig. 3E and Supplementary Fig.

3F). These data clearly indicate an additive defect in the repair of DSBs induced to

initiate immunoglobulin class switch recombination in Nbs1∆B/∆B Atm-/- VAV mice.

Genomic instability in Nbs1∆B/∆B Atm-/- VAV mice

In addition to defects in rejoining DSBs during CSR, Nbs1∆B/∆B Atm-/- VAV cells

exhibited gross defects in the rejoining of spontaneous DSBs. Splenocytes stimulated

to proliferate with αCD40 exhibited pronounced karyotypic instability. 52% of Nbs1∆B/∆B

Atm-/- VAV exhibited chromosomal aberrations compared to 17% in the Atm-/- VAV single

mutant (Fig. 4A grey bars, Ai and B). A similar metaphase spreads pattern was also

observed in MEFs (Supplementary Fig. 4C). Co-administration of αCD40 and IL-4

further increased the number of aberrations observed in both single, as well as in

Nbs1∆B/∆B Atm-/- VAV double mutants (Fig. 4A black bars and Supplementary Fig. 4A).

In each genotype, the spectrum of spontaneous aberrations observed were

suggestive of defects in the response to DSBs arising during DNA replication, but their

abundance was markedly increased in Nbs1∆B/∆B Atm-/- VAV cells. The vast majority (over

90%) were either chromatid breaks and fragments or chromatid fusions and exchanges

(Fig. 4C and Supplementary Fig. 4B). Chromosome fragility was associated with a

three fold increased staining of 53BP1, a marker for DNA breaks, in double mutant cells

(7%) compared to single mutants (average of 2.2%) (Supplementary Fig. 4D).

Consistent with the gross level of instability observed karyotypically, 15% of Nbs1∆B/∆B

Atm-/- VAV cells exhibited micronuclei, indicative of cell division in the presence of broken

chromosomes (Fig. 4D). These data clearly indicate that ATM deficiency combined with




Balestrini et al

15

Mre11 complex hypomorphism results in severe DSB repair deficiency.

ATR function in Nbs1∆B/∆B Atm-/- VAV cells

An alternative, and non-exclusive interpretation for the phenotypic synergy

observed was based on potential role of the Mre11 complex in the activation of ATR (11,

12). In this scenario, the severity of the phenotype observed would reflect concomitant

impairment of both the ATM and ATR arms of the DDR network.

To address this possibility, we assessed aphidicolin- and CPT-induced

phosphorylation of Chk1 on Ser345, both of which depend on ATR (24). Use of ATR-45,

an ATR inhibitor (12) provided evidence that Chk1 phosphorylation was dependent on

ATR after aphidicolin- and CPT treatment (Fig. 5A and Supplementary Fig. 5A). In WT

cells, Chk1 phosphorylation was evident at 1 h and decreased 5 h after treatment.

Similar levels of Chk1-Ser345 signal were observed in Nbs1∆B/∆B and Atm-/- VAV cells.

However, a moderate but reproducible reduction in Ser345 phosphorylation was

detected in Nbs1∆B/∆B Atm-/- VAV (Fig. 5A-B). A second ATR-dependent phosphorylation,

RPA32 Ser4/Ser8 (25) was also compromised in Nbs1∆B/∆B Atm-/- VAV (Fig. 5B). The

modest reduction of Chk1 phosphorylation observed in the double mutants would

appear to argue against a primary role for the Mre11 complex in regulating ATR.

Further supporting this interpretation, we found that Atm-/- VAV and Nbs1∆B/∆B Atm-/- VAV

cells exhibited a comparable defect in the maintenance of the G2/M checkpoint, which

is governed cooperatively by ATM and ATR (Supplementary Fig. 5B) (26).

Aphidicolin treatment causes instability of common fragile site (CFS). The

frequency of that outcome is heavily dependent upon ATR and Chk1 (27, 28).

Therefore, we assessed CFS stability in Nbs1∆B/∆B Atm-/- VAV cells as an index of ATR




Balestrini et al

16

function. Fra8E1 (ortholog of human FRA16D (29)) was analyzed by a two-color FISH

assay analogous to that used for CSR (Fig. 3Ci) using DNA probes adjacent to the

Fra8E1 fragile site. Chromosome breakage was indicated by the appearance of

separated green and red signals (Fig. 5Ci and 5Cii). Breakage of Fra8E1 was elevated

relative to WT or Nbs1∆B/∆B in untreated cells; Atm-/- VAV, Nbs1∆B/∆B Atm-/- VAV and WT

cells treated with ATR inhibitor each exhibited approximately 10% breakage.

Aphidicolin treatment doubled the frequency of breakage in Nbs1∆B/∆B, Nbs1∆B/∆B Atm-/-

VAV and ATR inhibited WT cells, but had no effect on Atm-/- VAV, consistent with the view

that fragile site induction by aphidicolin is ATM independent (27) (Fig. 5C). Aphidicolin

induced breakage at other loci as well (Supplementary Fig. 5C). Collectively, these

data suggest that CFS stability is compromised in Nbs1∆B/∆B Atm-/- VAV cells. The

observation that aphidicolin induced fragile site breakage in Nbs1∆B/∆B suggests that the

Mre11 complex may also contribute to its stability in an ATM proficient setting. Our data

raise the possibility that the Mre11 complex-dependent protection of CFS is attributable

to a function independent on both ATM and ATR.

Highly penetrant lymphomagenesis in Nbs1∆B/∆B Atm-/- VAV mice

The high degree of spontaneous genomic instability in Nbs1∆B/∆B Atm-/- VAV

hematopoietic cells was correlated with increased risk of lymphomagenesis. Cohorts of

25 mice per each genotype were aged and monitored for malignancy. No malignancy

was observed in Nbs1∆B/∆B whereas 50% of the Atm-/- VAV cohort succumbed to thymic

lymphoma within 12 months. Lymphomagenesis was completely penetrant in Nbs1∆B/∆B

Atm-/- VAV mice, with tumors observed by six months of age in 91% of the mouse cohort

(Fig 6A). The increased risk of malignancy in Nbs1∆B/∆B Atm-/- VAV was not attributable




Balestrini et al

17

to a differential effect on apoptosis, as Atm-/- VAV and Nbs1∆B/∆B Atm-/- VAV thymocytes

exhibited comparable apoptotic defects (Fig. 6B)

Thymic lymphomas arising in Atm-/- VAV and Nbs1∆B/∆B Atm-/- VAV were

histologically similar (Supplementary Fig. 6), but spectral karyotype analysis (SKY)

revealed a highly complex genome rearrangements in Nbs1∆B/∆B Atm-/- VAV, many of

which were clonal in the tumor (Fig. 6C). This outcome is consistent with the

observation of gross chromosomal instability in Nbs1∆B/∆B Atm-/- VAV cells.




Balestrini et al

18

DISCUSSION

Hypomorphic mutations of the Mre11 complex confer embyronic lethality in the

context of ATM deficiency (8, 10). These observations indicate that in addition to being

required for ATM activation, the Mre11 complex specifies ATM independent functions.

That these functions are essential to embryonic viability suggests that the Mre11

complex normally mitigates pathologic outcomes of ATM deficiency.

In this study, we examined the ATM independent functions of the Mre11 complex

using a conditional allele of ATM (ATMflox) in combination with Nbs1∆B which models the

canonical Nbs1 allele inherited in Nijmegen Breakage Syndrome patients (8, 30).

Expression of cre in Nbs1∆B/∆B Atmflox/- MEFs revealed that viable Nbs1∆B/∆B Atm-/- cells

could be obtained in vitro. Nbs1∆B/∆B Atm-/- cells exhibited severe cellular phenotypes

such as impaired DNA repair, extensive chromosome instability and reduced activation

of ATR, the replication-stress checkpoint kinase. Ablation of ATM in hematopoietic

lineages in vivo was effected by crossing Nbs1∆B/∆B Atmflox/- mice to hematopoietic stem

cell specific vavcre mice. Hematopoietic cells were viable in the Nbs1∆B/∆B Atm-/-VAV mice,

but they exhibited pronounced defects in lymphoid development, impaired class

switching, and completely penetrant early onset lymphomagenesis.

Previous studies analyzing the relationship between ATM and the Mre11

complex have been carried out in cultured cells with siRNA or chemically mediated

suppression of Mre11 complex and ATM functions (31, 32). The mouse model

presented here allowed us to examine that relationship in vivo in the context of

hematopoietic development in a physiological context that also affords the opportunity

to assess tumor risk.




Balestrini et al

19

Collectively, the Nbs1∆B/∆B Atm-/- phenotypes appear primarily attributable to

defects in DSB repair. The severe defect in the joining of AID induced DSBs during

CSR strongly suggests that non-homologous end joining (NHEJ) is impaired in

Nbs1∆B/∆B Atm-/- VAV cells (Fig. 3D). Recent data regarding the influence of 53BP1 and

Rif1 on DSB resection suggest a possible mechanistic basis for this outcome. ATM-

dependent phosphorylation of 53BP1 induces the recruitment of Rif1 to DSBs and to

dysfunctional telomeres. This event likely underlies the inhibitory effect of 53BP1 on

DSB resection. Because resected DSB ends are poor substrates for NHEJ, inhibition of

resection by 53BP1 and Rif1 effectively promotes NHEJ (33). The effect of ATM

deficiency on CSR may partially reflect the failure to inhibit resection of AID-induced

DSBs. Similarly, the Mre11 complex has been implicated in promoting NHEJ at

dysfunctional telomeres (34), as well as in NHEJ during CSR and VDJ recombination

(Fig. 3A) (5, 7, 19, 35). Although in those contexts, defects in NHEJ-mediated rejoining

must at least partially reflect a decrement in ATM activation associated with Mre11

complex hypomorphism, the additive defects in Nbs1∆B/∆B Atm-/- cells reveal a direct

(i.e., ATM-independent) role for the Mre11 complex in NHEJ.

On the other hand, residual NHEJ functions are evident in Nbs1∆B/∆B Atm-/- cells

as indicated by the development of mature B and T cells, and the frequent occurrence

of radial structures which require NHEJ to form (Fig. 2, 4B and Supplementary Fig. 4C).

Because the Mre11 complex is involved in DSB repair mediated by homology directed

repair (HDR) (36), the coincident impairment of NHEJ and homologous recombination

(HR) in Nbs1∆B/∆B Atm-/- cells may also account for the phenotypic severity observed.

Following ionizing radiation treatment, persistent RPA and Rad51 nuclear foci (Fig. 1B




Balestrini et al

20

and C) are observed in Nbs1∆B/∆B Atm-/- compared to Atm-/-. As RPA and Rad51

assemblies are intermediates in the HR process, their persistence indicates that the

completion of HDR is impaired or delayed in double mutant cells. We propose that

combined defects in DSB repair DDR signaling associated with ATM deficiency

underlies the phenotype of Nbs1∆B∆B Atm-/- VAV mutants.

Defects in the response to replication stress were also evident in Nbs1∆B/∆B Atm-/-

VAV cells, as inferred from expression of common fragile sites induced by aphidicolin

treatment. The suppression of fragile sites instability is strongly dependent on ATR (27).

Consequently, the simplest explanation for this result is that ATR function is impaired in

Nbs1∆B/∆B Atm-/- VAV cells. However, the effect on Chk1 and RPA phosphorylation in

double mutants was extremely mild, arguing against altered ATR functions as the

underlying basis of CFS expression. Consequently, we favor the possibility that Nbs1

plays a more direct role in maintaining stability at common fragile sites, or that the

stability of CFS depends both on ATR and ATM in mouse cells.

While previous studies in in vitro and in culture cells suggest the existence of a

Nbs1-dependent ATR activation pathway (11, 12) (37), our data do not support the

interpretation that the Mre11 complex exerts a strong influence on ATR activity in ATM

proficient cells. In this regard, the use of an in vivo genetic system that allowed the

derivation of primary cells provided a sensitive setting for the assessment of the Mre1

complex influence on ATR activation. It is also conceivable that because the product of

the Nbs1∆B allele retains the RPA-interacting domain that appears to influence ATR

activation (11), the influence of the Mre11 complex on ATR may not be fully revealed in

Nbs1∆B/∆B cells.




Balestrini et al

21

The development of aggressive T- cell lymphoma in Nbs1∆B/∆B Atm-/- VAV mice

demonstrates that Nbs1 contributes substantially to suppressing the oncogenic potential

of ATM deficiency . Despite the fact that genome instability per se is not sufficient to

elicit the onset of lymphomagenesis in Mre11 complex hypomorphic mice, it is sufficient

to promote the penetrance of an initial mutation such as p53 heterozygosity (9). Indeed,

recent data have highlighted a role of the Mre11 complex acting as a barrier to

oncogene-driven breast tumorigenesis (38). We propose that the higher rate of genome

instability exhibited by double mutant cells, combined with reduced DDR signaling,

underlie the basis for the observed increase in tumor predisposition. Supporting the idea

that reduced ATR activity in Nbs1∆B/∆B Atm-/- VAV mice accelerates lymphomagenesis,

ATR+/- mice have been reported to show increase in tumor incidence (39). In addition,

we found that Nbs1∆B/∆B Atm-/- VAV cells show a synergistic increase in spontaneously

arising and CSR-associated chromosomal aberrations (Fig. 3B and 4A).

The development of an animal model in which the ATM independent functions of

the Mre11 complex can be analyzed offers a novel perspective for analyzing

relationships among the components of the DDR network. The profound defects

associated with coincident inhibition of the ATM and ATR arms of the DDR (40), support

the idea that the simultaneous inhibition of both DNA damage signaling protein kinases

could be exploited to improve the efficacy of clastogenic therapies.




Balestrini et al

22

ACKNOWLEDGMENTS

We are grateful to Fred Alt for ATMflox mice and genotyping, and Matthias Stadtfeld and

Thomas Graf for vavcre mice; Monica Gostissa and Ryan L. Ragland for reagents and

technical advice; and members of the Petrini laboratory and Thomas J. Kelly for

providing helpful comments and suggestions throughout the course of this study. This

work was supported by the Geoffrey Beene Center at MSKCC and NIH grant GM59413

to J.H.J.P., grants from the National Institutes of Health (1RO1AI072194) and the Starr

Cancer Research Foundation to J.C., Department of Pathology and Laboratory

Medicine of the Children's Hospital of Philadelphia Research Institute, a Leukemia and

Lymphoma Society Scholar Award, and the National Institutes of Health R01 Grants

CA125195 and CA136470 (C.H.B), NIH/NCI 1K99CA178191 to O.A.G., American-

Italian Cancer Foundation fellowship and EMBO fellowship (EMBO ALTF 43-2011) to

A.B.. R.L.L. is a Leukemia and Lymphoma Society Scholar.




Balestrini et al

23

REFERENCES

1. Ciccia A, Elledge SJ. The DNA damage response: making it safe to play with knives. Mol Cell. 2010;40:179-204. 2. Stracker TH, Petrini JH. The MRE11 complex: starting from the ends. Nature reviews Molecular cell biology. 2011;12:90-103. 3. Shiloh Y. ATM and related protein kinases: safeguarding genome integrity. Nat Rev Cancer. 2003;3:155-68. 4. Stracker TH, Theunissen JW, Morales M, Petrini JH. The Mre11 complex and the metabolism of chromosome breaks: the importance of communicating and holding things together. DNA repair. 2004;3:845-54. 5. Deriano L, Stracker TH, Baker A, Petrini JH, Roth DB. Roles for NBS1 in alternative nonhomologous end-joining of V(D)J recombination intermediates. Mol Cell. 2009;34:13-25. 6. Saidi A, Li TL, Weih F, Concannon P, Wang ZQ. Dual Functions of Nbs1 in the Repair of DNA Breaks and Proliferation Ensure Proper V(D)J Recombination and T-Cell Development. Mol Cell Biol. 2010;30:5572-81. 7. Reina-San-Martin B, Nussenzweig MC, Nussenzweig A, Difilippantonio S. Genomic instability, endoreduplication, and diminished Ig class-switch recombination in B cells lacking Nbs1. Proc Natl Acad Sci U S A. 2005;102:1590-5. 8. Williams BR, Mirzoeva OK, Morgan WF, Lin J, Dunnick W, Petrini JH. A murine model of Nijmegen breakage syndrome. Curr Biol. 2002;12:648-53. 9. Theunissen JW, Kaplan MI, Hunt PA, Williams BR, Ferguson DO, Alt FW, et al. Checkpoint failure and chromosomal instability without lymphomagenesis in Mre11(ATLD1/ATLD1) mice. Mol Cell. 2003;12:1511-23. 10. Morales M, Theunissen JW, Kim CF, Kitagawa R, Kastan MB, Petrini JH. The Rad50S allele promotes ATM-dependent DNA damage responses and suppresses ATM deficiency: implications for the Mre11 complex as a DNA damage sensor. Genes Dev. 2005;19:3043-54. 11. Shiotani B, Nguyen HD, Hakansson P, Marechal A, Tse A, Tahara H, et al. Two distinct modes of ATR activation orchestrated by Rad17 and Nbs1. Cell reports. 2013;3:1651-62. 12. Duursma AM, Driscoll R, Elias JE, Cimprich KA. A role for the MRN complex in ATR activation via TOPBP1 recruitment. Mol Cell. 2013;50:116-22. 13. Flynn RL, Zou L. ATR: a master conductor of cellular responses to DNA replication stress. Trends Biochem Sci. 2011;36:133-40. 14. Lopez-Contreras AJ, Fernandez-Capetillo O. The ATR barrier to replication-born DNA damage. DNA repair. 2010;9:1249-55. 15. Zha S, Sekiguchi J, Brush JW, Bassing CH, Alt FW. Complementary functions of ATM and H2AX in development and suppression of genomic instability. Proc Natl Acad Sci U S A. 2008;105:9302-6. 16. Stadtfeld M, Graf T. Assessing the role of hematopoietic plasticity for endothelial and hepatocyte development by non-invasive lineage tracing. Development. 2005;132:203-13. 17. Stavnezer J, Guikema JE, Schrader CE. Mechanism and regulation of class switch recombination. Annu Rev Immunol. 2008;26:261-92.




Balestrini et al

24

18. Revy P, Buck D, le Deist F, de Villartay JP. The repair of DNA damages/modifications during the maturation of the immune system: lessons from human primary immunodeficiency disorders and animal models. Adv Immunol. 2005;87:237-95. 19. Helmink BA, Bredemeyer AL, Lee BS, Huang CY, Sharma GG, Walker LM, et al. MRN complex function in the repair of chromosomal Rag-mediated DNA double-strand breaks. J Exp Med. 2009;206:669-79. 20. Fehling HJ, Krotkova A, Saint-Ruf C, von Boehmer H. Crucial role of the pre-T-cell receptor alpha gene in development of alpha beta but not gamma delta T cells. Nature. 1995;375:795-8. 21. Mombaerts P, Iacomini J, Johnson RS, Herrup K, Tonegawa S, Papaioannou VE. RAG-1-deficient mice have no mature B and T lymphocytes. Cell. 1992;68:869-77. 22. Gordon J, Millsum MJ, Guy GR, Ledbetter JA. Resting B lymphocytes can be triggered directly through the CDw40 (Bp50) antigen. A comparison with IL-4-mediated signaling. J Immunol. 1988;140:1425-30. 23. Franco S, Gostissa M, Zha S, Lombard DB, Murphy MM, Zarrin AA, et al. H2AX prevents DNA breaks from progressing to chromosome breaks and translocations. Mol Cell. 2006;21:201-14. 24. Liu Q, Guntuku S, Cui XS, Matsuoka S, Cortez D, Tamai K, et al. Chk1 is an essential kinase that is regulated by Atr and required for the G(2)/M DNA damage checkpoint. Genes Dev. 2000;14:1448-59. 25. Anantha RW, Vassin VM, Borowiec JA. Sequential and synergistic modification of human RPA stimulates chromosomal DNA repair. J Biol Chem. 2007;282:35910-23. 26. Brown EJ, Baltimore D. Essential and dispensable roles of ATR in cell cycle arrest and genome maintenance. Genes Dev. 2003;17:615-28. 27. Casper AM, Nghiem P, Arlt MF, Glover TW. ATR regulates fragile site stability. Cell. 2002;111:779-89. 28. Durkin SG, Arlt MF, Howlett NG, Glover TW. Depletion of CHK1, but not CHK2, induces chromosomal instability and breaks at common fragile sites. Oncogene. 2006;25:4381-8. 29. Krummel KA, Denison SR, Calhoun E, Phillips LA, Smith DI. The common fragile site FRA16D and its associated gene WWOX are highly conserved in the mouse at Fra8E1. Genes Chromosomes Cancer. 2002;34:154-67. 30. Varon R, Vissinga C, Platzer M, Cerosaletti KM, Chrzanowska KH, Saar K, et al. Nibrin, a novel DNA double-strand break repair protein, is mutated in Nijmegen breakage syndrome. Cell. 1998;93:467-76. 31. Xie A, Kwok A, Scully R. Role of mammalian Mre11 in classical and alternative nonhomologous end joining. Nature structural & molecular biology. 2009;16:814-8. 32. Rass E, Grabarz A, Plo I, Gautier J, Bertrand P, Lopez BS. Role of Mre11 in chromosomal nonhomologous end joining in mammalian cells. Nature structural & molecular biology. 2009;16:819-24. 33. Chapman JR, Barral P, Vannier JB, Borel V, Steger M, Tomas-Loba A, et al. RIF1 is essential for 53BP1-dependent nonhomologous end joining and suppression of DNA double-strand break resection. Mol Cell. 2013;49:858-71. 34. Deng Y, Guo X, Ferguson DO, Chang S. Multiple roles for MRE11 at uncapped telomeres. Nature. 2009;460:914-8.




Balestrini et al

25

35. Dinkelmann M, Spehalski E, Stoneham T, Buis J, Wu Y, Sekiguchi JM, et al. Multiple functions of MRN in end-joining pathways during isotype class switching. Nature structural & molecular biology. 2009;16:808-13. 36. Williams RS, Williams JS, Tainer JA. Mre11-Rad50-Nbs1 is a keystone complex connecting DNA repair machinery, double-strand break signaling, and the chromatin template. Biochem Cell Biol. 2007;85:509-20. 37. Stiff T, Reis C, Alderton GK, Woodbine L, O'Driscoll M, Jeggo PA. Nbs1 is required for ATR-dependent phosphorylation events. EMBO J. 2004. 38. Gupta GP, Vanness K, Barlas A, Manova-Todorova KO, Wen YH, Petrini JH. The Mre11 complex suppresses oncogene-driven breast tumorigenesis and metastasis. Mol Cell. 2013;52:353-65. 39. Brown EJ, Baltimore D. ATR disruption leads to chromosomal fragmentation and early embryonic lethality. Genes Dev. 2000;14:397-402. 40. Al-Ahmadie H, Iyer G, Hohl M, Asthana S, Inagaki A, Schultz N, et al. Synthetic Lethality in ATM-Deficient RAD50-Mutant Tumors Underlies Outlier Response to Cancer Therapy. Cancer discovery. 2014;4:1014-21. 41. Theunissen JW, Petrini JH. Methods for studying the cellular response to DNA damage: influence of the Mre11 complex on chromosome metabolism. Methods Enzymol. 2006;409:251-84. 42. Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, et al. A third-generation lentivirus vector with a conditional packaging system. J Virol. 1998;72:8463-71. 43. Lois C, Hong EJ, Pease S, Brown EJ, Baltimore D. Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors. Science. 2002;295:868-72. 44. Lee-Theilen M, Matthews AJ, Kelly D, Zheng S, Chaudhuri J. CtIP promotes microhomology-mediated alternative end joining during class-switch recombination. Nature structural & molecular biology. 2011;18:75-9. 45. Nowak U, Matthews AJ, Zheng S, Chaudhuri J. The splicing regulator PTBP2 interacts with the cytidine deaminase AID and promotes binding of AID to switch-region DNA. Nature immunology. 2011;12:160-6. 46. Ehrenstein MR, Rada C, Jones AM, Milstein C, Neuberger MS. Switch junction sequences in PMS2-deficient mice reveal a microhomology-mediated mechanism of Ig class switch recombination. Proc Natl Acad Sci U S A. 2001;98:14553-8. 47. Hasham MG, Snow KJ, Donghia NM, Branca JA, Lessard MD, Stavnezer J, et al. Activation-induced cytidine deaminase-initiated off-target DNA breaks are detected and resolved during S phase. J Immunol. 2012;189:2374-82. 48. Bassing CH, Suh H, Ferguson DO, Chua KF, Manis J, Eckersdorff M, et al. Histone H2AX: a dosage-dependent suppressor of oncogenic translocations and tumors. Cell. 2003;114:359-70. 49. Stracker TH, Couto SS, Cordon-Cardo C, Matos T, Petrini JH. Chk2 suppresses the oncogenic potential of DNA replication-associated DNA damage. Mol Cell. 2008;31:21-32. 50. Chaudhuri J, Tian M, Khuong C, Chua K, Pinaud E, Alt FW. Transcription-targeted DNA deamination by the AID antibody diversification enzyme. Nature. 2003;422:726-30.




Balestrini et al

26




Balestrini et al

27

FIGURE LEGENDS

Figure 1. The Mre11 complex functions to promote DNA repair independently of ATM

(A) Western blot of splenocyte lysates from the indicated genotypes. Membranes were

probed with antibodies for ATM, Nbs1, Mre11, Rad50 and Smc1 (loading control).

Analysis of WT, Nbs1∆B/∆B, Atm -/- and two Nbs1∆B/∆B Atm -/- clones (C1 and C2) repair

defect in SV40 immortalized MEFs.

(B) Representative RPA (biii and biv) and Rad51(bi and bii) immunofluorescence foci 16

h and 24 h after 4 Gy IR (left), respectively. Rad51 and RPA foci are green; DNA

counterstained with 4,6-diamidino-2-phenylindole (DAPI), is in blue. Bar graphs (graph)

represent percentage of RPA (C) and Rad51 (D) foci-positive cells (> 10 foci) at the

indicated times: 0 (mock), 4 and 16 h or 24 h following IR treatment, respectively. Error

bars represent standard deviation from three independent experiments. P values were

determined by unpaired t-test.

Figure 2. Developmental block at early stage of maturation in Nbs1∆B/∆B Atm -/-

lymphocytes

(A) Total number of cells in thymus (i) and bone marrow (ii) of the indicated genotypes.

Flow-cytometric analysis of haematopoietic tissues from 4 week-old mice.

(B) T cell populations were identified in thymus based on CD4 and CD8 markers.

Percentages of DN, DP, CD4, and CD8 single positive cells are reported.

Representative CD4 versus CD8 staining profiles of each genotype is shown, together

with the quadrant gates used to identify DN (CD4-, CD8-), DP (CD4+, CD8+), and SP

(CD4+, CD8- and CD4-, CD8+) thymocytes (bottom).




Balestrini et al

28

(C) Expression of CD25 and CD44 on DN thymocytes with the percentages of DN1–4

subsets (DN1, CD44+CD25-; DN2, CD44+CD25+; DN3, CD44-CD25+; and DN4, CD44-

CD25-).

(D) Absolute B cell numbers are shown for the different populations in the bone marrow

and gated as follow: proB (B220+, CD43+, IgM-), preB ( B220+, CD43-, IgM-), Immature

B (B220+, CD43-, IgM+) cells. In each graph (a-d) bars denote the average ± standard

error of mean (SEM), and p values were calculated using an unpaired t-test. Each

symbol represents one animal.

Figure 3. Persistent breaks in Nbs1∆B/∆B Atm -/- VAV B cells activated for class switch

recombination

(A) Quantification of IgG1 surface expression in WT, Nbs1∆B/∆B, Atm-/- VAV , Nbs1∆B/∆B Atm-

/- VAV, B cells stimulated for 4 days with αCD40 in the presence of IL-4. Error bars

indicate SEM, and p values were calculated using an unpaired t-test. Each symbol

represents one animal.

(B) Chromosome breakage in the IgH locus. Percentage of metaphases with split

signal for 3’IgH and 5’IgH BACs on the indicated B cell genotypes stimulated with

αCD40/IL-4 for 4 days. 60 metaphases were scored per genotype. Bars represent the

mean of 3 experiments and p values were calculated using an unpaired t-test.

(C) Bar graph depicting the percentage of metaphases with different type of aberrations

from αCD40/IL-4 stimulated B cells in (B). Error bars represent standard deviation from

three independent experiments and p values were calculated using an unpaired t-test.

(D) The representative examples show signal from an intact IgH locus (di) and IgH




Balestrini et al

29

associated aberrations in Nbs1∆B/∆B Atm-/- VAV: IgH rearrangement (dii), IgH break and

IgH fusion (diii).

(E) Genomic DNA was amplified by PCR, and Sµ/Sγ1 junctions were sequenced.

Percentage of sequences with indicated nucleotide (nt) overlap for Sμ and Sγ1 junctions

are indicated. Three mice of each genotype were analyzed. A two-tailed Fisher's exact

test was applied for analyses of microhomology length at switch junctions. The

difference in the percentage of junctions with blunt ends (0 nt) and microhomology of ≥

ten nucleotides was statistically significant between WT and Nbs1∆B/∆B Atm -/- VAV

(P=0.03), Nbs1∆B/∆B and Nbs1∆B/∆B Atm -/- VAV (P=0.006), Atm -/- VAV and Nbs1∆B/∆B Atm -/-

VAV (P=0.01).

Figure 4. Loss of ATM exacerbates the chromosome instability conferred by Nbs1∆B/∆B

(A) Genomic instability of primary splenocytes stimulated with αCD40 in the presence or

absence of IL-4 for 4 days. Shown is the average ±SD of at least three independent

experiments per genotype. > 50 metaphases were scored per genotype. The p value

was determined by two tailed t-test. Examples of chromosome instability from a

αCD40/IL-4 treated in Nbs1∆B/∆B Atm-/- VAV spread is shown: two combinations of radial-

fusion and exchanges are indicated (right).

(B) Percentages of normal (0) and aberrant metaphases (subdivided in two categories

of 1 to 3 or > 3 aberrations/metaphase) in the indicated B cell genotypes stimulated with

αCD40.

(C) Percentage of metaphases with different type of chromosome aberrations

spontaneously occurring in αCD40 stimulated B cells in (a). Error bars denote standard




Balestrini et al

30

deviation.

(D) Bar graph reporting the percentage of αCD40 stimulated B cells with micronuclei (a

representative image, with micronuclei indicated by arrows, is on the right). Values

plotted represent the mean percentage from three experimental replicates. Error bars

represent the SD of the replicate means and the p value was determined by two tailed t-

test.

Figure 5. Reduced ATR activation in Nbs1∆B/∆B Atm-/- VAV cells

Western blot of B cell lysates from the indicated genotypes. (A) Membranes were

probed with antibodies for ATM, Nbs1, Chk1 pSer345 and Chk1 at various times after

treatment with 2 µM of Aph. Showed is a representative image of three independent

experiments. Note that Chk1 phosphorylation gives rise to multiple forms of decreased

electrophoretic mobility (26). In (a) and (b) Chk1 phospho-specific band on the top is the

results of several bands grouped together. Reduction of Chk1 phosphorylation in,

Nbs1∆B/∆B Atm-/- VAV, is highlighted by the lower band. Total Chk1 was used as loading

control. ATR inhibitor (ATR-45) was used as control for Aph specific ATR activation.

(B) Western blot of splenocytes probed with ATM, Nbs1, Chk1 (loading control), Chk1

pSer345 and RPA2 pSer4/8 at the indicated times after treatment with 1.5 µM CPT.

Showed is a representative image of three experimental replicates.

(C) Percentage of metaphases with Fra8E1 expression. Fragile site expression was

induced by adding 0.6 µM Aph to αCD40 stimulated B cells 24 h before harvest.

Positive control for fragile site expression was achieved by treating cells with 0.1 µM

ATR inhibitor (ATRi). Split signal for proximal-Fra8E1 and distal-Fra8E1 BACs of the




Balestrini et al

31

indicated genotypes was used as index of chromosome gaps and breaks at the Fra8E1

CFS. Error bars represent the SD of the replicate means and the p value was

determined by an unpaired t-test. The representative examples show Fra8E1

associated aberrations in Aph-treated Nbs1∆B/∆B Atm -/- VAV cells with DAPI staining

(right) and FISH probe hybridization (left): Fra8E1rearrangements (i), Fra8E1 break (ii).

The inset in (ci) depicts a higher-magnification image of a co-localized green and red

signal obtained from an intact Fra8E1 locus.

Figure 6. Nbs1∆B/∆BAtm -/- VAV double mutant mice are predisposed to a more

aggressive lymphomagenesis.

(A) Kaplan-Meier survival curves of Atm -/-VAV (n=39), Nbs1∆B/∆BAtm -/- VAV (n=33), WT

and Nbs1∆B/∆B (n=50) mice. Mice survival was not assessed beyond 12 months, and

thus the events were censored at that age. P values were calculated using the two-

tailed log rank test, relative to the Nbs1∆B/∆B and Atm -/- VAV genotypes.

(B) Thymocytes from the indicated genotypes were mock treated or exposed to 5 Gy of

IR in culture and analyzed 20 h post-treatment. Viability ratios (= AnnexinV/PI double

negative % after mock treatment and 20h after 5 Gy, divided by the average percentage

of viability after mock treatment) are plotted for each genotype, and experiments were

performed in triplicate. The error bars denote standard deviation, and p values were

calculated using two-sided Wilcoxon rank sum test.

(C) Thymic lymphomas from Atm -/- VAV and Nbs1∆B/∆BAtm -/- VAV mice harboring clonal

translocations. Representative metaphase spreads of one lymphoma from both

genotypes, with DAPI staining, spectral karyotype (SKY) image of the metaphase




Balestrini et al

32

spread and translocations indicated. Summary of chromosome translocations in

lymphomas are reported on the table (right).






















Published OnlineFirst November 4, 2015.Mol Cancer Res Alessia Balestrini, Laura Nicolas, Katherine Yang-lott, et al. with a Novel Mouse ModelDefining ATM-independent Functions of the Mre11 Complex

Updated version

10.1158/1541-7786.MCR-15-0281doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2015/11/04/1541-7786.MCR-15-0281.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/early/2015/11/04/1541-7786.MCR-15-0281To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-15-0281

http://mcr.aacrjournals.org/content/suppl/2015/11/04/1541-7786.MCR-15-0281.DC1

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/early/2015/11/04/1541-7786.MCR-15-0281


Documents

Balestrini et al Defining ATM-independent Functions of the ... · Balestrini et al 1 Defining ATM-independent Functions of the Mre11 Complex with a Novel Mouse Model Alessia Balestrini1,