Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Arabidopsis thaliana cell suspension culture as a model system to
understand plant responses under phosphate stress
Fazilah Abd Manan
2012
School of Plant Biology
Faculty of Natural and Agricultural Sciences
The University of Western Australia
This thesis is presented for the degree of
Doctor of Philosophy of
The University of Western Australia
ii
ABSTRACT
The requirement of phosphate (Pi) in many biochemical processes means that a plant
experiences stress when available Pi is limiting. The Phosphate Starvation Response (PSR)
in plants helps avoid the stress brought on by Pi limitation. Molecular processes in plants
are controlled by three different genomes. Sub-sets of genes in the nuclear, mitochondria
and plastid genomes are coordinately expressed to sustain plant growth and development
either in normal or stress conditions. In mitochondria, oxidative phosphorylation makes an
essential contribution to plant energy status and is a Pi-requiring process that is limited by
low Pi availability. The impact of the PSR on the expression of genes encoded in the
mtDNA, especially those involved in oxidative phosphorylation, is unknown. A proteomics
approach was undertaken to search for nucleic acid-binding proteins from Arabidopsis
thaliana cells grown in culture to evaluate this system as a model to understand plant
mitochondrial responses to Pi limitation. As a result, glycine rich RNA binding protein
(GR-RBP5), endoribonuclease L-PSP, chaperonin 20, and malate dehydrogenase were
identified in Pi-depleted cells as proteins that co-purify with mitochondrial nucleic acids
during CsCl gradient centrifugation, an assay that was developed to identify mitochondrial
nucleic acid-binding proteins. Based on available microarray data, the abundance of
transcripts encoding these proteins does not respond to Pi availability. In the cell cultures,
as Pi became depleted, members of three Pi transporter (PHT) gene families were up-
regulated, including PHT1;1, PHT1;2, PHT1;4, PHT1;7,and PHT3;2, as occurs in plant
tissues. In addition, the accumulation of lactate indicated that Pi deficient cells might
switch toward fermentative pathways of metabolism instead of aerobic respiration. At the
same time, higher amounts of organic acids that are involved in citric acid cycle in Pi
limited cells suggested that these compounds were not utilised for aerobic respiration.
Nonetheless, the relative abundance of the detected metabolites was reversed when Pi was
re-supplied to the cells. With the addition of phosphite (Phi), cell responses towards Pi
depletion were altered, depending on internal Pi status. Cell growth and P allocation
patterns differed between Pi-fed and Pi-deprived cells. At the transcript level, the induction
of PHT1;1, PHT 1;8 and PHT1;9 during Pi deficiency was accelerated by Phi, suggesting
Phi exacerbates Pi deficiency. Metabolic pathways were severely inhibited when cells
depleted of Pi were treated with Phi. The metabolic changes seem to reverse the effect of Pi
limitation for Phi treated cells indicated by a huge decreased for most of the compounds
iii
detected by GC-MS. Fermentation that replaced normal respiration during low Pi was more
strongly inhibited by Phi. Taken together, cells alter their physiology in Pi and Phi stress.
Similarly, their molecular metabolisms including transcript abundance of the PHT gene
family members and the metabolite profiles were changed under these conditions. These
results confirmed that Arabidopsis cultured cells could be used to better understand higher
plants responses to Pi and Phi stress.
iv
DECLARATION
I declare that this thesis contains no material that has been previously presented for any
degree at any university or institution. The experiments and the writing of this thesis were
all carried out by myself (unless stated in the thesis) in consultation with my supervisors
Associate Professor Patrick Finnegan and Winthrop Professor Harvey Millar.
Fazilah Abd Manan
June 2012
v
ACKNOWLEDGEMENTS
First of all, I would like to thank my outstanding supervisors, Associate Professor Patrick
Finnegan and Winthrop Professor Harvey Millar for their excellent supervision during my
PhD journey.
I am grateful to be a recipient of Malaysian Government Scholarship to pursue my study at
the University of Western Australia. I also acknowledge UWA for the Adhoc top-up
scholarship and School of Plant Biology for the financial and administrative support during
my PhD study.
Thanks to Nicholas, Oliver, Matt, Adam, Shaobai, Ricarda Jost, Ricarda Fenske and Dave
for valuable discussions and suggestions related to this project. Thanks to all past and
present members of Pat’s and Harvey’s lab especially Yingjun, Hazel, Pharma, Wangxing,
Weihua, Khalil, Lei, Michelle, Alex, and Tiago for being good companions in the lab.
To all my best friends; Somcit, Ejen, Chai and Annisa, thank you for all your supports and
kindness. Great to have you guys here while I’m so far away from home! Special thanks to
my beloved family; my parents Abd Manan and Sapiah, my brothers and sister; Faizal,
Shahrin, Shahirah, and my aunty; Sapinah. Thank you for your endless love and supports!
vi
LIST OF ABBREVIATIONS
AOX Alternative oxidase
ATP Adenosine triphosphate
dsDNA Double stranded DNA
EXS Protein domain
GABA Gamma-aminobutyric acid
GRP Glycine rich protein
GR-RBP Glycine rich RNA binding protein
Hsp60 Heat shock protein 60
Ilv5 Isoleucine-plus-valine requiring protein
mtDNA Mitochondrial DNA
mtTFA Mitochondrial Transcription Factor A
mtTFB Mitochondrial Transcription Factor B
MYB63 Transcription Factor
mRBP Mitochondrial RNA-binding protein
NDH NAD(P)H dehydrogenase
Pi Phosphate
Phi Phosphite
PHO2 Ubiquitin conjugating E2 enzyme UBC24
PHR1 Phosphate Starvation Response 1
PSR Phosphate starvation response
ROS Reactive oxygen species
SIZ1 Small ubiquitin-like modifier (SUMO) E3 ligase
SPX Protein domain
ssDNA Single stranded DNA
UCP Uncoupling protein
WYKR75 Transcription Factor
ZAT6 Transcription Factor
vii
TABLE OF CONTENTS
Thesis title i
Thesis abstract ii
Declaration iv
Acknowledgements v
List of abbreviations vi
Table of contents vii
CHAPTER 1 General Introduction and Literature Review 1
General introduction 2
Literature review 5
References 22
CHAPTER 2 Identification of mitochondrial nucleic acid-binding proteins
from Arabidopsis thaliana cells grown in cultures 32
Abstract 33
Introduction 34
Results 36
Discussion 51
Materials and methods 56
References 62
CHAPTER 3 Arabidopsis thaliana cells in suspension cultures alter their
physiological, transcript and metabolite responses during phosphate
depletion and re-supply 67
Abstract 68
Introduction 69
Results 71
Discussion 88
Materials and methods 95
References 99
viii
CHAPTER 4 Arabidopsis thaliana cells in suspension cultures alter their
physiological, transcripts and metabolites responses under phosphite stress 105
Abstract 106
Introduction 107
Results 108
Discussion 124
Materials and methods 131
References 135
CHAPTER 5 General Discussion and Conclusion 139
Introduction 140
Summary of major findings 141
Limitations 147
Future work 149
Conclusion 150
References 151
APPENDICES 154
Appendix 1: List of primers for qRT –PCR 155
Appendix 2: List of compounds and their retention time determined
from AMDIS and ME 156
Appendix 3: Metabolite ratios for Pi-deficient and Pi-resupplied
cells from AMDIS analysis 160
Appendix 4: Metabolite ratios for Pi-deficient and Pi-resupplied
cells from ME analysis 161
Appendix 5: Metabolite ratios for Phi-treated and non-treated cells
from AMDIS analysis 163
Appendix 6: Metabolite ratios for Phi-treated and non-treated cells
from ME analysis 164
1
CHAPTER 1:
General Introduction and Literature Review
2
General Introduction
Phosphate (Pi) is a major nutrient that is often limiting for plant growth. Due to the
importance of Pi in various biochemical processes, as well as its function as the building
blocks for many compounds inside the cells, Pi deficiency leads to stress. To survive during
low Pi availability, plants responded by changing their morphology and cellular
metabolism. The development of cellular processes in plants is controlled by three different
genomes: nuclear, mitochondrial and plastid. The expression of the genes located in these
genomes needs to be co-ordinately regulated to ensure plant survival under all
circumstances. Abiotic stress certainly impacts on the expression of these genomes
although the mechanism is not well understood. Thus, there are still much to learn about the
mechanisms of interconnected responses by these genomes during stress.
The work presented in this thesis was initiated to test the hypothesis that the mitochondrial
genome will respond to Pi status through changes in gene expression, including those genes
encoded by mitochondrial DNA (mtDNA) and types of proteins that were associated with
it, and that the changes in gene expression in response to Pi status would be altered by the
Pi analogue phosphite (Phi).
All experiments were conducted using Arabidopsis thaliana (Arabidopsis) cell suspension
culture derived from the stem of accession Landsberg erecta (May and Leaver, 1993)
which I proposed as a model system to understand the mechanism of Pi-deficiency
responses in plants.
For nearly all eukaryotes, the production of ATP by mitochondria is crucial as ATP is a
major mobile source of energy to drive biochemical processes. Pi deficiency interrupts
processes that produce ATP including photosynthesis (Fredeen et al., 1990; Ghannoum and
Conroy, 2007) and respiration (Theodorou and Plaxton, 1993; Plaxton and Tran, 2011). The
disruption of ATP synthesis will lead to an energy crisis in the cells which may initiate
changes in mitochondrial biogenesis as part of the Pi deficiency response. However, not
much is known about the factors regulating mitochondrial biogenesis in plants under stress
or normal conditions. During Pi stress, mtDNA expression is likely to change, and these
3
changes may be co-ordinately regulated by the activity of proteins that directly bind
mtDNA. This includes transcription factors and other proteins such as malate
dehydrogenase, which has been reported before to bind mtDNA (M.C. Freeman and D.G
Muench, unpublished data). Since nearly nothing is known about the proteins that bind
nucleic acid in plant mitochondria, the first experimental chapter in this work focused on
identification of mtDNA-binding proteins from Arabidopsis thaliana cells grown in culture
(Chapter 2).
Most genes in plants are carried by the nuclear genome. It is well documented that Pi
deficiency alters nuclear gene expression. In this study, the assay for identifying mtDNA-
binding proteins was not robust enough to see if they changed with Pi deprivation. Thus, re-
focussed work on understanding the physiological and cellular changes that occur in
Arabidopsis cells as Pi status changes during the culture cycle were studied. The emphasis
was on the regulation of Pi transporter (PHT) gene expression, including Pi transporter
located on the mitochondrial membrane. A major part of this study was to determine the
dynamics of the P status in the cell culture system, and examine the kinetics of the Pi
transporter gene transcript accumulation, metabolic changes and the physiological state of
cells during Pi depletion (Chapter 3) and the responses of these processes to the Pi analogue
phosphite (Phi) (Chapter 4).
Previous studies have shown that many Pi starvation induced responses in Arabidopsis
plants are regulated at the transcriptional level (Hammond et al., 2004; Misson et al., 2005;
Morcuende et al., 2007). Among these transcriptional responses, plants increase the
capacity of Pi uptake by up-regulating the expression of PHT gene family members (Smith
et al., 1997; Smith, 2002). Signalling molecules are important to sense the amount of Pi
needed to trigger the starvation response, including the up-regulation of Pi transporter
genes. Knowledge on Pi sensing machinery is well described in yeast and bacteria (Oshima,
1997; Vershinina and Znamenskaya, 2002), but it is still unclear in plants. Several genes
involved in Pi homeostasis in plants were identified to date. Among them is PHO2 that
regulates Pi uptake, allocation and remobilisation (Dong et al., 1998), which is also a target
of miRNA399 (Bari et al., 2006; Lin and Chiou, 2008; Fang et al., 2009; Yang and
Finnegan, 2010). Changes at the transcript level concomitantly showed that changes in
4
metabolic processes might occur. In Chapter 3, these perspectives were investigated using
the Arabidopsis cell suspension cultures.
In Chapter 4, Phi was used as a tool to advance our understanding of plant responses to
changes in Pi status. Phi was selected as it is a Pi analog and is known to disrupt Pi
starvation responses to Pi deficiency (Carswell et al., 1997; McDonald et al., 2001;
Varadarajan et al., 2002). With quite extensive research that provide initial discoveries in
plant responses to Phi, I hypothesised that Phi would change plant cell responses at the
physiological, transcript and metabolic levels.
Specifically, the three main objectives covered by this research are:
To identify the mitochondrial nucleic acid-binding proteins from Arabidopsis
thaliana cell culture using an undirected approach (Chapter 2)
To profile the physiological and cellular responses of plants under Pi deprivation
and Pi resupply using an Arabidopsis thaliana cell culture system (Chapter 3)
To profile the physiological and cellular responses of plants as Pi status changes in
the presence of Phi using an Arabidopsis thaliana cell culture system (Chapter 4)
5
Literature review
Introduction
Phosphorus (P) is a major nutrient needed in the cell components such as nucleic acids and
phospholipids, and involved in the regulation of various physiological and biochemical
reactions. P deficiency has been a classic problem for plants. This is because Pi, the form of
P that can be taken up by plants readily forms complexes with other compounds in soil
(Raghothama and Karthikeyan, 2005). Pi is an indispensable substrate for ATP synthesis,
and is therefore required for photosynthesis in the plastid and oxidative phosphorylation in
the mitochondria, processes that need input from both the nuclear and respective organellar
genomes.
In soil, the concentration of P is usually less than 10 µM (Bieleski, 1973) while the
concentration in the plant cytoplasm is in mM range (Smith, 2002). Sequestration of Pi by
soil particles often leads to Pi deficiency in plants. Due to Pi deficiency, the activities
controlled by all genomes in plants will be altered and plants cellular metabolism will be
affected.
To date, substantial studies in various plant species related to Pi limitation have been
conducted. While information on physiological aspects is quite abundant, there are still
many questions on the molecular aspects of plant responses to Pi deprivation. The
integration of expression of genes from all three plant genomes in response to Pi deficiency
at the transcript level that is also integrated with metabolite level is not well understood.
In this chapter, I review our current knowledge on several plant adaptations to Pi
deficiency. Since mitochondria are an important site for ATP production, a process that
needs Pi, I start the discussion by introducing mitochondrial function in general, the
importance of coordinated expression between mitochondrial and nuclear genomes, and the
importance of mtDNA-binding proteins that mainly regulate mitochondrial genome
expression. This information is the background knowledge for the studies reported in
Chapter 2.
6
I further explore our current knowledge and the gaps that might be addressed on plant
responses towards Pi limitation. These responses are generally termed the Pi starvation
response (PSR). They includes plant sensing of Pi supply limitations, changes in plant
morphology, and the deployment of the biochemical adaptations used by plants to survive
under Pi limited conditions. The regulation of Pi-starvation responsive genes at the
transcript level and the existing metabolic profiles of plants under Pi stress, which basically
relate to Chapter 3, are discussed.
Finally, I review our current, very limited knowledge on the application of Phi to further
explore the response of plants to Pi limitation, which will be the basis for Chapter 4. Since
an Arabidopsis cell suspension culture system was used throughout the study, I close with a
discussion on the importance of cells grown in culture in plant research.
Phosphate deficiency in plants: A mitochondrial genome perspective
Mitochondria are essential organelles in land plants that are continually produced during
cell growth. Renowned as the powerhouse of the cells and present in almost all eukaryotes,
mitochondria play many important roles, regardless of the small percentage (only 1%) of
the total cell volume that they occupy.
A main function of mitochondria is to produce cellular adenosine triphosphate (ATP) by
coupling electron transport to ATP synthesis in the process of oxidative phosphorylation.
This process oxidises organic compounds available in the cell cytoplasm to produce carbon
dioxide through the tricarboxylic acid (TCA) cycle during cellular respiration (Mackenzie
and McIntosh, 1999). ATP is a major mobile energy source for living organisms that has Pi
as a main component. Several studies have previously shown that low Pi conditions
reduced ATP content (Mikulska et al., 1998) and respiration was affected by Pi deficiency
(Theodorou and Plaxton, 1993; Plaxton and Tran, 2011).
Plant mitochondria are also involved in several anabolic pathways, including the synthesis
of nucleotides, amino acids (Ravanel et al., 1998; Hell, 2002; Hesse et al., 2004), vitamins
(Bartoli et al., 2000; Rebeille et al., 2007), lipids (Gueguen, 2000), folate (Rebeille et al.,
7
2007) and biotin (Picciocchi et al., 2001). Besides that, mitochondria take part in nitrogen
assimilation (Lam et al., 1996) and iron homeostasis (Balk and Lobréaux, 2005), involved
in protection against viral or pathogen invasion (Murphy et al., 1999), also involved in
programmed cell death (Reape et al., 2008). During stress, any of these functions might be
affected.
While most of the proteins are encoded by plant nuclear genome, the mitochondrial
genomes encode a number of components of the electron transport chain, including
apocytochrome b of the cytochrome b/cl complex, subunits nadl to nad7 of the NADH-
ubiquinone oxidoreductase complex, three subunits (coxl, coxll, and coxIII) of the
cytochrome c oxidase complex and at least four subunits of the Fo-Fl ATP synthase
complex. The mitochondrial genome size of Arabidopsis thaliana is 367 kb. It encodes 33
proteins, three rRNAs (26S, 18S, and a 5S rRNA), and 20 tRNAs (Unseld et al., 1997).
Thus, coordinated expression of all genome is important for plants.
During stress, mitochondrial genome expression will change and disturb plant cellular
metabolism. Nevertheless, the factors that control mitochondrial genome expression under
normal and stress conditions are not fully understood. Under Pi limited conditions, plants
utilise an alternative respiration pathway, bypassing the steps that require P-containing
compounds (Duff et al., 1989; Nagano and Ashihara, 1993; Plaxton and Tran, 2011). This
pathway involves the function of alternative oxidase (AOX), which diverts electrons
directly from the ubiquinone pool, reducing oxygen to water. The diversion of electrons
from flowing through complex III and IV causes the release of free energy in the form of
heat (Vanlerberghe and McIntosh, 1997; Finnegan et al., 2004). This process does not
contribute to the proton gradient and thus reduces ATP production. The increased
abundance of AOX protein has been observed in Pi-deficient tobacco cell cultures (Parsons
et al., 1999).
Besides AOX, uncoupling protein (UCP) and alternative NADH dehydrogenase (NDH) are
components of the mitochondrial electron transport chain that are responsive to stress
(Clifton et al., 2005). Mitochondria typically produce reactive oxygen species (ROS) during
stress, causing oxidative damage to various molecules in plants (Apel and Hirt, 2004). The
8
level of ROS could be reduced by accumulation of compounds such as pyruvate, GABA
and proline that help plants to cope under stress condition (Bouché and Fromm, 2004).
Pyruvate accumulation (Juszczuk and Rychter, 2002), which stimulates AOX activity
(Millar et al., 1993) in respiration are important aspects of plant metabolic adaptations
under low Pi condition. Unlike sucrose starvation, which regulates mitochondrial
biogenesis by changes in nuclear gene expression that are coordinated at the post-
transcriptional level (Giege et al., 2005), the nuclear response to Pi starvation is regulated at
the transcriptional (Misson et al., 2005; Thibaud et al., 2010), also post-transcriptional level
which mediated by miRNAs (Bari et al., 2006; Chiou et al., 2006), and post-translational
level where the enzyme activity is mediated by PHO2 and SIZ1 (Bari et al., 2006; Miura et
al., 2005).
The mitochondrial gene expression might be regulated by mitochondrial nucleic acid-
binding proteins. mtDNA- binding proteins regulates mitochondrial functions in
replication, recombination, repair and transcription, while mtRNA-binding proteins might
involved in post-translational processes (Vermel et al., 2002; Kucej and Butow, 2007;
Glisovic et al., 2008). Although many nucleic acid-binding proteins have been found in
yeast, animals and plants, the nucleic acid-binding protein from plant mitochondria has not
well defined in terms of number, identity and function. In most organisms examined, more
than 25 proteins are bound to mtDNA to form mitochondrial nucleoids (Kucej and Butow,
2007). The nucleoid is the region of mitochondrion where DNA is confined.
In mammals, mtTFA and mtSSB are two mtDNA-binding proteins involved in
mitochondrial biogenesis, although their specific function under stress was not clear (Lee
and Wei, 2005). While information on mitochondrial nucleic acid-binding proteins
involved in stress responses is still lacking in plants, such proteins are known from yeast for
example Ilv5 and Hsp60 (Kucej et al., 2008). During amino acid starvation, Ilv5 is needed
for parsing mtDNA into nucleoids (MacAlpine et al., 2000) while Hsp60 is a heat shock
protein or proteases that engaged to nucleoids during glucose repression (Kucej et al.,
2008).
9
Some examples of proteins that interact with plant mitochondrial nucleic acids are proteins
from Vigna radiata (mung bean) that were demonstrated to have the ability to direct DNA
replication and RNA transcription in vitro (Dai et al., 2005), Isovaleryl-CoA in Pisum
sativum (pea) that is involved in cell metabolism and linked to gene expression (Daschner
et al., 2001; Daschner et al., 1999) and p63 protein bound to the cox2 promoter in Triticum
aestivum (wheat) which initiate the transcription process. Other than that, proteins
interacting with the promoter region of cox1 were found in Zea mays (maize) (Tarasenko et
al., 2005). Similarly, two proteins were identified to have affinity towards the atp9 gene
promoter sequence in pea (Hatzack et al., 1998) and three proteins were found interacting
with different sequence promoters representing different parts of Lupinus albus (lupin)
mitochondria (Lesniewicz et al., 2003). These examples indicate that mt-DNA binding
proteins play various roles in plants. Unfortunately, knowledge on the function of these
proteins in stress condition is largely unknown. To date, the Arabidopsis mRBP1, a family
of RNA recognition motif-containing GRP was found to be induced by cold treatment.
However, its actual function during stress is still unclear (Vermel et al., 2002).
With the aim to identify mitochondrial nucleic acid-binding proteins that are possibly
involved in the plant response to low Pi condition, an undirected, proteomics-based
approach of protein identification was conducted using Arabidopsis thaliana cell
suspension culture as a model system (Chapter 2).
Phosphate deficiency in plants: Morphological and biochemical perspectives
Phosphorus (P) is a macronutrient and one of the least bioavailable nutrients for plants.
Inorganic phosphate (Pi) is the form of P that can be taken up by plants (Ullricheberius et
al., 1981; Raghothama, 1999), but since Pi in soil is often bound to other elements, such as
Ca, Al and Fe, it is not fully accessible to plants. To overcome the problem of P shortages
in plants, P fertiliser has been widely used in agricultural fields. However, the amount used
needs to be appropriate as excess P leads to eutrophication issues that disturb ecosystems
(Carpenter, 2005).
10
Due to limited amount of Pi naturally, plants responded either by increasing the capacity of
Pi uptake or reusing any available P source. Root morphology will be changed during Pi
deficiency. The root growth is enhanced relative to shoot growth, resulting in an increased
root to shoot ratio (Raghothama, 1999). Root architecture is also altered, with more lateral
roots being formed rather than the primary roots (Lopez-Bucio et al., 2003). For some
species, such as lupinus albus, the formation of cluster roots helps the plant acquire Pi in
low P conditions (Lambers and Shane, 2007; Cheng et al., 2011).
One P saving strategy under P limitation is to re-translocate Pi from older leaves to younger
leaves (Jeschke et al., 1997). Some other P containing compounds such as nucleotides will
be metabolised and used as a source of P (Ticconi et al., 2001). Other than that,
phospholipids could be replaced by sulfolipids during Pi deficiency which preserve anionic
character of the membranes (Essigmann et al., 1998). To dissolve the Pi from P containing
compounds in the soil, plants will secrete organic acids (Shen et al., 2002; Lambers et al.,
2006) or enzymes such as ribonucleases and phosphatases (Duff et al., 1994; Green, 1994;
Raghothama, 1999; Vance et al., 2003). The symbiotic interaction of plant roots with
mychorrizal fungi is another strategy that helps plants to acquire Pi (Bolan, 1991).
At the transcript level, microarray techniques have been used to elucidate the differential
expression of various genes in different plant tissues at various stages of Pi-deficiency
(Hammond et al., 2004; Misson et al., 2005; Muller, 2006). With this high throughput
technology, large sets of genes that are differentially expressed under Pi limitation were
identified and classified based on their function. Indeed, many processes were altered under
Pi stress, including the genes involved in plant metabolic pathways, transport, signaling,
transcriptional regulation, growth and development, and stress responses (Misson et al.,
2005).
Plant Pi uptake is against a concentration gradient and involves a proton co-transport
mechanism (Ullricheberius et al., 1981). At the cellular level under Pi deficiency, the
capacity of Pi uptake is increased by up-regulation of Pi transporter (PHT) gene expression
(Raghothama and Karthikeyan, 2005). Arabidopsis has nine PHT1 gene family members,
encoding proteins that are located on the plasma membrane, three members of PHT3
11
encoding proteins that are located to mitochondria (Takabatake et al., 1999) and one PHT2
encoding protein that is located to plastid (Daram et al., 1999). PHT1 members served as
high affinity transporters (Karthikeyan et al., 2002; Mudge et al., 2002). The Km value in
micromolar range indicates that PHT1 family is a high affinity Pi transporter. PHT1;1
specifically has a Km value of 3.1 µM (Mitsukawa et al., 1997). PHT2 on the other hand is
a low affinity transporter with a Km for Pi of 394 µM (Daram et al., 1999; Versaw and
Harrison, 2002). A recent study has found six members of PHT4 in Arabidopsis with five
of them encoding proteins that are located to plastid and one located to Golgi apparatus.
The Km values for members of PHT4 ranged from 0.45 mM to 0.74 mM (Guo et al., 2008).
Genes encoding Pi transporters are down-regulated when the internal Pi concentration is
high due to sufficient external Pi, and vice versa (Smith et al., 2000). Table 1.1 shows the
description of the PHT gene family members in Arabidopsis, while Figure 1.1 shows the
localisation of the PHT transporters in Arabidopsis cells.
Table 1.1 Description of PHT gene family members in Arabidopsis thaliana
Gene
AGI
number
Protein
Localisation
Ref Expressed in
tissue
Ref
PHT1;1
At5g43350 Plasma
membrane
(Rausch and
Bucher, 2002)
(Knappe et al.,
2003)
(Takabatake et
al., 1999)
Axillary buds
Hydathodes
Leaf vascular
tissues
Root hair zone
Lateral root
Root cap/root
tip
(Mudge et al.,
2002)
(Karthikeyan
et al., 2002)
(Nussaume et
al., 2011)
PHT1;2
At5g43370 Plasma
membrane
(Rausch and
Bucher, 2002)
(Knappe et al.,
2003)
(Takabatake et
al., 1999)
Old primary
root
Root hair zone
Lateral root
(Mudge et al.,
2002)
(Nussaume et
al., 2011)
PHT1;3
At5g43360
Plasma
membrane
(Rausch and
Bucher, 2002)
(Knappe et al.,
2003)
Pollen/anthers
Hydathodes
Leaf vascular
tissues
(Mudge et al.,
2002)
(Winter et al.,
2007)
12
(Takabatake et
al., 1999)
Root hair zone
Lateral root
Root cap/root
tip
Old primary
root
(Nussaume et
al., 2011)
PHT1;4
At2g38940 Plasma
membrane
(Rausch and
Bucher, 2002)
(Knappe et al.,
2003)
(Takabatake et
al., 1999)
Silique
abscission zone
Pollen/anthers
Flower
abscission zone
Axillary buds
Hydathodes
Leaf vascular
tissues
Senescing
leaves
Old primary
root
Root hair zone
Lateral root
Root cap/root
tip
(Mudge et al.,
2002)
(Karthikeyan
et al., 2009)
(Winter et al.,
2007)
(Nussaume et
al., 2011)
PHT1;5
At2g32830 Plasma
membrane
(Rausch and
Bucher, 2002)
(Knappe et al.,
2003)
(Takabatake et
al., 1999)
Young floral
buds
Hydathodes
Leaf vascular
tissues
Root hair zone
Senescing
leaves
(Mudge et al.,
2002)
(Nagarajan et
al., 2011)
(Nussaume et
al., 2011)
PHT1;6
At5g43340 Plasma
membrane
(Rausch and
Bucher, 2002)
(Knappe et al.,
2003)
(Takabatake et
Pollen/ anthers
Young floral
buds
(Mudge et al.,
2002)
(Nussaume et
al., 2011)
13
al., 1999)
PHT1;7
At3g54700 Plasma
membrane
(Rausch and
Bucher, 2002)
(Knappe et al.,
2003)
(Takabatake et
al., 1999)
Pollen/ anthers
Hydathodes
Root hair zone
(Mudge et al.,
2002)
(Nussaume et
al., 2011)
PHT1;8
At1g20860 Plasma
membrane
(Rausch and
Bucher, 2002)
(Knappe et al.,
2003)
(Takabatake et
al., 1999)
Root hair zone
(Mudge et al.,
2002)
(Nussaume et
al., 2011)
PHT1;9
At1g76430 Plasma
membrane
(Rausch and
Bucher, 2002)
(Knappe et al.,
2003)
(Takabatake et
al., 1999)
Root hair zone
(Mudge et al.,
2002)
(Nussaume et
al., 2011)
PHT2
At3g26570 Plastid inner
envelope
(Rausch and
Bucher, 2002)
(Knappe et al.,
2003)
Green tissues
(Daram et al.,
1999)
PHT3;1 At5g14040 Mitochondrial
inner
membrane
(Rausch and
Bucher, 2002)
(Knappe et al.,
2003)
(Takabatake et
al., 1999)
PHT3;2
At3g48850 Mitochondrial
inner
membrane
(Rausch and
Bucher, 2002)
(Knappe et al.,
2003)
(Takabatake et
al., 1999)
Root
(Muller et al.,
2007)
(Morcuende
et al., 2007)
(Misson et
al., 2005)
PHT3;3
At2g17270 Mitochondrial
inner
membrane
(Rausch and
Bucher, 2002)
(Knappe et al.,
14
2003)
(Takabatake et
al., 1999)
PHT4;1 At2g29650 Plastid
envelope
(Ferro et al.,
2003)
(Roth et al.,
2004)
(Guo et al.,
2008)
Leaves
Roots
(Guo et al.,
2008)
PHT4;2 At2g38060 Plastid
envelope
(Emanuelsson et
al., 2000)
(Emanuelsson et
al., 1999)
Root
(Guo et al.,
2008)
PHT4;3 At3g46980 Plastid
envelope
Targeting
prediction
Leaves
Roots
(Guo et al.,
2008)
PHT4;4 At4g00370 Plastid
envelope
(Ferro et al.,
2003)
(Roth et al.,
2004)
Leaves
(Guo et al.,
2008)
PHT4;5 At5g20380 Plastid
envelope
(Guo et al.,
2008)
Leaves
Roots
(Guo et al.,
2008)
PHT4;6 At5g44370 Golgi (Guo et al.,
2008)
Leaves
Roots
(Guo et al.,
2008)
15
PHT1;1
PHT1;2
PHT1;3
PHT1;4
PHT1;5
PHT1;6
PHT1;7
PHT1;8
PHT1;9 PHT3;1
PHT3;2
PHT3;3
PHT4:6
Plasma
membrane
Figure 1.1 The localisation of Arabidopsis thaliana phosphate transporters in plant cells
During Pi deficient condition, the sensing machinery will detect the lack of Pi and plants
will start to give responses. A Pi sensor in plants has not been elucidated yet although there
has been a speculation that members of the PHT1 family might involve in Pi sensing and
the systemic regulation of Pi homeostasis in plants (Abel et al., 2002). A Pi sensing
mechanism was described previously in yeast and bacteria. The Pho81 and PhoR/PhoB in
yeast and E.coli, respectively, sense the Pi-deficient condition and regulate the expression
of genes involved in Pi uptake (Lenburg and O'Shea, 1996; Hsieh and Wanner, 2010).
In plants, several components were identified to be involved in the regulation of Pi
starvation. PHR1 gene is a transcription factor that is believed to control the induction of
miRNA399 and some other genes during low Pi. Other transcription factors found to have a
role in the plant response to Pi deficiency are WRKY75 (Devaiah et al., 2007), ZAT6
(Devaiah et al., 2007), and MYB62 (Devaiah et al., 2009). Other than that, it is known that
miRNA399 and PHO2 genes regulate Pi-starvation responses in Arabidopsis (Lin and
Chiou, 2008; Fang et al., 2009) with perhaps PHT1;8 and PHT1;9 are functioning
PHT2
PHT4;1
PHT4;2
PHT4;3
PHT4;4
PHT4;5
Golgi
Mitochondria Chloroplast
Nucleus
16
downstream of PHO2. This is because PHT1;8 and PHT1;9 genes were up-regulated in the
pho2 mutant roots (Aung et al., 2006; Kuo and Chiou, 2011). miRNAs are transcribed as
primary transcripts (pri-miRNAs), which fold into stem loop structures and processed to
form precursor (pre-miRNAs). Once the loop is detached, mature miRNA is formed (Leung
and Sharp 2010). During Pi limitation, non-biologically active primary transcript (pri-
miR399) was induced, correspond to its biologically active mature miRNA399 (Jones-
Rhoades and Bartel, 2004; Bari et al., 2006; Pant et al., 2008). The model of Pi signaling
pathway is presented in Figure 1.2 (Bari et al 2006).
Figure 1.2 A model for Pi signalling pathway (Adapted from Bari et al., 2006).
Changes at the transcript level might reflect changes in metabolic level. Obviously in
plants, the level of sugar was increased (Liu et al., 2005; Karthikeyan et al., 2007; Muller et
al., 2007) during Pi deficiency. It could be due to the lack of Pi to convert sugar to starch or
to mobilise sugar into phloem. This mechanism is actually beneficial to support the up-
regulation of Pi transporter genes expression. Quite recently, sucrose has been found to be
the regulator of Pi-deficient responses in plants (Lei et al., 2011).
17
Other than that, low level of organic acids were detected inside the cells of some Pi-
deficient plants. This was presumably because most organic acids were secreted out to
solubilise P from the environment (Uhde-Stone et al., 2003). Compounds that serve as
indicators of oxidative stress were also found to accumulate during Pi limited condition, for
example putrecine in rice suspension culture (Shih and Kao, 1996) and anthocyanin in
many plants including rice and Arabidopsis (Dobermann and Fairhust 2000; Jiang et al.,
2007). Unlike the expression of Pi-starvation responsive genes that were quite common in
many plants, the metabolic responses were quite different depending on plant species
(Ciereszko and Barbachowska, 2000; Morcuende et al., 2007; Muller et al., 2007; Huang et
al., 2008).
To date, many reviews are available on various aspects of Pi- deficiency in plants
summarising the extensive studies that have been carried out in this field (Rouached et al.
2010; Yang and Finnegan., 2010; Dong et al., 1999; Raghothama, 1999; Franco-Zorrilla et
al., 2004; Hammond et al., 2004; Fang et al., 2009). However, the kinetics of plant
responses during Pi depletion and Pi resupply are not fully understood. In this study, I have
looked into the transcripts response of the PHT genes, the primary miRNA399 and PHO2,
also on the abundance of aqueous metabolites detectable by GC-MS method using
Arabidopsis thaliana cell cultures as a model system (Chapter 3).
Phosphate deficiency in plants: The effects of phosphite as an analog of phosphate
Phosphite (Phi) is an analog of Pi and transported via Pi transporters (Griffith et al., 1989;
Guest and Grant, 1991). It is a reduced form of Pi, lacking one oxygen molecule (Figure
1.3) and widely used in agriculture as a fungicide to control Phytophthora, a group of
oomycete pathogens that cause plant dieback (Fenn and Coffey, 1984; Guest and Grant,
1991; Guera et al., 2000).
Besides being a fungicide, Phi has been claimed to be a source of P fertiliser (Lovatt and
Mikkelsen 2006). More recently, Young (2004) has come out with a Phi fertiliser patent.
Currently, many commercial Phi fertilisers can be found on the market. Most of the
18
manufacturers declared that Phi is good to combat pathogen, has the ability to replace Pi for
nutrient, and at the same time it is environmentally friendly.
Nonetheless, the use of Phi as fertiliser has been a controversial issue (Rickard, 2000). It
has been rejected as a fertiliser because plants have no capacity to metabolise Phi without
the presence of bacteria (Ohtake et al., 1996; Barrett et al., 2004). Even though the
oxidation of Phi to Pi occurs in soil by soil bacteria, it happens in a very slow rate
(McDonald et al., 2001; Thao and Yamakawa, 2009).
Since Phi is used to control plant dieback, the toxic effects of Phi have been more
elucidated in Phytophthora than in plants. Following Phi application, the mycelial growth
of P.cinnamomi was inhibited (King et al., 2010). Other than that, Phi also triggers plant
respond by producing stress signalling compounds to enhance their defence mechanism
against pathogen (Guest and Grant, 1991; Daniel and Guest, 2005). For instance, cells of
Arabidopsis plants infected by Phytophthora and treated with Phi has form cytoplasmic
aggregates, increase superoxide production, increase localised cell death and accumulate
phenolic compounds (Daniel and Guest, 2005). One of the sites of Phi action in
Phytophthora is phosphorus metabolism. The level of pyrophosphate increased (Niere et al.,
1990; Niere et al., 1994), while adenylate and phosphorylated nucleotide production were
affected (Griffith et al., 1990; Barchietto et al., 1992).
To date, many evidences have shown that Phi actually does not contribute to crop
improvement, but rather, brings deteriorating effects to plants (Abel et al., 2002; Carswell
et al., 1996; Forster et al., 1998; Schroetter et al., 2006). As early as 1950s, Macintire found
that plant growth was impaired during the first year of Phi application (Macintire et al.,
1950). This is supported with more recent findings that show that Phi does not support the
growth of plants (Thao and Yamakawa 2010; Thao et al., 2008; Ratjen and Gerendas, 2009;
Thao et al., 2009). With these arguments, reviews about pros and cons of Phi application to
plants have been published (McDonald et al., 2001; Thao and Yamakawa, 2009; Lovatt and
Mikkelsen 2006).
19
Figure 1.3 Oxidation of Phi to Pi
From the molecular aspect, instead of replacing the need for Pi, Phi mimics Pi. Thus, plants
behaved as if they had enough Pi despite remained in Pi deficient condition (Carswell et al.,
1997). This is a big concern as Phi will inhibit plant adaptation to low Pi conditions
(Carswell et al., 1997; McDonald et al., 2001; Ticconi et al., 2001; Varadarajan et al., 2002;
Bozzo et al., 2004). Initial discovery have shown that relatively low Phi concentrations are
phytotoxic to Pi deprived plant. This is because Phi blocks the upregulation of enzymes and
high affinity Pi transporters characteristic of plant PSR (Carswell et al., 1996; Carswell et
al., 1997). This has lead to more studies being conducted using Phi as a tool to dissect plant
molecular and biochemical responses to Pi starvation. Later, more findings have shown that
the effect of Phi is clear in Pi-starved, but not Pi-sufficient plants (Thao and Yamakawa,
2009). Ticconi et al 2001 demonstrated the inability of Arabidopsis to discriminate between
Phi and Pi in suppressing common responses to Pi limitation, for example in the production
of anthocyanin, changes in roots architecture, the expression of nucleolytic enzymes and
transcripts of Pi-starvation inducible genes (Ticconi et al., 2001). Similarly, Pi-starved
Brassica nigra seedlings treated with Phi had reduced fresh weight, decreased root to shoot
ratio and decreased of intracellular Pi (Carswell et al., 1996). This is in agreement with the
findings from Pi starved tomato and Arabidopsis, where Pi starvation induced genes such as
several high affinity Pi transporters, a novel acid phosphatase and purple acid phosphatase,
were also suppressed by Phi (Varadarajan et al., 2002).
At the protein level, the induction of serine proteases upon Pi or Phi addition to –Pi tomato
cells caused the degradation of Pi-starvation inducible extracellular proteins (Bozzo et al.,
2004). Other enzymes such as phosphoenolpyruvate phosphatases and inorganic
Phosphite Phosphate
20
pyrophosphate-dependent phosphofructokinase induction were also reduced in Pi-limited
Brassica nigra seedlings treated with Phi (Carswell et al., 1996). In addition, Phi markedly
alters in vivo protein phosphorylation in Pi starved Brassica napus suspension cell cultures
(Carswell et al 1997).
Study in Brassica napus suspension cells have also shown the reduction of growth, Pi
content, acid phosphatase, pyrophosphate (PPi)-dependent phosphofructokinase and high
affinity translocator in Pi-starved cells treated with Phi (Carswell et al., 1997). The
deteriorating effects of Phi were also observed in organism such as yeast (McDonald et al.,
2001) and Chlorophyta ulvales (Lee et al., 2005). In yeast, although low Phi did not
influence respiration process, Phi presence in higher amounts inhibited certain enzymes
such as 3-phosphoglyceraldehyde dehydrogenase (Stehmann and Grant, 2000). The use of a
pho84 mutant which is unresponsive to Phi proved that PHO84 is the target for Phi action
in yeast (McDonald et al., 2001).
These examples have shown that Phi primary site of action in higher plants is at the signal
transduction level and Phi specifically interrupts processes involved in regulation of Pi
starvation responses. As Phi is non-metabolised by plants, it will persist in the tissues.
Thus, plants will continuously get the negative effects from Phi and finally cause cell’s
death (Singh et al., 2003).
Taken together, most of the available Phi studies are based on the physiological impact of
Phi towards plant growth and development. Although increasing research is conducted in
this area, a lot more information is needed especially in plant responses to Phi treatment at
the molecular and gene expression levels. Chapter 4 in this thesis describes the kinetics of
the responses of Arabidopsis cell cultures treated with Phi under +P and –P conditions.
Arabidopsis thaliana cell suspension culture
Arabidopsis thaliana has been widely used to study diverse aspects of plant physiology and
molecular biology. Given its many advantages over other plant species, Arabidopsis has
been adopted as a ‘model’ in studies related to plants. A cell culture derived from
21
Arabidopsis has been available for many years (May and Leaver, 1993). It has added value
to Arabidopsis research due to the advantages of cell suspension culture over plants. Cell
suspension cultures provide a homogenous and uniform system, unlike real plant that is
complex with many tissues and compartments. In this simple system, cells in suspension
divide rapidly and the growth conditions can be easily manipulated, hence very convenient
for molecular research.
Suspension cell cultures have been quite well established as an excellent model system to
study molecular and biochemical aspects of the Arabidopsis PSR (Veljanovski et al., 2006;
Tran and Plaxton., 2008; Gregory et al., 1990; Tran et al., 2010). In fact, suspension cell
cultures from other plants have been widely used for at least for the past 25 years for
detailed studies of plant PSR, including cell cultures of Catharanthus roseus (Nagano and
Ashihara 1993), Lycopersicon esculentum (tomato) (Bozzo et al., 2004; Bozzo et al.,2006)
and the closely related crucifers to Arabidopsis such as Brassica nigra (Duff et al., 1989)
and Brassica napus (Moraes and Plaxton 2000).
In my research, Arabidopsis cell suspension culture was proposed as a good model system
to study plant adaptations towards low Pi conditions, avoiding the challenge from the
complexity of Pi distribution to the various tissues in real plants. Arabidopsis has available
full genome and transcript sequences, which allows the identification of proteins from mass
spectrometry data and to design primers for quantitative real time PCR in this study. Many
databases on Arabidopsis are also available, thus basic research involving Arabidopsis
greatly aides the area of plant molecular and genetics. The external Pi concentration can be
easily controlled to suit experimental requirements and Phi can be added into the system to
better understand Pi-starvation effects on the cells. Finally, the results may be useful in
understanding the mechanisms of Pi-deficient responses in the more intricate plant system
because research findings obtained in Arabidopsis are often transferable to other plant
species.
Despite the rapid growing knowledge on plant adaptations towards Pi-deficiency, there are
still many gaps in the underlying molecular mechanisms that need to be filled. The majority
of information that is available is more on the physiological responses rather than the
22
molecular mechanisms underlying the physiology. Understanding the fundametal
mechanisms of Pi-starvation responses and the metabolic changes that occur under Pi
limitation is very valuable not only to gain new insights into plant adaptation to stress, but
also serves as a step stone to plan for better crop management in the future.
References
Abel S, Ticconi CA, Delatorre CA (2002) Phosphate sensing in higher plants. Physiologia
Plantarum 115: 1-8
Apel K, Hirt H (2004) Reactive oxygen species: Metabolism, oxidative stress, and signal
transduction. Annual Review of Plant Biology 55: 373-399
Aung K, Lin S-I, Wu C-C, Huang Y-T, Su C-L, Chiou T-J (2006) pho2, a phosphate
overaccumulator, is caused by a nonsense mutation in a MicroRNA399 target gene.
Plant Physiology 141: 1000-1011
Balk J, Lobréaux S (2005) Biogenesis of iron-sulfur proteins in plants. Trends in Plant
Science 10: 324-331
Barchietto T, Saindrenan P, Bompeix G (1992) Physiological responses of Phytophthora
citrophthora to a subinhibitory concentration of phosphonate. Pesticide
Biochemistry and Physiology 42: 151-166
Bari R., Pant B.D., Stitt M. & Scheible W.-R. (2006) PHO2, microRNA399, and PHR1
define a phosphate-signalling pathway in plants. Plant Physiology 141: 988–999.
Barrett S, Shearer B, Hardy G (2004) Phytotoxicity in relation to in planta concentration
of the fungicide phosphite in nine Western Australian native species. Australasian
Plant Pathology 33: 521-528
Bartoli CG, Pastori GM, Foyer CH (2000) Ascorbate biosynthesis in mitochondria is
linked to the electron transport chain between complexes III and IV. Plant
Physiology. 123: 335-344
Bieleski RL (1973) Phosphate pools, phosphate transport, and phosphate availability.
Annual Review of Plant Physiology and Plant Molecular Biology 24: 225-252
Bolan NS (1991) A critical review on the role of mycorrhizal fungi in the uptake of
phosphorus by plants. Plant and Soil 134: 189-207
Bouché N, Fromm H (2004) GABA in plants: just a metabolite? Trends in Plant Science
9: 110-115
Bozzo GG, Singh VK, Plaxton WC (2004) Phosphate or phosphite addition promotes the
proteolytic turnover of phosphate-starvation inducible tomato purple acid
phosphatase isozymes. FEBS Letters 573: 51-54
Bozzo GG, Dunn EL, Plaxton WC (2006) Differential synthesis of phosphate-starvation
inducible purple acid phosphatase isozymes in tomato (Lycopersicon esculentum)
suspension cells and seedlings. Plant Cell and Environment 29: 303-313
Carpenter SR (2005) Eutrophication of aquatic ecosystems: Bistability and soil
phosphorus. Proceedings of the National Academy of Sciences of the United States
of America 102: 10002-10005
23
Carswell C, Grant BR, Theodorou ME, Harris J, Niere JO, Plaxton WC (1996) The
fungicide phosphonate disrupts the phosphate-starvation response in Brassica nigra
seedlings. Plant Physiology 110: 105-110
Carswell MC, Grant BR, Plaxton WC (1997) Disruption of the phosphate-starvation
response of oilseed rape suspension cells by the fungicide phosphonate. Planta 203:
67-74
Cheng L, Bucciarelli B, Shen J, Allan D, Vance CP (2011) Update on white lupin cluster
root acclimation to phosphorus deficiency update on lupin cluster roots. Plant
Physiology 156: 1025-1032
Chiou TJ, Aung K, Lin SI, Wu CC, Chiang SF. & Su CL. (2006) Regulation of
phosphate homeostasis by microRNA in Arabidopsis. Plant Cell 18: 412–421
Ciereszko I, Barbachowska A (2000) Sucrose metabolism in leaves and roots of bean
(Phaseolus vulgaris L.) during phosphate deficiency. Plant Physiology 156: 640-644
Clifton R, Lister R, Parker KL, Sappl PG, Elhafez D, Millar AH, Day DA, Whelan J (2005) Stress-induced co-expression of alternative respiratory chain components in
Arabidopsis thaliana. Plant Molecular Biology 58: 193-212
Dai H, Lo Y-S, Litvinchuk A, Wang Y-T, Jane W-N, Hsiao L-J, Chiang K-S (2005)
Structural and functional characterizations of mung bean mitochondrial nucleoids.
Nucleic Acids Research. 33: 4725-4739
Daniel R, Guest D (2005) Defence responses induced by potassium phosphonate in
Phytophthora palmivora-challenged Arabidopsis thaliana. Physiological and
Molecular Plant Pathology 67: 194-201
Daram P, Brunner S, Rausch C, Steiner C, Amrhein N, Bucher M (1999) Pht2;1
encodes a low-affinity phosphate transporter from Arabidopsis. The Plant Cell
Online 11: 2153-2166
Daschner K, Couee I, Binder S (2001) The mitochondrial isovaleryl-coenzyme A
dehydrogenase of Arabidopsis oxidizes intermediates of leucine and valine
catabolism. Plant Physiology 126: 601 - 612
Daschner K, Thalheim C, Guha C, Brennicke A, Binder S (1999) In plants a putative
isovaleryl-CoA-dehydrogenase is located in mitochondria. Plant Molecular Biology
39: 1275-1282
Devaiah BN, Karthikeyan AS, Raghothama KG (2007) WRKY75 transcription factor is
a modulator of phosphate acquisition and root development in Arabidopsis. Plant
Physiology 143: 1789-1801
Devaiah BN, Madhuvanthi R, Karthikeyan AS, Raghothama KG (2009) Phosphate
starvation responses and gibberellic acid biosynthesis are regulated by the MYB62
Transcription Factor in Arabidopsis. Molecular Plant 2: 43-58
Devaiah BN, Nagarajan VK, Raghothama KG (2007) Phosphate homeostasis and root
development in Arabidopsis are synchronized by the zinc finger transcription factor
ZAT6. Plant Physiology 145: 147-159
Dong B, Rengel Z, Delhaize E (1998) Uptake and translocation of phosphate by pho2
mutant and wild-type seedlings of Arabidopsis thaliana. Planta 205: 251-256
Dong B, Ryan PR, Rengel Z, Delhaize E (1999) Phosphate uptake in Arabidopsis
thaliana: dependence of uptake on the expression of transporter genes and internal
phosphate concentrations. Plant Cell and Environment 22: 1455-1461
Dobermann A, Fairhurst T. (2000). Rice. Nutrient disorders & nutrient management.
Handbook series. Potash & Phosphate Institute (PPI), Potash & Phosphate Institute
of Canada (PPIC) and International Rice Research Institute. 191 p.
24
Duff SMG, Moorhead GBG, Lefebvre DD, Plaxton WC (1989) Phosphate starvation
inducible `bypasses' of adenylate and phosphate dependent glycolytic enzymes in
Brassica nigra suspension Cells. Plant Physiology 90: 1275-1278
Duff SMG, Sarath G, Plaxton WC (1994) The role of acid-phosphatases in plant
phosphorus metabolism. Physiologia Plantarum 90: 791-800
Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular
localization of proteins based on their N-terminal amino acid sequence. Molecular
Biology 300: 1005-1016
Emanuelsson O, Nielsen H, Von Heijne G (1999) ChloroP, a neural network-based
method for predicting chloroplast transit peptides and their cleavage sites. Protein
Science 8: 978-984
Essigmann B, Guler S, Narang RA, Linke D, Benning C (1998) Phosphate availability
affects the thylakoid lipid composition and the expression of SQD1, a gene required
for sulfolipid biosynthesis in Arabidopsis thaliana. Proceedings of the National
Academy of Sciences of the United States of America 95: 1950-1955
Fang ZY, Shao C, Meng YJ, Wu P, Chen M (2009) Phosphate signaling in Arabidopsis
and Oryza sativa. Plant Science 176: 170-180
Fenn ME, Coffey MD (1984) Studies on the in vitro and in vivo antifungal activity of
fosetyl-al and phosphorous acid. Phytopathology 74: 606-611
Ferro M, Salvi D, Brugiere S, Miras S, Kowalski S, Louwagie M, Garin J, Joyard J,
Rolland N (2003) Proteomics of the chloroplast envelope membranes from
Arabidopsis thaliana. Molecular and Cellular Proteomics 2: 325-345
Finnegan PM, Soole KL, Umbach AL (2004) Alternative mitochondrial electron transport
proteins in higher plants. Plant Mitochondria: From Genome to Function 17: 163-
230
Forster H, Adaskaveg JE, Kim DH, Stanghellini ME (1998) Effect of phosphite on
tomato and pepper plants and on susceptibility of pepper to Phytophthora root and
crown rot in hydroponic culture. Plant Disease 82: 1165-1170
Franco-Zorrilla JM, Gonzalez E, Bustos R, Linhares F, Leyva A, Paz-Ares J (2004)
The transcriptional control of plant responses to phosphate limitation. Experimental
Botany 55: 285-293
Fredeen AL, Raab TK, Rao IM, Terry N (1990) Effects of phosphorous nutrition on
photosynthesis in Glycine-max (L.) Merr. Planta 181: 399-405
Ghannoum O, Conroy JP (2007) Phosphorus deficiency inhibits growth in parallel with
photosynthesis in a C(3) (Panicum laxum) but not two C(4) (P. coloratum and
Cenchrus ciliaris) grasses. Functional Plant Biology 34: 72-81
Giege P, Sweetlove LJ, Cognat V, Leaver CJ (2005) Coordination of nuclear and
mitochondrial genome expression during mitochondrial biogenesis in Arabidopsis.
Plant Cell 17: 1497-1512
Glisovic T, Bachorik JL, Yong J, Dreyfuss G (2008) RNA-binding proteins and post-
transcriptional gene regulation. FEBS Letters 582: 1977-1986
Green PJ (1994) The ribonucleases of higher-plants. Annual Review of Plant Physiology
and Plant Molecular Biology 45: 421-445
Gregory AL, Hurley BA, Tran HT, Valentine AJ, She YM, Knowles VL, Plaxton WC
(2009) In vivo regulatory phosphorylation of the phosphoenolpyruvate carboxylase
AtPPC1 in phosphate starved Arabidopsis thaliana. Biochem J 420:57–65
25
Griffith JM, Akins LA, Grant BR (1989) Properties of the phosphate and phosphite
transport systems of Phytophthora palmivora. Archives of Microbiology 152: 430-
436
Griffith JM, Smillie RH, Grant BR (1990) Alterations in nucleotide and pyrophosphate
levels in Phytophthora palmivora following exposure to the antifungal agent
potassium phosphonate (phosphite). General Microbiology 136: 1285-1291
Gueguen V (2000) Fatty acid and lipoic acid biosynthesis in higher plant mitochondria.
Biological Chemistry 275: 5016-5025
Guera A, de Nova PG, Sabater B (2000) Identification of the Ndh (NAD(P)H-
plastoquinone-oxidoreductase) complex in etioplast membranes of barley: Changes
during photomorphogenesis of chloroplasts. Plant and Cell Physiology 41: 49 - 59
Guest D, Grant B (1991) The complex action of phosphonates as antifungal agents.
Biological Reviews 66: 159-187
Guo B, Jin Y, Wussler C, Blancaflor EB, Motes CM, Versaw WK (2008) Functional
analysis of the Arabidopsis PHT4 family of intracellular phosphate transporters.
New Phytologist 177: 889-898
Hammond JP, Broadley MR, White PJ (2004) Genetic responses to phosphorus
deficiency. Annals of Botany 94: 323-332
Hatzack F., Dombrowski S., Brennicke A., Binder S. (1998) Characterization of DNA
Binding Proteins from Pea Mitochondria. Plant Physiology 116:519-527
Hell R (2002) Molecular and biochemical analysis of the enzymes of cysteine biosynthesis
in the plant Arabidopsis thaliana. Amino Acids 22: 245
Hesse H, Nikiforova V, Gakiere B, Hoefgen R (2004) Molecular analysis and control of
cysteine biosynthesis: integration of nitrogen and sulphur metabolism. Experimental
Botany. 55: 1283-1292
Hsieh Y-J, Wanner BL (2010) Global regulation by the seven-component Pi signaling
system. Current Opinion in Microbiology 13: 198-203
Huang CY, Roessner U, Eickmeier I, Genc Y, Callahan DL, Shirley N, Langridge P,
Bacic A (2008) Metabolite profiling reveals distinct changes in carbon and nitrogen
metabolism in phosphate-deficient barley plants (Hordeum vulgare L.). Plant and
Cell Physiology 49: 691-703
Jeschke WD, Kirkby EA, Peuke AD, Pate JS, Hartung W (1997) Effects of P deficiency
on assimilation and transport of nitrate and phosphate in intact plants of castor bean
(Ricinus communis L). Experimental Botany 48: 75-91
Jiang C, Gao X, Liao L, Harberd NP, Fu X (2007) Phosphate starvation root architecture
and anthocyanin accumulation responses are modulated by the gibberellin-DELLA
signaling pathway in Arabidopsis(1 OA ). Plant Physiology 145: 1460-1470
Jones-Rhoades MW, Bartel DP (2004) Computational identification of plant microRNAs
and their targets, including a stress-induced miRNA. Mol Cell 14: 787-799
Juszczuk I, Rychter A (2002) Pyruvate accumulation during phosphate deficiency stress
of bean roots. Plant Physiology and Biochemistry 40: 783-788
Karthikeyan AS, Ballachanda DN, Raghothama KG (2009) Promoter deletion analysis
elucidates the role of cis elements and 5'UTR intron in spatiotemporal regulation of
AtPht1;4 expression in Arabidopsis. Physiologia Plantarum 136: 10-18
Karthikeyan AS, Varadarajan DK, Jain A, Held MA, Carpita NC, Raghothama KG
(2007) Phosphate starvation responses are mediated by sugar signaling in
Arabidopsis. Planta 225: 907-918
26
Karthikeyan AS, Varadarajan DK, Mukatira UT, D'Urzo MP, Damsz B, Raghothama
KG (2002) Regulated expression of Arabidopsis phosphate transporters. Plant
Physiology 130: 221-233
King M, Reeve W, Van der Hoek MB, Williams N, McComb J, O'Brien PA, Hardy
GESJ (2010) Defining the phosphite-regulated transcriptome of the plant pathogen
Phytophthora cinnamomi. Molecular Genetics and Genomics 284: 425-435
Knappe S, Flugge UI, Fischer K (2003) Analysis of the plastidic phosphate translocator
gene family in Arabidopsis and identification of new phosphate translocator-
homologous transporters, classified by their putative substrate-binding site. Plant
Physiology 131: 1178-1190
Kucej M, Butow RA (2007) Evolutionary tinkering with mitochondrial nucleoids. Trends
in Cell Biology 17: 586-592
Kucej M, Kucejova B, Subramanian R, Chen XJ, Butow RA (2008) Mitochondrial
nucleoids undergo remodeling in response to metabolic cues. J Cell Sci 121: 1861-
1868
Kuo HF, Chiou TJ (2011) The role of MicroRNAs in phosphorus deficiency signaling.
Plant Physiology 156: 1016-1024
Lam HM, Coschigano KT, Oliveira IC, Melo-Oliveira R, Coruzzi GM (1996) The
molecular genetics of nitrogen assimilation into amino acods in higher plants.
Annual Review of Plant Physiology and Plant Molecular Biology 47: 569-593
Lambers H, Shane MW (2007) Role of root clusters in phosphorus acquisition and
increasing biological diversity in agriculture. In Spiertz JHJ, Struik PC, Van Laar
HH, eds, Scale and Complexity in Plant Systems Research: Gene-Plant-Crop
Relations. Springer, Dordrecht, The Netherlands 21: 237-250
Lambers H, Shane MW, Cramer MD, Pearse SJ, Veneklaas EJ (2006) Root structure
and functioning for efficient acquisition of phosphorus: Matching morphological
and physiological traits. Annals of Botany 98: 693-713
Lee H-C, Wei Y-H (2005) Mitochondrial biogenesis and mitochondrial DNA maintenance
of mammalian cells under oxidative stress. The International Journal of
Biochemistry and Cell Biology 37: 822-834
Lee TM, Tsai PF, Shyu YT, Sheu F (2005) The effects of phosphite on phosphate
starvation responses of Ulva lactuca (Ulvales, Chlorophyta). Phycology 41: 975-
982
Lei M, Liu Y, Zhang B, Zhao Y, Wang X, Zhou Y, Raghothama KG, Liu D (2011)
Genetic and genomic evidence that sucrose is a global regulator of plant responses
to phosphate starvation in Arabidopsis. Plant Physiology 156: 1116-1130
Lenburg ME, O'Shea EK (1996) Signaling phosphate starvation. Trends in Biochemical
Sciences 21: 383-387
Lesniewicz K, Goraczniaka R, Radlowski M, Bartkowiak S, Augustyniak H (2003)
Detection of three DNA-binding proteins from lupine mitochondrial. International
Journal of Plant Sciences 164: 305-311
Leung, A. K. and Sharp, P. A. (2010) MicroRNA functions in stress responses. Mol.
Cell 40: 205-215.
Lin S-I, Chiou T-J (2008) Long-distance movement and differential targeting of
microRNA399s. Plant Signaling and Behavior 3: 730-732
Liu JQ, Samac DA, Bucciarelli B, Allan DL, Vance CP (2005) Signaling of phosphorus
deficiency-induced gene expression in white lupin requires sugar and phloem
transport. Plant Journal 41: 257-268
27
Lopez-Bucio J, Cruz-Ramirez A, Herrera-Estrella L (2003) The role of nutrient
availability in regulating root architecture. Current Opinion in Plant Biology 6: 280-
287
Lovatt, C.J. and R.L. Mikkelsen (2006) Phosphite fertilizers: What are they? Can you use
them? What can they do? Better Crops. 90: 11-13
MacAlpine DM, Perlman PS, Butow RA (2000) The numbers of individual
mitochondrial DNA molecules and mitochondrial DNA nucleoids in yeast are co-
regulated by the general amino acid control pathway. Embo Journal 19: 767-775
Macintire WH, Winterberg SH, Hardin LJ, Sterges AJ, Clements LB (1950) Fertilizer
evaluation of certain phosphorus, phosphorous, and phosphoric materials by means
of pot cultures. Agronomy Journal 42: 543-549
Mackenzie S, McIntosh L (1999) Higher Plant Mitochondria. Plant Cell 11: 571-586
May MJ, Leaver CJ (1993) Oxidative stimulation of glutathione synthesis in Arabidopsis
thaliana suspension-cultures. Plant Physiology 103: 621-627
McDonald AE, Grant BR, Plaxton WC (2001) Phosphite (phosphorous acid): Its
relevance in the environment and agriculture and influence on plant phosphate
starvation response. Plant Nutrition 24: 1505-1519
McDonald AE, Niere JO, Plaxton WC (2001) Phosphite disrupts the acclimation of
Saccharomyces cerevisiae to phosphate starvation. Canadian Journal of
Microbiology 47: 969-978
Mikulska M, Bomsel JL, Rychter AM (1998) The influence of phosphate deficiency on
photosynthesis, respiration and adenine nucleotide pool in bean leaves.
Photosynthetica 35: 79-88
Millar AH, Wiskich JT, Whelan J, Day DA (1993) Organic acid activation of the
alternative oxidase of plant mitochondria. FEBS Letters 329: 259-262
Miura K, Rus A, Sharkhuu A, Yokoi S, Karthikeyan AS, Raghothama KG, Baek D,
Koo YD, Jin JB, Bressan RA, et al (2005) The Arabidopsis SUMO E3 ligase SIZ1
controls phosphate deficiency responses. Proc Natl Acad Sci USA 102: 7760–7765
Misson J, Raghothama KG, Jain A, Jouhet J, Block MA, Bligny R, Ortet P, Creff A,
Somerville S, Rolland N, Doumas P, Nacry P, Herrerra-Estrella L, Nussaume
L, Thibaud M-C (2005) A genome-wide transcriptional analysis using Arabidopsis
thaliana Affymetrix gene chips determined plant responses to phosphate
deprivation. Proceedings of the National Academy of Sciences of the United States
of America 102: 11934-11939
Mitsukawa, N., Okumura, S., Shirano, Y., Sato, S., Kato, T., Harashima, S., and
Shibata, D. (1997) Overexpression of an Arabidopsis thaliana high-affinity
phosphate transporter gene in tobacco cultured cells enhances cell growth under
phosphate-limited conditions. Proc. Natl. Acad. Sci. U.S.A. 94: 7098–7102.
Moraes, T. and Plaxton, W.C. (2000) Purification and characterization of
phosphoenolpyruvate carboxylase from Brassica napus (rapeseed) suspension cell
cultures. Implications for phosphoenolpyruvate carboxylase regulation during
phosphate starvation, and the integration of glycolysis with nitrogen assimilation.
Eur. J. Biochem 267: 4465 –4476.
Morcuende R, Bari R, Gibon Y, Zheng WM, Pant BD, Blasing O, Usadel B,
Czechowski T, Udvardi MK, Stitt M, Scheible WR (2007) Genome-wide
reprogramming of metabolism and regulatory networks of Arabidopsis in response
to phosphorus. Plant Cell and Environment 30: 85-112
28
Mudge SR, Rae AL, Diatloff E, Smith FW (2002) Expression analysis suggests novel
roles for members of the Pht1 family of phosphate transporters in Arabidopsis. Plant
Journal 31: 341-353
Muller R (2006) Genome-wide analysis of the Arabidopsis leaf transcriptome reveals
interaction of phosphate and sugar metabolism. Plant Physiology 143: 156
Muller R, Morant M, Jarmer H, Nilsson L, Nielsen TH (2007) Genome-wide analysis of
the Arabidopsis leaf transcriptome reveals interaction of phosphate and sugar
metabolism. Plant Physiology 143: 156-171
Murphy AM, Chivasa S, Singh DP, Carr JP (1999) Salicylic acid-induced resistance to
viruses and other pathogens: a parting of the ways? Trends in Plant Science 4: 155-
160
Nagano M, Ashihara H (1993) Long-term phosphate starvation and respiratory
metabolism in suspension-cultured Catharanthus roseus cells. Plant and Cell
Physiology 34: 1219-1228
Nagarajan VK, Jain A, Poling MD, Lewis AJ, Raghothama KG, Smith AP (2011)
Arabidopsis Pht1;5 mobilizes phosphate between source and sink organs and
influences the interaction between phosphate homeostasis and ethylene signaling.
Plant Physiology 156: 1149-1163
Niere JO, Deangelis G, Grant BR (1994) The effect of phosphonate on the acid soluble
phosphorus components in the genus Phytophthora. Microbiology-UK 140: 1661-
1670
Niere JO, Griffith JM, Grant BR (1990) P-31 NMR-studies on the effect of phosphite on
Phytopthora palmivora. General Microbiology 136: 147-156
Nussaume L, Kanno S, Javot Hln, Marin E, Nakanishi TM, Thibaud M-C (2011)
Phosphate import in plants: focus on the PHT1 transporters. Frontiers in Plant
Science 2: 83
Ohtake H, Wu H, Imazu K, Anbe Y, Kato J, Kuroda A (1996) Bacterial phosphonate
degradation, phosphite oxidation and polyphosphate accumulation. Resources,
Conservation and Recycling 18: 125-134
Oshima Y (1997) The phosphatase system in Saccharomyces cerevisiae. Genes and
Genetic Systems 72: 323-334
Pant BD, Buhtz A, Kehr J, Scheible WR (2008) MicroRNA399 is a long distance signal
for the regulation of plant phosphate homeostasis. Plant J 53: 731-738
Parsons HL, Yip JYH, Vanlerberghe GC (1999) Increased respiratory restriction during
phosphate-limited growth in transgenic tobacco cells lacking alternative oxidase.
Plant Physiology 121: 1309-1320
Picciocchi A, Douce R, Alban C (2001) Biochemical characterization of the Arabidopsis
biotin synthase reaction. The importance of mitochondria in biotin synthesis. Plant
Physiology. 127: 1224-1233
Plaxton WC, Tran HT (2011) Metabolic adaptations of phosphate-starved plants. Plant
Physiology 156: 1006-1015
Raghothama KG (1999) Phosphate acquisition. Annual Review of Plant Physiology and
Plant Molecular Biology 50: 665-693
Raghothama KG, Karthikeyan AS (2005) Phosphate acquisition. Plant and Soil 274: 37-
49
Ratjen AM, Gerendas J (2009) A critical assessment of the suitability of phosphite as a
source of phosphorus. Plant Nutrition and Soil Science 172: 821-828
29
Rausch C, Bucher M (2002) Molecular mechanisms of phosphate transport in plants.
Planta 216: 23-37
Ravanel Sp, Gakiere B, Job D, Douce R (1998) The specific features of methionine
biosynthesis and metabolism in plants. Proceedings of the National Academy of
Sciences of the United States of America 95: 7805-7812
Reape TJ, Molony EM, McCabe PF (2008) Programmed cell death in plants:
distinguishing between different modes. Experimental Botany.: erm258
Rebeille F, Alban C, Bourguignon J, Ravanel S, Douce R (2007) The role of plant
mitochondria in the biosynthesis of coenzymes. Photosynthesis Research 92: 149-
162
Rickard DA (2000) Review of phosphorus acid and its salts as fertilizer materials. Plant
Nutrition 23: 161-180
Roth C, Menzel G, Petetot JMC, Rochat-Hacker S, Poirier Y (2004) Characterization of
a protein of the plastid inner envelope having homology to animal inorganic
phosphate, chloride and organic-anion transporters. Planta 218: 406-416
Rouached H, Arpat AB, Poirier Y (2010) Regulation of phosphate starvation responses in
plants: Signaling players and cross-talks. Molecular Plant 3: 288-299
Schroetter S, Angeles-Wedlel D, Kreuzig R, Schnug E (2006) Effects of phosphite on
phosphorus supply and growth of corn (Zea mays). Landbauforschung Volkenrode
56: 87-99
Shen H, Yan XL, Zhao M, Zheng SL, Wang XR (2002) Exudation of organic acids in
common bean as related to mobilization of aluminum- and iron-bound phosphates.
Environmental and Experimental Botany 48: 1-9
Shih CY, Kao CH (1996) Growth inhibition in suspension-cultured rice cells under
phosphate deprivation is mediated through putrescine accumulation. Plant
Physiology 111: 721-724
Singh VK, Wood SM, Knowles VL, Plaxton WC (2003) Phosphite accelerates
programmed cell death in phosphate-starved oilseed rape (Brassica napus)
suspension cell cultures. Planta 218: 233-239
Smith FW (2002) The phosphate uptake mechanism. Plant and Soil 245: 105-114
Smith FW, Ealing PM, Dong B, Delhaize E (1997) The cloning of two Arabidopsis genes
belonging to a phosphate transporter family. Plant Journal 11: 83-92
Smith FW, Rae AL, Hawkesford MJ (2000) Molecular mechanisms of phosphate and
sulphate transport in plants. Biochimica et Biophysica Acta (BBA) - Biomembranes
1465: 236-245
Stehmann C, Grant BR (2000) Inhibition of enzymes of the glycolytic pathway and
hexose monophosphate bypass by phosphonate. Pesticide Biochemistry and
Physiology 67: 13-24
Takabatake R, Hata S, Taniguchi M, Kouchi H, Sugiyama T, Izui K (1999) Isolation
and characterization of cDNAs encoding mitochondrial phosphate transporters in
soybean, maize, rice, and Arabidopsis. Plant Molecular Biology 40: 479-486
Tarasenko VI, Subota IY, Kobzev VF, Konstantinov YM (2005) Isolation of
mitochondrial DNA-binding proteins specific to the maize cox1 promoter.
Molecular Biology 39: 350-356
Thao HTB, Yamakawa T (2010) Phosphate absorption of intact komatsuna plants as
influenced by phosphite. Soil Science and Plant Nutrition 56: 133-139
Thao HTB, Yamakawa T (2009) Phosphite (phosphorous acid): Fungicide, fertilizer or
bio-stimulator? Soil Science and Plant Nutrition 55: 228-234
30
Thao HTB, Yamakawa T, Shibata K (2009) Effect of phosphite-phosphate interaction on
growth and quality of hydroponic lettuce (Lactuca sativa). Plant Nutrition and Soil
Science 172: 378-384
Thao HTB, Yamakawa T, Shibata K, Sarr PS, Myint AK (2008) Growth response of
komatsuna (Brassica rapa var. peruviridis) to root and foliar applications of
phosphite. Plant and Soil 308: 1-10
Theodorou ME, Plaxton WC (1993) Metabolic adaptations of plant respiration to
nutritional phosphate deprivation. Plant Physiology 101: 339-344
Thibaud M-C, Arrighi J-F, Bayle V, Chiarenza S, Creff A, Bustos R, Paz-Ares J,
Poirier Y, Nussaume L (2010) Dissection of local and systemic transcriptional
responses to phosphate starvation in Arabidopsis. Plant Journal 64: 775-789
Ticconi CA, Delatorre CA, Abel S (2001) Attenuation of phosphate starvation responses
by phosphite in arabidopsis. Plant Physiology 127: 963-972
Tran HT, Plaxton WC (2008) Proteomic analysis of alterations in the secretome of
Arabidopsis thaliana suspension cells subjected to nutritional phosphate deficiency.
Proteomics 8: 4317-4326
Tran HT, Qian W, Hurley BA, She YM, Wang D, Plaxton WC (2010b) Biochemical
and molecular characterization of AtPAP12 and AtPAP26: the predominant purple
acid phosphatase isozymes secreted by phosphate-starved Arabidopsis thaliana.
Plant Cell Environ 33: 1789–1803
Uhde-Stone C, Gilbert G, Johnson JMF, Litjens R, Zinn KE, Temple SJ, Vance CP,
Allan DL (2003) Acclimation of white lupin to phosphorus deficiency involves
enhanced expression of genes related to organic acid metabolism. Plant and Soil
248: 99-116
Ullricheberius CI, Novacky A, Fischer E, Luttge U (1981) Relationship between energy
dependent phosphate uptake and the electrical membrane potential in Lemna gibba
G1. Plant Physiology 67: 797-801
Unseld M, Marienfeld JR, Brandt P, Brennicke A (1997) The mitochondrial genome of
Arabidopsis thaliana contains 57 genes in 366,924 nucleotides. Nature Genetics 15:
57-61
Vance CP, Uhde-Stone C, Allan DL (2003) Phosphorus acquisition and use: critical
adaptations by plants for securing a nonrenewable resource. New Phytologist 157:
423-447
Vanlerberghe GC, McIntosh L (1997) Alternative oxidase: From gene to function.
Annual Review of Plant Physiology and Plant Molecular Biology 48: 703-734
Varadarajan DK, Karthikeyan AS, Matilda PD, Raghothama KG (2002) Phosphite, an
analog of phosphate, suppresses the coordinated expression of genes under
phosphate starvation. Plant Physiology 129: 1232-1240
Veljanovski V, Vanderbeld B, Knowles VL, Snedden WA, Plaxton WC (2006)
Biochemical and molecular characterization of AtPAP26, a vacuolar purple acid
phosphatase up-regulated in phosphate-deprived Arabidopsis suspension cells and
seedlings. Plant Physiology 142: 1282-1293
Vermel M, Guermann B, Delage L, Grienenberger J-M, Maréchal-Drouard L,
Gualberto JM (2002) A family of RRM-type RNA-binding proteins specific to
plant mitochondria. Proceedings of the National Academy of Sciences 99: 5866-
5871
31
Versaw WK, Harrison MJ (2002) A chloroplast phosphate transporter, PHT2;1,
influences allocation of phosphate within the plant and phosphate-starvation
responses. Plant Cell 14: 1751-1766
Vershinina OA, Znamenskaya LV (2002) The Pho regulons of bacteria. Microbiology
71: 497-511
Winter D, Vinegar B, Nahal H, Ammar R, Wilson GV, Provart NJ (2007) An
"Electronic Fluorescent Pictograph" browser for exploring and analyzing large-scale
biological data sets. Plos One 2
Yang XJ, Finnegan PM (2010) Regulation of phosphate starvation responses in higher
plants. Annals of Botany 105: 513-526
Young DC (2004) Ammonium phosphate/phosphate fertilizer compound. US Patent No.
6824584.
32
CHAPTER 2:
Identification of mitochondrial nucleic acid-binding proteins
from Arabidopsis thaliana cells grown in cultures
33
Abstract
Mitochondrial DNA (mtDNA) contains genes that are crucial to the survival of almost all
eukaryotes, including plants. Both nuclear and mitochondrial genomes need to be
coordinately expressed for optimal mitochondrial function. Despite the importance of
mitochondrial processes in plant development, little is known about the factors involved in
the synthesis, breakdown and reorganisation of mtDNA. It is likely that DNA-binding
proteins are involved in mtDNA replication, recombination, repair and transcription, while
RNA-binding proteins take part in post-transcriptional RNA maturation such as splicing,
editing, and translation. The research described in this chapter was designed to identify
mitochondrial nucleic acid-binding proteins from Arabidopsis thaliana cells grown in
suspension culture using an undirected approach. Mitochondria were isolated from cells
and fixed with 1 % formaldehyde to stabilise protein-nucleic acid interactions. The
temperature and length of heat treatment to reverse formaldehyde cross-linking were
optimised. Lysates of formaldehyde-fixed mitochondria were subjected to CsCl gradient
centrifugation for the isolation of mitochondrial nucleic acid-binding proteins as it was
found to be a better technique in getting more proteins than glycerol gradient
centrifugation. Proteins in the gradient fractions were separated using sodium dodecyl-
sulphate polyacrylamide gel electrophoresis (SDS-PAGE). Selected protein bands were
excised for trypsin digestion prior to liquid chromatography mass spectrometry sequencing.
This analysis identified a glycine-rich RNA-binding protein GR-RBP5 in lysates of fixed
mitochondria, and an endoribonuclease and chaperonin 20 in lysates of non-fixed
mitochondria. Malate dehydrogenase was detected in both fixed and non-fixed
mitochondrial lysates. These four proteins have the capacity to bind to mitochondrial
nucleic acids. Abundant mitochondrial proteins were identified in fixed, also non-fixed
mitochondrial lysates that were used as controls. Although several proteins associated with
mitochondrial nucleic acids were detected, this approach needs to be improved for better
protein identification in the future.
34
Introduction
Due to their sessile lifestyle, plants have to cope with various environmental conditions for
survival. Some of these conditions will lead to stress. Mitochondria have key roles in
oxidative stress where their function may change (Jones, 2000). Several mitochondrial
respiratory chain components responded to stress, especially the alternative oxidase (AOX).
AOX, type II NADPH dehydrogenase (NDH), and uncoupling protein (UCP) form
alternative electron-transport pathways. Phosphate (Pi) deficiency is among abiotic stress
that induce AOX abundance in Phaseolus vulgaris L.cv., Zlota Saxa (culture of bean
plants) (Juszczuk et al., 2001), and Nicotiana tabacum (tobacco) suspension-cultured cells
(Parsons et al., 1999). In some cases, changes in protein abundance have been demonstrated
to reflect the changes in the amounts of the transcripts encoding the protein. This could be
seen in AOX (Aubert et al., 1997) and UCP (Considine et al., 2001). While the transcript
abundance for alternative respiratory pathway genes is dynamic, the classical respiratory
chain and tricarboxylic acid (TCA) cycle genes are more stable under the majority of
conditions (Clifton et al., 2005).
The expression of genes encoding mitochondrial functions changed during stress. One
example is from Solanum tuberosum (potato) where the transcripts and protein amounts of
NADH dehydrogenase decreased under cold stress (Svensson et al., 2002). This condition
indicates that once plants experience stress, the mitochondrial functions may change
(Flagella et al., 2006). The changes most probably facilitated by transcription factors and
other mitochondrial nucleic acid-binding proteins. For example in yeast, Hsp60 and Ilv5
proteins attached to mtDNA nucleoids during glucose and amino acid starvation,
respectively (Kucej et al., 2008).
Nucleic acid-binding proteins have a DNA or RNA binding domain. DNA-binding proteins
will bind to specific DNA sequences, either alone or together with other proteins, to control
the transcriptional process. In general, transcription factors regulate gene expression by
controlling the activation and inactivation of certain genes in certain conditions, based on
the cellular requirements (Latchman, 1997; Martin et al., 2010; Riechmann et al., 2000;
Singh, 1998). This is true for plant nuclear genomes, but there is lack of information about
the factors involved in mtDNA metabolism or the proteins controlling mtDNA gene
35
expression. Since many transcription factors work by binding to DNA, DNA-binding
proteins are likely to be involved in mtDNA gene expression.
DNA-binding proteins are possibly involved in mtDNA replication, recombination, repair
and transcription (Kucej and Butow, 2007). During the replication of mtDNA of most
eukaryotes including plants, DNA polymerase, DNA primase and DNA helicase are
involved (Shutt and Gray, 2006). MutS Homolog1 (MSH1), RECA3 (Shedge et al., 2007)
and OSB1 (Zaegel et al., 2006) are three nuclear genes take part in recombination
surveillance in plant mitochondria. The transcription of plant mitochondrial genes is
initiated by multiple promoters (Kuhn et al., 2005) and performed by two phage-type RNA-
polymerases (Richter et al., 2002). mtrecA possibly functions in both mtDNA repair and
recombination in Arabidopsis thaliana (Arabidopsis) (Khazi et al., 2003).
Among several known mtDNA-binding proteins, members of the high mobility group
(HMG) box family (Kucej and Butow, 2007) are detectable in most organisms. For
instance, Abf2 in Saccharomyces cerevisiae (Diffley and Stillman, 1992), mtTFA and
mtTFB in Xenopus laevis (Shen and Bogenhagen, 2001), D-mtTFA (Takata et al., 2001),
D-mtTFB2 (Matsushima et al., 2004), and D-mtTFB1 (Matsushima et al., 2005) in
Drosophila and TFAM in human (Alam et al., 2003). In Arabidopsis, a gene encoding a
mtTFA-like protein was identified on chromosome III at locus AT3g51880 (Elo et al.,
2003). Various examples of proteins associated with mitochondrial nucleic acid in plants
are stated in Chapter 1. These proteins are often involved in regulating plant mitochondrial
DNA expression.
Unlike mtDNA-binding proteins, much less is known about plant mtRNA-binding proteins.
Generally, RNA-binding proteins contain RNA recognition motifs (RRM) and take part in
post-transcriptional RNA maturation processes, such as splicing, editing, and translation
(Vermel et al., 2002). In Arabidopsis, At-mRBP1a, AtmRBP1b, and At-mRBP2a were
found to have RNA binding activity, and could be imported to mitochondria (Vermel et al.,
2002). Other than that, glycine rich RNA binding protein (GR-RBP) family was found to
have high affinity to poly (G), poly (U), and ssDNA rather than poly (C), poly (A) and
dsDNA (Hirose et al., 1994; Ludevid et al., 1992; Vermel et al., 2002).
36
This study focused on developing an assay to identify novel mitochondrial nucleic acid-
binding proteins from Arabidopsis thaliana cells grown in culture. One of a major problems
in identifying mitochondrial nucleic acid binding-proteins is to separate them from the non-
nucleic acid-binding proteins. Thus, formaldehyde has been used as an agent to covalently
cross-link protein and nucleic acid, in addition to its ability to crosslink proteins (Orlando et
al., 1997). For proteins which have a physiological DNA binding capacity, cross-linking is
expected to occur easily. However, other proteins that do not naturally bind DNA are
expected to stay in the unbound condition even when a high concentration of formaldehyde
is used (Solomon and Varshavsky, 1985).
An undirected approach to identify proteins bound to formaldehyde-fixed mitochondrial
nucleoids in Arabidopsis cells grown in culture (Thirkettle-Watts, unpublished results)
discovered two problems. The first problem came from plastid contamination during
mitochondrial isolation. Similar to plants, cultured cells also contain many plastids. The
second problem came after mitochondrial lysis, when proteins containing cofactors such as
MnSOD appeared to co-purify with proteins that were bound to mitochondrial nucleic acids
(Thirkettle-Watts, unpublished results). In this research, dark-grown Arabidopsis
suspension cells were used to obtain mitochondria uncontaminated with mature
chloroplasts. A method for isolating nucleic acid-binding proteins from the mitochondria
was developed, and proteins that co-purified with nucleic acid were identified by mass
spectrometry.
Results
Optimisation of formaldehyde cross-linking and reversal in isolated mitochondria
Mitochondria were isolated using two-step Percoll™
gradient centrifugation from
Arabidopsis cells grown in cultures (Figure 2.1A). The mitochondria band (Figure 2.1B)
was determined based on previous mitochondrial isolation method (Millar et al 2001a and
b). The methods for formaldehyde fixation and reversal were optimised before
mitochondrial lysates were fractionated to identify nucleic acid-binding proteins.
37
A
B
Figure 2.1 Isolation of mitochondria from Arabidopsis cells grown in cultures. A. 7-day-
old Arabidopsis suspension cells were used to prepare mitochondria using B. two-step
Percoll™ density gradient centrifugation as described in the Materials and Methods.
Arrows indicate the bands of plastids, mitochondria and peroxisomes after the first and
second Percoll™ gradients.
Formaldehyde was used to fix and retain any protein-nucleic acid interactions present
within mitochondria after their isolation from Arabidopsis cells. Various amounts of
formaldehyde were tested to find the most suitable concentration for fixation - the amount
that ensures fixation and allows DNA and protein recovery after reversal of the cross-
linking. As heating reverses the cross-linking, DNA was recovered from formaldehyde-
fixed mitochondria after 30 min heat treatment at various temperatures. Lysates from
untreated mitochondria gave a sharp and strongly SYBR® gold stained band (Figure 2.2).
The amount of DNA recovered decreased with increasing formaldehyde concentration, but
Mitochondria
Peroxisomes
Plastid
Mitochondria
18%
5ml
25%
25ml
40%
5ml
Second gradient First gradient
38
8126
increased with increasing temperature for reversal. Thus, the greatest DNA recovery was
obtained from mitochondria treated with 0.5 % formaldehyde where cross-linking was
reversed with 70 oC heat treatment (Figure 2.2).
Analysis of both the formaldehyde treated and untreated mitochondria generated SYBR®
gold stained material that did not migrate into the gel (thick arrow, Figure 2.2). The
abundance of this material increased with formaldehyde concentration, even when heated at
70 oC.
Figure 2.2 Optimising formaldehyde cross-linking and reversal. Mitochondria were fixed
for 2 h with the concentrations of formaldehyde indicated across the top, and lysed as
described in Materials and Methods. The cross-linking was reversed by heating the lysates
for 30 min at the temperature indicated across the bottom. Equal portion of each sample of
the lysates were separated by agarose gel electrophoresis and stained with SYBR® gold. M
= Size marker (lambda DNA digested with Eco47I). The thin arrow points to a selected
marker band in base pair (bp). The thick arrow indicates the sample wells.
Varying the length of heat treatment did not change the DNA recovery for non-fixed
mitochondria (Figure 2.3). However, for fixed mitochondria, longer heat treatments
resulted in more intense DNA bands visible after agarose gel electrophoresis. Heating for
16 h reduced the intensity of the material retained in the loading wells (Figure 2.3).
25
60 70
Formaldehyde (%, v/v)
Reversal temperature (oC)
M (bp) 0 0.5 1.0 1.5 0 0.5 1.0 1.5 0 0.5 1.0 1.5
39
Figure 2.3 Optimising the length of heat treatment to reverse formaldehyde cross-linking.
Mitochondria were fixed with 1 % formaldehyde for 2 h and lysed as described in Materials
and Methods. The cross-linking was reversed by heating mitochondrial lysates at 70 oC for
the times indicated across the bottom. Equal portion of each sample of the lysate were
separated by agarose gel electrophoresis and stained with SYBR® gold. M = Size marker
(lambda DNA digested with Eco47I). F = Fixed mitochondria, NF = Non-fixed
mitochondria. The thin arrow points to a selected marker band in bp. The thick arrow
indicates the sample wells.
Mitochondrial lysates were subjected to differential centrifugation and large protein-DNA
complexes were expected to migrate to the bottom of the tube during centrifugation. Protein
recovery after various heat treatments of supernatant and pellet from the lysates was
determined. More proteins were found in the pellet of fixed than the non-fixed
mitochondrial lysates (Figure 2.4 B, C). In contrast, the abundance of proteins recovered in
the supernatant from lysates of non-fixed mitochondria was higher than from fixed
mitochondria, although the protein species was not obviously different (Figure 2.4 D, E).
Heating of more than 3 h produced less intense and smeary protein bands in fixed pellet
(Figure 2.4 B, C) and supernatant (Figure 2.4 D, E) fractions compared to the untreated
controls (Figure 2.4 A), suggesting protein degradation occurred during the heat treatment.
8126
M (bp) F NF F NF F NF F NF F NF
0.5 1 3 6 16 Heating time (h)
40
A B C
D E
Figure 2.4 Optimising the length of heating to reverse formaldehyde cross-linking.
Mitochondria were fixed with 1 % formaldehyde for 2 h and lysed as described in Materials
and Methods. Mitochondrial lysates were subjected to centrifugation at 20,200 x g for 2.5 h
at 4 oC. The pellet was resuspended in 350 µl ddH2O. The supernatant and resuspended
pellet were heated at 70 oC for the indicated times and 8 µl were loaded onto the SDS-
PAGE gels. The gels were stained with Flamingo™ fluorescent gel stain. M = Low
molecular weight marker in kilo dalton (kDa). At the top of each panel, F = Fixed
mitochondrial lysate, NF = Non-fixed mitochondrial lysate. A. Unfractionated crude lysate.
B and C. Resuspended pellet heated as indicated. D and E. Supernatant heated as indicated.
Gels were prepared separately and have been aligned to find matched protein size.
For downstream experiments, 1 % formaldehyde was used for fixation and 1 h heating at 70
oC for reversal. These conditions were selected because 1 % formaldehyde enabled DNA
and proteins to be recovered after heat treatment.
45
97
66
30
20
F NF F NF F NF F NF F NF F NF F NF
45
97
30 20
66
0 0.5 1 3 6 16
Heating time (h)
F NF F NF F NF F NF F NF F NF
Heating time (h) 0 0.5 1 3 6 16
41
Density gradient centrifugation as the basis for protein separations
The following sections describe the separation of mitochondrial lysates by different density
based centrifugation techniques to fractionate their components. Glycerol and/ or CsCl
solutions were used to separate mitochondrial lysates. The resulted gradients were tapped
and fractionated (Figure 2.5) before the contents were subjected to electrophoresis on
agarose or polyacrylamide gels.
Figure 2.5 Strategy for recovering gradient fractions after centrifugation. The gradient
obtained after centrifugation of mitochondrial lysates using glycerol or CsCl solutions was
tapped by poking a hole (thick arrow) with a needle about 1 cm from the bottom of the
tube. The first fraction collected was named as fraction 2. The fractions were continuously
collected until the top fraction. Fraction 1 was slowly pipette out not to include the pellet.
Attempts to isolate protein-DNA complexes by glycerol gradient centrifugation
Glycerol gradient centrifugation was used to separate components by size. Larger-sized
nucleoprotein complexes were anticipated to be towards the bottom of the gradient
(Bogenhagen et al., 2003). More intense mtDNA bands were visualised in the middle
fractions and towards the top fractions of the glycerol gradient (fractions 4 to 11) used to
separate lysates of non-fixed mitochondria. Compared to non-fixed lysates, less intense
bands were visualised for lysates of fixed mitochondria in fraction 6 to 11 (Figure 2.6). For
protein fractions from the same gradient (Figure 2.7), more protein bands were visible from
the middle towards the top fractions (fraction 4 to 7) of the gradient for non-fixed
mitochondrial lysates. For fixed mitochondrial lysates, more intense protein bands could be
Fraction 1
Top fraction
Pellet
Poke a hole here
42
seen at the top of the gradient (fraction 5 to 11). However, no obvious differences were
observed for the protein species present in the two lysates.
To further purify protein-nucleic acid complexes, the glycerol gradient fractions containing
nucleic acid were pooled and subjected to isopycnic centrifugation in a CsCl solution. From
SDS-PAGE analysis of the fractions collected, the amount of protein recovered was very
low, although several bands were still visible in the top fractions (9-13) from the non-fixed
mitochondria. Fraction 1 of non-fixed and fraction 2 of fixed mitochondria also had visible
proteins (Figure 2.8).
Figure 2.6 The recovery of nucleic acid from mitochondria fractionated by glycerol
gradient centrifugation. Non-fixed and fixed mitochondrial lysates were separated on
glycerol gradients (15 % - 40 %) as described in Materials and Methods. The gradients
were fractionated (700 µl each) and the pellets were resuspended in 700 µl dH2O. Each
fraction was heated at 70 oC for 1 h. For each fraction, 25 µl samples were separated by
agarose gel electrophoresis and stained with SYBR® gold. M= Size marker (lambda DNA
digested with Eco47I). P= Resuspended pellet. Lanes 1-11: Fractions 1 -11. The thin arrow
points to a selected marker band in bp. The thick arrow indicates the sample wells.
8126
Non-fixed Fixed
M (bp) P 1 2 3 4 5 6 7 8 9 10 11 P 1 2 3 4 5 6 7 8 9 10 11
Bottom Top Bottom Top
43
A B
C D
Figure 2.7 Protein distribution of mitochondrial lysates fractionated by glycerol gradient
centrifugation. 8 µl of each fraction described in Figure 2.6 was separated by SDS-PAGE
and stained with Flamingo™
fluorescent gel stain solution. M= Low molecular weight
protein marker in kDa. P= Resuspended pellet. Lanes 1-11: Fractions 1 -11. A and B. Non-
fixed fractions. C and D: Fixed fractions. (A and B), (C and D). Gels were prepared
separately and have been aligned to find matched protein size.
M (kDa P 1 2 3 4 5 6 7 8 9 10 11
45
97
66
30
20
45
97
66
30
20
M (kDa) P 1 2 3 4 5 6 7 8 9 10 11
Non-fixed
Fixed
Bottom Top
Bottom Top
44
A B
C D
Figure 2.8 Protein distribution of DNA-containing glycerol gradient fractions separated
across a CsCl gradient. Fractions containing mtDNA from the glycerol gradient as
described above were pooled and fractionated by CsCl gradient. The pellet from the CsCl
gradients were resuspended in 700 µl dH2O and each fraction heated at 70 oC for 1 h. 8 µl
of each fraction were separated by SDS-PAGE and stained with Flamingo™
fluorescent
stain. M= Low molecular weight marker in kDa. P= Resuspended pellet. Lanes 1-13:
Fractions 1-13. A and B: Non-fixed fractions. C and D: Fixed fractions. (A and B), (C and
D). Gels were prepared separately and have been aligned to find matched protein size.
M (kDa) P 1 2 3 4 5 6 7 8 9 10 11 12 13
M (kDa) P 1 2 3 4 5 6 7 8 9 10 11 12 13
45
97
66
30
20
45
97
66
30
20
Non-fixed
Fixed
Bottom Top
Bottom Top
45
CsCl gradient centrifugation allowed isolation of nucleic acid -protein complexes,
unlike the glycerol gradient or combinations of both gradients
To be able to be detected later by mass spectrometry, the proteins need to be concentrated.
Several methods to concentrate proteins were tested before-hand, including by 5000 kDa
molecular size cut-off spin columns, acetone, and methanol-chloroform precipitation, with
and without SDS (Figure 2.9). Acetone precipitation gave the highest protein recovery.
SDS added had changed the relative recovery of the proteins concentrated by spin column,
but not acetone and methanol-chloroform precipitated proteins.
Figure 2.9 Protein recovery from CsCl fractions. Fraction 13 from CsCl gradient
centrifugation of the non-fixed mitochondrial lysates were diluted 20X. 500 µl of the
diluted fraction were concentrated using spin columns with a 5000 kDa cut-off spin column
(SC), or acetone (A) or methanol-chloroform (Me) precipitation, either with (+) or without
(-) SDS. The precipitated proteins were separated by SDS-PAGE and stained with silver.
M= Low molecular weight marker in kDa. NP = non- precipitated samples.
Another preliminary experiment was determination of the density of CsCl fractions.
Different buoyant density of free proteins from proteins fixed to nucleic acids allowed these
two groups of proteins to be separated from one another by CsCl gradient centrifugation.
CsCl solution indeed generated a density gradient after centrifugation (Figure 2.10).
- + - + - + - +
NP SC A Me M (kDa) 97
45
97
66
30
20
46
1.15
1.2
1.25
1.3
1.35
1.4
1.45
P F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 F11 F12
CsCl gradient fraction
Den
sit
y (
g/m
l)
Figure 2.10 CsCl centrifugation generates a density gradient. The density of fractions and
resuspended pellet collected from CsCl gradient centrifugation was determined using the
equation (10.8601x refractive index)-13.4974.
Using CsCl gradient centrifugation, fixed and non-fixed mitochondrial lysates were
fractionated. Agarose gel electrophoresis of the fractions collected after the centrifugation
showed mtDNA bands in the fractions near the bottom of the gradient for both fixed and
non-fixed mitochondrial lysates, with the brightest band visible in the pellet (Figure 2.11).
Less intense DNA bands were visualised for the fixed fractions than the non-fixed
fractions.
Many protein bands were observed towards the top (fractions 6 -13) of the gradient for both
fixed and non-fixed mitochondrial lysates. In non-fixed mitochondrial lysates, intense
protein bands in the pellet and fraction 1 were visualised. The same trend observed in the
pellet of fixed mitochondrial lysates (Figure 2.12). The detection of nucleic acids
correspond to proteins in the pellet of fixed mitochondrial lysates and also the pellet to
fraction 6 of unfixed mitochondrial lysates suggests that these fractions might contain
mitochondrial nucleic acid-binding proteins.
47
Figure 2.11 The recovery of nucleic acid after separation of mitochondrial lysates by CsCl
gradient centrifugation. Mitochondrial lysates were fractionated in CsCl gradient. The
pellet was resuspended in 700 µl dH2O. Each fraction was heated at 70 oC for 1 h. 25 µl of
heated fraction were separated by agarose gel electrophoresis and stained with SYBR®
gold. M = Size marker (lambda DNA digested with Eco47I). P= Resuspended pellet. Lanes
1-13: Fractions 1 -13. The thin arrow points to a selected marker band in bp. The thick
arrow indicates the sample wells.
8126
M (bp) P 1 2 3 4 5 6 7 8 9 10 11 12 13 P 1 2 3 4 5 6 7 8 9 10 11 12 13
Non-fixed Fixed
Non-fixed Fixed
Bottom Top Top Bottom
48
A
B
Figure 2.12 Protein distribution across CsCl gradient fractions. 8 µl of each fraction
described in Figure 2.11 was separated by SDS-PAGE and stained with silver. M= Low
molecular weight marker in kDa. P= Resuspended pellet. Lanes 1-13: Fractions 1 -13. A:
Non-fixed. B: Fixed fractions.
Several proteins co-purified with mitochondrial nucleic acid after CsCl gradient
fractionation have nucleic acid binding properties
The nucleic acid-containing fractions from CsCl gradient centrifugation from fixed and
non-fixed mitochondrial lysates were pooled. Pellet and fraction 1 were combined into pool
1; fraction 2, 3 and 4 were combined into pool 2; fraction 5 and 6 were combined into pool
3. Proteins in the pooled fractions were precipitated with acetone, separated by SDS-PAGE
and stained with colloidal coomassie, a stain compatible with mass spectrometry analysis.
Higher protein amounts and more protein species were detected in pool 1 compared to
pools 2 and 3 in both fixed and non-fixed mitochondria (Figure 2.13). Selected bands from
the gel were subjected to trypsin digestion prior to mass spectrometry analysis for protein
identification. The mass spectrometry analysis was conducted with the help of Dr. Nicholas
45
97
66
30
20
M (kDa) P 1 2 3 4 5 6 7 8 9 10 11 12 13
Non-fixed
Fixed
P 1 2 3 4 5 6 7 8 9 10 11 12 13
45
97
66
30
20
Bottom Top
Bottom Top
49
Taylor (Australian Research Council Centre of Excellence in Plant Energy Biology,
University of Western Australia, Perth).
The list of putatively identified proteins was screened using several criteria. Firstly, only
proteins identified by two or more tryptic peptides from the same band were considered. Of
those proteins, only proteins with a predicted mass that matched the position of the band on
the gel were considered as valid identifications. Using these criteria, a total of 19 proteins
were identified (Figure 2.14). Seventeen proteins were found only in pool 1 of non-fixed
mitochondria. A glycine-rich RNA binding protein 5 (GR-RBPP5) was found in pool 2 of
fixed mitochondria. A list of mitochondrial proteins including endoribonuclease L-PSP and
chaperonin 20 (CPN20) were identified in non-fixed mitochondria. Malate dehydrogenase
1 was found in pool 1 of both fixed and non-fixed mitochondria. The details of the proteins
identified were listed in Table 2.1.
A B
Figure 2.13 Protein distributions in pooled CsCl fractions. Selected fractions obtained from
CsCl gradient centrifugation were pooled, and acetone precipitated as described in
Materials and Methods. Proteins in the pooled fractions were separated by SDS-PAGE and
stained with colloidal coomasie blue. M= Low molecular weight marker in kDa. Lanes 1-3:
Pool 1-3 of CsCl gradient fractions. Lysates from A: Non-fixed mitochondria B: fixed
mitochondria. Numbers in red indicate the protein bands cut from the gel for mass
spectrometric analysis.
M (kDa) 1 2 3 1 2 3
Non-fixed Fixed
1
2
3
4
5
6
7
8
16
15
14
13
12
11
10
9
17
18
21
27
31
9
10
11
12
13
14
20
15
16
17
18
19 45
97
66
30
20
3
2 1
4
6
7
8
19
22
23
20
24
25
26
28
29
30
33
32
5
50
Figure 2.14 Proteins identified from fixed and non-fixed mitochondria. The bands shown
in Figure 2.13 were excised and digested with trypsin prior to protein identification using
LC-MS/MS as described in Materials and Methods.
Table 2.1 Details of proteins identified in pooled fractions of fixed and unfixed
mitochondria. MW: Molecular weight. F: Fixed sample. NF: Non-fixed sample.
Full name Locus Pool
(number
treatment)
Tryptic
fragments
(number)
Predicted
MW
(Da)
Approximate
Observed
MW gel (Da)
Glycine-rich RNA-binding
protein 5
AT1g74230 2 F 2 28711 <30000
Malate dehydrogenase 1 AT1g53240 1 F 10 35782 30000-45000
Malate dehydrogenase 1 AT1g53240 1 NF 2 35782 30000
Malate dehydrogenase 2 AT3g15020 1 NF 12 35782 30000
Glutamate Dehydrogenase 1 AT5g18170 1 NF 7 44496 45000
Glutamate Dehydrogenase 2 AT5g07440 1 NF 10 44671 45000
Mitochondrial Lipoamide AT1g48030 1 NF 4 53954 60000
1. Malate dehydrogenase2 2. Glutamate Dehydrogenase 1 3. Glutamate Dehydrogenase 2 4. Mitochondrial Lipoamide Dehydrogenase 1 5. Mitochondrial Lipoamide Dehydrogenase 2 6. ATP synthase subunit beta-1, mitochondrial 7. Succinate-semialdehyde dehydrogenase,
mitochondrial
8. Citrate synthase 4, mitochondrial 9. NADH-cytochrome b5 reductase-like protein 10. Probable ATP synthase 24 kDa subunit,
mitochondrial 11. 20 kDa chaperonin, chloroplastic
(Chaperonin 10) (Ch-CPN10) (Cpn10) (Chaperonin 20) (Protein Cpn21)
12. ATP synthase subunit O, mitochondrial
13. (Oligomycin sensitivity conferral protein) (OSCP)
14. ATP synthase subunit d, mitochondrial (ATPase subunit d)
15. Peroxiredoxin-2F, mitochondrial 16. (Peroxiredoxin IIF) (Thioredoxin reductase 2F) 17. Endoribonuclease L-PSP family protein)
(Translational inhibitor protein like)
Malate dehydrogenase 1
Fixed Non-Fixed
Glycine-rich RNA-binding
protein 5
51
Discussion
Nucleic acid-binding proteins are not likely to be as abundant as other types of proteins in
mitochondria. However, their presence is likely to be important in regulating mitochondrial
gene expression. With the aim of identifying mitochondrial nucleic acid-binding proteins so
that their response to stress could be assessed, I attempted to develop an assay to purify and
identify these proteins from Arabidopsis thaliana cells grown in culture.
Dehydrogenase 1
Mitochondrial Lipoamide
Dehydrigenase 2
AT3g17240 1 NF 3 53954 45000-60000
ATP synthase subunit beta-1,
mitochondrial
AT5g08670 1 NF
2 59594 60000
Succinate-semialdehyde
dehydrogenase, mitochondrial
AT1g79440 1 NF 4 56523 45000-60000
Citrate synthase 4, mitochondrial AT2g44350 1 NF 2 52621 45000-60000
NADH-cytochrome b5
reductase-like protein
AT5g20080 1 NF 3 35964 30000
Probable ATP synthase 24 kDa
subunit, mitochondrial
AT2g21870 1 NF 3 27579 30000
20 kDa chaperonin, chloroplastic
(Cpn10)
AT5g20720 1 NF 6 26785 <30000
ATP synthase subunit O,
mitochondrial (OSCP)
At5g13450 1 NF 26305 <30000
Superoxide dismutase [Mn],
mitochondrial
At3g10920 1 NF 5 25428 <30000
ATP synthase subunit d,
mitochondrial
AT3g52300 1 NF 6 19574 20100-30000
Peroxiredoxin-2F, mitochondrial
(Thioredoxin reductase 2F)
AT3g06050 1 NF 3 21432 201000-
30000
(Endoribonuclease L-PSP family
protein) (Translational inhibitor
protein like)
AT3g20390 1 NF 4 19803 <20100
52
Using LC-MS/MS, proteins that were co-purified with mitochondrial nucleic acids by CsCl
gradient centrifugation technique were identified. Only proteins where two or more tryptic
peptides obtained from a single gel fragment and where the band had approximately the
expected mass on the gel were considered significant. The limited number of nucleic acid-
binding proteins detected could be due to several reasons. Firstly, proteins bound to nucleic
acid might be too low in abundance to be detectable by LC-MS/MS. Secondly, I speculate
that CsCl gradient centrifugation might vigorously disturb protein-nucleic acid interactions,
and formaldehyde fixation.
Seventeen proteins identified in non-fixed mitochondrial lysates came from pool 1. No
proteins were confidently detected in pools 2 and 3. These pools had less intense protein
bands visible on the SDS-PAGE gel than pool 1. Among the proteins identified,
endoriboluclease L-PSP has annotated with a nucleic acid-associated function.
Endoribonuclease is an enzyme that inhibits protein synthesis by cleavage of mRNA and is
involved in the regulation of purine biosynthesis (Morishita et al., 1999; Oka et al., 1995;
Rappu et al., 1999) which occurs in mitochondria and plastid (Atkins et al., 1997). This is
one of the nuclear encoded mitochondrial proteins that was found clustered in the DNA
metabolism loci in the Arabidopsis genome (Elo et al., 2003). Using SUB-cellular location
database for Arabidopsis proteins (SUBA) (Heazlewood et al., 2007), however, have shown
that this protein was localised to the plastid by MS/MS (Olinares et al., 2010).
A chaperonin was also identified. Although there was no strong evidence that it binds to
nucleic acid, many of them were classified as heat shock proteins that normally bound to
nucleic acids (Helen R, 2008). From the SUBA database, this protein was identified by
MS/MS and it was targeted to both mitochondria (Lee et al., 2008) and plastid (Olinares et
al., 2010). However, GFP experiments have localised this protein to peroxisomes (Cutler et
al., 2000) and plastids (Carrie et al., 2009). The other proteins identified were abundant
mitochondrial proteins involved in various aspects of mitochondrial metabolism. This
includes malate dehydrogenase (MDH), which was found in DNA-rich fractions of lysates
from both fixed and non-fixed mitochondria. Unpublished data by M.C. Freeman and D.G
Muench have shown that MDH possessed RNA-binding activity (Muench and Park, 2006).
In lysates of fixed mitochondria, only MDH and glycine-rich RNA binding protein 5 (GR-
RBP5) were indentified, which came from pool 1 and 2, respectively. SUBA has shown
53
that GR-RBP5 identified from the MS/MS was targeted to mitochondria (Ito et al., 2009).
Although GR-RBP5 has a capacity to bind RNA, it could also be that GR-RBP5 is
associated with ssDNA or dsDNA as demonstrated previously for GR-RBP4 in
Arabidopsis. GR-RBP4 was also found to interact with non-specific RNA homopolymers
(Kwak et al., 2005).
The function of GR-RBP5 during stress is not clear compared to other GR-RBP family
members. However, the transcripts level of GR-RBP5 increased about two-fold during cold
treatment in Arabidopsis (Kwak et al., 2005). There are eight members of glycine rich
RNA-binding proteins. GR-RBP2 and GR-RBP7 induce seed germination and seedling
growth under low temperature (Kim et al., 2008), while GR-RBP4 is involved in cold and
salinity stress (Kwak et al., 2005).
Previously, formaldehyde has been used successfully as a cross-linking agent to maintain
nucleic acid- protein interactions in isolated mitochondria in yeast, mammals and plants
(Kaufman et al., 2000; Kucej and Butow, 2007; Orlando et al., 1997; Saleh et al., 2008).
The formaldehyde concentration for fixation and strength, and length of the heat treatment
for reversing the cross-linking were optimised for Arabidopsis suspension cells. The most
intensely staining mtDNA band was identified in mitochondrial lysates treated with 0.5 %
formaldehyde followed by an overnight heat treatment at 70 oC. Typically, 0.2 % to 1%
formaldehyde was used for cross-linking in yeast (Sutherland et al., 2008) and 1 % for
Arabidopsis plant tissues (Saleh et al., 2008). Formaldehyde concentration at 1 % has
succeeded in recovering protein and nucleic acids, thus this percentage was used
throughout the experiments.
In my study, glycerol gradient and CsCl gradient centrifugation, alone and in combination,
were tested to isolate proteins that were associated with mitochondrial nucleic acid. The
combination technique did not give a good protein recovery, thus CsCl gradient
centrifugation technique alone was proceed. Protein distributions in the mitochondrial
lysates subjected to differential centrifugation were analysed beforehand. More intense
protein bands were visible in the pellet of fixed-mitochondrial lysates. This was expected as
larger protein complexes sedimented faster than the non-fixed control. With this
expectation, my first attempt to isolate mitochondrial nucleic acid-binding proteins was by
54
using glycerol gradient centrifugation. Glycerol gradient centrifugation is a rate zonal
centrifugation technique, enabling particles to be separated based on size, shape and density
(Cline et al., 1971). This method gives the opportunity to remove non-protein-DNA
complexes materials, such as small soluble proteins, cofactors and enzymes. It was
expected that mtDNA-protein complexes will be separated from small proteins as the
complexes would have much larger sizes, causing them to move to the bottom of the
gradient faster.
DNA could be degraded by high temperature. In this experiment, high temperature is
needed to reverse the formaldehyde crosslinking. Heating at 700C is sufficient to recover
DNA although it might have little effect on degrading DNA. From agarose gel
electrophoresis, low intensity DNA bands were visible in the fixed compared to the non-
fixed mitochondrial lysates fractionated by glycerol gradient centrifugation. This correlated
with the observed decrease in intensity of DNA staining in mitochondrial lysates subjected
to formaldehyde fixation and reversal during the experiments to optimise the fixation. The
decrease staining might be due to formaldehyde treatment that may have masked DNA
from staining. In addition, the glycerol itself might interfere in obtaining sharp bands after
the electrophoresis.
SDS-PAGE analysis of fractions collected after the glycerol gradient centrifugation showed
that most of the proteins remained near the top of the gradient for the fixed mitochondrial
lysates. This was not surprising because the majority of mitochondrial proteins will not be
associated with nucleic acids. Smaller sizes of these proteins prevented them from
penetrating the gradient. However, as fixation might retain protein-nucleic acids
complexes, more protein bands were anticipated to be visible in the bottom fractions of the
gradient. Since this did not happen, I have concluded that glycerol gradient centrifugation
was not adequate to purify mitochondrial nucleic acid-binding proteins.
The next attempt was protein fractionation by CsCl gradient centrifugation, which allows
molecules to be separated based on buoyant density. Proteins, which have a lower buoyant
density than nucleic acids, will band nearer the top of the gradient, DNA in the middle and
RNA at the lowest part of the tube as RNA density is higher than DNA (Carr and Griffith,
1987).
55
In earlier work, isopycnic centrifugation using metrazamide of glycerol gradient-purified
mitochondrial nucleoids from Xenopus oocytes allowed mtTFA, mtSSB and novel proteins
that interact with the nucleoids which are adenine nucleotide translocator 1, the lipoyl-
containing E2 subunits of pyruvate dehydrogenase, branched chain α-ketoacid
dehydrogenase and prohibitin 2 to be identified (Bogenhagen et al., 2003). Attempt to use
the two-step gradient centrifugation (glycerol gradient centrifugation followed by CsCl
gradient centrifugation) was not suitable to recover proteins interacting with mitochondrial
nucleic acid in Arabidopsis cells, as the protein abundance decreased tremendously after
the second gradient.
I then focused the approach to using single step CsCl gradient centrifugation. In yeast,
formaldehyde cross-linked mitochondrial nucleoids were able to be purified on CsCl
gradients. This allowed several proteins, including Abf2, Hsp60 and Kgd2p, to be identified
as potential mtDNA-binding proteins (Kaufman et al., 2000). In previous work using
Arabidopsis cultured cells, mtDNA was detected only in the pellet of CsCl gradient-
separated lysates of unfixed Arabidopsis mitochondria. The mtDNA moved from the pellet
to higher fractions when treated with formaldehyde (Thirkettle-Watts, unpublished results),
suggesting that its buoyant density decreased due to associations with proteins. In my
study, however, mitochondrial nucleic acid from the non-fixed mitochondrial lysates was
detected not only in the pellet, but also in some of lower fractions, which suggests stable
and strong interactions between nucleic acid and protein in mitochondria. Proteins and
DNA were visible in both high and low density fractions, suggesting proteins co-purifying
with nucleic acid were separated from other free proteins. Thus, single step CsCl gradient
centrifugation was found to be a better separation method than glycerol gradients or the
combination of both techniques.
Apart from several proteins associated with mitochondrial nucleic acids, many of the
proteins identified were redox active proteins such as peroxiredoxin and dehydrogenase-
related proteins. These proteins were co-purified with mitochondrial nucleic acids and
detected in dense protein fractions of non-fixed mitochondrial lysates after fractionated by
CsCl gradient centrifugation. As they were only detected in non-formaldehyde fixed
samples, it could be that the presence was due to their intrinsic density properties. Redox
56
proteins involved in various functions in cells including the transport of electron, gene
regulation and signalling (Kamata and Hirata, 1999).
In conclusion, GR-RBP5, endoribonuclease L-PSP, CPN 20, MDH1 and MDH2 were
proteins found in this study that may be associated with mitochondrial nucleic acid of
Arabidopsis thaliana cells grown in culture. Cells used for mitochondrial isolation were
collected at day 7, at the end of the culture cycle, before subculturing into fresh medium.
These cells were Pi depleted (Chapter 3). Based on the findings, CsCl gradient has a limited
capacity to fractionate mitochondrial proteins, thus it is not suitable to use this assay to
detect the differences in mitochondrial nucleic acid-binding proteins in response to
phosphate availability.
Materials and Methods
Plant Materials
Arabidopsis thaliana accession Landsberg erecta cell suspension cultures (May and
Leaver, 1993) were maintained by weekly sub-culturing in Murashige and Skoog basal
medium (Murashige and Skoog, 1962) (Phytotechlab, Shawnee Mission, KS USA)
supplemented with 3 % (w/v) sucrose, 0.5 mg/L naphthalene acetic acid (NAA) and 0.05
mg L-1
kinetin . The pH was adjusted to 5.8 using 1 M KOH. For sub-culturing, 27 ml of 7
day-old cells were transferred into 100 ml fresh medium in 250 ml Erlenmeyer flasks under
sterile conditions. Cells for maintenance were grown under continuous light and cells for
mitochondrial preparation were grown in the dark. The dark treatment reduced plastid
contamination during mitochondrial preparation. Cells were grown at 22 oC with shaking at
140 rpm.
Isolation of mitochondria from Arabidopsis thaliana cell cultures
Mitochondria were prepared using two-step Percoll™ (Pharmacia, Uppsala, Sweden)
gradient centrifugation (Millar et al., 2001a; Millar et al., 2001b). Dark-grown 7-day old
cells from 10 to 12 flasks were harvested by filtering the suspension cultures through four
layers of Miracloth (Calbiochem®, Merck, Darmstadt, Germany). Approximately 600 ml
57
extraction buffer (0.45 M mannitol, 50 mM tetra-sodium pyrophosphate, 0.5 % (w/v)
bovine serum albumin (BSA), 0.5 % (w/v) polyvinylpyrrolidone 40, 2 mM ethylene glycol
tetra-acetic acid (EGTA), 20 mM cysteine, pH 8.0) was added to the cells. The cells were
homogenised using a blender (Waring, Torrington, USA), once for 10 s at high speed and
twice for 10 s at medium speed, with a 30 s break between steps. Cell homogenates were
filtered through four layers of Miracloth, transferred into tubes and subjected to differential
centrifugation. The first centrifugation was at 2500 x g for 10 min at 4 oC (JA 20 fixed-
angel rotor, Beckman Coulter, Fullerton, CA, USA). The supernatant was collected and
subjected to centrifugation at 18,000 x g for 20 min at 4 oC (JA 20 fixed-angel rotor). The
pellet was gently resuspended with 1 X mannitol wash buffer (0.3 M mannitol, 10 mM N-
tris (hydroxymethyl) methyl- 2-aminoethane sulfonic acid (TES) free acid, 0.1 % (w/v)
BSA, pH 7.5). The suspension was layered onto a Percoll™
gradient that contained 5 ml of
40 % (v/v) Percoll™
, 25 ml of 25 % (v/v) Percoll™
and 5 ml of 18 % (v/v) Percoll™
in
mannitol wash buffer (Figure 2.1) prior to centrifugation at 40,000 x g for 45 min (JA 25.5
rotor, Beckman Coulter, Fullerton, CA, USA). Mitochondria were collected as a grey band
between the 25 % (v/v) and 40 % (v/v) Percoll™
interface. The mitochondria were washed
with 1 X sucrose buffer (0.3 M sucrose, 10 mM TES free acid, 0.1 % (w/v), BSA pH 7.5)
and subjected to centrifugation at 10,000 x g for 10 min at 4 oC. The pellet was collected
and subjected to centrifugation in 35 % (v/v) Percoll™
in sucrose wash buffer for 45 min,
40,000 x g at 4 oC. The mitochondria that banded at the upper part of the tube were
collected, transferred to a new tube and washed with sucrose wash buffer without BSA
prior to centrifugation at 10,000 x g for 10 min at 4 oC. The final washing step was repeated
three times to remove residual Percoll™
.
Preparation of mitochondrial lysates for gradient centrifugation
Isolated mitochondria were resuspended in sucrose wash buffer without BSA and the
protein concentration determined (Marion M, 1976) using a commercial reagent
(Coomassie Plus Protein Assay Reagent, Pierce, Rockford, USA). The absorbance was
recorded at 595 nm (UVmini-1240 UV-VIS spectrophotometer, Shimatzu Scientific
Instruments, Sydney, Australia) and the protein concentration determined based on a BSA
standard curve. The mitochondria were treated with micrococcal nuclease (0.03 U µl-1
) for
1 h on ice. The reaction was terminated by adding 10 mM EGTA pH 8.0. The mitochondria
58
were collected, washed once with wash buffer and diluted to 2 mg ml-1
with cross-linking
buffer (0.5 M sucrose, 68 mM HEPES, 50 mM NaCl, 2 mM EDTA, 1 mM EGTA, pH 7.4).
For protein-nucleic acid fixation, formaldehyde was added to the mitochondria to 1 % (v/v)
and incubated at 4 oC for 2 h with slow mixing. The reaction was terminated by adding 125
mM glycine pH 7.0. The mitochondria were collected and stored at -80 oC. Mitochondria
were thawed and resuspended in lysis buffer (20 mM HEPES pH 8, 2 mM EDTA, fresh 2
mM dithiothreitol (DTT), homogenised with a dounce homogeniser and lysed by adding 1
% (w/v) Sarkosyl. RNase A was added to 50 µg ml-1
final concentration before incubating
1 h at room temperature.
Fractionation of mitochondrial lysates
Gradient solutions were prepared in centrifuge tubes and 700 µl of mitochondrial lysates
was layered onto the gradient.
Rate Zonal Centrifugation using Glycerol Gradients
Linear glycerol gradients contained 15 % (v/v) to 40 % (v/v) glycerol in 30 mM HEPES,
pH 8.0, 2 mM EDTA, 20 mM NaCl, fresh 2 mM DTT). Mitochondrial lysates layered on
top of glycerol gradients were subjected to centrifugation at 186,000 x g for 1 h at 4 oC
(SW-41 swing out rotor, L-70 Ultracentrifuge, Beckman, CA, USA).
Isopycnic Centrifugation using CsCl Gradients
The refractive index of mitochondrial lysates was adjusted to 1.365 with solid CsCl. CsCl
solution 48.8 % (w/v) prepared in Tris-EDTA (TE) buffer with 1 % (w/v) sarkosyl was
added to balance tubes prior to centrifugation at 260,000 x g for 16 h at 25 o
C (NVT65
fixed angle near vertical rotor, L-70 Ultracentrifuge, Beckman, CA, USA).
Gradients were gravity fractionated after centrifugation by collecting about 700 μl aliquots
(Figure 2.5). Fractions from CsCl gradients were dialysed against TE buffer pH 8.0 at 4 oC
for 16 hours with a 7000 Da cut off (Snake Skin Dialysis Tubing, Pierce, Thermo
Scientific, USA). Unless otherwise indicated, the formaldehyde cross-links were reversed
by heat treatment at 70 oC for 1 h.
59
Agarose gel electrophoresis
1 % (w/v) agarose gels were used for DNA analysis. DNA samples were mixed with
loading dye prior to electrophoresis in 1 X TBE running buffer (Sambrook et al., 1989).
Gels were incubated in 1 X staining SYBR® Gold (Invitrogen) solution for 16 h. 1X
solution was the SYBR® Gold stock diluted into TBE (89 mM Tris Base, 89 mM boric
acid, 1 mM EDTA, pH 8.0). The gel image was captured using a gel documentation
instrument (Electrophoresis Gel Imaging Scanner Analyzer).
SDS-PAGE
SDS-PAGE was carried out based on Laemmli (1970) (Miniprotein System, Bio-Rad-
Laboratories, Gladesville, Australia). The stacking gel solution (125 mM Tris-
hydrochloride (Tris-HCl) pH 6.8, 0.1 % (w/v) SDS, 4 % (w/v) acrylamide (acrylamide :
bis-acrylamide ratio of 37.5 : 1), 0.05 % (w/v) ammonium persulphate and 0.05 % (v/v)
N,N,N’,N’-tetramethylethane-1,2-diamine (TEMED) was overlayed on the separating gel
solution (375 mM Tris-HCl pH 8.8, 0.1 % (w/v) SDS, 12 % (w/v) acrylamide, 0.05 % (w/v)
ammonium persulphate and 0.5 % (v/v) TEMED). Samples were mixed with 2 X sample
buffer (125 mM Tris-HCl, pH 6.8, 4 % (w/v) SDS, 20 % (v/v) glycerol, 0.004 % (w/v)
bromophenol blue, 20 % (v/v) 2-mercaptoethanol) and heated for 5 min at 90 oC, followed
by centrifugation at 10,000 x g for 5 min at 25 oC. Samples were loaded on the gel and
separated at 200 V until the bromophenol blue reached the bottom of the gel. The gel was
stained with either:
a) Coomassie Blue: The gel was incubated in Coomassie blue R-250 (0.05 % (w/v)
coomassie blue R-250, 10 % (v/v) acetic acid, 40 % (v/v) methanol) for 16 h and
transferred to destaining solution (20 % (v/v) methanol, 7 % (v/v) acetic acid). Gel was
destained until the protein bands are visible and the gel background was colourless. The
image was captured using gel documentation equipment (Electrophoresis Gel Imaging
Scanner Analyzer).
60
b) Silver staining: The gel was incubated in fixation solution (50 % (v/v) methanol, 10 %
(v/v) glacial acetic acid) from 2 to 16 h. It was then transferred to incubation solution (30 %
ethanol (v/v), 0.2 % (v/v) sodium thiosulphate, 0.8 M anhydrous sodium acetate and 0.5 %
(v/v) gluteraldehyde) for 2 h, prior to staining with 0.1 % (w/v) silver nitrate in 0.01 %
(v/v) formaldehyde for 30 min. The gel was rinsed with deionised water and protein bands
were developed by incubating the gel in a solution containing 2.5 % (w/v) sodium
carbonate, 0.01 % (v/v) formaldehyde, pH 10.9. The development was terminated with 0.05
M EDTA. The image was captured using gel documentation equipment (Electrophoresis
Gel Imaging Scanner Analyzers).
c) Flamingo™
: The gel was soaked in 1 X Flamingo™
fluorescent reagent (Pierce,
Rockford, USA) for 16 h at 4 oC with 50 rpm shaking. The gel was imaged using a laser
scanner (Typhoon™
Laser scanner, GE Healthcare, Sydney, Australia) using blue laser 473
nm excitation wavelength with 530 nm emission filter.
d) Colloidal Coomassie: The gel was stained in colloidal coomassie solution (0.08 % (w/v)
coomassie G-250, 0.96 % (w/v) ortho-phosphoric acid, 8 % (w/v) ammonium sulphate
(NH4)2SO4, 20 % methanol) for 16 h. For destaining, gels were incubated in 0.5 % (w/v)
phosphoric acid.
Protein concentration methods
For spin columns, 500 μl samples were subjected to centrifugation at 15,000 x g, 4 oC on
spin columns having a 5000 kDa molecular weight cut-off (Ultrafree®-MC Centrifugal
Filter Units, Milipore Corporation, Billerica MA) until the volume was reduced to 20 μl for
recovery. For acetone precipitation, samples were mixed thoroughly with 4 volume (vol)
cold acetone prior to incubating at -20 o
C for at least 16 h. The samples were subjected to
centrifugation at 14,000 x g, 4 oC for 10 min. The supernatant was discarded and the pellet
was washed with 80 % of -20 oC cold acetone. The washing step was repeated twice and the
pellet was air dried. Precipitated proteins were dissolved in 20 μl sample buffer as
described for SDS-PAGE. For methanol-chloroform precipitation, samples were mixed
thoroughly with methanol: chloroform: water (4 : 1 : 2.5). The precipitate was collected by
centrifugation at 14,000 x g for 10 min at 4 oC. The aqueous phase was discarded and 2.5
61
vol methanol was added followed by centrifugation at the same conditions. The supernatant
was discarded and the pellet was air dried. Precipitated proteins were resuspended in 20 μl
sample buffer as described in SDS-PAGE.
In-gel trypsin digestion
Protein bands were excised from colloidal coomassie stained gels and subjected to in-gel
trypsin digestion (Shevchenko et al., 1996). Destaining solution (50 % (v/v) acetonitrile, 10
mM NH4HCO3) was added to the excised protein bands and incubated for 45 min with 800
rpm orbital shaking. The destaining was repeated. The gel was dried for 20 min at 50 oC
prior to digestion of the protein with 12.5 μg ml-1
trypsin, 10 mM NH4HCO3 at 37 oC for at
least 16 h. The gel was mixed with acetonitrile and incubated for 15 min with 800 rpm
orbital shaking. For peptide extraction, the supernatant was collected, transferred to a 96-
well microtitre plate and mixed with extraction solution (50 % (v/v) acetonitrile, 5 % (v/v)
formic acid). Samples were incubated with 800 rpm orbital shaking for 15 min. The
resulting supernatant was removed and stored in a 96-well microtitre plate. The peptide
extraction was repeated and collected supernatants were dried for 1 h under vacuum (Speed
Vac, Labconco, Kansas City, MO, USA).
Liquid Chromatography (LC)-electrospray-ionisation 9 ESI) - Ion Trap
For mass spectrometry analysis, dried tryptic peptides were resuspended in 5 % (v/v)
acetonitrile and 0.01 % (v/v) formic acid, and loaded to a microtitre plate. Samples were
loaded onto self-packed Microsorb (Varian Inc.) C18 (5 µm, 100 Å) reverse phase columns
(0.5 x 50 mm) using an Agilent Technologies 1100 series capillary liquid chromatography
system and eluted into an Agilent XCT Ultra IonTrap mass spectrometer with an ESI
source equipped with a low flow nebuliser in positive mode and controlled by Chemstation
(Rev B.01.03 [204]: Agilent Technologies) and MSD Trap Control v 6.0 (Build 38.15)
software (Bruker Daltonik). Peptides were eluted from the C18 reverse phase column at 10
µL min-1
using a 9 minute acetonitrile gradient (5 – 60 %) in 0.1% (v/v) formic acid at a
regulated temperature of 50 °C. The method used for initial ion detection utilized a mass
range of 200 – 1400 m/z with scan mode set to Standard (8100 m/z per sec) and a Ion
Charge Control (ICC) conditions set at 250000 with 3 Averages taken per scan. Smart
62
mode parameter settings were used using a Target of 800 m/z, a Compound Stability factor
of 90 %, a Trap Drive Level of 80 % and Optimize set to Normal. Ions were selected for
MS/MS after the intensity reached 80000 cps and two precursor ions were selected from the
initial MS scan. MS/MS conditions employed SmartFrag for ion fragmentation, a scan
range of 70 - 2200 m/z using an average of 3 scans, the exclusion of singly charged ions
option and ICC conditions set to 200000 in Ultra scan mode (26000 m/z per sec).
Protein identification
MS/MS spectra obtained were exported from the DataAnalysis for LC/MSD Trap version
3.3 (Build 149) software package (Bruker Daltonik) using default parameters for
AutoMS(n) and compound Export. Results extracted were queried against the Arabidopsis
protein set (TAIR 9, 33621 sequences; 13487170 residues) using the Mascot search engine
(Matrix Science, version 2.2.03) which utilizing error tolerances of ± 1.2 Da for MS and ±
0.6 Da for MS/MS, ‘Max Missed Cleavages’ set to 1, with variable modifications of
Oxidation (M), Carboxymethyl (C). Instrument set to ESI-TRAP and Peptide charge set at
2+ and 3+. Results were filtered using ‘Standard scoring’, ‘Max. number of hits’ set to 20,
‘Significance threshold’ at p< 0.05 and ‘Ions score cut-off’ at homology level,
approximately 38.
References
Alam T.I., Kanki T., Muta T., Ukaji K., Abe Y., Nakayama H., Takio K., Hamasaki
N., Kang D. (2003) Human mitochondrial DNA is packaged with TFAM. Nucleic
Acids Research 31:1640-1645
Atkins C.A., Smith P., Storer P.J. (1997) Reexamination of the intracellular localization
of de novo purine synthesis in cowpea nodules. Plant Physiology 113:127-135
Aubert S., Bligny R., Day D.A., Whelan J., Douce R. (1997) Induction of alternative
oxidase synthesis by herbicides inhibiting branched-chain amino acid synthesis.
Plant Journal 11:649-657
Bogenhagen D.F., Wang Y., Shen E.L., Kobayashi R. (2003) Protein components of
mitochondrial DNA nucleoids in higher eukaryotes. Molecular Cell Proteomics
2:1205-1216
Carr S.M., Griffith O.M. (1987) Rapid isolation of animal mitochondrial DNA in a small
fixed-angle rotor at ultrahigh speed. Biochemical Genetics 25:385-390
Carrie C., Kuhn K., Murcha M.W., Duncan O., Small I.D., O'Toole N., Whelan J. (2009) Approaches to defining dual-targeted proteins in Arabidopsis. Plant Journal
57:1128-1139
63
Clifton R., Lister R., Parker K.L., Sappl P.G., Elhafez D., Millar A.H., Day D.A.,
Whelan J. (2005) Stress-induced co-expression of alternative respiratory chain
components in Arabidopsis thaliana. Plant Molecular Biology 58:193-212
Cline G.B., Ryel R.B., William B.J. (1971) [18] Zonal centrifugation, Methods in
Enzymology, Academic Press.168-204
Considine M.J., Daley D.O., Whelan J. (2001) The expression of alternative oxidase and
uncoupling protein during fruit ripening in mango. Plant Physiology 126:1619-1629
Cutler S.R., Ehrhardt D.W., Griffitts J.S., Somerville C.R. (2000) Random GFP ::
cDNA fusions enable visualization of subcellular structures in cells of Arabidopsis
at a high frequency. Proceedings of the National Academy of Sciences of the United
States of America 97:3718-3723
Diffley J.F., Stillman B. (1992) DNA binding properties of an HMG1-related protein from
yeast mitochondria. Biological Chemistry 267:3368-3374
Elo A., Lyznik A., Gonzalez D.O., Kachman S.D., Mackenzie S.A. (2003) Nuclear genes
that encode mitochondrial proteins for DNA and RNA metabolism are clustered in
the Arabidopsis genome. Plant Cell 15:1619-1631
Flagella Z., Trono D., Pompa M., Di Fonzo N., Pastore D. (2006) Seawater stress
applied at germination affects mitochondrial function in durum wheat (Triticum
durum) early seedlings. Functional Plant Biology 33:357-366
Heazlewood J.L., Verboom R.E., Tonti-Filippini J., Small I., Millar A.H. (2007)
SUBA: The Arabidopsis subcellular database. Nucleic Acids Research 35:D213-
D218
Helen R S. (2008) Chaperone machines in action. Current Opinion in Structural Biology
18:35-42
Hirose T., Sugita M., Sugiura M. (1994) Characterization of a cDNA encoding a novel
type of RNA-binding protein in tobacco: its expression and nucleic acid-binding
properties. Molecular and General Genetics MGG 244:360-366
Ito J., Taylor N.L., Castleden I., Weckwerth W., Millar A.H., Heazlewood J.L. (2009)
A survey of the Arabidopsis thaliana mitochondrial phosphoproteome. Proteomics
9:4229-4240
Jones A. (2000) Does the plant mitochondrion integrate cellular stress and regulate
programmed cell death? Trends in Plant Science 5:225-230.
Juszczuk I., Malusa E., Rychter A.M. (2001) Oxidative stress during phosphate
deficiency in roots of bean plants (Phaseolus vulgaris L.). Plant Physiology
158:1299-1305
Kamata H., Hirata H. (1999) Redox regulation of cellular signalling. Cellular Signalling
11:1-14
Kaufman B.A., Newman S.M., Hallberg R.L., Slaughter C.A., Perlman P.S., Butow
R.A. (2000) In organello formaldehyde crosslinking of proteins to mtDNA:
Identification of bifunctional proteins. Proceedings of the National Academy of
Sciences of the United States of America 97:7772-7777
Khazi F.R., Edmondson A.C., Nielsen B.L. (2003) An Arabidopsis homologue of
bacterial RecA that complements an E. coli recA deletion is targeted to plant
mitochondria. Molecular Genetics and Genomics 269:454-463
Kim C.Y., Bove J., Assmann S.M. (2008) Overexpression of wound-responsive RNA-
binding proteins induces leaf senescence and hypersensitive-like cell death. New
Phytologist 180:57-70
Kucej M., Butow R.A. (2007) Evolutionary tinkering with mitochondrial nucleoids.
Trends in Cell Biology 17:586-592
64
Kucej M., Kucejova B., Subramanian R., Chen X.J., Butow R.A. (2008) Mitochondrial
nucleoids undergo remodeling in response to metabolic cues. Cell Science
121:1861-1868
Kuhn K., Weihe A., Borner T. (2005) Multiple promoters are a common feature of
mitochondrial genes in Arabidopsis. Nucleic Acids Research 33:337-346
Kwak K.J., Kim Y.O., Kang H. (2005) Characterization of transgenic Arabidopsis plants
overexpressing GR-RBP4 under high salinity, dehydration, or cold stress.
Experimental Botany 56:3007-3016
Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227 (5259): 680-685
Latchman D.S. (1997) Transcription factors: An overview. The International Journal of
Biochemistry and Cell Biology 29:1305-1312
Lee C.P., Eubel H., O'Toole N., Millar A.H. (2008) Heterogeneity of the mitochondrial
proteome for photosynthetic and non-photosynthetic Arabidopsis metabolism.
Molecular and Cellular Proteomics 7:1297-1316
Ludevid M.D., Freire M.A., Gómez J., Burd C.G., Albericio F., Giralt E., Dreyfuss G.,
Pagès M. (1992) RNA binding characteristics of a 16 kDa glycine-rich protein from
maize. Plant Journal 2:999-1003
Marion M B. (1976) A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Analytical
Biochemistry 72:248-254
Martin C., Ellis N., Rook F. (2010) Do transcription factors play special roles in adaptive
variation? Plant Physiology 154:506-511
Matsushima Y., Garesse R., Kaguni L.S. (2004) Drosophila mitochondrial transcription
factor B2 regulates mitochondrial DNA copy number and transcription in Schneider
cells. Biological Chemistry 279:26900-26905
Matsushima Y., Adan C., Garesse R., Kaguni L.S. (2005) Drosophila mitochondrial
transcription factor B1 modulates mitochondrial translation but not transcription or
DNA copy number in Schneider cells. Biological Chemistry 280:16815-16820
May M.J., Leaver C.J. (1993) Oxidative stimulation of glutathione synthesis in
Arabidopsis thaliana suspension cultures. Plant Physiology 103:621-627
Millar A.H., Liddell A., Leaver C.J. (2001a) Isolation and subfractionation of
mitochondria from plants, Methods in Cell Biology, Vol 65, Academic Press Inc,
San Diego. pp. 53-74
Millar A.H., Sweetlove L.J., Giege P., Leaver C.J. (2001b) Analysis of the Arabidopsis
mitochondrial proteome. Plant Physiology 127:1711 - 1727
Morishita R., Kawagoshi A., Sawasaki T., Madin K., Ogasawara T., Oka T., Endo Y.
(1999) Ribonuclease activity of rat liver perchloric acid-soluble protein, a potent
inhibitor of protein synthesis. Biological Chemistry 274:20688-20692
Muench D.G., Park N. I. (2006) Messages on the move: the role of the cytoskeleton in
mRNA localization and translation in plant cells. Canadian Journal of Botany
84:572-580
Murashige T., Skoog F. (1962) A revised medium for rapid growth and bio assays with
tobacco tissue cultures. Physiologia Plantarum 15:473-497
Oka T., Tsuji H., Noda C., Sakai K., Hong Y.M., Suzuki I., Muñoz S., Natori Y. (1995)
Isolation and characterization of a novel perchloric acid-soluble protein inhibiting
cell-free protein synthesis. Jurnal of Biological Chemistry 270:30060-30067
Olinares P.D.B., Ponnala L., van Wijk K.J. (2010) Megadalton complexes in the
chloroplast stroma of Arabidopsis thaliana characterized by size exclusion
65
chromatography, mass spectrometry, and hierarchical clustering. Molecular and
Cellular Proteomics 9:1594-1615
Orlando V., Strutt H., Paro R. (1997) Analysis of chromatin structure by in vivo
formaldehyde cross-linking. Methods 11:205-214
Parsons H.L., Yip J.Y.H., Vanlerberghe G.C. (1999) Increased respiratory restriction
during phosphate-limited growth in transgenic tobacco cells lacking alternative
oxidase. Plant Physiology 121:1309-1320
Rappu P., Shin B.S., Zalkin H., Maentsaelae P. (1999) A role for a highly conserved
protein of unknown function in regulation of Bacillus subtilis purA by the purine
repressor. Bacteriology 181:3810-3815
Richter U., Kiessling J., Hedtke B., Decker E., Reski R., Borner T., Weihe A. (2002)
Two RpoT genes of Physcomitrella patens encode phage-type RNA polymerases
with dual targeting to mitochondria and plastids. Gene 290:95-105
Riechmann J.L., Heard J., Martin G., Reuber L., Jiang C.Z., Keddie J., Adam L.,
Pineda O., Ratcliffe O.J., Samaha R.R., Creelman R., Pilgrim M., Broun P.,
Zhang J.Z., Ghandehari D., Sherman B.K., Yu C.L. (2000) Arabidopsis
transcription factors: Genome-wide comparative analysis among eukaryotes.
Science 290:2105-2110
Saleh A., Alvarez-Venegas R., Avramova Z. (2008) An efficient chromatin
immunoprecipitation (ChIP) protocol for studying histone modifications in
Arabidopsis plants. Nature Protocols 3:1018-1025
Sambrook J., E.F.Fritsch, T. Maniatis (1989) Molecular cloning: A laboratory Manual
2nd
Ed. Cold Spring Harbor Laboratory Press
Shedge V., Arrieta-Montiel M., Christensen A.C., Mackenzie S.A. (2007) Plant
mitochondrial recombination surveillance requires unusual RecA and MutS
homologs. The Plant Cell Online 19:1251-1264
Shen E.L., Bogenhagen D.F. (2001) Developmentally-regulated packaging of
mitochondrial DNA by the HMG-box protein mtTFA during Xenopus oogenesis.
Nucleic Acids Research 29:2822-2828
Shevchenko A., Wilm M., Vorm O., Mann M. (1996) Mass spectrometric sequencing of
proteins from silver stained polyacrylamide gels. Analytical Chemistry 68:850-858
Shutt T., Gray M. (2006) Twinkle, the mitochondrial replicative DNA helicase, is
widespread in the eukaryotic radiation and may also be the mitochondrial DNA
primase in most eukaryotes. Molecular Evolution 62:588-599
Singh K.B. (1998) Transcriptional regulation in plants: The importance of combinatorial
control. Plant Physiology 118:1111-1120
Solomon M.J., Varshavsky A. (1985) Formaldehyde-mediated DNA-protein crosslinking:
a probe for in vivo chromatin structures. Proceedings of the National Academy of
Sciences of the United States of America 82:6470-6474
Sutherland B.W., Toews J., Kast J. (2008) Utility of formaldehyde cross-linking and
mass spectrometry in the study of protein-protein interactions. Mass Spectrometry
43:699-715
Svensson A.S., Johansson F.I., Møller I.M., Rasmusson A.G. (2002) Cold stress
decreases the capacity for respiratory NADH oxidation in potato leaves. FEBS
Letters 517:79-82
Takata K., Yoshida H., Hirose F., Yamaguchi M., Kai M., Oshige M., Sakimoto I.,
Koiwai O., Sakaguchi K. (2001) Drosophila mitochondrial transcription factor A:
Characterization of Its cDNA and expression pattern during development.
Biochemical and Biophysical Research Communications 287:474-483
66
Vermel M., Guermann B., Delage L., Grienenberger J.-M., Maréchal-Drouard L.,
Gualberto J.M. (2002) A family of RRM-type RNA-binding proteins specific to
plant mitochondria. Proceedings of the National Academy of Sciences 99:5866-
5871
Zaegel V., Guermann B., Le Ret M., Andrés C., Meyer D., Erhardt M., Canaday J.,
Gualberto J.M., Imbault P. (2006) The plant-specific ssDNA binding protein
OSB1 is involved in the stoichiometric transmission of mitochondrial DNA in
Arabidopsis. The Plant Cell Online 18:3548-3563
67
CHAPTER 3:
Arabidopsis thaliana cells in suspension cultures alter their
physiological, transcript and metabolite responses during
phosphate depletion and re-supply
68
Abstract
Phosphate (Pi) is a plant macronutrient that is often limiting for growth. Pi deficiency leads
to stress. Plants have various adaptations to survive Pi deprivation. For example, plants
typically increase the capacity of Pi transport through membranes by up-regulating the
expression of numerous Pi transporters of the PHT gene family. This chapter aimed to
develop a cell culture approach to understand how each member of the PHT1, PHT2 and
PHT3 gene families responds to Pi depletion and re-supply. Cell suspension cultures have
several advantages over the whole plant system. Cultures quickly produce many uniform
cells and can be easily manipulated. Arabidopsis thaliana (Arabidopsis) cells responded
quickly when subcultured into fresh media containing Pi. They rapidly took the majority of
Pi out of the media and the cell biomass increased. As in plant tissues, the transcripts of
several PHT gene family members were repressed in P-containing medium. Pi resupply to
Pi-deprived cells also caused the cells to switch from fermentation to a normal respiration
pathway. As Pi in the medium became depleted during growth, the Pi inside the cells
decreased but the biomass continued to increase for an extended period before cell
proliferation became inhibited, presumably due to Pi limitation. As Pi inside the cells
declined, several PHT gene transcripts started to be up-regulated, presumably to increase
the capacity of Pi uptake. However, the onset of induction varied from gene to gene. During
Pi depletion, the amounts of lactic acid increased indicating cells initiated a fermentation
process. Some sugars and organic acids that are mainly involved in the citric acid cycle
increased in abundance while the amounts of some amino acids decreased, reversing the
direction from their abundance change in Pi-resupplied cells. These results confirm and
extend previous work demonstrating that Arabidopsis suspension cells, like whole plants,
alter their physiological and molecular metabolism to maintain their survival under various
Pi conditions.
69
Introduction
Like other living organisms, plants need sufficient nutrients to sustain their growth and
development. Phosphorus (P) is one of the major nutrients that are necessary for plants and
Pi deficiency causes plant stress. Although there is a high level of P present in most soils,
most of it usually forms complexes with cations such as aluminium and iron, making it
hardly accessible to plants (Bieleski, 1973). Thus, plants typically need to adjust their
biochemical and cellular metabolisms to survive Pi limitation.
Lack of local Pi supply which is independent of internal Pi content will lead plants to
respond by altering their root morphology (Robinson, 1994; Bates and Lynch, 2001;
Williamson et al., 2001; Lynch and Brown, 2008). This is to acquire more P from soil. P is
taken up by plants in the form of the orthophosphate ion (PO43-
) and the capacity of Pi
uptake is increased by the up-regulation of members of the various Pi transporter gene
families (Muchhal et al., 1996; Mudge et al., 2002; Shin et al., 2004). The Pi acquired from
soil will be strategically used during low P conditions. For example, Pi may be translocated
from older to younger tissues or released from P-containing compounds (Vance et al.,
2003).
When plants change their physiological and molecular metabolisms, it indicates that the
gene expression patterns are altered. Transcriptome studies using microarrays in
Arabidopsis (Wu et al., 2003; Hammond et al., 2004; Misson et al., 2004) rice (Wasaki et
al., 2003; Li et al., 2010) and lupin (Uhde-Stone et al., 2003) revealed that the expression of
many genes involved in various functions were co-ordinately changed during Pi-deficiency.
Among them are the genes involved in regulation of the Pi-starvation responses and
signalling. Information related to Pi sensing and signalling in plants are still lacking, unlike
in yeast (Oshima, 1997) and bacteria (Vershinina and Znamenskaya, 2002) which has been
well characterised. To date, several genes were found to be involved Pi regulation in plants;
this includes a membrane protein PHO1 that contains SPX and EXS domains and PHO2
that encodes a ubiquitin-conjugating E2 enzyme, a target gene of miRNA399 (Lin et al.,
2009; Chiou and Lin, 2011). SPX and EXS domain-containing proteins are potential
regulators involved in the Pi signalling network (Chiou et al 2011). SPX domain could
70
function as a sensor for Pi level (Duan et al., 2008) while specific function for EXS domain
remains unknown.
During Pi-deficiency, mature miRNA399 is translocated from the shoot to the root,
repressing the translation of PHO2 transcripts. The outcome is an increase in the transcript
abundance for some PHT genes (Lin and Chiou, 2008). PHT family members have been
widely studied and most of them were found to be up-regulated in Pi stressed plants (Smith
et al., 1997; Okumura et al., 1998; Morcuende et al., 2007). The model of Pi signalling
pathway adapted from Bari et al., 2006 is included in Chapter 1. PHT1 are the transporters
located to plasma membrane that function under low and high Pi conditions (Misson et al.,
2004; Shin et al., 2004). Indeed, some members of the PHT1 family have also been
speculated to be the candidates for sensing the lack of Pi in plants (Abel, 2011). PHT2,
which is located to the inner envelope of plastid, is a low affinity Pi transporter that is
involved in Pi uptake into leaves and intercellular movement, but not Pi remobilisation
(Daram et al., 1999; Rausch et al., 2004). Three members of PHT3, are located to the
mitochondria (Takabatake et al., 1999). One of the members, PHT3;2 was found to be
regulated in Pi-limited Arabidopsis leaves and root (Misson et al., 2005; Morcuende et al.,
2007; Müller et al., 2007).
Changes in the transcript profiles of Pi starvation responsive genes suggest alterations in
metabolite profiles. Pi-deficient plants modify their carbohydrate metabolism to
compensate for low Pi condition (Plaxton, 1996; Abel et al., 2002; Huang et al., 2008).
Several biochemical pathways, for example glycolysis, become modified to bypass the
steps that require Pi (Duff et al., 1989; Plaxton et al., 2006), causing changes in the
amounts of citric acid cycle intermediates. Furthermore, the altered abundance of amino
acids during Pi deficiency will affect the amounts of compounds that are synthesised from
these amino acids (Morcuende et al., 2007). While similar Pi responsive transcript profiles
were found in different plants, the metabolite profiles seem to be more dependent on the
plant species (Ciereszko and Barbachowska, 2000; Ciereszko et al., 2002; Hernandez et al.,
2007; Huang et al., 2008).
This chapter aimed to understand plant responses towards Pi depletion and resupply, using
Arabidopsis cell suspension cultures as a model system. Cell suspension culture is a robust
71
0
0.2
0.4
0.6
0.8
1
1.2
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14
Day
Pi
left
in
med
ium
(m
M)
0
5
10
15
20
25
30
Pi
insid
e t
he c
ell
s
(µm
ol.
g F
W-1
)
Pi inside the cells Pi in the medium
system with many experimental advantages over plants (Chapter 1). In this study, I focused
on the physiological responses of the cells, the kinetics of transcript abundance of the PHT
gene family members, together with some other genes involved in Pi regulation and
signalling, and the metabolic changes that occur when Pi-limited Arabidopsis cells were re-
supplied with Pi, followed by Pi depletion during growth. The concentration of total P, Pi
and sucrose were estimated using respected standard curve. The similarities and differences
of the responses in suspension cells to these reported in plants are discussed.
Results
Pi depletion compromised the growth of Arabidopsis cells in suspension cultures
Arabidopsis cells cultured for 7 days in MS medium containing 1 mM Pi completely
depleted the media of Pi (Figure 3.1). During normal subculturing, 20 % of the cells
obtained in a 127 ml culture were subcultured into fresh MS media to give a final
concentration of 1 mM Pi. Cells went through three days of lag phase before the biomass
increased linearly from day 4, and reached about 14 g fresh weight per 127 ml culture at
day 7. For –Pi treatment, 20 % of cells from 7-day old cultures were subcultured into fresh
medium without Pi to prolong the Pi-deficient condition. Prolonged Pi deficiency caused a
drastic change to the cell growth profile. A very small increase of biomass was recorded
during the first three days of subculture and reached a plateau by day 10 from the last
exposure to 1 mM Pi (Figure 3.2).
Figure 3.1 Pi status of Arabidopsis suspension cells in response to Pi depletion during
growth. At day 0, 7-day old Arabidopsis cells were subcultured into fresh MS media
72
containing 1.25 mM Pi to give a final concentration of 1 mM Pi. Cells were grown for 7
days before subculture into fresh MS media without Pi and grown for a further 7 days. Pi
left in the medium (left-hand axis) and Pi inside the cells (right-hand axis) were
determined. Thin arrows indicate when the cells were subcultured. The thick arrow
indicates the level of Pi supplied by the subculture. Values are mean + SE (n=3 flasks).
When not visible, the error bars are too small to be seen outside the symbols for the data
points.
0
2
4
6
8
10
12
14
16
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14
Day
Fre
sh
we
igh
t (g
.fla
sk
-1)
Figure 3.2 Growth of Arabidopsis suspension cells in 1 mM Pi-containing medium
followed by growth in -Pi medium. Using the cultures from Figure 3.1, cell biomass was
determined. The heads of the arrows indicate the initial cell fresh weight and the day of
subculture. Values are mean + SE (n=3 flasks). At day 0, the cell fresh weight was obtained
before and after subculturing. When not visible, the error bars are too small to be seen
outside the symbols for the data points.
Cells cultured for 7 days in MS media with an initial Pi concentration of 1 mM took up
nearly all the Pi from the media within one day after subculturing into fresh P-containing
media (Figure 3.1). The highest Pi content inside the cells was found at day 1 indicated that
Pi-depleted cells responded quickly in taking up Pi upon Pi-resupply. The Pi content inside
the cells on a gram fresh weight basis decreased rapidly from day 2 until day 6 and reached
a minimum level at day 9.
Pi is used in a variety of biochemical reactions and some of them were transferred into P-
containing organic compounds (Po). Except for day 2, the amount of P in the Po pool was
73
always greater than that in the Pi pool throughout the cell growth period, although no clear
trend could be detected (Figure 3.3). For some cultures, the amount of total P recovered
was less than the amount initially supplied. This was because a variable amount of up to 30
% of the added P was unaccounted for the P assays during sample preparation.
0
10
20
30
40
50
60
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14
Day
P p
oo
ls in
sid
e t
he
ce
lls (
µm
ol.
g F
W-1
)
Pi Po
Figure 3.3 The dynamics of the Pi and Po pools in Arabidopsis suspension cells in
response to Pi depletion. Using the cultures from Figure 3.1, total P inside the cells was
determined. Po was calculated by subtracting Pi from total P. Values are mean + SE (n=3
flasks). When not visible, the error bars are too small to be seen outside the symbols for the
data points. The values for Pi are those shown in Figure 3.1.
The PHT gene family transcripts in Arabidopsis cells supplied with 1 mM Pi did not
respond strongly to changes in Pi-status
The response of the transcript pools for the PHT1, PHT2 and PHT3 gene family members
as a function of changing Pi status in cells supplied with 1 mM Pi was determined (Figure
3.4). Overall, transcripts from all PHT1 genes except PHT1;3 were detected in each
sample. PHT1;4 was by far the most abundant PHT1, followed by PHT1;7. PHT1;9 was
the least abundant of the detectable transcripts. PHT2 transcripts were about as abundant as
the average PHT1 transcript. The transcripts for all the PHT3 genes were quite plentiful,
each being about as abundant as PHT1;7 transcripts. The transcript amounts for some of the
PHT gene family members did not increase more than 2-fold between day 1, when cells
74
contained the highest concentrations of Pi, and day 11, when the media had been depleted
of Pi for about 10 days, including PHT1;4. The amounts of PHT1;5 and PHT1;6 transcripts
increased slightly more than 2-fold by day 11. However, the amounts of PHT1;1 and
PHT1;2 transcripts increased more than 5-fold over this period.
Transcripts for PHT2, the plastid Pi transporter, were 5-fold higher by day 11, while the
transcripts for the mitochondrial Pi transporters PHT3;1, PHT3;2 and PHT3;3 had a weak
induction of about 2-fold magnitude by day 11 (Figure 3.4). Except for PHT1;1, PHT1;2,
PHT1;5, PHT1;6 and PHT2, other transcripts changes between day 1 and day 11 were not
statistically significant. Overall, PHT gene transcript profiles suggested that the supply of 1
mM Pi to cells depleted of Pi over 7 days was insufficient to repress the expression of some
of the PHT gene family members to the extent reported in the literature. This observation
indicates that the cells were responding to a low Pi status throughout the growth period.
25
30
35
40
45
50
PHT1;1 PHT1;2 PHT1;3 PHT1;4 PHT1;5 PHT1;6 PHT1;7 PHT1;8 PHT1;9 PHT2 PHT3;1 PHT3;2 PHT3;3
Gene
40
-de
lta
Ct
Day1 Day7 Day11
Figure 3.4 The transcript profiles of PHT gene families in Arabidopsis suspension cells in
response to Pi depletion. Using the cultures from Figure 3.1, mRNA from 1-day-, 7-day-
and 11-day-old Arabidopsis cells were isolated and used for quantitative real time
polymerase chain reaction (qRT-PCR) assays. The y-axis is a log2 scale, where each
integer increment is equal to a 2-fold change in transcript abundance. Values are mean +
SE (n=3). When not visible, the error bars are too small to be seen outside the symbols for
*
* *
* *
Day1 Day7 Day11
[Pi]
75
the data points. Significant differences (*) between cells at day 1 and day 11 were
determined by a t-test (p<0.05). The triangle represents Pi concentration inside the cells for
indicated days.
High Pi supplies compromised the growth of Arabidopsis cells in suspension cultures
The 1 mM Pi supplied initially in MS media to Pi-depleted cell suspensions was apparently
not sufficient to fully repress PHT gene transcripts. To understand more clearly the
responses of these transcripts to Pi depletion, a range of Pi concentrations in the initial
medium were supplied and cells harvested after 7 days. A Pi supply of 1 mM gave the
highest yield of cells (Figure 3.5). The cell fresh weight was about 20 % lower for all Pi
supplies above 1 mM, suggesting unfavourable growth conditions.
0
2
4
6
8
10
12
14
16
0 1 2 4 8 16
Culture media [Pi] at Day-0 (mM)
Fre
sh
weig
ht
(g.f
lask
-1)
Figure 3.5 Growth of Arabidopsis suspension cells under various Pi supplies. At day 0, 7-
day old Arabidopsis cells were subcultured into fresh MS media containing the indicated Pi
supply. Cells were harvested at day 7 and the biomass was determined. Values are mean +
SE (n=3 flasks).
Pi supplied to Arabidopsis suspension cells in the medium were allocated to different P
pools
Arabidopsis suspension cells were very responsive in taken up Pi into the cells when they
were supplied with a certain amount of Pi (Figure 3.6). They had an even higher capacity to
consume Pi from the medium than was found in cultures supplied 1 mM Pi. For cultures
supplied with 4 to 16 mM Pi, about 50 % of the Pi was removed from the media during 7
76
day growth period, regardless of the starting Pi concentration. At day 7, the concentration
of Pi inside cells initially supplied with 4 mM Pi was 13 fold higher compared to cells
supplied with 1 mM Pi. Higher initial Pi supplies did not change the final Pi concentration
inside the cells at day 7. This result shows that an initial supply of 4 mM Pi was enough to
saturate the Pi storage capacity of cells in culture. In agreement with this finding, the
amount of Pi left in the medium after the culture period increased with increasing amounts
of Pi supplied above 4 mM (Figure 3.6).
0
2
4
6
8
10
0 1 2 4 8 16
Culture media [Pi] concentration at Day 0 (mM)
Pi
left
in
th
e m
ed
ium
(m
M)
0
5
10
15
20
25
30
35
40
Pi
insid
e t
he c
ell
s (
µm
ol.
g F
W-1
)
Pi inside the cells Pi in the medium
Figure 3.6 Pi status of Arabidopsis suspension cells grown under various initial Pi supplies.
Using the cultures from Figure 3.5, the Pi left in the medium (left-hand axis) and the Pi
inside the cells (right-hand axis) were determined. Values are mean + SE (n=3 flasks).
When not visible, the error bars are too small to be seen outside the symbols for the data
points.
For all treatments, the majority of P was in the Po pool. Similar to Pi concentration inside
the cells that reached plateau at Pi supplies of 4 mM or greater, the same trend was also
found for the amount of Po (Figure 3.7).
77
0
20
40
60
80
100
120
1 2 4 8 16
Culture media [Pi] at Day 0P p
oo
ls in
sid
e t
he
ce
lls (
µm
ol.
g FW
-1)
Pi Po
Figure 3.7 The response of P pools to Pi supply in Arabidopsis cells. Using the cultures
from Figure 3.5, total P inside the cells was determined. The amount of Po was calculated
by subtracting Pi from total P. Values are mean + SE (n=3 flasks). The values for Pi are
those shown in Figure 3.6.
Most members of PHT1 family and PHT3;2 gene transcripts were strongly repressed by
higher Pi supply
The PHT transcript profiles for 7 day old cells supplied with various amounts of Pi were
determined (Figure 3.8). Most of the PHT1 transcripts were repressed with increasing
amounts of Pi including PHT1;1, PHT1;2, PHT1;4, PHT1;6 and PHT1;7. Transcripts from
PHT1;5, PHT1;8 and PHT1;9 were not changed. For PHT genes located to the organelles,
PHT2 and PHT3;1 transcripts were induced with increasing Pi supply, PHT3;2 transcripts
were repressed while PHT3;3 transcripts did not change.
78
25
30
35
40
45
50
PHT1
;1
PHT1
;2
PHT1
;3
PHT1
;4
PHT1
;5
PHT1
;6
PHT1
;7
PHT1
;8
PHT1
;9
PHT2
PHT3
;1
PHT3
;2
PHT3
;3
Gene
40-D
elt
a C
t
0 mM Pi 1 mM Pi 2 mM Pi 4 mM Pi 8 mM Pi
Figure 3.8 The PHT gene family transcript profiles for Arabidopsis suspension cells in
various Pi supplies. Using the cultures from Figure 3.5, mRNA were isolated and used for
qRT-PCR. The y-axis is a log2 scale, where each integer increment is equal to a 2-fold
change in transcript abundance. Values are mean + SE (n=3). When not visible, the error
bars are too small to be seen outside the symbols for the data points.
Arabidopsis cells in suspension cultures loaded with excess Pi has the ability to survive
longer culture cycle without added Pi
To determine the effect of Pi depletion on cells supplied with a higher rate of Pi, cells
grown for 7 days in 1 mM Pi were subcultured into fresh MS medium and supplied 4 mM
Pi. By day 7, cell fresh weight had increased to about 11 g flask-1
(Figure 3.9), slightly less
than the amount of cells obtained from cultures supplied 1 mM Pi (Figure 3.5). These cells
were subcultured into fresh medium lacking Pi and a similar growth pattern was observed
through day 13, indicating enough Pi was still available for the cells. Cells were
subcultured again into medium without Pi. This time, the cell growth reached a plateau by
day 17 at a lower level than in the previous subcultures. The biomass accumulated at day
21 was about 50 % lower than that recorded at day 7 and day 13 (Figure 3.9), indicating
that cell growth arrested because the internal P pools had become lowered to the point of
compromising growth.
79
Figure 3.9 Growth of Arabidopsis suspension cells in Pi-containing medium followed by P
withdrawal. At day 0, 7-day old Arabidopsis cells grown in 1 mM Pi were subcultured into
fresh MS media to a final Pi concentration of 4 mM. Cells were grown for 7 days before
being subcultured into fresh MS media without Pi until day 13. These cells were
subcultured into fresh MS media without Pi at day 13 and the growth was continued until
day 21. Arrows indicate the initial cell fresh weight and day of subculture. Cells were
harvested every two-days and the fresh weight determined. Values are mean + SE (n=3
flasks). At day 0, the cell fresh weight was obtained before and after subculturing. When
not visible, the error bars are too small to be seen outside the symbols for the data points.
The P pool of Arabidopsis suspension cells was dynamically changed in response to Pi
loading and Pi depletion
Within one day of subculturing 7-day old Arabidopsis suspension cells from Pi-exhausted
media into fresh MS medium to a final concentration of 4 mM Pi, cells had taken up 90 %
of the Pi from the media. The amount of Pi inside the cells was at the highest level at day 1.
This amount decreased to almost undetectable levels from day 11 onwards. While the Pi
left in the medium was low at day 1, it increased 4-fold at day 3. An experiment to test if
the increasing of P amount was due to secreted P that was initially bound to the flask was
conducted. Empty flasks that previously contained medium without cells inoculated were
acid digested. Results have shown that only about 1 µmol P could be detected, indicating
not much P was contributed from this source. Starting from day 3, the amount of Pi in the
medium decreased to almost undetectable levels by day 9 (Figure 3.10).
0
2
4
6
8
10
12
14
16
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
Day
Fre
sh
weig
ht
(g.f
lask
-1)
80
0
1
2
3
4
5
0 1 3 5 7 9 11 13 15 17 19 21
Day
Pi
left
in
th
e m
ed
ium
(m
M)
0
20
40
60
80
100
120
Pi
insid
e t
he c
ell
s (
µm
ol.
g F
W-1
)
Pi inside the cells Pi in the medium
Figure 3.10 Pi status of Arabidopsis cells during Pi depletion. Using cultures from Figure
3.9, the Pi left in the medium (left-hand axis) and the Pi inside the cells (right-hand axis)
were determined. Thin arrows indicate the time-point when the cells were subcultured. The
thick arrow indicates the level of Pi supplied by the subculture. Values are mean + SE (n=3
flasks). When not visible, the error bars are too small to be seen outside the symbols for the
data points.
Except for day 1 and day 3, the Po amounts inside the cells were at least two times higher
than the Pi amounts (Figure 3.11). At day 1, where Pi was at the highest level, there was
virtually no Po inside the cells. However, by day 3, cells have readjusted the P distribution
as could be seen from equal amounts in both Pi and Po. At day 9 (two days after subculture
of cells into fresh media lacking Pi, but containing the other substances needed for growth),
another dramatic remodelling of the P pools, where a large change in P content inside the
cells were observed. Po increased at day 9, before decreased again at day 11. By day 13, an
equilibrium has been reached and cell growth has stopped. It appears that 40 µmol.g FW -1
is the base P status for cell growth.
81
0
20
40
60
80
100
120
140
0 1 3 5 7 9 11 13 15 17 19 21P po
ols
insi
de t
he c
ells
(µm
ol. g
FW
-1)
Pi Po
Figure 3.11 The growth-dependent P pool dynamics of Pi-loaded Arabidopsis suspension
cells. Using the cultures from Figure 3.9, total P inside the cells was determined. The
amount of Po was computed by subtracting Pi from total P. Values are mean + SE (n=3
flasks). When not visible, the error bars are too small to be seen outside the symbols for the
data points. The values for Pi are those shown in Figure 3.10.
The transcript abundance profiles for Pi-starvation responsive genes during Pi-depletion
are gene-dependent
Within one day of supplying Pi-depleted cells with 4 mM Pi, the amounts of transcripts for
most of the high-affinity Pi transporters decreased strongly (Figure 3.12A). Significant
reduction were determined at day 1 for PHT1;4 by nearly 200-fold, PHT1;7 by 75-fold,
PHT1;2 by 40-fold and PHT 1;8 by 24-fold. The amounts of transcripts for PHT1;6
decreased 3-fold upon Pi re-supply. PHT3;2 transcripts were strongly repressed by 17-fold,
while PHT2 gene transcripts decreased 2-fold (Figure 3.12B). By contrast to all other PHT
genes examined, there was a 2-fold increase in PHT3;3 transcripts. PHT1;4 and PHT1;8
repressed more quickly than other Pi transporters, while PHT3;2, PHT1;7 and PHT1;8
were the slowest to be repressed to the lowest level observed. These transcripts were
repressed for several days before induction began, presumably due to the onset of Pi
depletion. However, the kinetics of transcript repression and induction varied from gene to
gene. The transcript amounts for PHT1;4 and PHT1;6 started to increase at day 5, while
PHT1;1 and PHT1;2 transcripts began to accumulate by day 7. PHT1;7, PHT1;8 and
82
PHT1;9 had two cycles of repression and de-repression, which differs from the trends of
PHT1;1, PHT1;2, PHT1;4 and PHT3;2 which simply repressed and de-repressed.
The transcript pool behaviour of two genes involved in regulating the Pi-starvation
response in Arabidopsis, PHO2 and the primary miRNA399, were also examined. In
suspension cells, PHO2 transcript amounts decreased 8-fold upon Pi resupply (Figure 3.12
B). PHO2 transcripts accumulated as the Pi decreased. The abundance of the miRNA399
primary transcript decreased more than 800-fold by day 1 of Pi resupply. These transcripts
began to accumulate again by day 9.
A
25
30
35
40
45
50
PHT1;1 PHT1;2 PHT1;3 PHT1;4 PHT1;5 PHT1;6 PHT1;7 PHT1;8 PHT1;9
Genes
40
- D
elt
a C
t
Day 0 Day 1 Day 3 Day 5 Day 7 Day 9 Day 13 Day 21
Day 0 Day 1 Day 3 Day 5 Day 7 Day 9 Day 13 Day 21
[Pi]
83
B
25
30
35
40
45
50
PHT2 PHT3;1 PHT3;2 PHT3;3 PHO2 miRNA399
Genes
40-
Delt
a C
t
Day 0 Day 1 Day 3 Day 5 Day 7 Day 9 Day 13 Day 21
Figure 3.12 Transcript profiles for selected Pi-responsive genes in Arabidopsis suspension
cells in response to Pi supply and depletion. Using the cultures from Figure 3.9, mRNAs
from cells of selected time points were isolated and used for qRT-PCR. The y-axis is a
log2 scale, where each integer increment is equal to a 2-fold change in transcript
abundance. Values are mean + SE (n=3). When not visible, the error bars are too small to
be seen outside the symbols for the data points. A) Transcript amounts for PHT genes
encoding proteins located to the plasma membrane. B) Transcript amounts for the PHT
genes encoding proteins located to organelles, PHO2 and primary miRNA399. The triangle
represents Pi concentration inside the cells for indicated days.
High amounts of some sugars, amino acids and organic acids during Pi depletion were
reversed by Pi re-supply
Methanol-soluble metabolites in Arabidopsis suspension cells harvested at different Pi
status were identified and the relative abundance determined by GC-MS analysis. Using
automated mass spectral deconvolution and identification system software (AMDIS), a
total of 60 known compounds were detected, and 27 were of unknown identity (Appendix
2). Using the alternative data processing platform Metabolome Express (ME), a total 44
compounds were detected, 20 of which were classified as unknown compounds. The
84
metabolite ratio in -P cells (day 7 after 1 mM Pi resupply) and +P (day 1 after 4 mM Pi
resupply) were calculated and the full metabolites ratios from results analysed using
AMDIS are listed in Appendix 3.
Using the AMDIS analysis protocol, the levels of sucrose, glucose and fructose were higher
with Pi depletion (Figure 3.13). Amino acids such as threonine, serine, isoleucine, glycine
and proline were lower; while phenylalanine, valine and GABA were higher with Pi-
depletion. The detected organic acids; citrate, succinate, fumarate, and malate were
increased with Pi depletion, the same trend as lactate, a product of fermentation, was also
more abundant in cultures depleted of Pi.
For most of these metabolites, the same trend was found when ME analysis was performed.
Most sugars and organic acids increased except for citrate and lactate that were not detected
in ME analysis. Isoleucine, threonine and serine were also not detected in the ME analysis.
Alanine that was not detected by AMDIS was identified but found not to change in ME.
The full metabolites ratios from results analysed using ME are listed in Appendix 4.
Another metabolite comparison was made between –P cells that were harvested at day 9,
two days after subcultured into fresh medium without Pi, and +P cells harvested at day 1
after 4 mM Pi resupply. Analyses by both AMDIS and ME have shown the same trend for
detected metabolites. The amounts of sugars, lactate, citrate, succinate, and fumarate were
higher with Pi depletion (Figure 3.14).
85
Fructose
Alanine
Asparagine
Acetyl-coenzyme A
Glutamine
Citrate
Glucose
Glucose 6-phosphate
Fructose 6-phosphate
Glycerate 3-phosphate
Lactate
Day 0/ Day 1
from AMDIS
Phenylalanine
*8.2114.6 * 2.59
* 0.16
* 0.72
* 1.84
* 1.67Sucrose 1.44
7.99
0.92-
-
- 0.95 0.78
1.8
-
1.19 0.81
0.85 -
- 1.011.37 -
* 3.67 * 3.09
* 3.86 2.17
* 2.36 * 2.10 * 0.45 * 0.47
1.201.71
* 4.58 -
Day 0/ Day 1
from ME
ArginineProline
GABA
Glutamate
α-Ketoglutarate
Succinate
Malate
Fumarate
Oxaloacetate
Aspartate
Isoleucine
Threonine
0.85
Isoleucine
Valine
Leucine
GlycineSerine
Phosphoenolpyruvate
Pyruvate
Glycerol 3-phosphate
-
Leucine
1.01
-1.33
-4.23
Fructose
Alanine
Asparagine
Acetyl-coenzyme A
Glutamine
Citrate
Glucose
Glucose 6-phosphate
Fructose 6-phosphate
Glycerate 3-phosphate
Lactate
Day 0/ Day 1
from AMDIS
Phenylalanine
*8.2114.6 * 2.59
* 0.16
* 0.72
* 1.84
* 1.67Sucrose 1.44
7.99
0.92-
-
- 0.95 0.78
1.8
-
1.19 0.81
0.85 -
- 1.011.37 -
* 3.67 * 3.09
* 3.86 2.17
* 2.36 * 2.10 * 0.45 * 0.47
1.201.71
* 4.58 -
Day 0/ Day 1
from ME
ArginineProline
GABA
Glutamate
α-Ketoglutarate
Succinate
Malate
Fumarate
Oxaloacetate
Aspartate
Isoleucine
Threonine
0.85
Isoleucine
Valine
Leucine
GlycineSerine
Phosphoenolpyruvate
Pyruvate
Glycerol 3-phosphate
-
Leucine
1.01
-1.33
-4.23
Figure 3.13 Metabolite differences in Pi-depleted Arabidopsis suspension cells resupplied
with 4 mM Pi in MS medium: Selected cells treated as in Figure 3.9 were harvested and the
metabolites were profiled by GC-MS. The ratios of metabolites in -P cells (day 7 after 1
mM Pi resupply) and +P (day 1 after 4 mM Pi resupply) are shown on the figure by
different colour boxes. Compounds that were not detected are indicated in italics. Colours
represent ≥2, ≥5 and ≥10-fold higher (red gradient) or lower (green gradient) in +P cells
compared to –P cells. Mixed colours indicated different range in AMDIS and ME analysis.
The ratios obtained from AMDIS (left-hand box) and ME (right-hand box) are shown next
to the name of the metabolites. Whenever the ratio of metabolite was not determined, it was
indicated with a dash (-). Significant differences (*) were determined by a t-test (p<0.05, n=
2 biological replicates with 3 technical replicates for each biological replicate).
+5 +10 +2 -10 -5 -2
86
Fructose
Alanine
Asparagine
Acetyl-coenzyme A
Glutamine
Citrate
Glucose
Glucose 6-phosphate
Fructose 6-phosphate
Glycerate 3-phosphate
Lactate
Day 9/ Day 1
from AMDIS
Phenylalanine
*4.63*5.6 *2.81
*0.09
*0.24
*3.44
*1.74Sucrose *2.32
*5.05
*13.75-
-
- *0.18 *0.17
- *0.21
-
*0.61 *0.53
0.87 -
- *0.35*0.17 -
*8.06 *6.17
*7.37 5.73
*2.29 *2.04 *0.25 *0.36
*0.51*0.60
* 2.73 -
Day 9/ Day 1
from ME
ArginineProline
GABAGlutamateα-Ketoglutarate
Succinate
Malate
Fumarate
Oxaloacetate
Aspartate
Isoleucine
Threonine
0.87
Isoleucine
Valine
Leucine
GlycineSerine
Phosphoenolpyruvate
Pyruvate
Glycerol 3-phosphate
-
Leucine
Fructose
Alanine
Asparagine
Acetyl-coenzyme A
Glutamine
Citrate
Glucose
Glucose 6-phosphate
Fructose 6-phosphate
Glycerate 3-phosphate
Lactate
Day 9/ Day 1
from AMDIS
Phenylalanine
*4.63*5.6 *2.81
*0.09
*0.24
*3.44
*1.74Sucrose *2.32
*5.05
*13.75-
-
- *0.18 *0.17
- *0.21
-
*0.61 *0.53
0.87 -
- *0.35*0.17 -
*8.06 *6.17
*7.37 5.73
*2.29 *2.04 *0.25 *0.36
*0.51*0.60
* 2.73 -
Day 9/ Day 1
from ME
ArginineProline
GABAGlutamateα-Ketoglutarate
Succinate
Malate
Fumarate
Oxaloacetate
Aspartate
Isoleucine
Threonine
0.87
Isoleucine
Valine
Leucine
GlycineSerine
Phosphoenolpyruvate
Pyruvate
Glycerol 3-phosphate
-
Leucine
Figure 3.14 Metabolite differences in Pi-depleted Arabidopsis cells. Selected cells treated
as in Figure 3.9 were harvested and the metabolites were profiled by GC-MS. The ratios of
metabolites in –P cells (day 9 after 4 mM Pi resupply, 2 days after subculture into fresh
medium lacking Pi) and +P (day 1 after 4 mM Pi resupply) are shown on the figure by
different colour boxes. Compounds that were not detected are indicated in italics. Colours
represent ≥2, ≥5, and ≥10 higher (red gradient) or lower (green gradient) amounts in –P
cells compared to +P cells. Mixed colours indicated different range in AMDIS and ME
analysis. The ratios obtained from AMDIS (left-hand box) and ME (right-hand box) are
shown next to the name of the metabolites. Whenever the ratio of metabolite was not
determined, it was indicated with a dash (-). Significant differences (*) were determined by
a t-test (p<0.05, n= 2 biological replicates with 3 technical replicates for each biological
replicate).
+5 +10 +2 -10 -5 -2
87
Pi-depleted cells took up a higher level of sucrose compared to cells that were supplied
with Pi
Sucrose amount left in the medium for selected time points was measured by anthrone
assay (Figure 3.15). The amount of sucrose detected in the medium was quite high at day 1,
a day after subculturing the cells into fresh medium containing sucrose. Sucrose amount in
the medium separated from the cells that was not supplied with Pi was 31 % lower
compared to the amount of sucrose in medium separated from the cells supplied with 4 mM
Pi. The lower amount of sucrose in the medium might indicates that more sucrose has been
taken up by the cells. There is also a possibility of extracellular sucrose hydrolysis into
hexose by extracellular acid invertase. This finding is in agreement with the high sucrose
level inside the cells determined by GC-MS as described previously.
0
5
10
15
20
25
30
35
Day 7 in
1mM Pi
Day 1 in
0mM Pi
Day 1 in
4mM Pi
Day 7 in
4mM Pi
Day 13 in
4mM Pi
Day 21 in
4mM Pi
Samples
Su
cro
se (
g/l
)
Figure 3.15 Higher amounts of sucrose were taken up by Pi-depleted cells. The medium
separated from Arabidopsis cells harvested at selected time points were assayed for sucrose
as described in Materials and Methods. Values are mean + SE (n=3 flasks). When not
visible, the error bars are too small to be seen outside the symbols for the data points.
88
Discussion
Pi-depletion and re-supply influenced the growth and P pools in Arabidopsis suspension
cells
A cell culture approach was used to understand how plant cells react to variations in Pi
status. Arabidopsis suspension cells were maintained in normal MS media containing 1
mM Pi by weekly subculturing. In this system, the Pi supply was cyclical and continuously
changing. Regardless of the Pi amount supplied, cells rapidly took Pi out of the media
within one day from subculture. Almost all Pi was removed out of culture media during day
1 for the 1 mM treatment. With higher Pi supplies (4 mM), cells took up about 90 % of the
Pi supplied. Rapid Pi uptake was also observed in tomato cell suspension cultures, as the
cells accumulate the highest amount of Pi two days after the subculture (Bozzo et al.,
2006). The reduction of Pi amount inside the cells and the increase in cell biomass over
time indicates an active utilisation of Pi for cell growth.
In this study, 50 % and 90 % of Pi was removed from the medium 7 days after the cells
were supplied 4 mM Pi in the first and second batch, respectively. Although the amount of
Pi inside the cells was about the same, the Po amounts for the second batch was 11 %
higher than the first batch. These discrepancies might be due to biological variations of the
cells grown in different batches.
The Pi level in cells supplied with just 1 mM Pi at day 0 was 0.59 µmol g FW-1
at day 11.
Since the Pi decreased to this level from about 25 µmol g FW-1
over the 11 days, the
transcripts of the PHT gene family members, which are repressed by high Pi, might be
expected to be up-regulated. However, only a very small increase in abundance for most of
the PHT transcripts by day 11 was observed. The inability of these genes to be highly up-
regulated as expected in Pi starved plants indicated that the cells were already experiencing
Pi deprivation at day 1 after exposure to 1 mM Pi. Some previous studies found that 1.25
mM Pi was insufficient to maintain the growth of Arabidopsis seedlings grown in liquid
media (Veljanovski et al., 2006) and other suspension cells, such as Brassica nigra, (Duff
et al., 1989; Lefebvre et al., 1990) Brassica napus (Carswell et al., 1997) and tomato
89
(Bozzo et al., 2002, 2004). However, 1 mM Pi was clearly sufficient for growth in this
study. In fact, in some situations, less than 1.25 mM Pi was also sufficient for growth of
Arabidopsis suspension cells (Shimaoka et al., 2004). Relationship between Pi
concentration and cell growth in these studies is important to further understand cell
responses under different P status.
Since the cells were Pi-deprived in 1 mM Pi, several amounts of Pi were tested to identify a
Pi-replete condition. Among them, 4 mM Pi in MS media was determined as the amount
that saturates cell storage capacity for Pi. However, this amount of Pi slightly lessens the
biomass accumulation at day 7. From the study of Veljanovski (2006), the highest cell
biomass was determined for 7-days-old Arabidopsis cells grown in MS medium containing
final concentration of 4.5 mM Pi. In the case of Catharanthus roseus cells grown in culture,
optimum growth was achieved in medium containing between 1.25 mM and 2.5 mM Pi.
There was an inhibition of growth observed in 5 mM Pi (Nagano and Ashihara, 1993). It
could be possible that too much Pi leads to P toxicity. In cell suspension culture, changes in
the appearance of cells might indicate the symptoms of toxicity. Catharanthus roseus for
example, changed colour from pale yellow to brown with some cells dying in high Pi.
Nevertheless, in my study, the reduction of biomass produced in cultures supplied with 4
mM Pi was most probably not due to P toxicity, as no colour changes observed for the
cultures. Rather, the lower biomass determined could be due to an inability of the cells to
cope with a big change in Pi supply, perhaps through the depletion of some other nutrient
that leads to unfavourable growth conditions. Taken together, it is necessary to determine
the amount of Pi needed for maximal growth in different plant systems.
Pi supplied at 4 mM at the beginning of a growth cycle was enough to sustain cell growth
until day 13, as long as fresh medium lacking Pi was added. When the Pi inside the cells
declined to 0.54 µmol g FW-1
, the cells stopped growing. When either 1 mM or 4 mM Pi
was supplied in fresh medium, the amount of Pi inside the cells was at its highest level at
day 1. The low Pi concentration remaining in the medium at day 1 increased again at day 3,
indicating a certain amount of Pi was contributed into the medium. There are two
mechanisms to explain this observation. It is most likely that excess Pi was secreted by the
cells, as was observed in barley roots (Mimura et al., 1996). The more Pi that was supplied
to the external medium, the more Pi was secreted from the roots prior to re-absorption for
90
translocation to the shoots (Mimura et al., 1996). Thus, Pi homeostasis in plants, and
perhaps cells in suspension culture, not only depends on Pi influx, but also on Pi efflux and
re-absorption. Alternatively, the re-appearance of Pi in the medium might be due to
phosphatase activities hydrolysing Pi that had stuck to the flask. Based on total P
measurement, a small amount of P was measured after flasks incubated with medium
containing P (without cells) were emptied, acid-digested and assayed. Just about 1 µmol P
had adhered to the flask, indicating that this source of Pi did not contribute to the spike in
Pi in the medium at day 3.
The amount of P in the Po form was dynamic and higher than Pi amounts during most of
the cell growth cycle. To explain the variation in the Po pool, the P mass balance was
determined for selected samples. The measurements suggested that a significant and
variable amount of P was not accounted for, as it was lost during the sample preparation
process. Looking across numerous studies, Po in the form of nucleic acids, phospholipids
and phosphate esters each increased proportionally to the total P content of plant tissues,
while the amount of Pi increased exponentially (Eric Veneklass, unpublished data). This
trend was also seen for Arabidopsis cells, which showed an exponential increase of Pi
inside the cells for up to 4 mM Pi supplied while the Po did not increase significantly.
Behaviour of various genes indicates the sum of the changes across the whole plant except
for PHT1;3 and PHT1;6
The PHT gene families, consisting of nine PHT1, one PHT2 and three PHT3 genes, are
responsible for much of the Pi transport in Arabidopsis (Okumura et al., 1998; Dong et al.,
1999). The transcript abundance for most of these genes was repressed when Pi-deprived
Arabidopsis plants were supplied with sufficient Pi (Morcuende et al., 2007). When
Arabidopsis cells that had depleted the culture media of an initial supply of 1 mM Pi were
re-supplied with 4 mM Pi, most of the PHT transcripts were repressed more than 2-fold
within a day. PHT1;4 was repressed to its lowest level within 24 h. PHT1;1 and PHT1;2
were a bit slower to be strongly repressed, while PHT1;7 was the slowest of the genes to
respond by repression. These genes remained repressed for a time and started to be induced
again when the cells were grown for an extended time without adding more Pi. The
physiological state of the cells will determine when the genes are induced. However, this
91
state is unknown and differs in a gene-dependent manner. PHT1;3 transcript was not
detected in all experiments. Troubleshooting showed that the primers work well for
detecting PHT1;3 transcripts in Arabidopsis plants.
The response to Pi status was mostly observed for the members of the PHT1 gene family,
while the transcript abundance for genes encoding transporters located to the organelles did
not change much in response to Pi supply or cellular Pi status. This could be due to cell
regulation, where the PHT1 members might react as the first response machinery in
transporting Pi across the plasma membrane before the Pi is distributed to the organelles.
In Arabidopsis plants, the expression of all PHT members could be detected in both shoots
and roots. These PHT genes responded quite strongly with Pi re-supply by repression of the
transcripts amounts except for PHT1;6 in shoots that showed little repression, PHT2 and
PHT3;1 showed a small induction and PHT3;3 was not significantly changed in either
shoots and roots (Morcuende et al., 2007). Results from my study have shown that PHT1;1,
PHT1;2, PHT1;4, PHT1;7, and PHT3;2 were the genes that were induced in low Pi with
PHT1;4 as the fastest gene to respond to low Pi conditions.
Pi homeostasis in plants is controlled by miRNA399, a small regulatory RNA that targets
transcripts of the PHO2 gene. miRNA399 was highly expressed in Pi deficient plants and
suppressed the PHO2 gene during low Pi (Fujii et al., 2005; Aung et al., 2006; Chiou et al.,
2006). Although lower Pi condition did not cause PHO2 transcripts to be repressed across
the cell culture growth cycle as expected, the relative amount of PHO2 transcripts was
always inversely correlated with primary miRNA399 transcripts except at day 21 where the
amounts were about the same. However, the transcript amounts for primary miRNA399 and
PHO2 transcripts were not significantly different except for day 1, day 5 and day 9. Higher
primary miRNA399 transcripts and lower amount of PHO2 transcripts was found at day 0
and later, 13 days after Pi re-supplied in the growth medium. At both day 0 and day 13, the
Pi amount inside the cells was low and these two genes were expected to have such
inversed abundance of transcript amounts.
In plants, the suppression of PHO2 correlates with the induction of the PHT genes.
However the response of most of the PHT genes (PHT1;1, PHT1;2, and PHT1;4) in the
92
suspension cells was earlier than the suppression of PHO2 transcripts. Since the timing of
transcript induction for PHT1;7, PHT1;8 and PHT1;9 was correlated with the repression of
PHO2 transcripts, it could be that these genes were regulated by primary miRNA399 and
PHO2 under low Pi status.
Apparently, the up-regulation of primary miRNA399 and repression of PHO2 was not
observed as expected at day 21 when the cells have the lowest Pi content that was observed.
At day 21, primary miRNA399 was anticipated to be up-regulated and PHO2 was expected
to be down-regulated to induce PHT genes expression. However, both transcripts stayed at
the same level. It looks like that the genes stop responding at this stage and this regulation
is different in homogenous cultures than in plants. In plants, miRNA399 and PHO2 regulate
a long distance signalling between shoots to roots in plants (Lin and Chiou, 2008).
However, there is no capacity for transports between tissues in homogenous cell cultures,
which might explain the inconsistency of both genes in responding to Pi status.
The repression of all responded PHT genes happened at day 1 when Po was at the lowest
level and Pi was at the highest level. Thus, Pi inside the cells seems to be triggering gene
repression. Most PHT gene members keep repressed while Pi inside the cells was dropping
and Po was increasing. At this stage, the repression could be triggered by cellular Po
amounts. Depending on the genes, some PHT members started to be induced as less P was
available. Overall, the repression might be triggered by local internal Pi amount, while the
induction were based on P status, either in Pi or Po pools available inside the cells.
Accumulation of some sugars, organic acids and amino acids in cells depleted of Pi
Plants change their biochemical and cellular metabolism to survive low Pi conditions
(Raghothama and Karthikeyan, 2005; Plaxton and Tran, 2011). In Arabidopsis suspension
cells deprived of Pi, some sugars, some amino acids and some organic acids associated with
citric acid cycle were increased in amount compared to cells containing the highest levels
of Pi. The breakdown of sucrose produces reducing sugars such as glucose and fructose
which can enter the glycolytic pathway. These reducing sugars were abundant in Pi-
deficient cells compared to Pi-replete cells. However, once the Pi deficient cells were re-
supplied with Pi, the amount of these sugars was lower. The accumulation of sugars was
93
also observed in the roots of Pi-deficient beans (Rychter and Randall, 1994; Hernandez et
al., 2007) and the tissues of Pi-deficient cucumber (Ciereszko et al., 2002).
Essentially, higher sugar content was found to facilitate the up-regulation of Pi-starvation
responsive genes, including PHT1;1 and PHT2 (Liu et al., 2005; Liu and Vance, 2010; Lei
et al., 2011) that were also used in this study. Although sucrose had been found to trigger
Pi-starvation responses, Pi- depletion was still the main factors that cause changes of cells
responses observed in this study. This is supported by the decreasing amounts of most of
the PHT transcripts for cells supplied with a constant amount of sucrose and several
concentrations of Pi. The more Pi supplied at day 0, the more repressed PHT transcripts
were determined at day 7. Pi-starvation responses were somehow still related to sucrose.
This is because lower amounts of sucrose were detected in the medium during cell growth,
indicating higher sucrose level inside the cells. This finding is consistent with the role of
sucrose as a regulator under low Pi condition.
The accumulation of organic acids in response to Pi status and supply varies between
species. Legume tissues were found to have a lower amount of organic acids under low Pi
conditions, perhaps because these compounds were secreted to solubilise Pi from the soil
(Johnson et al., 1996; Neumann and Romheld, 1999; Shen et al., 2002; Dong et al., 2004).
Similarly, strongly Pi-deficient barley plants had a lower amount of organic acids compared
to mildly Pi-deficient barley. This alteration may be the result of modifications to
carbohydrate metabolism that would reduce P consumption due to diminished amounts of
P-containing compounds (Huang et al., 2008). Arabidopsis plants, on the other hand,
showed a higher level of organic acids under low Pi condition compared to Pi sufficient,
which then may allow P to be recycled from the phosphorylated intermediates (Morcuende
et al., 2007). Organic acids content of these two plants were quite different as legumes and
grains have a natural capacity to exudates organic acid through cluster roots to acquire
more Pi (Raghothama, 1999; Cheng et al., 2011). In the context of this study which was
using Arabidopsis cells grown in culture, this condition might not reflect the differences in
plants metabolic profiles.
Most of the detected organic acids in this study were intermediates of the citric acid cycle.
High amounts of citric acid cycle intermediates suggest a possible disruption of
94
mitochondrial metabolism. During Pi deficiency, electron flow through the cytochrome
pathway might be restricted, slowing flux through the citric acid cycle (Vijayraghavan and
Soole, 2010). In the Arabidopsis cell culture system, the higher levels of lactate inside the
cells lacking Pi suggests fermentation was occurring due to an inability of flux through the
citric acid cycle to keep up with glycolytic demand. The production of ethanol and lactate
was previously proposed to be a prominent pathway during Pi starvation in Arabidopsis
plants (Wu et al., 2003). While fermentation by Pi-deficient plants is not fully understood,
low Pi condition had favoured higher fermentation rate in bakers yeast (Hayashibe, 1957).
Yeast Candida parapsilosis were capable of performing aerobic fermentation and cyanide-
resistant respiration as an alternative to cytochrome pathway respiration (Milani et al.,
2001). Another possibility that caused higher concentration of organic acids could be a
correlation with the known marked up-regulation and in vivo phosphorylation or activation
of PEP carboxylase of Pi-starved Arabidopsis suspension cells and seedlings (Gregory et
al., 2009).
For plants such as barley, the amino acids levels were much elevated with lower Pi
indicating protein degradation and repression of protein synthesis (Huang et al., 2008).
However, the amounts of most amino acids detected in Arabidopsis cells were less as Pi
was depleted, which was quite similar to Arabidopsis plants. In Arabidopsis plants, the
amount of glycine and valine were decreased after 24 hr of Pi-starvation (Morcuende et al.,
2007), the same trend observed in Arabidopsis cells after 9 days of Pi supplied. It could be
that less Pi retards the production of some amino acids. By Pi re-supply, most of the amino
acids were decreased, consistent with gradual activation of protein synthesis. Since Pi
deficiency caused oxidative stress to plants (Juszczuk et al., 2001), a higher level of GABA
in Pi-depleted cells may have adaptive value in improving stress tolerance (Bouché and
Fromm, 2004). A similar trend of amino-acid accumulation was found in glucose-starved
cells, contrasting with nitrogen-starved cells where most amino acids were depleted
(Klosinska et al., 2011). Although several metabolite ratios (i.e., glucose-6-phosphate and
some amino acids) were found to contradict general plant Pi-stress metabolite literature,
there were still agreement in many cases, such as amino acids (Morcuende et al.,2007).
Both AMDIS and ME were used for metabolite data processing, and gave the same trends
for most of the detected metabolites. The comparisons between these two software
95
packages on methanolic extracts of Arabidopsis suspension cells resulted to very similar
results with greater advantages in terms of statistical reliability by ME (Carroll et al., 2010).
The small variation seen between the results produced by the two packages could be due to
the choice of settings used before performing the analysis.
In conclusion, this study demonstrated that Pi-deficient Arabidopsis cell cultures were
responsive to Pi status. Physiologically, the responses were observed as changes in cell
growth. At the cellular level, changes in Pi utilisation and distribution to other P pools
were found correlated with transcriptional changes among various PHT gene family
members. Several PHT gene family members were repressed upon Pi-resupply, and the
kinetics of repression varied from gene to gene. Similarly, the induction of transcripts for
several Pi-responsive genes was gene dependent as Pi was depleted from the cells. Cells
seem to have experienced a severe stress condition during Pi deficiency as they switched
from aerobic respiration to aerobic lactic acid fermentation judged by some changes in
organic acids content. Most of these responses were similar to those in plants and
corroborates a variety of previous reports that Arabidopsis cell cultures are an excellent
model system to understand general plant responses to Pi deficiency.
Materials and Methods
Plant Materials
Arabidopsis thaliana accession Landsberg erecta cell suspension cultures (May and
Leaver, 1993) were maintained in Murashige and Skoog (MS) basal medium (Phytotechlab,
Shawnee Mission, KS USA) by weekly subculturing with the addition of 3 % (w/v)
sucrose, 0.5 mg/L naphthalene acetic acid (NAA) and 0.05 mg/L kinetin (Murashige and
Skoog, 1962). For various Pi treatments, 250 mM filter sterilised KH2PO4 was added to the
medium to the required final concentration. The pH was adjusted to 5.8 using 1 M KOH.
For subculturing, 27 ml of a 7-day-old culture were transferred into 100 ml fresh MS basal
medium in a 250 ml Erlenmeyer flask under sterile conditions. Cells were grown under
continuous light at 22 oC with shaking at 140 rpm and harvested by vacuum filtration. Cells
were stored in -80 oC for analysis.
96
Inorganic phosphate assay
Pi was determined using an ascorbic acid-ammonium molybdate method (Bruce N, 1966).
Approximately 50 mg fresh cells were frozen in liquid nitrogen prior to the addition of 500
µl of 1 % (v/v) acetic acid. Cells were homogenised three times at 5000 rpm for 45 s in a
cell homogeniser (PrecellysR 24, Bertin Technologies, Montigny-le-Bretonneux, France).
The samples were placed on ice for 30 min and subjected to centrifugation at 16, 000 x g
for 15 min at 4 oC. The supernatant was transferred to a fresh tube and further clarified by
centrifugation at the same conditions. For the assay, 90 µl of the sample was added to 210
µl test solution (mixture of six parts 0.42 % ammonium molybdate in 1 N H2SO4 and one
part 10 % ascorbic acid in water). The mixture was incubated at 37 oC for 1 h. The samples
were prepared in a 96 well plate and the OD820 was measured (Thermo Multiskan Spectrum
spectrophotometer, Thermo Scientific, Vantaa, Findland).
Total phosphorus measurement
For total P measurement, 3 ml nitric acid (HNO3) was added to a known oven-dried mass
of Arabidopsis tissues in a 50 ml Erlenmeyer flask. A first digestion was performed by
heating 10 min at 100 oC. The samples were allowed to cool to room temperature and 1 ml
perchloric acid (HClO4) was added. The digestion was continued at 140-150 oC until the
vigorous reaction between HClO4 and organic residues was completed. The temperature
was raised to 170-180 oC and samples were heated for 10 min to dissolve the silica. The
digested samples were allowed to cool to room temperature before 3 ml water was added
and warmed to dissolve any KClO4 crystals. The solution was transferred to a plastic vial,
brought up to 10 ml with water. The sample was assayed for total P using a malachite green
method (Vanveldhoven and Mannaerts, 1987) in a 96-well format. The absorbance was
measured at OD630 (Thermo Multiskan Spectrum spectrophotometer, Thermo Scientific,
Vantaa, Findland).
Sucrose assay
Sucrose in the medium was assayed as described previously (Stepan-Sarkissian and Grey,
1990). 30 % (w/v) KOH was added to the samples, mixed well and placed in boiling water
97
bath for 10 min and cooled to room temperature. 3 ml of anthrone reagent was added and
the mixture was placed in 40 o
C water bath for 20 min. The absorbance at 620 nm was
recorded (UVmini-1240 UV-VIS spectrophotometer, Shimatzu Scientific Instruments,
Sydney, Australia).
mRNA preparation
Messenger RNA was isolated from cells using magnetic beads coated with oligo-dT (Jost et
al., 2007). About 70 mg Arabidopsis thaliana cells were lysed in lysis buffer (100 mM Tris,
500 mM LiCl, 10 mM EDTA, 1 % LiDS, 5 mM DTT) and incubated at room temperature
for 10 min. Samples were subjected to three cycles of homogenisation at 5000 rpm, 45 s
each, in a cell homogeniser (PrecellysR 24, Bertin Technologies, Montigny-le-Bretonneux,
France) before centrifugation for 10 min, 12,000 x g at 15 oC. The supernatant was
transferred to a new tube and further clarified by 5 min centrifugation at 12, 000 x g. In the
meantime, 10 µl of oligo-dT magnetic beads (Dynabeads® Oligo(dT)25, Invitrogen Dynal
AS, Oslo, Norway) were transferred into PCR tubes. The beads were washed twice with
lysis buffer and the supernatant was removed after each wash by magnetic separation
(Dynal® MPC-9600 Magnetic Particle Concentrator, Invitrogen Dynal AS, Oslo, Norway).
To the washed beads, 240 µl of the clarified cellular extract was added. Mixtures were
incubated at room temperature for 10 min to allow annealing of poly-A+ RNA to the beads.
The supernatant was removed after magnetic bead separation. The beads were washed
twice with washing buffer (10 mM Tris, 150 mM LiCl, 1 mM EDTA, 0.1 % LiDS), twice
with washing buffer lacking LiDS, and twice with ice-cold 1X RT buffer (50 mM Tris, 50
mM KCl, 10 mM MgCl2 x 6H2O, pH 8.3, 0.1 mM DTT). RNA was eluted from the beads
by incubating 5 min at 70 oC in 10 µl RT buffer, and chilled on ice prior to adding 10 µl 2x
RT mix (5x RT buffer (Bioline Aust Pty Ltd, New South Wales, Australia) 100 mM DTT,
dNTP-mix (40 mM each), RNasin (40 U/ µl) (Bioline Aust Pty Ltd, New South Wales,
Australia), MLV reverse ranscriptase (200 U/ µl) (Bioline Aust Pty Ltd, New South Wales,
Australia), DEPC-ddH2O). Samples were incubated at 42 oC
for 90 min. The cDNA on the
beads was washed twice with 1 X RT buffer. The mRNA was eluted by incubating the
beads in 25 µl elution buffer (2 mM EDTA, 10 mM Tris-HCl pH 8) for 10 min at 95 oC,
before chilling on ice for 1 min. The supernatant containing the mRNA was quickly
removed after magnetic separation and stored in a new tube. The RNA recovery was
98
measured using a spectrophotometer (ND-1000 UV-Vis Spectrophotometer, NanoDrop
Technologies, Wilmingon, DE, USA). The cDNA yield was assumed to be equivalent to
the mRNA eluted from the beads and was adjusted to 2 ng µl-1
by adding sterile distilled
water to the beads. The cDNA was stored in -80 oC.
Quantitative Real-Time Polymerase Chain Reaction
Primers for members of the PHT gene family, primary miRNA399 and PHO2 were
designed (Appendix 1; DNASTAR software, DNASTAR Inc, Madison Wisconsin, USA).
For qRT PCR, 2.5 µl cDNA diluted 1:10 with sterile distilled water was added to 2.5 µl
primer mix (1.2 µM each) and 5 µl real-time master mix (Power SYBR® Green PCR
Master Mix, Applied Biosystem, Foster City, CA, USA). The reaction was performed
(7500- Fast Real-Time PCR System Applied Biosystems, Scoresby, Victoria, Australia) by
40 X cycling at 2 min at 50 oC, 10 min at 95
oC, 15 min at 95
oC and 1 min at 60
oC.
Sample extraction, derivatisation and gas chromatoghraphy mass spectrometry (GC-
MS) analysis
Metabolites were extracted and derivatised using a protocol adapted from (Roessner-Tunali
et al., 2003). Approximately 30 mg fresh weight of Arabidopsis cells were extracted in 500
µl 20: 2:1 HPLC grade methanol: water: ribitol. Samples were incubated on a thermomixer
at 75 oC
with 1200 rpm for 20 min prior to centrifugation at 16,000 x g, 3 min, at 20
oC. A
100 µl aliquot of the supernatant was dried down for 1 h under vacuum (Labcon co, Kansas
City, MO, USA). For automated derivatisation and GC-MS run, 20 µl pyridine was added
to the dried sample, the sample was incubated at 65 oC, 750 rpm for 1 h (Agilent 5975C
inert XL MSD with Triple-Axis Detector, Forest Hill, VIC, Australia) before 30 µl N-
,methyl-N-(tri-methylsilyl) trifluoroacetamide (Derivatisation grade, Sigma) was added and
the samples was incubated at room temperature for a further 30 min.
For GC-MS run, 1 µl of derivatized sample was injected into the front inlet splitless
injector at 300 oC initial temperature, 9.13 psi pressure and 9.9 ml min
-1 purge flow, with
helium carrier gas with a constant flow of 1.0 ml min-1
(Capillary column Factor 4, Varian
Inc, Blackburn, VIC, Australia). The GC column oven was held at 70 oC initial
99
temperature for 1 min. The temperature was increased to 76 oC
at 1
oC
min
-1, followed by
325 oC at 6
oC
min
-1 in before being held for 8 min. Mass selective detector (MSD) transfer
line heater was used with initial temperature of 250 oC. For the mass spectrometry (MS),
the scan acquisition mode was used. The MS source temperature was 230 oC
and MS Quad
temperature was 150 oC. The solvent delay time was 8 min and the relative electron
multiplier voltage (EMV) mode was used. The low mass was 50 amu and the high mass
was 600 amu. The GC-MS analysis was conducted at Metabolomics Australia, The
University of Western Australia.
Statistical analysis of GC-MS data
With two biological replicates and at least three technical replicates of each samples, the
raw GC-MS data obtained were processed and the statistical analysis was performed using
AMDIS (http://chemdata.nist.gov/mass-spc-amdis) and METABOLOME-EXPRESS
software (version 1.0, http://www.metabolome-express.org) (Carroll et al., 2010).
References
Abel S (2011) Phosphate sensing in root development. Current Opinion in Plant Biology
14: 303-309
Abel S, Ticconi CA, Delatorre CA (2002) Phosphate sensing in higher plants. Physiologia
Plantarum 115: 1-8
Aung K, Lin SI, Wu CC, Huang YT, Su CL, Chiou TJ (2006) pho2, a phosphate
overaccumulator, is caused by a nonsense mutation in a MicroRNA399 target gene.
Plant Physiology 141: 1000-1011
Bates TR, Lynch JP (2001) Root hairs confer a competitive advantage under low
phosphorus availability. Plant and Soil 236: 243-250
Bieleski RL (1973) Phosphate pools, phosphate transport, and phosphate availability.
Annual Review of Plant Physiology 24: 225-252
Bouché N, Fromm H (2004) GABA in plants: just a metabolite? Trends in Plant Science
9: 110-115
Bozzo GG, Dunn EL, Plaxton WC (2006) Differential synthesis of phosphate-starvation
inducible purple acid phosphatase isozymes in tomato (Lycopersicon esculentum)
suspension cells and seedlings. Plant Cell and Environment 29: 303-313
Bozzo GG, Raghothama KG, Plaxton WC (2002) Purification and characterization of
two secreted purple acid phosphatase isozymes from phosphate-starved tomato
(Lycopersicon esculentum) cell cultures. European Journal of Biochemistry 269:
6278-6286
100
Bozzo GG, Raghothama KG, Plaxton WC (2004) Structural and kinetic properties of a
novel purple acid phosphatase from phosphate-starved tomato (Lycopersicon
esculentum) cell cultures. Biochemical Journal 377: 419-428
Bruce N A (1966) [10] Assay of inorganic phosphate, total phosphate and phosphatases. In
VG Elizabeth F. Neufeld, ed, Methods in Enzymology, Vol Volume 8. Academic
Press, pp 115-118
Carroll AJ, Badger MR, Millar AH (2010) The MetabolomeExpress Project: enabling
web-based processing, analysis and transparent dissemination of GC/MS
metabolomics datasets. BMC Bioinformatics 11:376-388
Carswell MC, Grant BR, Plaxton WC (1997) Disruption of the phosphate-starvation
response of oilseed rape suspension cells by the fungicide phosphonate. Planta 203:
67-74
Cheng L, Bucciarelli B, Shen J, Allan D, Vance CP (2011) Update on white lupin cluster
root acclimation to phosphorus deficiency update on lupin cluster roots. Plant
Physiology 156: 1025-1032
Chiou TJ, Aung K, Lin SI, Wu CC, Chiang SF, Su CL (2006) Regulation of phosphate
homeostasis by microRNA in Arabidopsis. Plant Cell 18: 412-421
Chiou TJ, Lin SI (2011) Signaling network in sensing phosphate availability in plants. In
SS Merchant, WR Briggs, D Ort, eds, Annual Review of Plant Biology, Vol 62, Vol
62. Annual Reviews, Palo Alto, pp 185-206
Ciereszko I, Barbachowska A (2000) Sucrose metabolism in leaves and roots of bean
(Phaseolus vulgaris L.) during phosphate deficiency. Plant Physiology 156: 640-644
Ciereszko I, Janonis A, Kociakowska M (2002) Growth and metabolism of cucumber in
phosphate-deficient conditions. Plant Nutrition 25: 1115-1127
Daram P, Brunner S, Rausch C, Steiner C, Amrhein N, Bucher M (1999) Pht2;1
encodes a low-affinity phosphate transporter from Arabidopsis. The Plant Cell
Online 11: 2153-2166
Dong B, Ryan PR, Rengel Z, Delhaize E (1999) Phosphate uptake in Arabidopsis
thaliana: dependence of uptake on the expression of transporter genes and internal
phosphate concentrations. Plant Cell and Environment 22: 1455-1461
Dong D, Peng X, Yan X (2004) Organic acid exudation induced by phosphorus deficiency
and/or aluminium toxicity in two contrasting soybean genotypes. Physiologia
Plantarum 122: 190-199
Duan, K., Yi, K., Dang, L., Huang, H., Wu, W. and Wu, P. (2008) Characterization of a
sub-family of Arabidopsis genes with the SPX domain reveals their diverse
functions in plant tolerance to phosphorus starvation. Plant J. 54, 965–975.
Duff SMG, Lefebvre DD, Plaxton WC (1989) Purification and characterization of a
phosphoenolpyruvate phosphatase from Brassica nigra suspension cells. Plant
Physiology 90: 734-741
Duff SMG, Moorhead GBG, Lefebvre DD, Plaxton WC (1989) Phosphate starvation
inducible `bypasses' of adenylate and phosphate dependent glycolytic enzymes in
Brassica nigra suspension cells. Plant Physiology 90: 1275-1278
Fujii H, Chiou TJ, Lin SI, Aung K, Zhu JK (2005) A miRNA involved in phosphate-
starvation response in Arabidopsis. Current Biology 15: 2038-2043
Gregory AL, Hurley BA, Tran HT, Valentine AJ, She YM, Knowles VL, Plaxton WC (2009) In vivo regulatory phosphorylation of the phosphoenolpyruvate carboxylase
AtPPC1 in phosphate-starved Arabidopsis thaliana. Biochemical Journal 420:57-65
Hammond JP, Broadley MR, White PJ (2004) Genetic responses to phosphorus
deficiency. Annals of Botany 94: 323-332
101
Hayashibe M (1957) Alcoholic fermentation by intact cells of bakers yeast.1.Inhibition of
fermentation by phosphate. Biochemistry 44: 543-556
Hernandez G, Ramirez M, Valdes-Lopez O, Tesfaye M, Graham MA, Czechowski T,
Schlereth A, Wandrey M, Erban A, Cheung F, Wu HC, Lara M, Town CD,
Kopka J, Udvardi MK, Vance CP (2007) Phosphorus stress in common bean:
Root transcript and metabolic responses. Plant Physiology 144: 752-767
Huang CY, Roessner U, Eickmeier I, Genc Y, Callahan DL, Shirley N, Langridge P,
Bacic A (2008) Metabolite profiling reveals distinct changes in carbon and nitrogen
metabolism in phosphate-deficient barley plants (Hordeum vulgare L.). Plant and
Cell Physiology 49: 691-703
Johnson JF, Allan DL, Vance CP, Weiblen G (1996) Root carbon dioxide fixation by
phosphorus-deficient Lupinus albus - Contribution to organic acid exudation by
proteoid roots. Plant Physiology 112: 19-30
Jost R, Berkowitz O, Masle J (2007) Magnetic quantitative reverse transcription PCR: A
high-throughput method for mRNA extraction and quantitative reverse transcription
PCR. Biotechniques 43: 206-211
Juszczuk I, Malusà E, Rychter AM (2001) Oxidative stress during phosphate deficiency
in roots of bean plants (Phaseolus vulgaris L.). Plant Physiology 158: 1299-1305
Klosinska MM, Crutchfield CA, Bradley PH, Rabinowitz JD, Broach JR (2011) Yeast
cells can access distinct quiescent states. Genes and Development 25: 336-349
Lefebvre DD, Duff SMG, Fife CA, Julien-Inalsingh C, Plaxton WC (1990) Response to
phosphate deprivation in Brassica nigra suspension cells : Enhancement of
intracellular, cell surface, and secreted phosphatase activities compared to increases
in Pi-absorption rate. Plant Physiology 93: 504-511
Lei M, Liu Y, Zhang B, Zhao Y, Wang X, Zhou Y, Raghothama KG, Liu D (2011)
Genetic and genomic evidence that sucrose is a global regulator of plant responses
to phosphate starvation in Arabidopsis. Plant Physiology 156: 1116-1130
Li LH, Qiu XH, Li XH, Wang SP, Zhang QF, Lian XM (2010) Transcriptomic analysis
of rice responses to low phosphorus stress. Chinese Science Bulletin 55: 251-258
Lin S-I, Chiou T-J (2008) Long-distance movement and differential targeting of
microRNA399s. Plant Signaling and Behaviour 3: 730-732
Lin WY, Lin SI, Chiou TJ (2009) Molecular regulators of phosphate homeostasis in
plants. Experimental Botany 60: 1427-1438
Liu J, Vance CP (2010) Crucial roles of sucrose and microRNA399 in systemic signaling
of P deficiency: a tale of two team players? Plant signaling and Behavior 5: 1556-
1560
Liu JQ, Samac DA, Bucciarelli B, Allan DL, Vance CP (2005) Signaling of phosphorus
deficiency-induced gene expression in white lupin requires sugar and phloem
transport. Plant Journal 41: 257-268
Lynch JP, Brown KM (2008) Root strategies for phosphorus acquisition. The
Ecophysiology of Plant-Phosphorus Interactions. In PJ White, JP Hammond, eds,
Vol 7. Springer Netherlands, pp 83-116
May MJ, Leaver CJ (1993) Oxidative stimulation of glutathione synthesis in Arabidopsis
thaliana suspension cultures. Plant Physiology 103: 621-627
Milani G, Jarmuszkiewicz W, Sluse-Goffart CM, Schreiber AZ, Vercesi AE, Sluse FE (2001) Respiratory chain network in mitochondria of Candida parapsilosis: ADP/O
appraisal of the multiple electron pathways. FEBS Letters 508: 231-235
102
Mimura T, Sakano K, Shimmen T (1996) Studies on the distribution, re-translocation and
homeostasis of inorganic phosphate in barley leaves. Plant, Cell and Environment
19: 311-320
Misson J, Raghothama KG, Jain A, Jouhet J, Block MA, Bligny R, Ortet P, Creff A,
Somerville S, Rolland N, Doumas P, Nacry P, Herrerra-Estrella L, Nussaume
L, Thibaud M-C (2005) A genome-wide transcriptional analysis using Arabidopsis
thaliana Affymetrix gene chips determined plant responses to phosphate
deprivation. Proceedings of the National Academy of Sciences of the United States
of America 102: 11934-11939
Misson J, Thibaud M-C, Bechtold N, Raghothama K, Nussaume L (2004)
Transcriptional regulation and functional properties of Arabidopsis Pht1;4, a high
affinity transporter contributing greatly to phosphate uptake in phosphate deprived
plants. Plant Molecular Biology 55: 727-741
Morcuende R, Bari R, Gibon Y, Zheng WM, Pant BD, Blasing O, Usadel B,
Czechowski T, Udvardi MK, Stitt M, Scheible WR (2007) Genome-wide
reprogramming of metabolism and regulatory networks of Arabidopsis in response
to phosphorus. Plant Cell and Environment 30: 85-112
Muchhal US, Pardo JM, Raghothama KG (1996) Phosphate transporters from the higher
plant Arabidopsis thaliana. Proceedings of the National Academy of Sciences 93:
10519-10523
Mudge SR, Rae AL, Diatloff E, Smith FW (2002) Expression analysis suggests novel
roles for members of the Pht1 family of phosphate transporters in Arabidopsis. Plant
Journal 31: 341-353
Müller R, Morant M, Jarmer H, Nilsson L, Nielsen TH (2007) Genome-wide analysis of
the Arabidopsis leaf transcriptome reveals interaction of phosphate and sugar
metabolism. Plant Physiology 143: 156-171
Murashige T, Skoog F (1962) A revised medium for rapid growth and bio-assays with
tobacco tissue cultures. Physiologia Plantarum 15: 473-497
Nagano M, Ashihara H (1993) Long-term phosphate starvation and respiratory
metabolism in suspension-cultured Catharanthus roseus cells. Plant and Cell
Physiology 34: 1219-1228
Neumann G, Romheld V (1999) Root excretion of carboxylic acids and protons in
phosphorus-deficient plants. Plant and Soil 211: 121-130
Okumura S, Mitsukawa N, Shirano Y, Shibata D (1998) Phosphate transporter gene
family of Arabidopsis thaliana. DNA Research 5: 261-269
Oshima Y (1997) The phosphatase system in Saccharomyces cerevisiae. Genes and
Genetic Systems 72: 323-334
Plaxton W, Podest, Florencio (2006) The Functional organization and control of plant
respiration. Critical Reviews in Plant Sciences 25: 159-198
Plaxton WC (1996) The organization and regulation of plant glycolysis. Annual Review of
Plant Physiology and Plant Molecular Biology 47: 185-214
Plaxton WC, Tran HT (2011) Metabolic adaptations of phosphate-starved plants. Plant
Physiology 156: 1006-1015
Raghothama K, Karthikeyan A (2005) Phosphate acquisition root physiology: from Gene
to Function. In H Lambers, T Colmer, eds, Vol 4. Springer Netherlands, pp 37-49
Raghothama KG (1999) Phosphate acquisition. Annual Review of Plant Physiology and
Plant Molecular Biology 50: 665-693
103
Rausch C, Zimmermann P, Amrhein N, Bucher M (2004) Expression analysis suggests
novel roles for the plastidic phosphate transporter Pht2;1 in auto- and heterotrophic
tissues in potato and Arabidopsis. Plant Journal 39: 13-28
Robinson D (1994) The responses of plants to non uniform supplies of nutrients. New
Phytologist 127: 635-674
Roessner-Tunali U, Hegemann B, Lytovchenko A, Carrari F, Bruedigam C, Granot
D, Fernie AR (2003) Metabolic profiling of transgenic tomato plants
overexpressing hexokinase reveals that the influence of hexose phosphorylation
diminishes during fruit development. Plant Physiology 133: 84-99
Rychter AM, Randall DD (1994) The effect of phosphate deficiency on carbohydrate
metabolism in bean roots. Physiologia Plantarum 91: 383-388
Shen H, Yan XL, Zhao M, Zheng SL, Wang XR (2002) Exudation of organic acids in
common bean as related to mobilization of aluminum- and iron-bound phosphates.
Environmental and Experimental Botany 48: 1-9
Shimaoka T, Ohnishi M, Sazuka T, Mitsuhashi N, Hara-Nishimura I, Shimazaki K-I,
Maeshima M, Yokota A, Tomizawa K-I, Mimura T (2004) Isolation of intact
vacuoles and proteomic analysis of tonoplast from suspension-cultured cells of
Arabidopsis thaliana. Plant and Cell Physiology 45: 672-683
Shin H, Shin H-S, Dewbre GR, Harrison MJ (2004) Phosphate transport in Arabidopsis:
Pht1;1 and Pht1;4 play a major role in phosphate acquisition from both low- and
high-phosphate environments. Plant Journal 39: 629-642
Smith FW, Ealing PM, Dong B, Delhaize E (1997) The cloning of two Arabidopsis genes
belonging to a phosphate transporter family. Plant Journal 11: 83-92
Stepan-Sarkissian G, Grey D (1990) Growth Determination and Medium Analysis Plant
Cell and Tissue Culture. In JW Pollard, JM Walker, eds, Vol 6. Humana Press, pp
13-27
Takabatake R, Hata S, Taniguchi M, Kouchi H, Sugiyama T, Izui K (1999) Isolation
and characterization of cDNAs encoding mitochondrial phosphate transporters in
soybean, maize, rice, and Arabidopsis. Plant Molecular Biology 40: 479-486
Uhde-Stone C, Zinn KE, Ramirez-Yáñez M, Li A, Vance CP, Allan DL (2003) Nylon
filter arrays reveal differential gene expression in proteoid roots of white lupin in
response to phosphorus deficiency. Plant Physiology 131: 1064-1079
Vance CP, Uhde-Stone C, Allan DL (2003) Phosphorus acquisition and use: critical
adaptations by plants for securing a nonrenewable resource. New Phytologist 157:
423-447
Vanveldhoven PP, Mannaerts GP (1987) Inorganic and organic phosphate measurements
in the nanomolar range. Analytical Biochemistry 161: 45-48
Veljanovski V, Vanderbeld B, Knowles VL, Snedden WA, Plaxton WC (2006)
Biochemical and molecular characterization of AtPAP26, a vacuolar purple acid
phosphatase up-regulated in phosphate-deprived Arabidopsis suspension cells and
seedlings. Plant Physiology 142: 1282-1293
Vershinina OA, Znamenskaya LV (2002) The Pho regulons of bacteria. Microbiology
71: 497-511
Vijayraghavan V, Soole K (2010) Effect of short- and long-term phosphate stress on the
non-phosphorylating pathway of mitochondrial electron transport in Arabidopsis
thaliana. Functional Plant Biology 37: 455-466
104
Wasaki J, Yonetani R, Kuroda S, Shinano T, Yazaki J, Fujii F, Shimbo K, Yamamoto
K, Sakata K, Sasaki T, Kishimoto N, Kikuchi S, Yamagishi M, Osaki M (2003)
Transcriptomic analysis of metabolic changes by phosphorus stress in rice plant
roots. Plant Cell and Environment 26: 1515-1523
Williamson LC, Ribrioux S, Fitter AH, Leyser HMO (2001) Phosphate availability
regulates root system architecture in Arabidopsis. Plant Physiology 126: 875-882
Wu P, Ma L, Hou X, Wang M, Wu Y, Liu F, Deng XW (2003) Phosphate Starvation
Triggers Distinct Alterations of Genome Expression in Arabidopsis Roots and
Leaves. Plant Physiology 132: 1260-1271
105
CHAPTER 4:
Arabidopsis thaliana cells in suspension cultures alter their
physiological, transcripts and metabolites responses under
phosphite stress
106
Abstract
Phosphite (Phi) is widely used as a fungicide to combat oomycete pathogens. Being an
analog of phosphate (Pi), Phi disturbs Pi-starvation responses in plants. The mechanism of
plant responses towards Phi treatment at the transcript and metabolite levels are not well
characterised. Using Arabidopsis cell suspension cultures as a model system, detrimental
effects of Phi were clearly seen in Pi-depleted cells. Phi perturbed the growth of Pi-depleted
cells by reducing cell biomass. At high Phi supply rates, the cell colour changed from
yellow to whitish or brownish and irregular-shaped cell structures were detected during
viability staining. Distinct accumulation patterns of Pi, organic phosphorus (Po) and Phi
inside the cells were found in Pi-containing and Pi-deficient medium containing Phi. In Pi-
deficient medium, a higher amount of Pi was found inside Phi treated cells compared to the
non-Phi treated cells. Once the cells were subcultured into fresh medium containing Phi, Pi-
deficient cells took up more Phi into the cells. The amount of Phi inside the cells then
reduced to about the same concentration as Pi-sufficient cells. At the transcript level, the
induction of several PHT gene family members during Pi depletion was more pronounced
during Phi treatment. Metabolite profiling revealed that the amounts of sugars, some
organic acids and some amino acids were largely decreased by the presence of Phi in Pi-
deficient cells compared to the absence of Phi. In the absence of Phi, cells rapidly took up
Pi within a day after sub-culturing into fresh media, similar to the cells treated with Phi. Phi
in the medium did not affect the Pi concentration inside the cells, although Phi was also
taken up by the cells. The abundance of PHT gene family transcripts and the metabolites
detected in Pi-sufficient cells did not change significantly in the presence of Phi. In
conclusion, Phi affected Pi-deficient cells, but not Pi-sufficient cells, at the physiological,
transcript and metabolite levels.
107
Introduction
Phosphite (Phi) is a reduced form of phosphorus (P) and an analogue of phosphate (Pi). Phi
has been widely used as a fungicide to increase plant resistance towards oomycetes (Fenn
and Coffey, 1984; Guest and Grant, 1991). It is also claimed to be a source of P fertiliser
and probably suppresses parasitic and pathogenic soil microbes. However, the idea that Phi
is a P fertiliser has become a controversial issue. This is because Phi negatively effects
growth of Pi-deficient plants. In plants with low Pi status, the ability of Phi to mimic Pi
causes plants to react as if they had sufficient Pi. Plants will not establish Pi starvation
responses as they should, and this finally disrupts the whole plant system (Carswell et al.,
1997). Furthermore, although Phi can be oxidised to Pi by bacteria, this process is very
slow (Ohtake et al., 1996) and it is likely not to aid plant growth through Pi fertilisation in
the short term. There is no evidence that plants can metabolise Phi, which means that the
detrimental effects of Phi are retained in plant cells for a long time (Barrett et al., 2004).
Knowledge of the molecular response of plants to Phi treatment is limited. Due to their
analogous properties, both Pi and Phi are transported via Pi transporters (Varadarajan et al.,
2002) encoded by the PHT gene family members (Okumura et al., 1998). Some PHT genes
are part of the Pi-starvation response, which when induced, the encoded proteins move Phi
into the plant, and probably from cell to cell and into intracellular compartments. At the
transcript level, Phi seems to impede plant responses towards Pi deprivation by suppressing
the induction of Pi-starvation inducible genes (Ticconi et al., 2001; Varadarajan et al.,
2002).
The growth of several plant species treated with Phi has been examined. In most cases, Phi
did not give any benefit in improving plant growth and yield (Thao and Yamakawa, 2009).
In fact, Phi can be toxic to Pi-depleted plants (Ticconi et al., 2001). The effects of Phi on
plant metabolism are largely unknown, except Phi has the capacity to boost plant responses
towards pathogens (Eshraghi et al., 2011). The metabolic changes caused by Phi treatment
are better known in phytophthora (Niere et al., 1994) where the main target of Phi is the
inhibition of protein phosphorylation (Carswell et al., 1997). Phytophthora metabolism was
affected beginning at an early stage of growth, with changes in the composition of lipids,
108
water-soluble metabolites, macromolecules and cell wall fractions (Dunstan et al., 1990). In
yeast, several enzymes in the glycolytic and phosphogluconate pathways were inhibited by
Phi (Stehmann and Grant, 2000).
The ability of Arabidopsis suspension cells to mimic plant responses to low Pi status
(Chapter 3) makes it a good system to study the effects of Phi on plant cells. In this chapter,
the effects of Phi on Arabidopsis cells grown in culture were investigated at the
physiological and molecular levels, with special focus on changes to the transcript
abundance profiles of the PHT gene family members, and the metabolite profiles of cells.
These analyses gave insight into the responses of plants that occur upon Phi exposure.
Results
Concentration-dependent Phi toxicity for Arabidopsis suspension cells grown in culture
The amount of Phi that is non-toxic, yet prompts responses in Arabidopsis suspension cells
was investigated. Cells grown for 7 days in media initially containing 1 mM Pi have
completely depleted the external Pi supply (Chapter 3). These cells were re-supplied with
an initial concentration of 4 mM Pi in fresh media and various concentrations of Phi.
Previously, cells cultured in this way in the absence of Phi were found to be able to
continue growth for 14 days, but cell growth then ceased, presumably because the P status
of the cells dropped below the point that can sustain growth (Chapter 3).
In the current experiment, cell growth was monitored for 3 weeks with subculturing into
media lacking both Pi and Phi every 7 days. The exposure of Arabidopsis cells to Phi did
not influence the cell appearance at day 7 (Figure 4.1). For initial Phi concentrations lower
than 8 mM, culture biomass accumulated to about the same level as for cultures without Phi
treatment (Figure 4.2). By day 14, initial Phi supplies of 2 mM or more had altered cell
appearance. This could be seen as a change of colour of the cultures. Except for cells
initially supplied with 1 mM Phi, the symptoms of apparent toxicity became stronger
during the third week of Phi treatment (Figure 4.1). A fluorescent dye uptake assay that
assesses cell viability, however, did not detect significant cell death during the experiment.
In this assay, live cells would fluoresce green while dead cells would fluoresce red. Almost
109
100 % cells were visible in green, and whenever the colour of the cells in culture changed,
irregularly-shaped structures were observed under the microscope (Figure 4.1C). At day 14,
the accumulated biomass of cells supplied with Phi decreased as the concentration of Phi
increased. Although further biomass reduction was expected for all cells at day 21 due to
inability of cells to grow under Phi toxicity (based on the structure of the cells observed), a
higher amount of ‘biomass’ was obtained for cells supplied with 8 mM Phi. Loss of
biomass after 21 days in control cultures was expected due to Pi depletion. From the
changes of cell appearance, the production of unknown compounds might have contributed
to the apparent increase in ‘biomass’.
A
0 mM
Phi
4 mM
Phi
0.93/*0.79
hFructose
0.97/*0.79
iAMDIS/M
E
2mM
Phi
8 mM
Phi 1 mM
Phi
0 mM Phi 4 mM Phi 2 mM Phi 8 mM Phi 1 mM Phi
110
B
C
Figure 4.1 High Phi concentration altered the physical appearance of Arabidopsis
suspension cells. At day 0, 7-day-old Arabidopsis cells were subcultured into fresh MS
media to give 4 mM as the final Pi concentration, and the indicated concentrations of Phi.
Cells were subcultured into fresh media lacking both Pi and Phi at day 7 and again at day
14. Culture (top panel) and cell appearance (bottom panel) after A) 7 days, B) 14 days and
C) 21 days of growth. Arrows indicate the flasks where the colour of the cells had changed
0 mM
Phi
4 mM
Phi
2 mM
Phi
8 mM
Phi 1 mM
Phi
0 mM
Phi
4 mM
Phi
2 mM
Phi
8 mM
Phi 1 mM
Phi
0 mM Phi 4 mM Phi 2 mM Phi 8 mM Phi 1 mM Phi
0 mM Phi 4 mM Phi 2 mM Phi 8 mM Phi 1 mM Phi
111
0
2
4
6
8
10
12
14
16
0 mM Phi 1 mM Phi 2 mM Phi 4 mM Phi 8 mM Phi
Treatment
Fre
sh
we
igh
t (g
. fla
sk
-1)
Day 7 Day 14 Day 21
visibly. The bottom panel of each figure shows the corresponding cells after viability
staining using fluorescent diacetate and propidium iodide.
Figure 4.2 Estimation of the effect of Pi and Phi on the growth of Arabidopsis suspension
cells. Using the cultures shown in Figure 4.1, cell fresh weight was determined (n= cells
from 1 flask). Red arrows indicate cultures with cells that had abnormal colour.
Phi compromised the growth of Pi-depleted Arabidopsis cells
From the experiments in Chapter 3, an initial supply of 4 mM Pi was found to be enough to
saturate the cells with Pi. The results above showed that 1 mM Phi did not cause visible
toxicity, while 2 mM Phi was moderately toxic to cells after 14 days. Thus, a detailed
analysis of the effects moderate Phi on Pi-replete cells was done. Arabidopsis suspension
cells were initially supplied with 4 mM Pi and either 1 mM or 2 mM Phi. The growth was
determined every two days until day 9 (Figure 4.3). Cells in all treatments including the
minus-Phi control cultures went through a three-day lag phase before the biomass showed a
gradual increase. There was no significant difference in cell fresh weight for the different
treatments at day 9 (Figure 4.3).
112
Figure 4.3 Time course of Phi effects on growth of Pi-replete Arabidopsis suspension cells.
At day 0, 7-day-old Arabidopsis cells were subcultured into fresh media to get 4 mM Pi as
the final concentration. Phi was supplied to a final concentration of 0, 1 or 2 mM Phi. Cell
growth was determined every 2 days over a 9 day period by weighing cell mass. Arrow
indicates the initial cell fresh weight and day of subculture. Values are mean + SE (n=3
flasks). When not visible, the error bars are too small to be seen outside the symbols for the
data points.
The effects of Phi on Pi-depleted cells were then investigated. Cells depleted of Pi by
growth for 7 days in medium initially containing 1 mM Pi were re-supplied with 4 mM Pi
without Phi, and grown for 7 days before being subcultured into fresh media lacking Pi but
supplemented with Phi. In absence of Phi, cells cultured on 4 mM Pi have enough Pi stores
to sustain growth for another 6 days after subculturing (Figure 4.4). However, Phi inhibits
this further growth that relies on the internal P pool. At day 11, cells without Phi treatment
have 3.3 g additional fresh weight, but cells treated with 1 mM Phi and 2 mM Phi have only
0.1 g and 0.5 g additional fresh weight, respectively. Previously, the inability of Pi deprived
Brassica napus and Lycopersicon esculentum (tomato) cells to grow in suspension culture
in the presence of low Phi concentration was reported (Carswell et al., 1997; Bozzo et al.,
2004).
0
5
10
15
20
1 3 5 7 9
Day
Fre
sh w
eig
ht
(g.
flas
k-1
)
0 mM Phi 1mM Phi 2 mM Phi
113
0
2
4
6
8
10
12
14
9 11 13 15 17 19 21
Day
Fre
sh w
eig
ht
(g.f
lask
-1)
0 mM Phi 1 mM Phi 2 mM Phi
Figure 4.4 Growth of Arabidopsis suspension cells depleted of Pi were inhibited by Phi.
Cells grown in 4 mM Pi for 7 days were subcultured into medium without Pi containing
either 1 mM or 2 mM Phi. The fresh weight was determined every 2 days. At day 14, cells
were subcultured into fresh medium lacking both Pi and Phi. Values are mean + SE (n=3
flasks). When not visible, the error bars are too small to be seen outside the symbols for the
data points. Significant differences (*) between Phi treatment and the control culture (0 Phi)
at the same time point were determined by a t-test (p<0.05).
P pools in Arabidopsis cells changed with Phi treatment
Pi was rapidly taken up by the cells within a day of being transferred to fresh media
containing 4 mM Pi (Figure 4.5A), as shown in Chapter 3. Phi suppressed the size of the
internal Pi pool by about 20 % at day 1 for cells treated with 2 mM Phi, and by day 3 for
cells treated with 1 mM Phi. The Pi content inside the cells was depleted by day 3 to about
the same level for all the treatments and continued to decrease until day 7.
As the cells took up Pi with time, the available external Pi in the absence of Phi was
depleted from the initial supply of 4 mM by more than 70 % at day 1 (Figure 4.5B), as
observed in Chapter 3. Phi slowed the removal of Pi from the medium and the effect was
stronger for 2 mM Phi than for 1 mM Phi. As described in Chapter 3, the external Pi in the
cultures increased at day 3. At the times sampled, this increase in Pi in the medium was
highest for cells grown in medium containing 1 mM Phi. By day 5, the amount of Pi left in
* * * * *
* * * * * * * *
114
the medium had decreased and was largely depleted in all cultures by day 9. Thus, 1 mM
Phi slowed Pi removal and that 2 mM slowed Pi removal more than 1 mM Phi.
A)
0
20
40
60
80
100
1 3 5 7 9
Day
Pi in
sid
e t
he
ce
lls
(µ
mo
l. g
FW
1-))
0 mM Phi 1 mM Phi 2 mM Phi
B)
0
0.5
1
1.5
2
1 3 5 7 9
Day
Pi
left
in
med
ium
(m
M)
0 mM Phi 1 mM Phi 2 mM Phi
Figure 4.5 Effect of Phi treatment on Pi concentration inside Pi-sufficient Arabidopsis cells
(A) and Pi removed from the medium by Pi-sufficient Arabidopsis cells (B). Using the
cultures presented in Figure 4.3, the Pi concentrations inside the cells and left in the
medium were determined. Values are mean + SE (n=3 flasks). When not visible, the error
bars are too small to be seen outside the symbols for the data points. Significant differences
(*) between Phi treatment and the control culture (0 Phi) at the same time points were
determined by a t-test (p<0.05).
*
* *
*
* * *
* * *
*
115
The Pi concentration inside cells after 7-days growth in 4 mM Pi decreased with time until
day 15, regardless of the presence of Phi (Figure 4.6A). The internal Pi concentration was
more than 50 % higher for cells treated with Phi than the control cells by day 11, at both
Phi supplies. There was a very small amount of Pi in the media that might have been
carried over from the cells and medium during subculturing. This Pi in the medium was
removed by the cells by day 15 and was then maintained at a low concentration from day
15 (Figure 4.6B). Cells treated with Phi took longer to use this residual Pi than the control
cells.
A)
0
2
4
6
8
9 11 13 15 17 19 21
Day
Pi i
ns
ide
th
e c
ells
(µ
mo
l. g
FW
-1)
0 mM Phi 1 mM Phi 2 mM Phi
B)
0
0.01
0.02
0.03
0.04
9 11 13 15 17 19 21
Day
Pi l
eft
in m
ediu
m (
mM
)
0 mM Phi 1 mM Phi 2 mM Phi
Figure 4.6 Effects of Phi treatment on the Pi concentration inside Pi-depleted Arabidopsis
cells (A) and Pi removed from the medium by Pi-depleted Arabidopsis cells (B). Using the
*
* * * *
* * * * * *
* *
116
cultures shown in Figure 4.4, the Pi concentration inside the cells and Pi concentration left
in the medium was determined. Values are mean + SE (n=3 flasks). When not visible, the
error bars are too small to be seen outside the symbols for the data points. Significant
differences (*) between Phi treatment and the control culture (0 Phi) at the same time points
were determined by a t-test (p<0.05).
Phi accumulated to a higher level in plants depleted of Pi
The accumulation of Phi inside treated cells and the amount left in the medium were
determined. The amount of Phi taken up by the cells was dependent on Pi. For cells
supplied with Pi at the start of their growth cycle (day 1 to day 7 in Figure 4.7A), exposure
to 2 mM Phi caused the cells to accumulate more than twice the Phi as cells treated with 1
mM Phi. Phi inside the cells was maximal at day 1 and stayed constant until day 7. Based
on the results of a t-test (p<0.05), Arabidopsis cells depleted of Pi for 7 days before adding
Phi (day 9 to day 15 in Figure 4.7A) did not differ in Phi content compared to cells supplied
with Pi and Phi simultaneously, except at day 9. In Pi-depleted cells, the Phi concentration
inside the cells was about the same for both 1 mM and 2 mM Phi treatments, except for day
15, where the amount of Phi inside the cells supplied with 2 mM Phi was twice that in cells
supplied with 1 mM Phi. Phi inside the cells decreased from day 9 to day 13, and continued
to decrease at day 15, one day after subculturing into fresh medium lacking both Pi and Phi.
The amount of Phi left in the medium was very low for all time points for cells initially
supplied 1 mM Phi, but fluctuated for cultures supplied with 2 mM Phi (Figure 4.7B).
117
A)
0
5
10
15
20
25
30
35
40
1 3 5 7 9 13 15
Day
Phi
insi
de th
e ce
lls(µ
mol
.g F
W-1
)
1 mM Phi 2 mM Phi
B)
0
0.2
0.4
0.6
0.8
1
1 3 5 7 9 13 15
Day
Ph
i le
ft i
n t
he m
ed
ium
(m
M)
1 mM Phi 2 mM Phi
Figure 4.7 Phi status in Pi-replete and Pi-depleted Arabidopsis suspension cells. Using the
cells from Figure 4.3 (cells harvested at day 1 to day 7) and Figure 4.4 (cells harvested at
day 9 to day 15), the amount of Phi inside the cells (A) and the amount of Phi left in the
medium (B) was determined. Arrow indicates the day of subculture. Values are mean + SE
(n=3 flasks). ND= not detected.
Total P was determined for cells treated with Phi. In the acid digests conducted to
determine total P, Phi was quantitatively converted to Pi, and thus Phi contributed to the
total P measured inside the cells.
ND ND ND ND ND ND ND ND
118
For cells supplied with Pi, P in the form of Pi was at the highest level inside the cells at day
1 (Figure 4.8A, B and C). Starting from day 3, more P was incorporated into the organic P
(Po) pool than was present in the Pi pool. Phi contributed less than 10 % of the total P in
cells treated with 1 mM Phi (Figure 4.8B) and 10 % to 20 % of the total P in cells treated
with 2 mM Phi (Figure 4.8C). As shown in Figure 4.7A, the more Phi that was supplied to
cells, the more Phi was taken into the cells. For cells depleted of Pi, Po was always the
largest P pool, followed by Phi and Pi inside the cells (Figure 4.8B and C).
A)
0
20
40
60
80
100
120
1 3 5 7 9 13 15
Day
P i
nsid
e t
he c
ell
s (
µm
ol.
g F
W-1
)
Pi Po
B)
0
20
40
60
80
100
120
1 3 5 7 9 13 15
Day
P i
nsid
e t
he c
ell
s (
µm
ol.
g F
W-1
)
Pi Phi Po
0 mM Phi
1 mM Phi
119
C)
0
20
40
60
80
100
120
1 3 5 7 9 13 15
Day
P in
sid
e t
he
ce
lls
(µ
mo
l. g
FW
-1)
Pi Phi Po
Figure 4.8 The P pools of Phi-treated Arabidopsis suspension cells with different P status.
Using the cells from the cultures described in the legend to Figure 4.7, total P inside the
cells was determined. The amount of Po was calculated by subtracting Pi and Phi from total
P. Values are mean + SE (n=3 flasks). When not visible, the error bars are too small to be
seen outside the symbols for the data points. The cells were cultured in the presence of 0
mM Phi (A), 1 mM Phi (B) or 2 mM Phi (C). The values for Pi are those shown in Figure
4.5A and 4.6A. The values for Phi are those shown in Figure 4.7A.
Several members of the PHT gene family from Pi-depleted Arabidopsis cells respond to Phi
When cells lacking Pi were re-supplied with 4 mM Pi, PHT1;1, and PHT1;4 transcript
amounts were significantly repressed. Transcript amounts from PHT1;2, PHT1;7,and
PHT3;2 were also probably repressed but the results did not pass the significance test
(Figure 4.9). PHT1;8 and PHT1;5 transcripts were only slightly repressed by Pi. The only
gene tested that was not repressed by added Pi was PHT1;9. The magnitude and timing of
these trends was the same as described in Chapter 3. At day 7, PHT1;2, PHT1;5 and
PHT3;2 transcripts were slightly more abundant in the Phi-treated cells compared to non-
Phi-treated cells. The kinetics of repression for PHT1;1, PHT1;2, PHT1;4, PHT1;5,
PHT1;7 PHT1;8 and PHT3;2 was not affected by 2 mM Phi, as the transcript amounts did
2 mM Phi
120
not differ from the non-Phi treated cells at either day 1 or 7 after the addition of Pi and Phi
together.
The transcripts for most of the PHT genes began to be induced at day 9. That is, after 9
days growth in media initially containing 4 mM Pi and 2 days growth in fresh medium
lacking added Pi. Again, these trends were similar to as those described in Chapter 3. For
some of the genes, the transcript abundance was significantly affected by Phi treatment. Phi
accelerates the induction of PHT1;1, PHT1;5, PHT1;8, PHT1;9, and PHT3;2 transcripts,
slows the induction of PHT1;2 and PHT1;7 transcripts and attenuates the induction of
PHT1;4 transcripts.
25
30
35
40
45
50
PHT1;1 PHT1;2 PHT1;4 PHT1;5
Gene
40
-De
lta
Ct
Day 0 Day1 (0 mM Phi) Day 1 (2 mM Phi) Day 7 (0 mM Phi) Day 7 (2 mM Phi) Day 9 (0 mM Phi) Day 9 (2 mM Phi) Day 13 (0 mM Phi) Day 13 (2 mM Phi)
25
30
35
40
45
50
PHT1;7 PHT1;8 PHT1;9 PHT3;2
Gene
40
-De
lta
Ct
Day 0 Day1 (0 mM Phi) Day 1 (2 mM Phi) Day 7 (0 mM Phi) Day 7 (2 mM Phi) Day 9 (0 mM Phi) Day 9 (2 mM Phi) Day 13 (0 mM Phi) Day 13 (2 mM Phi)
Figure 4.9 Response to Pi and Phi status of PHT gene family transcript profiles from
Arabidopsis suspension cells. The cells described in the legend to Figure 4.3, sampled at
day 0, day 1 and day 7, and in the legend to Figure 4.4, sampled at day 9 and day 13, were
used. mRNA was isolated and cDNAs were prepared and used for quantitative real time
*
*
* *
121
polymerase chain reaction (qRT-PCR) assays. The y-axis is a log2 scale, where each
increment is equal to a 2-fold difference in transcript abundance. Values are mean + SE
(n=3). Significant differences (*) between Phi treatment and the control culture (0 Phi) at
the indicated time point were determined by a t-test (p<0.05).
Phi lowered the amount of most of the metabolites detected inside Pi-depleted Arabidopsis
cells
The effect of Phi on metabolite profiles in Arabidopsis cells was determined by GC-MS
(Figure 4.10 and Figure 4.11). The GC-MS raw data was processes using AMDIS and ME
analysis packages. Using AMDIS, it was found that the amounts of sugars such as sucrose
and fructose, were decreased in Phi-treated cells compared to non-Phi treated cells, a day
after Pi was supplied. Most amino acids detected were lower in amount in the Phi-treated
cells, except for glycine and GABA, which were slightly more abundant. Most of the
organic acids detected were lower in amount as well, except for lactate and succinate. The
changes in these metabolite levels, however, were small (Figure 4.10).
The metabolite profile for cells grown for 7 days in media with an initial concentration of 4
mM Pi followed by transfer to fresh media containing 2 mM Phi but no Pi (day 9 cells) was
compared to the day 1 cells grown without Phi treatment. The day 9 cells were Pi-depleted
(Figure 4.5), and had been grown for 2 days in Phi-containing medium. With AMDIS, the
amount of sucrose and fructose were increased in Phi treated cells compared to the
untreated cells. The amino acids serine, valine, glycine and GABA were reduced in
amount, while isoleucine was somewhat higher in amount in the Phi treated cells than in the
untreated cells. The amounts of the detected organic acids, citrate, succinate, fumarate and
malate were significantly lower in Phi-treated cells (Figure 4.11).
With ME analysis, a similar trend was detected for most of these metabolites (Figures 4.10
and 4.11). Details on the ratios of the metabolite changes in Arabidopsis cells treated with
Phi analysed using AMDIS and ME are presented in Appendix 5 and 6, respectively.
122
Fructose
Alanine
Asparagine
Acetyl-coenzyme A
Glutamine
Citrate
Glucose
Glucose 6-phosphate
Fructose 6-phosphate
Glycerate 3-phosphate
Lactate
Day 1 Phi / Day 1
from AMDIS
Phenylalanine
*0.80- 0.88
0.92
0.84
1.26
0.79Sucrose 0.93
0.97
*0.63-
-
- 1.04 1.04
- 0.52
-
0.92 *0.75
0.90 -
- *0.840.66 -
0.88 0.74
0.84 0.76
1.34 1.11 0.91 1.24
1.071.30
0.88 -
Day 1 Phi / Day 1
from ME
ArginineProline
GABAGlutamateα-Ketoglutarate
Succinate
Malate
Fumarate
Oxaloacetate
Aspartate
Isoleucine
Threonine
0.90
Isoleucine
Valine
Leucine
GlycineSerine
Phosphoenolpyruvate
Pyruvate
Glycerol 3-phosphate
-
Leucine
0.64 -
Fructose
Alanine
Asparagine
Acetyl-coenzyme A
Glutamine
Citrate
Glucose
Glucose 6-phosphate
Fructose 6-phosphate
Glycerate 3-phosphate
Lactate
Day 1 Phi / Day 1
from AMDIS
Phenylalanine
*0.80- 0.88
0.92
0.84
1.26
0.79Sucrose 0.93
0.97
*0.63-
-
- 1.04 1.04
- 0.52
-
0.92 *0.75
0.90 -
- *0.840.66 -
0.88 0.74
0.84 0.76
1.34 1.11 0.91 1.24
1.071.30
0.88 -
Day 1 Phi / Day 1
from ME
ArginineProline
GABAGlutamateα-Ketoglutarate
Succinate
Malate
Fumarate
Oxaloacetate
Aspartate
Isoleucine
Threonine
0.90
Isoleucine
Valine
Leucine
GlycineSerine
Phosphoenolpyruvate
Pyruvate
Glycerol 3-phosphate
-
Leucine
0.64 -
Figure 4.10 Metabolite differences in Pi-supplied Arabidopsis thaliana cell cultures treated
with Phi. Arabidopsis cells cultured for 7 days in 1 mM Pi were subcultured into media so
that the final Pi concentration was 4 mM and Phi concentration was 2 mM. One day after
subculturing, cells were harvested and the metabolites were profiled by GC-MS as
described in Materials and Methods. The ratios of metabolites in Phi-treated cells to non-
Phi treated cells are shown on the figure by different colour boxes. Compounds that were
not detected are indicated in italics. Colours represent ≥2, ≥5, ≥10 and ≥20-fold higher (red
gradient) or lower (green gradient) abundance in the Phi-exposed cells compared to the
unexposed cells. The ratios obtained from AMDIS (left-hand box) and ME (right-hand box)
are shown next to the name of the metabolites. Whenever the ratio of metabolite was not
determined, it was indicated with a dash (-). Significant differences (*) were determined by
a t-test (p<0.05, n= 2 biological replicates with 3 technical replicates for each biological
replicate).
+5 +10 +2 -10 -5 -2
123
Fructose
Alanine
Asparagine
Acetyl-coenzyme A
Glutamine
Citrate
Glucose
Glucose 6-phosphate
Fructose 6-phosphate
Glycerate 3-phosphate
Lactate
Phenylalanine
*1.64- *2.66
*0.02
0.85
*1.4Sucrose 1.67
*2.09
0.71-
-
- *0.26 *0.17
- *0.05
-
*0.25 *0.19
1.24 -
- *0.06
*0.34 *0.31
*0.23 0.24
*0.12 - *0.09
*0.09*0.11
* 0.21 -
ArginineProline
GABAGlutamateα-Ketoglutarate
Succinate
Malate
Fumarate
Oxaloacetate
Aspartate
Isoleucine
Threonine
1.24
Isoleucine
Valine
Leucine
GlycineSerine
Phosphoenolpyruvate
Pyruvate
Glycerol 3-phosphate
Leucine
Day 9 Phi / Day 1
from AMDIS
Day 9 Phi / Day 1
from ME
*0.16
Fructose
Alanine
Asparagine
Acetyl-coenzyme A
Glutamine
Citrate
Glucose
Glucose 6-phosphate
Fructose 6-phosphate
Glycerate 3-phosphate
Lactate
Phenylalanine
*1.64- *2.66
*0.02
0.85
*1.4Sucrose 1.67
*2.09
0.71-
-
- *0.26 *0.17
- *0.05
-
*0.25 *0.19
1.24 -
- *0.06
*0.34 *0.31
*0.23 0.24
*0.12 - *0.09
*0.09*0.11
* 0.21 -
ArginineProline
GABAGlutamateα-Ketoglutarate
Succinate
Malate
Fumarate
Oxaloacetate
Aspartate
Isoleucine
Threonine
1.24
Isoleucine
Valine
Leucine
GlycineSerine
Phosphoenolpyruvate
Pyruvate
Glycerol 3-phosphate
Leucine
Day 9 Phi / Day 1
from AMDIS
Day 9 Phi / Day 1
from ME
*0.16
Figure 4.11 Metabolic differences in Pi-deficient Arabidopsis thaliana cell cultures treated
with Phi. Arabidopsis cells cultured for 7 days in 4 mM Pi were subcultured into fresh
medium without Pi with 0 and 2 mM Phi. Two days after subculturing, cells were harvested
and the metabolites were profiled by GC-MS as described in Materials and Methods. The
ratios of metabolites in Phi-treated cells (day-9 Phi) to non-Phi treated (day-9 no Phi) cells
were shown in different colour boxes. Compounds that were not detected are indicated in
italics. Colours represent ≥2, ≥5, ≥10 and ≥20-fold higher (red gradient) or lower (green
gradient) abundance in the Phi-exposed cells compared to the unexposed cells. The ratios
obtained from AMDIS (left-hand box) and ME (right-hand box) are shown next to the
metabolite names. Whenever the ratio of metabolite was not determined, it is indicated with
a dash (-). Significant differences (*) were determined by a t-test (p<0.05, n= 2 biological
replicates with at least 3 technical replicates for each biological replicates).
+5 +10 +2 -10 -5 -2
124
Discussion
Phi affects the physiology of Pi-depleted Arabidopsis cells
Phi at certain concentration affects cell culture growth and cause toxicity. As seen in
Chapter 3, loading of cells with Pi allowed growth to occur for two 7-day culture cycles.
When more than 1 mM Phi was added to Pi-depleted cells, cell growth ceased at day 14.
However, supplying Pi together with either 1 mM or 2 mM Phi to Pi-deficient cells did not
inhibit growth up to 9 days. This was not unexpected because similar situation was
observed in Spinacia oleracia L (spinach) where the ratio of Pi to Phi is important in
determining the effects of Phi to plants (Thao et al., 2008). In Arabidopsis, growth was
inhibited by more than 2.5 mM Phi regardless of the Pi status of the plants (Ticconi et al.,
2001). A similar case of decreased cell culture density was observed in yeast (McDonald et
al., 2001).
In Arabidopsis cultured cells, high Phi concentrations did not only inhibit growth, but also
caused the cells to develop toxicity symptoms, indicated by the changes of the cultures
colour. In most conditions, cell toxicity could be seen through changes in colour of the cells
in suspension (Kristen U. 1997). However, there has been no research that demonstrates
there is an alteration of pigment composition in suspension cells. Similarly, symptom of Phi
toxicity such as leaf burning has also been detected in plants (Bachiega Zambrosi et al.,
2011). The present study has confirmed that the growth attenuating effects of Phi in plant
tissues, as well as its dependence on Pi status, is also seen in cell culture.
Phi toxicity might lead to either programmed cell death (PCD) or necrosis (Pilbeam et al.,
2000; Singh et al., 2003). PCD in Brassica napus suspension cells exposed to prolonged Pi
deficiency indicated by protoplast shrinkage, chromatin condensation and fragmentation of
nuclear DNA, and that was accelerated by Phi (Singh et al., 2003). The irregular shapes of
broken cells seen when Arabidopsis cells from discoloured cultures were stained for cell
viability indicated that the hallmark phenotypic symptoms of PCD were not observed.
Instead, it looks more like necrotic cell death that might be stimulated at high Phi. In
necrotic cell death, cells usually swell, lyse, lose their membrane integrity and have
125
lysosomal leakage (McCabe and Leaver, 2000; Reape et al., 2008). The apparent necrosis
observed in my study may be due to the lower Pi to Phi ratio in these cultures, which is
likely to be a harsher condition for the cells compared to cells at higher Pi to Phi ratio. Phi
may compete for the same transporter with Pi to enter cells (Carswell et al., 1997;
McDonald et al., 2001). With lower Pi to Phi ratio, the assimilation of Pi into cells is
decreased and Phi that accumulated due to inability of cells to metabolise Phi will interrupt
cells system and cause toxicity.
Perhaps at the higher Pi to Phi ratio, Phi did not kill the cells but rather arrested cell growth
by preventing cell division, which is similar to Phi that only slow the growth of pathogen,
permitting plants to wall off pathogen infection (Huberli et al.,2008). For example, in
certain fungi, such as Fusarium solani, Phi only had a fungistatic effect, instead of a
fungicidal effect (Lobato et al., 2010). The biostatic effect of Phi was also observed in Pi-
depleted yeast cells. These cells continued their growth when re-supplied with Pi,
indicating that Phi only retarded growth, but did not cause death (McDonald et al., 2001).
The application of low Phi concentration (1 mM and 2 mM) to cultured Arabidopsis cells
having different Pi status did not cause immediate toxicity. Apparently, Phi did not have a
beneficial or inhibitory effect on the growth of cells supplied with Pi, as biomass
accumulation continued at the same rate as in the control cultures. Some findings of
previous studies also showed that Phi did not stimulate growth in plants, for example in
strawberries (Moor et al., 2009) and komatsuna (Thao and Yamakawa, 2010), supporting
the idea of the inability of plants to metabolise Phi (Ratjen and Gerendas, 2009).
Phi affects P partitioning in Arabidopsis cell suspension cultures
The allocation of P to different pools in Phi treated cells was quite distinctive from that of
cells not treated with Phi. This is because Phi contributed to the total amount of P inside the
cells, in addition to free Pi and Po. Phi was taken into cells, accumulated and was not lost
during growth, indicating that it is not used by the cells.
126
Arabidopsis cells are very responsive to the provided Pi. They take up Pi rapidly from the
medium and contained the highest amount of Pi one day after subculturing to fresh Pi-
containing medium. Within first few days Pi was removed from the medium and this
sustained growth for the next time period. During this time in Pi-deficient media when cells
had removed all Pi, Pi inside the cells decreased, either being allocated to Po or being
diluted by cell division. Pi taken up by the cells is used in numerous biochemical processes
and much of the Pi will be incorporated into organic compounds.
When Pi-deficient cells were subcultured into Pi-containing medium, the Pi level inside the
cells was low at day 1 and day 3 for cells treated with Phi. There was more free Pi in the
media of Phi-treated cells compared to non-Phi treated cells. This indicates that Phi inhibits
Pi uptake. This is in agreement with the condition in Brassica rapa var. Perviridis
(komatsuna) where Pi absorption was strikingly decreased by Phi treatment (Thao and
Yamakawa, 2010). Similarly, Pi concentration in Brassica napus suspension cells was also
reduced by Phi in various Pi:Phi ratios (Carswell et al., 1997).
Although Pi was diluted as it was utilised by the cells for growth, Phi acquisition was not
enhanced. In this study, the amount of Phi removed from the medium was about the same
in Pi-sufficient and Pi-deficient cells, except two days after cells that have been grown in
Pi-containing medium were subcultured into fresh medium with Phi. In a previous study in
komatsuna, the amount of Phi taken up by komatsuna plants supplied with Pi was higher
than the amount of Phi in Pi-depleted plants. Lower Phi uptake during low Pi was due to a
decrease in nutrient uptake capacity, including Phi, which occurred due to the effects of the
low Pi condition on root growth and function (Thao and Yamakawa, 2010).
It could be that the Phi detected inside the cells was actually in a different location than the
Pi, for example in the vacuoles and that was not used by the cells. Normally, excess Pi will
be stored in vacuoles, while cytoplasmic Pi accumulates to a much lesser extent (Mimura et
al., 1990). A 31
P-NMR study in Nicotiana tabacum suspension cultures has shown that Phi
was transported to vacuole (Danova-Alt et al., 2008). Phi was found to be transported
across the plasma membrane at a lower rate than Pi (Jost, unpublished data). Thus, it could
also be that Phi in Arabidopsis cultured cells was also transported at a lower rate than Pi
127
into the vacuole. This will need further clarification in the future as in this assay, Pi was
measured as total Pi in the cells, including the cytoplasmic and vacuolar Pi.
The structure of Phi that resembles Pi caused the competition of Pi and Phi uptake into the
cells by Pi transport system (McDonald et al., 2001; Thao et al., 2008). In cultures
containing Pi, cells preferably absorbed Pi rather than Phi, indicating that they have the
ability to discriminate between these anions. The discrimination of Phi and Pi were also
seen in plants (Plaxton, 1999). In medium depleted of Pi, higher amounts of Pi inside the
cells of Phi-treated cells were observed compared to non-Phi treated cells. This time,
cultured cells do not have added Pi except for the relatively small amount of Pi that was
brought across inside the cells and medium that was transferred during subculturing,
showing that Phi contributed to the increased amount of Pi inside the cells. This might due
to two possible reasons. Firstly, the presence of Phi might induce the capacity of cells to
absorb Pi, thus the P allocation and Pi mobilisation changed. A previous study in yeast
showed that Phi causes the coordinated reduction of polyP pools with increased amount of
Pi inside the cells, suggesting that Phi triggers mobilisation of internal P by the conversion
of organic P to Pi (McDonald et al., 2001). It is not clear if this occurs in cell culture or in
plants. The second possibility is the conversion of Phi to Pi that was taken up by the cells.
The oxidation of Phi to Pi has only been found to occur in the presence of bacteria. There is
no evidence that plants can metabolise Phi (Sukarno et al., 1993; Carswell et al., 1996;
Forster et al., 1998). Since the cells were grown in culture and was maintained in a sterile
condition, it is unlikely that Phi was oxidised to Pi.
PHT 1;1, PHT1;8 and PHT1;9 are highly induced by Phi treatment in Pi depleted cells
During Pi deficiency, the PHT gene family members in Arabidopsis are up-regulated to
increase the capacity of Pi uptake (Smith et al., 1997; Okumura et al., 1998; Morcuende et
al., 2007). As shown in Chapter 3, the transcript abundance for the PHT gene family
members tested are strongly repressed within one day of supplying Pi. One day after
Arabidopsis cells were supplied with Pi and Phi together, the transcript abundance for this
set of genes was repressed to the same magnitude as in the absence of the Phi treatment.
The repression of these genes might be regulated by internal Pi amount that was at the
128
highest level at this time point. This finding shows that external Phi did not interfere with
the transcript level of several PHT genes for cells in a dynamic Pi state that moved from Pi-
deficient to Pi-sufficient condition, at least at the Pi to Phi ratio that have been tested. The
tested PHT genes family members were more strongly repressed with time. Again, Phi did
not affect the Pi-dependent repression of the PHT transcript pools.
As seen in Chapter 3, transcripts from these genes started to be induced upon Pi-depletion
in gene dependent manner. Since Phi is thought to mimic Pi, and is thought to be hardly
discriminated from Pi by the cells (Carswell et al., 1997; McDonald et al., 2001), it was
expected that the up-regulation of PHT transcripts by a lack of Pi would be disrupted by
Phi. PHT1;8 and PHT1;9, whose transcripts did not change very much in response to Pi
status had strong responses towards Phi treatment. In Pi-depleted cells the transcript
abundance for these genes, together with those from PHT1;1, were more quickly induced
when Pi-deficient cells were treated with Phi. Previously, the suppression of several Pi-
starvation induced genes such as high affinity transporters, a novel acid phosphatase, and
purple acid phosphatases were observed in tomato and Arabidopsis (Varadarajan et al.,
2002), Similarly, phosphite has attenuate Pi-starvation response genes in Arabidopsis plants
(Ticconi et al., 2001) and in yeast (McDonald et al., 2001). The contradict expression of the
tested genes might be due to different treatments and conditions applied to the Arabidopsis
suspension cells especially the Pi: Phi ratios and the tested genes.
In this study, higher induction of these genes suggests that the cells treated with Phi
respond more strongly to the Pi-starvation. It could be that Phi has worsened the Pi-
deficient condition by masking the real P content of these cells and disturbing Pi starvation
response. Thus, the cells behave as if it has lower Pi than it really does. This might mean
that Phi is somehow interacting with the Pi sensor, preventing it from sensing the true Pi
content of the cell. In this study, a strong differences in Phi-treated and untreated Pi-
deficient cells at the later time points (starting from day 9) suggest that Phi effects might be
delayed at the transcripts level. This delay could be due to slower Phi transport inside the
cells, as Phi was not transported as quickly as Pi in plant tissues (Jost, unpublished results).
129
Thus, Phi may be used to dissect gene expression patterns in response to Pi status. This is
due to the ability of Phi to disrupt the ability of the Pi sensor to judge the amount of Pi that
is available during Pi deficiency.
Phi induced metabolic changes in Pi-depleted Arabidopsis cells
To date, not much is known about the metabolic changes of Phi-treated plants. In Brassica
napus suspension cells, Phi suppressed the induction of several Pi stress marker enzymes
such as phosphoenolpyruvate phosphatase and pyrophosphate-dependent
phosphofructokinase (Carswell et al., 1996; Carswell et al., 1997) which disrupted protein
phosphorylation. In Arabidopsis, Phi suppressed the activity of nucleolytic enzymes
(Ticconi et al., 2001).
From the GC-MS analysis of Arabidopsis cells subjected to Pi starvation, the amounts of
sugar and some organic acids were higher, while some amino acids were lower compared
to cells supplied with Pi (Chapter 3). Comparing the metabolic changes of Pi-sufficient
cells treated and not treated with Phi, most of the detected metabolites did not change in
amount. This might be because cells still have plenty of Pi, and Phi did not affect the
perception of the available Pi, in accordance with how these cells responded at the
physiological and transcript levels. However, the metabolism of cells depleted of Pi was
strongly affected by Phi.
From the results obtained, strong increases in sugars, and decreases in glucose-6-phosphate,
citrate, succinate and malate may suggest that sugar metabolism is compromised. This led
to the accumulation of sugars as substrates and caused the depletion of downstream
products. Phi has changed the activity of citric acid cycle due to the decreased amounts of
components involved in it. This possibly affects the energy balance inside the cells. A
number of the carbon compounds that linked to the TCA cycle or glycolysis are also
decreased, suggesting a depletion of carbon. Fermentation might occur due to slight
increase in lactate. Together, the results indicate that oxidative metabolism is compromised,
leading to an energy crisis, that indicated by the inhibition of the cell growth.
130
Normally, sucrose can be metabolised by two ways in plants; either by sucrose synthase
that convert sucrose to UDP-glucose and fructose, or invertase that converts sucrose to
glucose and fructose. In the presence of Phi, both glucose and fructose accumulated, so it
seems that sucrose cleavage is occurring in the presence of Phi. Glucose is converted to
glucose 6-phosphate by glucokinase and ATP. Since glucose 6-phosphate was decreased, it
seems likely that the process downstream is blocked. The same argument holds for
decreases of all amino acids from glycerate-3-phosphate indicates that the block is before
the formation of glycerate 3-phosphate.
The metabolic change in Phytophthora treated with Phi is more elucidated compared to
plants. The activity of several enzymes such as D-glyceraldehyde 3-phosphate:NAD+
oxidoreductase and 6-phospho-D-gluconate:NADP+ 2-oxidoreductase involved in the
phosphogluconate and glycolytic pathways in the Phytophthora, also in yeast were affected
(Stehmann and Grant, 2000) by Phi. The toxicity effect of Phi to Pytophthora was due to
the accumulation of poly-phosphate (poly-P) and inorganic pyrophosphate (PPi), which
inhibit their pyrophosphorylase reactions (Niere et al., 1994). Accumulation of these
compounds will divert ATP from other metabolite pathways and fungal growth inhibited.
Pyrophosphorylase reactions formed PPi by the cleavage of nucleotide triphosphate, the
reactions that normally occur in major biosynthetic pathway. However, the method used for
metabolite analysis in this study was not designed to detect Poly-P and PPi. Also in
phytophthora, inhibition of phosphorylation by Phi did not increase the level of ADP, AMP
and adenosine, although the pyrophosphate level increased, suggesting that adenylate
synthesis is the primary target site of Phi in fungi (Griffith et al., 1990). Since PPi also
could be formed in Arabidopsis, it is likely that the similar mechanism occurred, although
further investigation is needed. Other than that, changes in cell wall and lipid fractions, also
water-soluble metabolites such as amino acids were observed (Dunstan et al., 1990).
In conclusion, Arabidopsis cells grown in culture do somehow have the ability to recognise
and discriminate between Phi and Pi. Cells were much more affected by Phi when their
internal Pi status was low. These effects were observed in their growth, dynamics of P
pools, the transcripts level of several PHT gene family members and metabolite changes
when Phi was supplied to Pi-depleted cells.
131
Materials and Methods
Plant Materials
Arabidopsis thaliana ecotype Landsberg erecta cell suspension cultures (May and Leaver,
1993) were maintained in Murashige and Skoog (MS) basal medium (Phytotechlab,
Shawnee Mission, KS USA) by weekly sub-culturing with 3 % (w/v) sucrose, 0.5 mg/L
naphthalene acetic acid (NAA) and 0.05 mg/L kinetin (Murashige and Skoog, 1962). For
various Pi and Phi treatments, 250 mM filter sterilised KH2PO4 and 1 M KH2PO3 was
added to the medium, respectively, to the final concentration required. The pH was adjusted
to 5.8 using 1 M KOH. For subculturing, 27 ml of 7-day-old cells were transferred into 100
ml fresh MS basal medium in a 250 ml Erlenmeyer flask under sterile conditions. Cells
were grown under continuous light at 22 oC with shaking at 140 rpm and harvested by
vacuum filtration. Cells were stored in -80 oC for analysis.
Cell Viability Staining
For protoplasting, cells were subjected to centrifugation for 10 min, 500 x g at 25 ˚C. The
supernatant was removed and enzyme solution was added (0.4 M mannitol, 3 % sucrose, 8
mM CaCl2, 1 % cellulose, 0.25 % macrozyme). The mixed were kept horizontal in the dark
at 25 ˚C for 1 h, followed by 1 h gentle rocking, another 1 h horizontal and 1 h gentle
rocking. These cells were harvested by centrifugation for 5 min, 500 x g at 25˚C. For live-
dead cell staining, cells were resuspended in Phosphate Saline Buffer containing 2 µg/ml
fluorescein diacetate (FDA) and incubated for 5 min at 25 ˚C prior to 5 min incubation in
10 µg/ml propidium iodide (Jones and Senft, 1985). The images were captured using a
fluorescent microscope (Carl Zeiss, New South Wales, Australia).
Inorganic phosphate assay
Pi was determined using an ascorbic acid-ammonium molybdate method (Bruce N, 1966).
Approximately 50 mg fresh cells were frozen in liquid nitrogen prior to the addition of 500
µl of 1% (v/v) acetic acid. Cells were homogenised three times at 5000 rpm for 45 s in a
cell homogeniser (PrecellysR 24, Bertin Technologies, Montigny-le-Bretonneux, France).
132
The samples were placed on ice for 30 min and subjected to centrifugation at 16, 000 x g
for 15 min at 4 °C. The supernatant was transferred to a fresh tube and further clarified by
centrifugation at the same conditions. For the assay, 90 µl of the sample was added to 210
µl test solution (mixture of six parts 0.42 % ammonium molybdate in 1 N H2SO4 and one
part 10 % ascorbic acid in water). The mixture was incubated at 37 °C for 1 h. The samples
were prepared in a 96 well plate and the absorbance was measured at OD820 (Thermo
Multiskan Spectrum spectrophotometer, Thermo Scientific, Vantaa, Findland).
Total phosphorus measurement
For total P measurement, 3 ml nitric acid (HNO3) was added to a known oven-dried mass
of Arabidopsis cells in a 50 ml Erlenmeyer flask. A first digestion was performed by
heating 10 min at 100 oC. The samples were allowed to cool to room temperature and 1 ml
perchloric acid (HClO4) was added. The digestion was continued at 140-150 oC until the
vigorous reaction between HClO4 and organic residues was completed. The temperature
was raised to 170-180 oC and samples were heated for 10 min to dissolve the silica. The
digested samples were allowed to cool to room temperature before 3 ml water was added
and warmed to dissolve any KClO4 crystals. The solution was transferred to a plastic vial,
brought up to 10 ml with water. The sample was assayed for Pi using a malachite green
method (Vanveldhoven and Mannaerts, 1987) in a 96-well format. The absorbance was
measured at OD630 (Thermo Multiskan Spectrum spectrophotometer, Thermo Scientific,
Vantaa, Findland). The amount of total P was assayed based on dry weight basis and
calculated using the corresponding cell fresh weight.
Phi assay
Phi was measured using enzymatic fluorescent assay (Berkowitz et al 2011).
Approximately 50 mg of Arabidopsis cells were extracted using 1 % acetic acid. Cells were
homogenised three times at 5000 rpm for 45 s in a cell homogeniser (PrecellysR 24, Bertin
Technologies, Montigny-le-Bretonneux, France). The samples were placed on ice for 30
min and subjected to centrifugation at 16, 000 x g for 15 min at 4 °C. Supernatant was
assayed for Phi in the 96-well microtiter plate. The assay mix containing a final
concentration of 50 mM MOPS (pH 7.3), 100 µM NAD, 100 µM phenazine methosulfate,
133
100 µM resazurin, and 1 µg recombinant 6 X His-PtxD per well were prepared. The
microtiter plates were incubated in the dark at 37 °C for 1 h. The reaction product resofurin
was measured using a fluorescence reader (DTX880 Multimode Detector, Beckman
Coulter, Gladesville, Australia) at 535-nm excitation and 595-nm emission wavelengths.
The analysis was conducted at the Centre for Phytophthora Science and Management,
School of Biological Sciences and Biotechnology, Murdoch University.
mRNA preparation
Messenger RNA was isolated from cells using magnetic beads coated with oligo-dT (Jost et
al., 2007). About 70 mg Arabidopsis thaliana cells were lysed in lysis buffer (100 mM Tris,
500 mM LiCl, 10 mM EDTA, 1 % LiDS, 5 mM DTT) and incubated at room temperature
for 10 min. Samples were subjected to three cycles of homogenisation at 5000 rpm, 45 s
each, in a cell homogeniser (PrecellysR 24, Bertin Technologies, Montigny-le-Bretonneux,
France) before centrifugation for 10 min, 12,000 x g at 15 oC. The supernatant was
transferred to a new tube and further clarified by 5 min centrifugation at 12, 000 x g. In the
meantime, 10 µl of oligo-dT magnetic beads (Dynabeads® Oligo(dT)25, Invitrogen Dynal
AS, Oslo, Norway) were transferred into PCR tubes. The beads were washed twice with
lysis buffer and the supernatant was removed after each wash by magnetic separation
(Dynal® MPC-9600 Magnetic Particle Concentrator, Invitrogen Dynal AS, Oslo, Norway).
To the washed beads, 240 µl of the clarified cellular extract was added. Mixtures were
incubated at room temperature for 10 min to allow annealing of poly-A+ RNA to the beads.
The supernatant was removed after magnetic bead separation. The beads were washed
twice with washing buffer (10 mM Tris, 150 mM LiCl, 1 mM EDTA, 0.1 % LiDS), twice
with washing buffer lacking LiDS, and twice with ice-cold 1X RT buffer (50 mM Tris, 50
mM KCl, 10 mM MgCl2 x 6H2O, pH 8.3, 0.1 mM DTT). RNA was eluted from the beads
by incubating 5 min at 70 oC in 10 µl RT buffer, and chilled on ice prior to adding 10 µl 2x
RT mix (5x RT buffer (Bioline Aust Pty Ltd, New South Wales, Australia) 100 mM DTT,
dNTP-mix (40 mM each), RNasin (40 U/ µl) (Bioline Aust Pty Ltd, New South Wales,
Australia), MLV reverse ranscriptase (200 U/ µl) (Bioline Aust Pty Ltd, New South Wales,
Australia), DEPC-ddH2O). Samples were incubated at 42 oC
for 90 min. The cDNA on the
beads was washed twice with 1 X RT buffer. The mRNA was eluted by incubating the
134
beads in 25 µl elution buffer (2 mM EDTA, 10 mM Tris-HCl pH 8) for 10 min at 95 oC,
before chilling on ice for 1 min. The supernatant containing the mRNA was quickly
removed after magnetic separation and stored in a new tube. The RNA recovery was
measured using a spectrophotometer (ND-1000 UV-Vis Spectrophotometer, NanoDrop
Technologies, Wilmingon, DE, USA). The cDNA yield was assumed to be equivalent to
the mRNA eluted from the beads and was adjusted to 2 ng µl-1
by adding sterile distilled
water to the beads. The cDNA was stored in -80 oC.
Quantitative Real-Time Polymerase Chain Reaction
Primers for members of the PHT gene family, were designed (Appendix 1; DNASTAR
software, DNASTAR Inc, Madison Wisconsin, USA). For qRT PCR, 2.5 µl cDNA diluted
1:10 with sterile distilled water was added to 2.5 µl primer mix (1.2 µM each) and 5 µl real-
time PCR master mix (Power SYBR® Green PCR Master Mix, Applied Biosystem, Foster
City, CA, USA). The reaction was performed (7500- Fast Real-Time PCR System Applied
Biosystems, Scoresby, Victoria, Australia) by 40 X cycling at 2 min at 50 oC, 10 min at 95
oC, 15 sec at 95
oC and 1 min at 60
oC.
Sample extraction, derivatisation and gas chromatoghraphy / mass spectrometry (GC-
MS) analysis
Metabolites were extracted and derivatised using a protocol adapted from (Roessner-Tunali
et al., 2003). Approximately 30 mg fresh weight of Arabidopsis thaliana cells were
extracted in 500 µl 20:2:1 HPLC grade methanol: water: ribitol. Samples were incubated on
a thermomixer at 75 oC
with 1200 rpm mixing for 20 min prior to centrifugation at 16,000 x
g, 3 min, at 20 oC. A 100 µl aliquot of the supernatant was dried down for 1 h under
vacuum (Labconco, Kansas City, MO, USA). For the automated derivatisation and GC-MS
run, 20 µl pyridine was added to the dried sample, the sample was incubated at 65 oC, 750
rpm mixing for 1 h (Agilent 5975C inert XL MSD with Triple-Axis Detector, Forest Hill,
VIC, Australia) before 30 µl N-,methyl-N-(tri-methylsilyl) trifluoroacetamide
(Derivatisation grade, Sigma) was added and the samples incubated at room temperature
for a further 30 min.
135
For GC-MS run, 1 µl of derivatized sample was injected into the front inlet splitless
injector at 300 oC initial temperature, 9.13 psi pressure and 9.9 ml min
-1 purge flow, with
helium carrier gas with a constant flow of 1.0 ml min-1
(Capillary column Factor 4, Varian
Inc, Blackburn, VIC, Australia). The GC column oven was held at 70 oC initial
temperature for 1 min. The temperature was increased to 76 oC
at 1
oC
min
-1, followed by
increasing to 325 oC at 6
oC min
-1 before being held for 8 min. A mass selective detector
transfer line heater was used with an initial temperature of 250 oC. For the mass
spectrometry, the scan acquisition mode was used. The MS source temperature was 230 oC
and MS Quad temperature was 150 oC. The solvent delay time was 8 min and the relative
electron multiplier voltage mode was used. The low mass was 50 amu and the high mass
was 600 amu. The GC-MS analysis was conducted at Metabolomics Australia, The
University of Western Australia.
Statistical analysis of GC-MS data
With two biological replicates and at least three technical replicates of samples, the raw
GC-MS data obtained were processed and the statistical analysis was performed using
AMDIS (http://chemdata.nist.gov/mass-spc-amdis) and METABOLOME-EXPRESS
software (version 1.0, http://www.metabolome-express.org) (Carroll et al., 2010).
References
Bachiega Zambrosi FC, Mattos D, Jr., Syvertsen JP (2011) Plant growth, leaf
photosynthesis, and nutrient-use efficiency of citrus rootstocks decrease with
phosphite supply. Plant Nutrition and Soil Science 174: 487-495
Barrett SR, Shearer BL, Hardy GES (2004) Phytotoxicity in relation to in planta
concentration of the fungicide phosphite in nine Western Australian native species.
Australasian Plant Pathology 33: 521-528
Berkowitz, O., Jost, R., Pearse, S.J., Lambers, H., Finnegan, P.M., Hardy, G.E., and
O’Brien, P.A. (2011). An enzymatic fluorescent assay for the quantification of
phosphite in a microtiter plate format. Analytical Biochemistry 412: 74-78.
Bozzo GG, Singh VK, Plaxton WC (2004) Phosphate or phosphite addition promotes the
proteolytic turnover of phosphate-starvation inducible tomato purple acid
phosphatase isozymes. FEBS Letters 573: 51-54
Bruce N A (1966) [10] Assay of inorganic phosphate, total phosphate and phosphatases. In
VG Elizabeth F. Neufeld, ed, Methods in Enzymology, Vol Volume 8. Academic
Press, pp 115-118
136
Carroll AJ, Badger MR, Millar AH (2010) The MetabolomeExpress Project: enabling
web-based processing, analysis and transparent dissemination of GC/MS
metabolomics datasets. BMC Bioinformatics 11: 376-388
Carswell C, Grant BR, Theodorou ME, Harris L, Niere JO, Plaxton WC (1996) The
fungicide phosphonate disrupts the phosphate-starvation response in Brassica nigra
seedlings. Plant Physiology 110: 105-110
Carswell MC, Grant BR, Plaxton WC (1997) Disruption of the phosphate-starvation
response of oilseed rape suspension cells by the fungicide phosphonate. Planta 203:
67-74
Danova-Alt R, Dijkema COR, De Waard P, KÖCk M (2008) Transport and
compartmentation of phosphite in higher plant cells – kinetic and 31P nuclear
magnetic resonance studies. Plant, Cell and Environment 31: 1510-1521
Dunstan RH, Smillie RH, Grant BR (1990) The effects of sub-toxic levels of
phosphonate on the metabolism and potential virulence factors of Phytophthora
palmivora. Physiological and Molecular Plant Pathology 36: 205-220
Eshraghi L, Anderson J, Aryamanesh N, Shearer B, McComb J, Hardy GES, O’Brien
PA (2011) Phosphite primed defence responses and enhanced expression of defence
genes in Arabidopsis thaliana infected with Phytophthora cinnamomi. Plant
Pathology 60: 1086-1095
Fenn ME, Coffey MD (1984) Studies on the in vitro and in vivo antifungal activity of
fosetyl-al and phosphorus acid. Phytopathology 74: 606-611
Forster H, Adaskaveg JE, Kim DH, Stanghellini ME (1998) Effect of phosphite on
tomato and pepper plants and on susceptibility of pepper to Phytophthora root and
crown rot in hydroponic culture. Plant Disease 82: 1165-1170
Griffith JM, Smillie RH, Grant BR (1990) Alterations in nucleotide and pyrophosphate
levels in Phytophthora plamivora following exposure to the antifungal agent
potassium phosphonate (phosphite). General Microbiology 136: 1285-1291
Guest D, Grant B (1991) The complex action of phosphonates as antifungal agents.
Biological Reviews 66: 159-187
Huberli D, Shearer BL, Calver MC, Paap T, Moore NA, Barrett S,Freebury
G,Howard K, O'Gara E, Dunstan W, Bowen B, Gower K, Palmer B, Long N,
Crane C, Spadek T, Dell B, O'Brien P, McComb JA and Hardy G.E.St.J (2008)
Research into natural and induced resistance in Australian native vegetation of
Phythopthora cinnamomi and innovative methods to contain and/or eradicate within
localised incursions in areas of high biodiversity in Australia. Does physiological
status of the plant at the time of spraying affect the efficacy of phosphite? Prepared
by the Centre for Phytophora Science and Management for the Australian
Government Department of the Environment Water, Heritage and the Arts.
Jones KH, Senft JA (1985) An improved method to determine cell viability by
simultaneous staining with fluorescein diacetate-propidium iodide. Histochemistry
and Cytochemistry 33: 77-79
Jost R, Berkowitz O, Masle J (2007) Magnetic quantitative reverse transcription PCR: A
high-throughput method for mRNA extraction and quantitative reverse transcription
PCR. Biotechniques 43: 206-211
Kristen U. (1997): Use of higher plants as screens for toxicity assessment. Toxicology in
vitro. 11: 181-191
137
Lobato MC, Olivieri FP, Daleo GR, Andreu AB (2010) Antimicrobial activity of
phosphites against different potato pathogens. Plant Diseases and Protection 117:
102-109
May MJ, Leaver CJ (1993) Oxidative stimulation of glutathione synthesis in Arabidopsis
thaliana suspension cultures. Plant Physiology 103: 621-627
McCabe PF, Leaver CJ (2000) Programmed cell death in cell cultures. Plant Molecular
Biology 44: 359-368
McDonald AE, Grant BR, Plaxton WC (2001) Phosphite (phosphorous acid): Its
relevance in the environment and agriculture and influence on plant phosphate
starvation response. Plant Nutrition 24: 1505-1519
McDonald AE, Niere JO, Plaxton WC (2001) Phosphite disrupts the acclimation of
Saccharomyces cerevisiae to phosphate starvation. Canadian Journal of
Microbiology 47: 969-978
Mimura T, Dietz KJ, Kaiser W, Schramm MJ, Kaiser G, Heber U (1990) Phosphate
transport across biomembranes and cytosolic phosphate homeostasis in barley
leaves. Planta 180: 139-146
Moor U, Põldma P, Tõnutare T, Karp K, Starast M, Vool E (2009) Effect of phosphite
fertilization on growth, yield and fruit composition of strawberries. Scientia
Horticulturae 119: 264-269
Morcuende R, Bari R, Gibon Y, Zheng W, Pant BD, BlÄSing O, Usadel B,
Czechowski T, Udvardi MK, Stitt M, Scheible W-R (2007) Genome-wide
reprogramming of metabolism and regulatory networks of Arabidopsis in response
to phosphorus. Plant, Cell and Environment 30: 85-112
Murashige T, Skoog F (1962) A Revised Medium for Rapid Growth and Bio Assays with
Tobacco Tissue Cultures. Physiologia Plantarum 15: 473-497
Niere JO, Deangelis G, Grant BR (1994) The effect of phosphonate on the acid soluble
phosphorus components in the genus phytophthora. Microbiology-UK 140: 1661-
1670
Ohtake H, Wu H, Imazu K, Anbe Y, Kato J, Kuroda A (1996) Bacterial phosphonate
degradation, phosphite oxidation and polyphosphate accumulation. Resources,
Conservation and Recycling 18: 125-134
Okumura S, Mitsukawa N, Shirano Y, Shibata D (1998) Phosphate Transporter Gene
Family of Arabidopsis thaliana. DNA Research 5: 261-269
Pilbeam RA, Colquhoun IJ, Shearer B, Hardy GES (2000) Phosphite concentration: its
effect on phytotoxicity symptoms and colonisation by Phytophthora cinnamomi in
three understorey species of Eucalyptus marginata forest. Australasian Plant
Pathology 29: 86-95
Plaxton WC (1999) Metabolic aspects of phosphate starvation in plants. In: Deikman J,
Lynch J (eds) Phosphorus in plant biology: regulatory roles in molecular, cellular,
organismic, and ecosystem processes. American Society of Plant Physiologists,
Rockville, pp164–176
Ratjen AM, Gerendas J (2009) A critical assessment of the suitability of phosphite as a
source of phosphorus. Plant Nutrition and Soil Science 172: 821-828
Reape TJ, Molony EM, McCabe PF (2008) Programmed cell death in plants:
distinguishing between different modes. Experimental Botany 59: 435-444
Roessner-Tunali U, Hegemann B, Lytovchenko A, Carrari F, Bruedigam C, Granot
D, Fernie AR (2003) Metabolic profiling of transgenic tomato plants
138
overexpressing hexokinase reveals that the influence of hexose phosphorylation
diminishes during fruit development. Plant Physiology 133: 84-99
Singh VK, Wood SM, Knowles VL, Plaxton WC (2003) Phosphite accelerates
programmed cell death in phosphate-starved oilseed rape (Brassica napus)
suspension cell cultures. Planta 218: 233-239
Smith FW, Ealing PM, Dong B, Delhaize E (1997) The cloning of two Arabidopsis genes
belonging to a phosphate transporter family. Plant Journal 11: 83-92
Stehmann C, Grant BR (2000) Inhibition of enzymes of the glycolytic pathway and
hexose monophosphate bypass by phosphonate. Pesticide Biochemistry and
Physiology 67: 13-24
Sukarno N, Smith SE, Scott ES (1993) The effect of fungicides on vesicular–arbuscular
mycorrhizal symbiosis. New Phytologist 125: 139-147
Thao H, Yamakawa T, Shibata K, Sarr P, Myint A (2008) Growth response of
komatsuna (Brassica rapa var. peruviridis) to root and foliar applications of
phosphite. Plant and Soil 308: 1-10
Thao HTB, Yamakawa T (2009) Phosphite (phosphorous acid): Fungicide, fertilizer or
bio-stimulator? Soil Science and Plant Nutrition 55: 228-234
Thao HTB, Yamakawa T (2010) Phosphate absorption of intact komatsuna plants as
influenced by phosphite. Soil Science and Plant Nutrition 56: 133-139
Ticconi CA, Delatorre CA, Abel S (2001) Attenuation of phosphate starvation responses
by phosphite in arabidopsis. Plant Physiology 127: 963-972
Vanveldhoven PP, Mannaerts GP (1987) Inorganic and organic phosphate measurements
in the nanomolar range. Analytical Biochemistry 161: 45-48
Varadarajan DK, Karthikeyan AS, Matilda PD, Raghothama KG (2002) Phosphite, an
analog of phosphate, suppresses the coordinated expression of genes under
phosphate starvation. Plant Physiology 129: 1232-1240
139
CHAPTER 5:
General Discussion and Conclusion
140
Introduction
Cell suspension cultures have been used in many basic studies on plant cell functions.
Understanding plant responses to various environmental conditions also have been made
easier with this approach as it avoids the challenges caused by the complexity of plant
vascular system. Previously, Arabidopsis cells grown in culture have been used to
understand cells responses under Pi stress. For instance, the transcripts abundance of
glycerol 3-phosphate permease gene family during Pi-deficiency was profiled (Ramaiah et
al., 2011) and the proteins that have changed under Pi-sufficient and Pi-deficient condition
have been identified (Tran and Plaxton, 2008). Besides Arabidopsis, Brassica nigra
suspension cells have also been used to study the metabolite levels of Pi-starved plants
(Duff et al., 1989). The importance of Pi for various functions in plants makes it an
essential nutrient and Pi limitation causes stress to plants. With three different genomes to
coordinate, plant adaptation to stress can be complex. All genomes need to be expressed to
sustain plant survival in different conditions. Thus, knowledge on the coordination of
processes that happen in plants at the genomic, transcriptomic, proteomic and metabolomic
levels is important, yet currently it is limited.
This research was aimed to increase our understanding of plant responses towards Pi
depletion using cell suspension cultures as a model system. Arabidopsis thaliana accession
Landsberg erecta was used in a series of experiments to study plant responses at both the
physiological and molecular levels. Findings from this research have improved our
knowledge on how plants react towards Pi depletion, Pi resupply, also their responses
towards Pi depletion in the presence of Phi, an analog of Pi. Changes in culture growth, P
allocation patterns and transcript abundance of selected genes involved in Pi transport and
homeostasis were studied across a time course, while metabolite profiles were studied for
cells at selected time points. Focusing on the processes controlled by the plant genomes,
major findings from this research can be discussed at the levels of transcriptomic,
proteomic, metabolomic, and physiological states of Arabidopsis suspension cells in
response to Pi stress.
141
Summary of major findings
This thesis has contributed to knowledge through major findings as discussed below.
1. Several higher density proteins identified from Arabidopsis thaliana cells grown
in culture have nucleic acid binding capacity
Mitochondrial nucleic acid-binding proteins are likely to be important in regulating the
processes inside mitochondria during normal and stress conditions. However, their identity
and functions are not well characterised. In chapter 2, I have developed a method for
separation of proteins that have a greater density than the bulk of mitochondrial proteins
using centrifugation techniques. These proteins have either previously reported to have the
capacity to bind nucleic acid; GR-RBP5 (Vermel et al., 2002), chaperonin 20 (Saibil,
2008), malate dehydrogenase (M.C. Freeman and D.G Muench, unpublished data) or
associate with nucleic acid metabolism such as endoribonuclease L-PSP (Elo et al., 2003).
Since these proteins were identified from the mitochondria of 7-days old Arabidopsis cells
grown in media initially supplied with 1 mM Pi, these cells were actually subjected to Pi
depletion (Chapter 3). Genevestigator was used to find publicly available microarray data
to determine if transcript of the genes encoding these proteins changed depending on Pi
status (Zimmermann et al., 2004). Except for chaperonin 20 that had a weak respond to Pi
level, the transcript abundance for the genes encoding other proteins found in Chapter 2 did
not appear to change in response to Pi (Figure 5.1). Most probably these genes are likely to
be unresponsive to Pi status in cell culture. However, this hypothesis needs to be tested by
profiling their transcripts abundance by qRT-PCR.
142
1) GR-RBP5
2) Malate dehydrogenase 1
3) Malate dehydrogenase 2
4) Endoribonuclease L-PSP
143
5) Chaperonin
Figure 5.1 The expression of genes encoding identified putative mitochondrial nucleic
acid-binding proteins under low Pi condition from Genevestigator database.
2. Redox active proteins in non-formaldehyde fixed mitochondrial lysates
separated by CsCl gradient centrifugation have been identified
Most of the proteins identified in denser fractions of non- formaldehyde fixed
mitochondrial lysates from Pi-limited cells were redox active proteins, apart from several
protein that have the capacity to bind nucleic-acids. The presence of redox active proteins
in the dense fractions could be due to the ability of these proteins to form complexes with
other molecules (Prudencio and Ubbink, 2004), perhaps the covalently bound co-factors
have the ability to increase protein density that is apparent on CsCl gradients (Thirkettle-
Watts, unpublished results). Since redox active proteins were involved in the regulation of
transcription in plant mitochondria (Konstantinov et al., 1995; Wilson et al., 1996), their
presence in mitochondrial lysates is not unexpected. Due to lacking of nucleic acid-binding
proteins identified with high confidence using this assay, this part of study was not being
continued.
3. P was a limiting factor for cell growth and P was re-allocated into organic pool
during cell growth, similar to responses reported in plants
The amount of Pi that is enough to maintain the growth of different plant species varies.
This study has extended the information on the amount of Pi that is sufficient for
Arabidopsis thaliana suspension cells, beyond supply the optimal Pi amount needed for
144
Arabidopsis cultured cells reported in previous work (Veljanovski et al., 2006). In Chapter
3, I have found that an initial supply of 4 mM Pi was enough to saturate the cells with Pi
under the culture conditions used and enough to load cells to the extent that they could
continue to grow for a further 7 days without additional Pi. Inorganic (Pi) and organic P
(Po) pools were redistributed during the growth cycle, confirming the dynamic mobilisation
of P from one pool to the other. Po made up the largest P pool in the cells throughout the
culture cycle, except at the very start of the cycle. The same trend of P pool allocation
happens in most plant tissues (Veneklaas, unpublished data). Pi secretion into the medium
from cells supplied with high Pi might indicate that a Pi efflux mechanism is also present in
this system, similar to those in plants supplied with high P (Mimura et al., 1996).
4. The response to Pi status of several PHT gene family members in Arabidopsis
suspension cells is similar to the response in plants.
Genes involved in a variety of functions were differentially expressed in response to Pi
deficiency (Misson et al., 2005). Whilst much of the data available at the moment are based
on microarray results that provide information on the changes in transcript abundance for
many genes expression, I have focused this study on the transcript abundance of the
members of only three of the PHT gene families. PHT1, PHT2 and PHT3 genes are
important set of genes encoding the proteins involved in transporting Pi across the plasma
membrane of cells, plastid and mitochondria (Okumura et al., 1998). Changes in the
transcript abundance of the genes upon Pi depletion and re-supply were profiled through
time course analysis. I have found that, as in plants, most of the PHT gene transcripts were
repressed when Pi-depleted cells were re-supplied with Pi. Repression continued for a
certain time until these genes were induced again. The timing of the repression and
induction was gene dependent, although the factor that facilitates the variation of induction
is unknown.
PHT1 family members located to the plasma membrane responded proactively to Pi status.
Transcript abundance for the plastid and mitochondrial Pi transporters were not strongly
changed by Pi amount except for PHT3;2, a mitochondrial transporter that responded in Pi
deficiency. This gene was also changed in respond to other types of stresses found in
previous studies such as H2O2, ozone, ultraviolet and some other tested stress conditions
145
(Van Aken et al., 2009). A relatively low involvement of the Pi transporters located to
organelles compared to cytoplasmic genes could be due to re-distribution of intracellular Pi
under Pi shortage. It also suggests that the mechanism of cell adaptation during Pi
deficiency relies mostly on processes that happen at the plasma membrane. Overall, the
general transcript patterns of the PHT gene families were similar to those observed in
plants; they tended to be up-regulated during low Pi conditions and down-regulated during
Pi sufficient conditions.
5. Primary miRNA399 and PHO2 transcripts accumulated in a pattern similar to
most of the PHT gene family members in Arabidopsis suspension cells
In Chapter 3, transcript amounts for the primary miRNA399 and PHO2 genes were
determined. Pi depletion caused the primary miRNA399 and PHO2 to be induced in
Arabidopsis cell cultures and the transcripts amounts for PHT1;7, PHT1;8 and PHT1;9
were induced. In regulating Pi homeostasis in plants however, miRNA399 is up-regulated
upon Pi starvation, directing the down-regulation of PHO2 (Chiou et al., 2006). This is
thought to cause the induction of some of the PHT gene family transcripts and increase the
capacity of Pi uptake (Aung et al., 2006; Bari et al., 2006). In plants, the up-regulation of
PHT1;8 and PHT1;9 were observed when PHO2 was down-regulated during Pi stress
(Doerner, 2008). It could be that miRNA399 and PHO2 are involved in Pi signalling in
homogenous cell cultures, although their interaction is somewhat different. The difference
could be due to a partial complementary sequence of At4/ IPS1, non-coding RNA that
might suppress the cleavage of miRNA399 on PHO2 (Franco-Zorrilla et al., 2007).
6. Metabolic profiles for Pi-depleted and Pi-resupplied Arabidopsis cells revealed
dynamic changes compared to plants
Metabolic changes as a result of variations in Pi concentration in cultured cells were
profiled. The abundance of some of the detected compounds from GC-MS from cells with
different Pi status varied, when compared to the other cultured cells or in real plants. This is
expected as the metabolism occurs in plant tissues like leaves and roots may not be the
same as in cultures. Even for the cells grown in culture itself, tissue of cultures origin, plant
species of origin, treatment conducted during experiments, time of harvest, type of nutrients
146
supplied and many other factors will contribute to these differences. The comparisons
between cell cultures from Catharanthus roseus (Ukaji and Ashihara, 1987) and
Arabidopsis thaliana (Chapter 3) have shown that both cultures exhibit dynamic metabolite
profiles under Pi-stress.
7. Phi caused toxicity to Pi-deficient Arabidopsis cells and altered the P pool in
the cells
Arabidopsis cells had the ability to assimilate Phi to a certain extent, depending on Pi
availability (Chapter 4). A high ratio of Pi to Phi did not affect Arabidopsis cells during the
early stage of growth. However, Phi toxicity effects could be observed once the cells were
Pi-depleted in the later stages of growth. P allocation was found to be different for Pi-
sufficient and Pi-depleted cells treated with Phi. From the analysis of total P and internal Pi,
Phi seems to influence P distribution in parallel. Phi reduced the capacity of Pi uptake in Pi-
sufficient cells while in Pi-deficient cells, Phi contributes to a higher amount of Pi inside
the cells. While the concentration of Pi inside the cells was depleted with cell growth, Phi
concentration was stable in Pi-sufficient cells. In contrast, for Pi-depleted cells, Phi
amounts inside the cells decreased as the cell biomass increased marginally. Alteration of P
allocation was also observed in plants treated with Phi, for example in komatsuna (Thao et
al., 2008; Thao and Yamakawa, 2010; Avila et al., 2011). Taken together, whether or not
plants have enough Pi, the application of Phi will affect growth and P allocation to a certain
extent.
8. Some members of the PHT gene family responded to Phi stress while others
only responded to Pi stress
In the Pi-starvation response of Arabidopsis cells, PHT1;1, PHT1;2, PHT1;4 and PHT1;7
were up-regulated under low Pi conditions (Chapter 3). PHT1;8 and PHT1;9 transcript
abundance did not change significantly with changes in Pi status over the same period of
time. However, in Phi treated cells, PHT1;1, PHT1;8 and PHT1;9 were up-regulated
significantly more quickly than in non-Phi treated cells. These three genes behave similarly
to one another, but differently to other genes in the same family suggesting that they could
be part of a separate regulatory circuit. Among these three genes, PHT1;8 and PHT1;9
147
were found to be regulated by miRNA399 and PHO2 that are involved in the control of Pi
remobilisation and translocation in plants (Chiou et al., 2006; Peter, 2008). Clear
explanation of Phi effects to the action of primary miRNA399 and PHO2 genes in cell
cultures is unknown.
9. Phi reduced the abundance of detected metabolites in Pi-depleted cells
Pi-deficiency causes some of the detected metabolites to be increased and the amounts of
these compounds were reduced when cells re-supplied with Pi. However, addition of Phi
instead of Pi into the medium caused the detected metabolites to be further reduced in
amount, including compounds that are involved in the citric acid cycle, as well as other
pathways in the cells. Other by-pass enzymes such as PPi dependent phosphofructokinase
(PPi-PFK), phosphoenol pyruvate (PEP) phosphatase, and PEP carboxylase (PEPCase)
(Plaxton 2004) might also contribute to the shift in metabolite pools. However, it has to be
examined using techniques other than GC-MS. Phi brings the amounts of citric acid cycle
intermediates way down to low level, which perhaps removing the symptoms of low Pi
physiologically. This situation suggests that Phi has an impact on oxidative metabolism of
the cells. In aerobic respiration, Pi is required to produce ATP. However, if there was no Pi
available, alternative non-phosphorylating respiration pathways may be activated
(Theodorou and Plaxton, 1993), which could be tested by respiratory measurements
(Gonzàlez-Meler et al., 2001). In this case, Phi appeared to worsen stress condition by not
allowing the cells to respire, or even to ferment properly. In phytophthora, Phi treatment
reduces the ability of the cells to generate energy and scavenge ROS under oxidative stress
(Daniel and Guest, 2005).
Limitations
Several novel findings have been achieved as discussed above. However, there were also
some limitations encountered during this research.
1. The development of an assay to identify mitochondrial nucleic acid-binding proteins
from Arabidopsis thaliana cell culture proved difficult. Two centrifugation based
methods were tested and CsCl gradient centrifugation was found to be the most
148
promising approach, with good protein recoveries compared to glycerol gradient
centrifugation or the combination of glycerol gradient centrifugation followed by
CsCl gradient centrifugation. In developing this assay, I identified several issues:
a. The number of proteins species co-purifying with mitochondrial nucleic acid
and identified by mass spectrometry was very low, probably due to the low
abundance of these kinds of proteins in the sample.
b. While some proteins co-purifying with nucleic acid were identified; only
five out of the 19 identified proteins were predicted to have nucleic acid
binding capacity, according to either their annotated functions or the
proximity of their properties with known nucleic acid-binding proteins.
c. Nucleic acid binding properties of the detected proteins are not proved. It
could be confirmed using suitable assay such as electrophoretic mobility
shift assay (EMSA).
2. The full accounting of P in the cell system was not able to be done due to a small
amount of P that binds to glassware and certain amounts of Pi that have been lost in
the pellet during sample preparation for Pi assay. This has restricted a full analysis
to monitoring the fate of the entire added Pi after it was incorporated into cells.
3. The transcript-profiling study was narrowed to the analysis of the PHT gene
families, PHO2 and primary miRNA399. Thus a wide range of genes that responded
to Pi is still to be studied in the future.
4. In this study, I have measured the transcript abundance for the primary miRNA399,
not the miRNA399 itself. Thus, the transcript profile for the active RNA molecule
of this gene is still unknown.
5. Measurement of Pi and Phi are based on the total amount of Pi and Phi inside the
cells. Details on the intracellular locations and the amount of the Pi or Phi are
unknown.
6. The GC-MS method enables the detection of a very small number of hydrophilic
aqueous metabolites from the samples. However, the sensitivity is limited and
149
prevents detection of a wide range of metabolites. Some compounds produced
weak signals and certainly there were many metabolites that were present below the
instrument’s detection limit.
Future Work
To address the limitations discussed above, there are several research directions that could
be conducted in the future:
1. Develop a new approach that could potentially identify more mitochondrial nucleic
acid-binding proteins from Arabidopsis cell culture, for example by using affinity
chromatography. Affinity chromatography is one of the liquid chromatography
techniques that allow protein purification using suitable columns based on the
nucleic acid-binding properties of the protein (Gadgil et al., 2001). It has been used
previously to purify mitochondrial RNA binding proteins in potato (Vermel et al.,
2002).
2. Confirm the nucleic acid-binding activities for proteins identified through LC/MS-
MS by EMSA. Using EMSA, protein-nucleic acid complexes will move more
slowly compared to free linear DNA or RNA during non-denaturing polyacrylamide
or agarose gel electrophoresis (Hendrickson and Schleif, 1985), making complexes
distinguishable from free proteins.
3. Perform 31
P nuclear magnetic resonance (NMR) (Shanks, 2001) or HPLC analysis
(Liu et al., 2006) to identify and quantify the metabolites not amenable to GC-MS,
notably the phosphorylated compounds such as ATP, ADP, AMP, NAD(P)H. The
quantitative metabolic profiles of these P-compounds will help to improve our
knowledge in metabolic changes related to mitochondrial functions during Pi stress.
31P-NMR analysis also can be used to measure the amount of Pi in various
compartments of the cell, for example cytosolic and vacuolar spaces (Rebeille et al.,
1983), besides being capable of distinguishing Pi and Phi (Danova-Alt et al., 2008).
150
4. Profile the kinetics of transcript abundance for more Pi-starvation responsive genes
under Phi stress by quantitative real time-PCR. The determination of PHR1, PHO2,
miRNA399, and SPX domain gene expression will broaden our knowledge on the
regulation of Pi-starvation in plants.
5. Previously, there were contrasting effects of oxidative stress on mitochondrial
respiration. Tiwari et al (2002) found that mitochondrial respiration was generally
increased by oxidative stress from the treatment of Arabidopsis cell culture with
chemicals such as rotenone and Antimycin A. On the other hand, the respiratory
capacity was maintained, although oxidative stress was induced by treatment of
chemicals such as H2O2, menadione or Antimycin A to Arabidopsis cells
(Sweetlove et al., 2002). Specific to Pi stress, respiration rate in bean roots was
reduced (Rychter and Mikulska, 1990). In this study, Phi treatment brought on
effects that were opposite to those caused by Pi-starvation responses in cultured
cells. The abundance of some detected components in cell metabolic pathways,
including in aerobic respiration, specifically referred to the citric acid cycle
intermediates were altered, thus it would be interesting to measure the respiration
rate of isolated mitochondria from the cells to get insights on how Phi affects
respiratory processes in plants.
6. Since the transcript changes do not always correlate well with changes in the
amount of the encoded proteins (Tran and Plaxton 2008; Plaxton and Tran 2011),
there is a need for future research to assess the amounts or activities of the
corresponding PHT transporter proteins.
Conclusion
Taken together, this work has made significant contributions to knowledge of basic genetic
research that has applications to agricultural research. Pi stress leads to changes at
physiology and molecular level in plants. Our understanding of the complexity of the
mechanisms involved during plant responses to Pi depletion and resupply have been
increased using a cell culture approach as a simplified system. Collectively, the kinetics of
Pi mobilisation, gene expression, protein abundance and metabolic changes are controlled
151
by the coordinated expression of all genomes to sustain plant survival under Pi stress. Phi
was found to have negative affects on plant cell function, making the usage of Phi in
agriculture practise questionable. Findings from this work will help the community,
especially farmers, make better evidence based decisions before adding Phi to crops as a Pi
fertiliser.
References
Aung K, Lin S-I, Wu C-C, Huang Y-T, Su C-L, Chiou T-J (2006) pho2, a phosphate
overaccumulator, is caused by a nonsense mutation in a MicroRNA399 target gene.
Plant Physiology 141: 1000-1011
Avila FW, Faquin V, Araujo JL, Marques DJ, Ribeiro PM, Lobato AKD, Ramos SJ,
Baliza DP (2011) Phosphite supply affects phosphorus nutrition and biochemical
responses in maize plants. Australian Journal of Crop Science 5: 646-653
Bari R, Pant BD, Stitt M, Scheible W-R (2006) PHO2, microRNA399, and PHR1 define
a phosphate-signaling pathway in plants. Plant Physiology 141: 988-999
Chiou TJ, Aung K, Lin SI, Wu CC, Chiang SF, Su CL (2006) Regulation of phosphate
homeostasis by microRNA in Arabidopsis. Plant Cell 18: 412-421
Daniel R, Guest D (2005) Defence responses induced by potassium phosphonate in
Phytophthora palmivora-challenged Arabidopsis thaliana. Physiological and
Molecular Plant Pathology 67: 194-201
Danova-Alt R, Dijkema COR, De Waard P, KÖCk M (2008) Transport and
compartmentation of phosphite in higher plant cells – kinetic and 31
P nuclear
magnetic resonance studies. Plant, Cell and Environment 31: 1510-1521
Doerner P (2008) Phosphate starvation signaling: a threesome controls systemic Pi
homeostasis. Current Opinion in Plant Biology 11: 536-540
Duff SMG, Moorhead GBG, Lefebvre DD, Plaxton WC (1989) Phosphate starvation
inducible bypasses of adenylate and phosphate dependent glycolytic enzymes in
Brassica nigra suspension cells. Plant Physiology 90: 1275-1278
Elo A, Lyznik A, Gonzalez DO, Kachman SD, Mackenzie SA (2003) Nuclear genes that
encode mitochondrial proteins for DNA and RNA metabolism are clustered in the
Arabidopsis Genome. The Plant Cell Online 15: 1619-1631
Franco-Zorrilla JM, Valli A, Todesco M, Mateos I, Puga MI, Rubio-Somoza I, Leyva
A, Weigel D, Garcia JA, Paz-Ares J (2007) Target mimicry provides a new
mechanism for regulation of microRNA activity. Nature Genetics 39: 1033-1037
Gadgil H, Oak SA, Jarrett HW (2001) Affinity purification of DNA-binding proteins.
Biochemical and Biophysical Methods 49: 607-624
Gonzàlez-Meler MA, Giles L, Thomas RB, Siedow JN (2001) Metabolic regulation of
leaf respiration and alternative pathway activity in response to phosphate supply.
Plant, Cell and Environment 24: 205-215
Hendrickson W, Schleif R (1985) A dimer of AraC protein contacts three adjacent major
groove regions of the AraI DNA site. Proceedings of the National Academy of
Sciences of the United States of America 82: 3129-3133
152
Konstantinov YM, Lutsenko GN, Podsosonny VA (1995) Genetic functions of isolated
maize mitochondria under model changes of redox conditions. Biochemistry and
Molecular Biology International 36: 319-326
Liu H, Jiang YM, Luo YB, Jiang WB (2006) A simple and rapid determination of ATP,
ADP and AMP concentrations in pericarp tissue of litchi fruit by high performance
liquid chromatography. Food Technology and Biotechnology 44: 531-534
Mimura T, Sakano K, Shimmen T (1996) Studies on the distribution, re-translocation and
homeostasis of inorganic phosphate in barley leaves. Plant Cell and Environment
19: 311-320
Misson J, Raghothama KG, Jain A, Jouhet J, Block MA, Bligny R, Ortet P, Creff A,
Somerville S, Rolland N, Doumas P, Nacry P, Herrerra-Estrella L, Nussaume
L, Thibaud M-C (2005) A genome-wide transcriptional analysis using Arabidopsis
thaliana Affymetrix gene chips determined plant responses to phosphate
deprivation. Proceedings of the National Academy of Sciences of the United States
of America 102: 11934-11939
Okumura S, Mitsukawa N, Shirano Y, Shibata D (1998) Phosphate transporter gene
family of Arabidopsis thaliana. DNA Research 5: 261-269
Peter D (2008) Phosphate starvation signaling: a threesome controls systemic Pi
homeostasis. Current Opinion in Plant Biology 11: 536-540
Plaxton W.C. (2004) Plant response to stress: biochemical adaptations to phosphate
deficiency. In Encyclopedia of Plant and Crop Science (ed. R.Goodman) pp. 976–
980. Marcel Dekker, Inc., New York, USA
Plaxton WC, Tran HT (2011) Metabolic adaptations of phosphate-starved plants. Plant
Physiology 156: 1006-1015
Prudencio M, Ubbink M (2004) Transient complexes of redox proteins: structural and
dynamic details from NMR studies. Molecular Recognition 17: 524-539
Ramaiah M, Jain A, Baldwin JC, Karthikeyan AS, Raghothama KG (2011)
Characterization of the phosphate starvation-induced glycerol-3-phosphate
permease gene family in Arabidopsis. Plant Physiology 157: 279-291
Rebeille F, Bligny R, Martin JB, Douce R (1983) Relationship between the cytoplasm
and the vacuole phosphate pool in Acer-pseudoplanatus cells. Archives of
Biochemistry and Biophysics 225: 143-148
Rychter AM, Mikulska M (1990) The relationship between phosphate status and cyanide-
resistant respiration in bean roots. Physiologia Plantarum 79: 663-667
Saibil HR (2008) Chaperone machines in action. Current Opinion in Structural Biology 18:
35-42
Shanks JV (2001) In situ NMR systems. Current issues in molecular biology 3: 15-26
Sweetlove LJ, Heazlewood JL, Herald V, Holtzapffel R, Day DA, Leaver CJ, Millar
AH (2002) The impact of oxidative stress on Arabidopsis mitochondria. The Plant
Journal 32: 891-904
Thao H, Yamakawa T, Shibata K, Sarr P, Myint A (2008) Growth response of
komatsuna (Brassica rapa var. peruviridis) to root and foliar applications of
phosphite. Plant and Soil 308: 1-10
Thao HTB, Yamakawa T (2010) Phosphate absorption of intact komatsuna plants as
influenced by phosphite. Soil Science and Plant Nutrition 56: 133-139
Theodorou ME, Plaxton WC (1993) Metabolic adaptations of plant respiration to
nutritional phosphate deprivation. Plant Physiology 101: 339-344
Tiwari BS, Belenghi B, Levine A. (2002) Oxidative stress increased respiration and
generation of reactive oxygen species, resulting in ATP depletion, opening of
153
mitochondrial permeability transition, and programmed cell death. Plant Physiology
128 : 1271-1281
Tran HT, Plaxton WC (2008) Proteomic analysis of alterations in the secretome of
Arabidopsis thaliana suspension cells subjected to nutritional phosphate deficiency.
Proteomics 8: 4317-4326
Ukaji T, Ashihara H (1987) Effect of inorganic phosphate on the levels of amino acids in
suspension cultured cells of Catharanthus roseus. Annals of Botany 60: 109-114
Van Aken O, Zhang B, Carrie C, Uggalla V, Paynter E, Giraud E, Whelan J (2009)
Defining the mitochondrial stress response in Arabidopsis thaliana. Molecular Plant
2: 1310-1324
Veljanovski V, Vanderbeld B, Knowles VL, Snedden WA, Plaxton WC (2006)
Biochemical and molecular characterization of AtPAP26, a vacuolar purple acid
phosphatase up-regulated in phosphate-deprived Arabidopsis suspension cells and
seedlings. Plant Physiology 142: 1282-1293
Vermel M, Guermann B, Delage L, Grienenberger J-M, Maréchal-Drouard L,
Gualberto JM (2002) A family of RRM-type RNA-binding proteins specific to
plant mitochondria. Proceedings of the National Academy of Sciences 99: 5866-
5871
Wilson SB, Davidson GS, Thomson LM, Pearson CK (1996) Redox control of RNA
synthesis in potato mitochondria. European Journal of Biochemistry 242: 81-85
Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W (2004)
GENEVESTIGATOR. Arabidopsis Microarray Database and Analysis Toolbox.
Plant Physiology 136: 2621-2632
154
APPENDICES
155
Appendix 1: List of primers for qRT-PCR
Gene
Forward primer Melting
temperature (Tm)
Reverse primer Melting temperature
(Tm)
Product size (bp)
PHT1;1
CCAAAGGCAAGTCCCTTGAAGAACT
54.7 AACAAAACCAAACATCGCACTCCAAATA
A
57.6 109
PHT1;2
AGGGCAAGTCCCTCGAAGAACT
57.3 ATCAAACAAACCACAAACAACTCCACAT
56.7 109
PHT1;3
CCAAAGGCAAGTCCCTTGAAGAACT
57.37 CAAAGAACGTAAAACGTAAAAGTAGTAC
ACCATT
57.15 141
PHT1;4
TTGCTCCTAATTTTCCTGATGCT
54.7 TGTGCCGGCCGAAATCT
57.6 80
PHT1;5
CGCCGATATCCCATGACAAG
55.7 GACCTAATGCGACG
ACGTTTG
56.3 80
PHT1;6
ACGTTATACATCATGGCAGGAATCAAT
55.13 AAGCTCCTCAAGTGATTTCCCATTAGT
56.25 90
PHT1;7
TGGAGGATATCCATGCTCTGTCT
57.2 CGCGGCTTCTGGAAAATTAG
54.3 100
PHT1;8
TTATCCCGAAGTAAACCGTATGAGAA
53.9 AATACGTCACCAAGATTCCAGCAA
54.84 80
PHT1;9
TGGAGCTGCAGGGAAGTTTG
55.2 ATCTGGAAAACCGTCCTCTTCAT
54.8 88
PHT2
AATGCATCAGGAGATTT
GTTTACAGT
53.55 AGGCTAAGGCTTGT
GATAGAGCTAT
55.14 156
PHT3;1 GCAACCGTTGGAGATG
CGGTGA
59.99 AACACCACCAGTGG
TTGGCA
56.54 159
PHT3;2
CGTTGCTGATGCAGTAA
AGAGGCTA
57.43 TTGACAGCATCATA
GATAACCCACT
53.82 120
PHT3;3
AGTCTTAAGCGGATTCC
CTACAA
53.24 CCTTCTAATCGCTAC
ACAACGCCT
57.10 183
PHO2
CATCTCAAAATGCTTTG
GAGGCT
56 CGAGCCGAGGGAG
AGAAAAA
57 103
pri-miRNA399
CCTCTCCATTGGCAGGTCCTTTACTT
60.8 GCAACTCTCCTTTGGCAGGTCATT
59.5 104
PDF2 TTGGCCACGTTAAATTTGATGTT
53.9 GCAGCATATAGTTCCTCAGGTTCTAGA
57.5 187
ACT7 GTGGTTGCACCGCCAGAGAGA
59.7 CCACATCTGTTGGAAGGTGCTGA
58.6 84
YLS8 CATCCATCTGCATACAGGTCTCA
56.4 CTCCGGTTGGGCTGTTGA
57.8 101
156
Appendix 2: List of compounds and their retention time determined from AMDIS and ME
Compounds from AMDIS Compounds from ME Retention time
(min)
RI=974.8, 8.4840 min, 1 8.4837
RI=980.6, 8.6198 min, 1 8.6255
RI=985.6, 8.7373 min, 1 8.7395
RI=989.5, 8.8309 min, 1 8.8337
Lactic Acid (2TMS) 9.5344
Glycolate (2TMS) 10.0746
RI=1049.7, 10.2450 min, 1 10.2472
RI=1079.6, 10.9483 min, 1 10.9217
L-Alanine 10.936
Glycine (2TMS) 11.4858
RI=1125.5, 12.0277 min, 1 12.0189
RI=1129.9, 12.1302 min, 1 12.1232
RI=1129.5, 12.1214 min, 1 12.124
Pentasiloxane, dodecamethyl-, MS92, RI1152.7 12.707
RI=1168.7, 13.0413 min, 1 13.0456
Phosphoric acid, bis(trimethylsilyl)monomethyl ester, MS91, RI1170.6, Putative but Unconfirmed
13.048
Dodecamethylpentasiloxane-c 13.8096
L-Valine (2TMS) L-Valine 14.0440
gamma-Hydroxybutyric acid Gamma-hydroxybutyric acid (2TMS), MS89, RI1236.5, Putative but Unconfirmed
14.6491
Ethanolamine (3TMS), MS90, RI1265.4, Putative but Unconfirmed
15.331
Ethylolamine (3TMS) 15.3322
Phosphoric acid 15.524
Glycerol (3 TMS) 15.5849
RI=1273.8, 15.5130 min, 1 15.6451
L-Isoleucine (2 TMS) 16.0574
RI=1299.7, 16.1226 min, 1 16.1281
L-Proline 16.149
L-Proline (2 TMS) 16.1506
Nicotinic acid (TMS) 16.1689
Nicotinic acid 16.225
Glycine 16.35
Succinic acid (2TMS) 16.6190
Succinic acid 16.622
D-(+)-Glyceric acid (3 TMS) 16.9302
Fumaric acid 17.482
Fumaric acid (2TMS) 17.4847
L-Serine (3 TMS) 17.6574
RI=1388.6, 18.2122 min, 1 18.2115
157
4,4'-Bipyridine 19.7353
Peak from Glutamine 1 20.1779
L-Malic acid 20.472
L-(-)-Malic acid (3 TMS) 20.4829
Meso-erythritol 20.8271
D-Threitol (4 TMS) 20.8300
L-Aspartic acid (3 TMS) 21.1369
L-Proline- 5-Oxo (TMS) = L-Pyroglutamic acid (2TMS)
21.1857
Hydroxyproline 21.188
Pyroglutamic acid 21.196
Gamma-Aminobutyric acid 21.301
Butanoic acid 4amino 21.3028
L-Cysteine (3 TMS) 21.8129
L-Threonic acid 21.8992
2-Ketoglutaric acid methoxime (2TMS)
22.3008
L-Glutamic acid (3 TMS) 23.1109
L-Phenylalanine (2 TMS) 23.2189
L-Phenylalanine 23.219
Gluconic acid, 2-methoxime, tetra(TMS)-, TMS ester
23.6098
Unknown Probable Sugar Acid Derivative, RI1653.9 23.68
1,4 Butanediamine (4TMS) 25.2072
Xylonic acid Lacton (3TMS) 25.2680
2-Keto-l-gluconic acid, penta(O-trimethylsilyl)-, MS81, RI1747.6
25.459
Ribonic acid (5TMS) 25.4625
Galactonic acid (6TMS), MS90, RI1980.7 29.523
Phosphoric acid (2TMS) 25.7054
Phosphoric acid, bis(trimethylsilyl) 2,3-bis[(trimethylsilyl)oxy]propyl ester
25.7069
Allantoin 25.798
Arabinofuranose, 1,2,3,5-tetrakis-O-(trimethylsilyl)-
25.8153
Fructose 5TMS 26.3793
Citric acid (4TMS) 26.7069
D-Mannopyranoside, methyl 2,3,4,6-tetrakis-O-(trimethylsilyl)-, MS80, RI1844.6
27.254
Tetradecanoic acid (1TMS), MS93, RI1849.4, Putative but Unconfirmed
27.312
RI=1867.0, 27.6355 min, 1 27.5937
RI=1865.7, 27.6110 min, 1 27.6075
RI=1866.5, 27.6267 min, 1 27.6194
D-Fructose 27.625
158
RI=1875.6, 27.7957 min, 1 27.7596
D-Galactose 27.823
D-Glucose 27.949
RI=1893.3, 28.1236 min, 1 28.0425
RI=1907.2, 28.3598 min, 1 28.2957
Sorbitol 28.555
D-Sorbitol (6 TMS) 28.5635
Gulose 5-O-TMS 28.6655
Maltose (8TMS) 29.0104
D-Glucose (5-O-TMS) 29.3734
D-Gluconic acid 29.5486
Palmitelaidic acid (TMS) 30.0890
Hexadecanoic acid (1TMS) 30.5191
Palmitic acid 30.52
myo-Inositol (6TMS)-mpimp 31.0080
Inositol, scyllo- (6TMS), MS88, RI2078.2, Putative but Unconfirmed
31.009
Sedoheptulose methoxime (6TMS), MS86, RI2116.9 31.617
Sedoheptulose methoxime (6TMS), MS84, RI2122.6 31.705
Gulose, 2,3,4,5,6-pentakis-O-(trimethylsilyl)-, MS82, RI2171.7
32.479
Octadecadienoic acid (1TMS) 32.9876
9,12-Octadecadienoic acid (Z,Z)-, trimethylsilyl ester, MS92, RI2208.2
32.995
RI=2212.4, 33.0739 min, 1 33.0759
Linolenic acid (TMS) 33.0798
Oleic acid, trimethylsilyl ester, MS89, RI2214.4 33.082
Oleic acid (TMS) 33.1661
Stearic acid 33.454
2-O-Glycerol-à-d-galactopyranoside, 6TMS
34.2740
Glucose 6-phosphate 34.318
D-Glucose-6-P-1 34.3230
D-glycero-D-gulo-heptose methoxime (6TMS), MS77, RI2350.8
34.841
D-Glucuronic acid (5TMS) 35.1361
Inositol monophosphate, MS94, RI2407.7, Putative but Unconfirmed
35.574
D-Myo-Inositol, 1,2,4,5,6-pentakis-O-(trimethylsilyl)-, bis(trimethylsilyl) pho
35.5747
Sucrose 38.418
D-(+)-Sucrose 38.4233
RI=2627.2, 38.4281 min, 1 38.4382
RI=2628.8, 38.4491 min, 1 38.4440
RI=2628.6, 38.4471 min, 1 38.4514
159
RI=2627.7, 38.4355 min, 1 38.4565
Galactinol Dihydrate 39.3756
Cellobiose 39.573
RI=2716.6, 39.5828 min, 1 39.5819
Maltose methoxime (8TMS) EZ Peak 1, MS92, RI2717.6
39.585
D-(+)-Trehalose 39.6444
Trehalose 39.661
D-Maltose 39.899
Unknown Probable Disaccharide, RI2748.9 39.978
Gentiobiose 40.7701
RI=2918.7, 41.9351 min, 1 41.9349
Galactinol (9TMS) 42.6599
RI=3103.0, 43.9153 min, 1 43.9137
alpha-Tocopherol 44.2466
Campesterol (TMS) 45.4560
Sitosterol (TMS) 46.3070
160
Appendix 3: Metabolite ratios for Pi-deficient and Pi-resupplied cells from AMDIS
analysis
Compounds Ratio (Day0/Day1) Ratio (day 9/day 1)
Lactic Acid (2TMS) *1.84+0.19 *3.44+0.18
Glycine (2TMS) 0.95+0.21 *0.18+0.02
L-Valine (2TMS) 1.19+0.26 *0.61+0.06
L-Isoleucine (2 TMS) 0.85+0.24 0.87+0.10
L-Proline (2 TMS) *0.45+0.17 *0.25+0.03
Succinic acid (2TMS) *2.36+0.1 *2.29+0.15
L-Threonine (2 TMS) *0.16+0.11 *0.09+0.08
Fumaric acid (2TMS) *3.86+1.03 *7.37+0.73
L-Serine (3 TMS) *0.72+0.06 *0.24+0.02
Glutamine 1 1.33+0.44 -
L-(-)-Malic acid (3 TMS) *3.67+0.21 *8.06+0.56
L-Aspartic acid (3 TMS) 1.37+0.17 *0.17+0.01
Butanoic acid 4amino(TMS) GABA 1.71+0.38 *0.60+0.05
L-Cysteine (3 TMS) 7.00+3.3 -
L-Glutamic acid (3 TMS) 4.23+2.64 -
L-Phenylalanine (2 TMS) 1.8+0.73 -
Citric acid (4TMS) *4.58+0.27 *2.73+0.18
D-(-)-Fructose-2 (TMS) 7.99+1.87 *5.05+0.20
D-Glucose (5-O-TMS) 14.6+3.03 *5.6+0.41
D-(+)-Sucrose 1.44+0.18 *2.32+0.27
D-(+)-Trehalose - *6.23+1.04
Whenever the ratio of metabolite was not determined, it was indicated with a dash (-).
Significant differences (*) were determined by a t-test (p<0.05, n= 2 biological
replicates with 3 technical replicates for each biological replicate).
161
Appendix 4: Metabolite ratios for Pi-deficient and Pi-resupplied cells from ME analysis
Ratio (Day0/Day1) Ratio (Day9/Day1)
Chemical Class Metabolite Name
Amino Acids
L-Alanine 1.01+0.1 *0.35+0.04
L-Valine 0.81+0.11 *0.53+0.06
Glycine 0.78+0.21 *0.17+0.01
Hydroxyproline 0.88+0.09 *2.7+0.25
Pyroglutamic acid 1.41+0.19 0.59+0.08
Gamma-Aminobutyric acid 1.20+0.11 *0.51+0.02
L-Phenylalanine 1.01+0.17 0.21+0.01
L-Proline *0.47+0.08 *0.36+0.04
Nicotinic acid *0.04+0.004 0.06+0.004
Unknown
Pentasiloxane, dodecamethyl-, MS92, RI1152.7
0.76+0.02 1.22+0.05
Phosphoric acid, bis(trimethylsilyl)monomethyl ester, MS91, RI1170.6, Putative but Unconfirmed
*0.29+0.09 *1.5+0.17
Ethanolamine (3TMS), MS90, RI1265.4, Putative but Unconfirmed
*0.52+0.06 *0.13+0.02
Inositol, scyllo- (6TMS), MS88, RI2078.2, Putative but Unconfirmed
*4.98+0.53 *31.15+0.93
Inositol monophosphate, MS94, RI2407.7, Putative but Unconfirmed
*1.55+0.15 *4.65+0.27
Maltose methoxime (8TMS) EZ Peak 1, MS92, RI2717.6
*10.98+1.55 *7.35+0.26
Galactonic acid (6TMS), MS90, RI1980.7
0.9+0.12 *2.94+0.2
Sedoheptulose methoxime (6TMS), MS86, RI2116.9
*3.14+0.55 *7.3+0.55
2-Keto-l-gluconic acid, penta(O-trimethylsilyl)-, MS81, RI1747.6
*0.67+0.09 *2.19+0.18
D-Mannopyranoside, methyl 2,3,4,6-tetrakis-O-(trimethylsilyl)-, MS80, RI1844.6
1.27+0.40 1.36+0.22
Allantoin 0.62+0.09 *0.27+0.02
Oleic acid, trimethylsilyl ester, MS89, RI2214.4
*0.63+0.05 2.02+0.03
Gamma-hydroxybutyric acid (2TMS), MS89, RI1236.5, Putative but Unconfirmed
*0.35+0.03 *3.25+0.31
Gulose, 2,3,4,5,6-pentakis-O-(trimethylsilyl)-, MS82, RI2171.7
1.00+0.07 *5.98+0.38
9,12-Octadecadienoic acid (Z,Z)-, trimethylsilyl ester, MS92, RI2208.2
*0.68+0.06 *2.94+0.06
Unknown Probable Disaccharide, RI2748.9
1.42+0.22 *5.88+0.39
Sedoheptulose methoxime (6TMS), MS84, RI2122.6
*4.97+0.63 *7.63+0.64
D-glycero-D-gulo-heptose methoxime (6TMS), MS77, RI2350.8
*1.57+0.15 *4.96+0.20
162
Unknown Probable Sugar Acid Derivative, RI1653.9
*3.31+0.39 *14.80+2.02
Tetradecanoic acid (1TMS), MS93, RI1849.4, Putative but Unconfirmed
1.03+0.11 *1.68+0.21
Inorganic Ions and Gases Phosphoric acid
*0.17+0.04 *0.66+0.04
Dicarboxylic Acids
Succinic acid *2.10+0.18 *2.04+0.21
Fumaric acid 2.17+0.55 5.73+0.63
L-Malic acid *3.09+0.22 *6.17+0.28
Fatty Acids
Palmitic acid - -
Stearic acid - -
Carbohydrates
Sucrose *1.67+0.10 *1.74+0.02
D-Maltose 6.55+1.18 *6.23+0.23
D-Fructose *8.21+0.40 *4.63+0.24
D-Galactose 2.72+0.16 *1.84+0.14
D-Glucose *2.59+0.07 *2.81+0.05
Cellobiose *9.51+1.26 *6.16+0.11
Trehalose *1.73+0.22 *3.6+0.32
Alcohols and Polyols Sorbitol
*0.69+0.06 1.29+0.09
Sugar Phosphates Glucose 6-phosphate
0.92+0.10 *13.75+1.14
Whenever the ratio of metabolite was not determined, it was indicated with a dash (-).
Significant differences (*) were determined by a t-test (p<0.05, n= 2 biological
replicates with 3 technical replicates for each biological replicate).
163
Appendix 5: Metabolite ratios for Phi-treated and non-treated cells from AMDIS analysis
Compounds Ratio (Day1 Phi/Day1) Ratio (Day 9 Phi/Day 1)
Lactic Acid (2TMS) 1.26+0.15 0.85+0.08
Glycine (2TMS) 1.04+0.09 *0.26+0.02
L-Valine (2TMS) 0.92+0.05 *0.25+0.02
L-Isoleucine (2 TMS) 0.90+0.08 1.24+0.06
L-Proline (2 TMS) 0.91+0.05 -
Succinic acid (2TMS) 1.34+0.17 *0.16+0.02
Fumaric acid (2TMS) 0.84+0.06 *0.23+0.06
L-Serine (3 TMS) 0.84+0.03 *0.02+0.001
L-Threonine (3 TMS) 0.92+0.04 -
Glutamine 1 0.64+0.09 -
L-(-)-Malic acid (3 TMS) 0.88+0.11 *0.34+0.06
L-Aspartic acid (3 TMS) 0.66+0.10 -
Butanoic acid 4amino(TMS) GABA 1.30+0.11 *0.11+0.004
L-Cysteine (3 TMS) - -
2-Ketoglutaric acid methoxime (2TMS) - -
L-Glutamic acid (3 TMS) - -
L-Phenylalanine (2 TMS) - -
Citric acid (4TMS) 0.88+0.07 *0.21+0.03
D-(-)-Fructose-2 (TMS) 0.97+0.09 *2.09+0.09
D-Glucose-6-P-1 - -
D-(+)-Sucrose 0.93+0.07 1.67+0.23
D-(+)-Trehalose 1.43+0.38 -
Whenever the ratio of metabolite was not determined, it was indicated with a dash (-).
Significant differences (*) were determined by a t-test (p<0.05, n= 2 biological
replicates with 3 technical replicates for each biological replicate).
164
Appendix 6: Metabolite ratios for Phi-treated and non-treated cells from ME analysis
Chemical Class Metabolite Name Ratio (Day 1 Phi/Day 1) Ratio (Day 9 Phi/Day 1)
Amino Acids L-Alanine *0.84+0.03 *0.06+0.01
L-Valine *0.75+0.06 *0.19+0.02
Glycine 1.04+0.12 *0.17+0.01
Hydroxyproline 0.69+0.09 *0.68+0.06
Pyroglutamic acid 0.58+0.06 *0.03+0.002
Gamma-Aminobutyric acid
1.07+0.06 *0.09+0.01
L-Phenylalanine 0.52+0.18 *0.05+0.01
L-Proline 1.24+0.12 *0.09+0.01
Nicotinic acid *0.64+0.12 0*.04+0.002
Unknown Pentasiloxane, dodecamethyl-, MS92, RI1152.7
1.02+0.07 *1.73+0.06
Phosphoric acid, bis(trimethylsilyl)monomethyl ester, MS91, RI1170.6, Putative but Unconfirmed
0.8+0.09 *1.49+0.16
Ethanolamine (3TMS), MS90, RI1265.4, Putative but Unconfirmed
1.05+0.06 *0.12+0.01
Inositol, scyllo- (6TMS), MS88, RI2078.2, Putative but Unconfirmed
1.04+0.11 *16.27+1.11
Inositol monophosphate, MS94, RI2407.7, Putative but Unconfirmed
0.93+0.03 *4.65+0.35
Maltose methoxime (8TMS) EZ Peak 1, MS92, RI2717.6
1.01+0.07 *1.75+0.21
Galactonic acid (6TMS), MS90, RI1980.7
*0.76+0.05 1.02+0.14
Sedoheptulose methoxime (6TMS), MS86, RI2116.9
*0.85+0.03 *3.63+0.54
2-Keto-l-gluconic acid, penta(O-trimethylsilyl)-, MS81, RI1747.6
*0.72+0.05 1.03+0.16
D-Mannopyranoside, methyl 2,3,4,6-tetrakis-O-(trimethylsilyl)-, MS80, RI1844.6
*0.7+0.06 0.65+0.12
Allantoin 0.64+0.10 *0.24+0.05
Oleic acid, trimethylsilyl ester, MS89, RI2214.4
0.91+0.06 *3.00+0.12
165
Gamma-hydroxybutyric acid (2TMS), MS89, RI1236.5, Putative but Unconfirmed
1.21+0.19 *0.14+0.01
Gulose, 2,3,4,5,6-pentakis-O-(trimethylsilyl)-, MS82, RI2171.7
*0.83+0.04 *4.59+0.37
9,12-Octadecadienoic acid (Z,Z)-, trimethylsilyl ester, MS92, RI2208.2
0.99+0.04 *2.95+0.11
Unknown Probable Disaccharide, RI2748.9
0.91+0.10 *4.51+0.69
Sedoheptulose methoxime (6TMS), MS84, RI2122.6
0.86+0.05 *3.46+0.5
D-glycero-D-gulo-heptose methoxime (6TMS), MS77, RI2350.8
0.94+0.03 3.4+0.61
Unknown Probable Sugar Acid Derivative, RI1653.9
0.95+0.25 2.36+0.55
Tetradecanoic acid (1TMS), MS93, RI1849.4, Putative but Unconfirmed
0.80+0.03 *1.62+0.13
Inorganic Ions and Gases
Phosphoric acid 0.99+0.03 0.96+0.04
Dicarboxylic Acids Succinic acid 1.11+0.12 *0.12+0.02
Fumaric acid 0.76+0.06 0.24+0.04
L-Malic acid 0.74+0.14 *0.31+0.08
Fatty Acids Palmitic acid - -
Stearic acid - -
Carbohydrates Sucrose 0.79+0.08 *1.4+0.07
D-Maltose 0.93+0.05 *1.92+0.17
D-Fructose *0.8+0.06 *1.64+0.16
D-Galactose 0.77+0.11 0.8+0.19
D-Glucose 0.88+0.12 *2.66+0.27
Cellobiose 1.05+0.09 *1.62+0.16
Trehalose 0.78+0.07 0.86+0.09
Alcohols and Polyols Sorbitol 0.85+0.09 0.71+0.12
Sugar Phosphates Glucose 6-phosphate *0.63+0.09 0.71+0.10
Whenever the ratio of metabolite was not determined, it was indicated with a dash (-).
Significant differences (*) were determined by a t-test (p<0.05, n= 2 biological
replicates with 3 technical replicates for each biological replicate).