Arabidopsis thaliana, a Candidate Protein Kinase Involved ... · Cloning Arabidopsis STY46 1 Haishan Gao Cloning and Preliminary Characterization of STY46 from Arabidopsis thaliana,

Cloning Arabidopsis STY46

1

Haishan Gao

Cloning and Preliminary Characterization of STY46 from

Arabidopsis thaliana, a Candidate Protein Kinase Involved in

the Plant Sugar Starvation Response

Haishan Gao, Shaoyun Dong*, Diane M. Beckles

Department of Plant Sciences, University of California—Davis, California, U.S.A.

*Corresponding Author

Shaoyun Dong

Department of Plant Sciences,

University of California—Davis,

Davis, California, U.S.A.

Tel: 530 752 8821

Email: [email protected]


2

Haishan Gao

Abstract

To study how plants respond to conditions under which the carbohydrates needed for growth

and development are exhausted, this project focuses on cloning and functional characterization

of a cytosolic protein kinase, STY46 that may potentially be involved in the sugar starvation

response (SSR). Generating A. thaliana STY46 knockout (-KO) and overexpression (-OE) lines

is the main method in this project to determine the function of the protein. A SALK line

(SALK_116340) was confirmed to contain a T-DNA insert in the STY46 gene and the aim was

to prove that this reduced the expression of this gene. Highly intact RNA was isolated and

reverse transcription PCR performed to determine the level of transcript of STY46 in STY46-KO.

However the results were inconclusive. This may be due to not enough amount of RNA use for

the cDNA reverse transcription. To develop an overexpression line, STY46 was cloned from

wild type Arabidopsis genotype. Primers were designed to flank the open read frame of the

STY46. They also contained restriction enzyme recognition sites and a myc-tag engineered at

their 5’ ends to facilitate subsequent synthesis of a plant transformation construct. A cDNA

fragment of the expected size was successfully amplified by PCR.

Keyword: sugar starvation response, gene cloning, protein kinase, Arabidopsis

1. Introduction

Understanding how plants respond to sugar starvation conditions is important for agriculture.

It is known that plants activate a SSR for survival when the content of cellular sugar goes down

under non-ideal conditions (Geigenberger, 2011). However, the proteins and genes that modulate

this response are not well known. Identifying proteins that regulate plant response to “famine”


3

Haishan Gao

conditions can contribute to our understanding of how plants adapt to maintain normal growth

and development under adverse environments.

According to a recent report, STY46 is a protein kinase involved in chloroplast

differentiation in Arabidopsis (Lamberti et al, 2011). It facilitates pre-protein import into

chloroplast by transit peptide phosphorylation. This implies a regulatory or kinetic function

during chloroplast development and that this kinase might be important in developmental stages

that require the massive influx of nuclear encoded chloroplast proteins (Lamberti et al., 2011).

Previous research (Arias MC, 2014) aimed at identifying novel genes involved in the SSR,

showed that STY46 co-expresses with almost all of the genes within a SSR network structure

including genes involved in amino acid, lipid, and cell wall metabolism, sugar signaling and

transcription regulation. This suggests a central role for STY46 in the SSR. Furthermore,

bioinformatics analysis shows that STY46 gene expression is up-regulated under varying

conditions that leads to low sugars and nitrogen (unpublished data), consistent with a role in SSR.

It is then reasonable to assume that STY46 is a positive regulator in the SSR via affecting the

level of metabolism-related and other proteins in chloroplasts. The function of STY46 has been

hypothesized but no research has been conducted to determine its potential relation with SS.

Our goal is to test if STY46 has a critical role in the SSR. To achieve this, the project will

focus on generating and characterizing STY46-KO and STY46-OE lines. If STY46 is a positive

regulator in the SSR, then plants with lower or higher levels of protein STY46 would be

expected to show defected or better responses to SS conditions respectively, compared with

control. These changes could be examined at multiple levels, including examining (1) levels of


4

Haishan Gao

SS marker metabolites, (2) carbon fluxes through primary metabolism pathways in source and

sink organ, and (3) growth parameters under ‘feast’ and ‘famine’ conditions in these genotypes.

The propose of the project is to generate STY46-KO and STY46-OE lines used for further

physiological and biochemical study, which is the fundamental step of the whole project. The

suppressed and overexpressed lines will be generated in different ways. STY46-KO Arabidopsis

lines were selected from the TAIR database (https://www.arabidopsis.org). Two lines with T-

DNA inserted in different exons of STY46 were chosen. Genetic screening was conducted to

produce T-DNA homozygous lines. Conversely, the purpose of generating an overexpression

line is to produce a line with higher STY46 protein level than wild type. STY46- KO and -OE

lines could be used to study how plants with altered level of STY46 respond to SS differently.

The long-term goal of this project is to perform a detailed physiological and biochemical

analysis of Arabidopsis lines with altered levels of this gene, which will contribute to our

understanding of the role of STY46 in plants. Furthermore, it will better illustrate the multiple

biological events that occur during SSR and its specific effects on plant productivity. The result

of the research could be extended to design better engineering strategies for agriculturally

important crops, which show more robust growth to non-ideal conditions.

2. Materials and Methods

2.1 PCR amplification of the full-length modified STY46 cDNA for cloning

2.1.1 Primer design

The sequence of the STY46 gene (gene identifier number AT4g38740) was obtained from

National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). The left and right

http://www.ncbi.nlm.nih.gov/


5

Haishan Gao

primers were designed using two websites: Primer3Plus (http://www.bioinformatics.nl/cgi-

bin/primer3plus/primer3plus.cgi) and Oligoevaluator (http://www.oligoevaluator.com/). First,

the cDNA full length gene sequence was placed into the Primer 3 Plus program with settings as

following: Primer size: Min of 18, Opt of 22 and Max of 25. Primer Tm: Min of 65, Opt of 72

and Max of 80. Primer GC%: Min. 40, Opt. 60, Max. 80. Then the given pairs of primers were

than pasted into Oligoevaluator to check for presence of primer dimers and secondary structure,

both of which should be absent ideally. The primers chosen ranged from Tm difference within

5°C, and the %GC was between 40-60%, with no or very weak secondary structure or primer

dimers.

Restriction sites (LP BamH1- CGCGGATCC, RP- PstI CTGCAGTTTT) were added to the

left primers (LP) and right primer (RP) respectively, in order to facilitate the insertion of STY46

into the expression plasmid that will be transformed into the plant using the bacterium

Agrobacterium tumefasciens. A MYC-tag (GAACAAAAACTTATTTCTGAAGAAGATCTG)

was added to the RP to facilitate Co-Immunoprecipitation of proteins in plant tissues that may

interact with STY46 in vitro in subsequent experiments. The modified primers were also checked

on Oligoevaluator. (Figure 3)

2.1.2 PCR amplification of the full-length modified STY46 cDNA for cloning

Wild type Arabidopsis cDNA was used as template to amplify STY46 gene fragment with

the designed primer LP (CCCAAGCTTATGGTGATGGAGGACAACGAGAGT) and RP

(GAGGAGAAGCACCACACATCATGAACAAAAACTTATTTCTGAAGAAGATCTG

TAGCTGCAGTTTT) (Figure 2) The PCR conditions are as follows; an initial hot start at 98°C

http://www.oligoevaluator.com/


6

Haishan Gao

for 1 min, annealing at 98°C for 20s and extension at 65°C for 2 min, subsequent denaturation at

72°C for 3 min, 35cycles, and a final extension at 72°C for 10 min. the volume of reaction

mixtures was 20 μL which contained 5 μL cDNA, 1 μL of each primer (10μM), 0.5 μL of dNTP

mix (10mM), 4 μL HF PCR buffer, 0.2 Phusion DNA polymerase (New England Biolabs) and

8.3 μL nuclease-free water.

2.1.3 Agarose Gel Electrophoresis

For every 5 μL of DNA, 1 μL loading dye was added prior to electrophoresis. The agarose

gel was made to a final concentration of 0.8% gel (w/v) (SeaKem®

LE Agarose). Ethidium

bromide was added to a final concentration of (0.1 mg/ mL) to the molten agarose to visualize

DNA on the gel. In the first lane of each gel, 5 μL of a DNA ladder (Lambda HindIII) was used

for comparison of the size of unknown DNA fragments. The gel was electrophoresed for 35 min

at 83 Volts.

2.1.4 DNA extraction from Agarose Gel

The 1.8 kb DNA fragment amplified using STY46 primers was excised from the gel and the

DNA extracted. The gel was placed into a 1.5 mL tube with a melting buffer that was three

times the volume of the gel and put into water bath at 50 °C for 10 min. The gel was incubated

for an additional 5 min and pipetted into a column. It was then centrifuged at 12000 g for 1 min.

After the flow-through was discarded, 600 uL of reagent W1 was added into the column and

centrifuged at 12000 g for 1 min. The flow-through was discarded and the sample was

centrifuged at the max speed for 3 min. The column was then placed into a recovery tube.


7

Haishan Gao

Approximately 50 uL of E5 buffer was pipetted onto the column. After incubation for 1 min at

room temperature, it was then centrifuged at 12000 g for 1 min, and the DNA was collected in

the recovery tube.

2.1.5 Adenine-tailing of the PCR product

Fresh adenines are added to the ends of the DNA fragment to ensure the ligation to the

thymines on the plasmid. To 4 uL of DNA sample, the following were added: 1 μL 10x PCR

buffer, 0.3 μL 50mM MgCl2, 2 μL 1mM dATP, 1 μL AmpliTaq polymerase and 1.7 μL water.

The mixture was incubated at room temperature for 20 min.

2.1.6 Subcloning reaction

To obtain enough PCR products for STY46 sequencing, the PCR fragment was subcloned

into one of the two plasmid vectors, the TOPO pCR4.0 plasmid (Invitrogen, Carlsbad, CA)

and the pGEM-T plasmid vector described below (Promega, Madison, WC).

2.1.6.1 Ligation with TOPO®

Cloning Reaction. Here, 1 μL of PCR®4-TOPO

® vector was mixed

with 4 μL fresh PCR product and 1 μL of salt solution, and enough water to make a final volume

6 μL. Then, the sample was mixed gently and incubated for 30 min at room temperature.

2.1.6.2 Ligation with pGEM®

-T easy plasmid vector. Approximately 3 μL PCR product was

added to a solution containing 0.35 μL pGEM®-T easy vector (50 ng), 5 μL 2X raid ligation

buffer, 1 μL T4 DNA ligase (3 Weiss units/ μL) and 0.65 μL nuclease-free water to a final

volume of 10 μL. The sample was incubated at room temperature for 1 h.


8

Haishan Gao

2.1.6.3 Transformation into Chemically Competent E. coli. The ligation reaction was then left on

ice and 4 μL of this mixture was added to a vial of 25 uL Chemically Competent E. coli (JM109),

mixed together and incubated on ice for 20 min. It was then heat shocked for 50 seconds at 42 °C,

and then put on ice immediately for 2 min. Approximately 950 μL of room temperature S.O.C.

medium was added and the entire tube was shaken at 37 °C for 1.5 hour at 20 rph. Finally, the

solution was spread on pre-warmed selective plates containing 20 mL Agar mixed with

Ampicillin (100 ng/ mL) and X-gal for selection. The plates were then incubated at 37 °C

overnight. The next day, clear and single white cell colonies were selected and inoculated into 5

mL LB broth with Ampicillin(100 ng/ mL) and incubated at 37 °C in shaker for at least 12 hours

for the growth.

2.1.6.4 Plasmid isolation. The QIAprep Spin Miniprep Kit (QIAGEN) was used to isolate

plasmid from overnight bacterial growth. Approximately 5 mL LB broth was pipetted into a 1.5

mL tube, centrifuged 30 s and the supernatant removed. Then, 250 μL buffer P1was added to the

tube and vortexed. Next, 250 μL buffer P2 was added and the tube was inverted gently for 4-6

times to mix. This was followed by the addition of, 350 μL N3 buffer after which the samples

were centrifuged for 10 min and then the supernatant formed was pipetted to a spin column. The

column was centrifuged for 60s and the flow-through was discarded. Next, 750 μL PE buffer was

added and the column was centrifuged for 60s to discard the flow-through. Additional 60s

centrifuge was conducted to ensure that all the liquid was discarded. Finally, the QIA columns

were put into sterile 1.5 mL tubes and added 50 μL EB buffer. After 60 s incubation at room

temperature and 60s centrifuge, the flow-through EB buffer in the 1.5 mL tubes contain the

plasmid. Then, the concentration of the plasmid samples was determined by using Nanodrop.


9

Haishan Gao

2.1.6.5 Plasmid digestion. The isolated plasmid DNA was digested with either EcoRI or PstI

(Promega, Madison, WC). Approximately 2 μL plasmid DNA (~250 ng) sample was mixed

with 16.3 μL nuclease-free water, 2 μL 10×buffer 0.2 μL Acetylated BSA (10 μg/ μL). The

mixture was pipetted several times to mix completely. Then, 0.5 μL EcoRI restriction enzyme

(10 μg/ μL) was added and the solution was incubated at 37°C for 3 hours.

2.2 Characterization of Arabidopsis STY46 KO-lines.

2.2.1 Sampling plant tissues for RNA extraction

When the seedlings were 3 weeks old, young leaves were harvested into liquid nitrogen

from the Col (control) and STY46-KO lines for RNA extraction. Total RNA was isolated from

each seedling. Approximately 100 mg of tissue was finely ground in liquid nitrogen. The tissue

powder was then transferred into a 2 mL eppendorf tube, and 1 mL TRIzol reagent (Invitrogen)

was added. The sample was then shaken and incubated at room temperature for 5 min, after

which 200 μL of chloroform: isoamyl alcohol (chloroform: IAA=24:1) was added. After

vortexing and incubation at room temperature for 3 min, the sample was centrifuged at 12000 g

for 10 min at 4 °C. Next, the upper phase of the sample was transferred to a new sterile

eppendorf tube and 500 μL Isopropanol was added and incubated at room temperature for 10 min.

The solution was centrifuged at 12000 g for 10 min at 4 °C, and the supernatant t discarded.

Approximately 500 μL 4M LiCl was then added into the sample and inverted to mix.

Centrifuged at 12000g for 10 min at 4°C, the supernatant that formed was then discarded. The

sample was then resuspended in 500 μL 1×TE (pH=8.0) and added 500 μL chloroform: IAA and

inverted. Centrifuged at 12000 g for 10 min, the upper phase that formed will be taken and added

500 μL Isopropanol, 66 μL 3M Sodium Acetate (pH=5.2) and inverted to make sure the


10

Haishan Gao

complete mixture. The solution was centrifuged at 12000 g for 10 min at 4 °C, and the

supernatant was discarded. Then 1 mL 75% (v/v) ethanol was added and the sample was then

centrifuged at 7500 g for 5 min at 4 °C. Finally, the pellet was dried briefly and re-dissolved in

50 μL RNA-free double distilled water and the concentration of the solution was measured by

Nanodrop Spectrophotometer. In order to check the integrity of the RNA, an Electrophoresis was

done. Extracted RNA was loaded in the well within 0.8% gel (w/v) (SeaKem® LE Agarose) with

the HindIII Lambda DNA marker.

2.2.2 Reverse Transcription Polymerase Chain Reaction (RT-PCR).

After treating the resulting RNA with a DNase I (Invitrogen, Carlsbad, CA), the RNA

concentration was measured using a Nanodrop Spectrophotometer. The RNA samples were then

transferred to sterile tubes. A master mix containing 10 μL 2xRT master mix (containing 2.0 μL

RT Buffer, 0.8 μL 100nM 25x dNTP mix, 2.0 μL10x RT Random Primer, 1.0 μL MultiScribe

Reverse Transcriptase and 4.2 μL Nuclease-free water) was added into 10 μL RNA, and the

tubes were placed in the PCR machine at 25 °C for 10 min, 37 °C for 120 min and 85 °C for 5

min. The resulting cDNA product was kept on ice.

The cDNA synthesized from the RNA samples were used to conduct the following PCR to

examine the effectiveness of the STY46-KO lines. The PCR cycling parameters were as follows;

an initial hot start at 95 °C for 10 min, annealing at 95 °C for 45s and extension at 55 °C for 45s,

subsequent denaturation at 72 °C for 1min, 28 cycles, and a final extension at 72 °C for 10 min.

The volume of reaction mixtures was 25 μL which contained 5 μL cDNA, 2 μL of each primer

(STY46-s, STY46-as, Actin-s and Actin-as (Table 2)), 1 μL MgCl2 solution, 0.5 μL of dNTP mix


11

Haishan Gao

Figure 1. STY46 cDNA sequence with

the position of the primers to amplify

the full-length cDNA highlighted in

yellow.

(10mM), 2.5 μL 10xPCR buffer, 0.5 μL Taq polymerase and 7.5 μL nuclease-free water. PCR

amplified products were analyzed by using 2% (w/v) agarose gel (SeaKem® LE Agarose) with

ethidium bromide.

3. Results & Discussion

3.1 Amplification of the full-length STY46 to engineer a construct for STY46-OE lines

3.1.1 PCR amplification of cDNA

According to the reference from the website Oligoevaluator, the complementary nuclear

acids of the first 24 and the last 22 (ending code not included) base pairs (Figure 1) from the

CDS full length STY46 DNA sequence were picked as basic part of the primers for the following

amplification while requirements such as no secondary structure or dimers are considered.


12

Haishan Gao

The primers designed to the sequence were modified by adding a restriction site and a myc-

tag sequence. The additional restriction site enables the gene to be digested more easily and the

myc-tag will facilitate the STY46 protein to Co-immunoprecipitation assay later (Figure 2):

Modified Sense primer:

CGCGGATCCATGGTGATGGAGGACAACGAGAGT

Modified Antisense primer:

AAAACTGCAGCTACAGATCTTCTTCAGAAATAAGTTTTTGTTCTCAATGATGTGTGG

TGCTTCTCCTC

Figure 2. The sequence of the primers including the modified ends. The BamHI site is shown in

red, the PstI site in green and the myc-tag in blue.

The modified primers were examined on Oligoevaluator (Figure 3) to ensure that the

amplification could continue successfully.

Figure 3. The result of the modified primers on Oligoevaluator


13

Haishan Gao

Primers were designed to the cDNA sequence and used in a PCR reaction with a proof-

reading DNA polymerase called Phusion High Fidelity Taq. This would ensure that the cDNA

is synthesized accurately, and that the sequence of the open reading frame (ORF) would be

translated into the correct polypeptide when transformed into the plants. A band of ~1800 bp in

the first lane is in accordance with the expected size of the STY46 full-length ORF (Figure 4).

Therefore, it was cut and purified from the gel for further experimentation.

3.1.2 Subcloning the PCR product to generate enough DNA for sequencing and construct

synthesis.

DNA extracted from the agarose gel was purified and then ligated into the pCR4.0 TOPO

plasmid vector (Figure 5), and transformed into E.coli competent cells. After isolating the

plasmid DNA from the cells, we conducted a diagnostic test with restriction enzyme EcoRI to

determine whether the recombination was successful. If the STY46 full-length cDNA fragment

was cloned into the plasmid and the recombinant plasmid digested with EcoRI, there should be 3

DNA fragments of sizes: 3.9 kb, 1.1 kb, 0.7 kb.

Figure 4 Gel electrophoresis of PCR

product amplified from wild type

Arabidopsis thaliana cDNA using

primers designed to STY46

Shown is an agarose gel 0.8% (w/v) after

electrophoresis for 40 minutes at 83 volt.

Lambda HindIII marker was used to

estimate the sizes of the DNA amplified.


14

Haishan Gao

Figure 5. pCR4-TOPO vector map

These bands would be generated because there is an EcoRI site inside STY46 gene at the

location of 1.1 kb and two EcoRI sites in the multiple cloning site in the vector (Figure 5). If not,

it means there is no effective recombination.

The result of the diagnostic test shows three bands, whose lengths are 3.9 kb, 2.3 kb, 1.8 kb,

which does not correspond to that expected (Figure 6).

Figure 6 Gel electrophoresis of diagnostic test:

restriction digest with EcoRI within pCR4-TOPO

vector


electrophoresis for 35 minutes at 83 volt. Lambda

HindIII marker was used to estimate the sizes of

the DNA amplified.


15

Haishan Gao

In the 2nd

lane (P1), there are faint bands of 2.3 kb and 1.8 kb length and a clear band of 3.9

kb (the length of the vector). These results were inconclusive. There may be several reasons:

First, the sample might contain supercoiled DNA due to incomplete digestion of the plasmid

with EcoRI. Supercoiled DNA migrates faster on the gel than linear DNA leading to the

appearance of an insert that is smaller than the plasmid vector although both forms of DNA are

of identical size. The problem may have occurred during the digestion with EcoRI. Therefore,

PstI restriction enzyme was used to digest the plasmid to double check if there is an insert of the

correct size. If the ligation and transformation were successful, there should be two bands with

different lengths as 1.8 kb and 4.0 kb after digestion with PstI (See plasmid map in Figure 5).

The results showed that the sizes of bands on the gel did not comport with that if the plasmid was

recombinant. (Figure 7)

The results from both the EcoRI and PstI suggest that the settings of the PCR system might

not be the optimal for the amplification of enough DNA for efficient ligation into the vector.

Because the transformation efficiency is low, a more efficient vector, pGEM-T easy vector

(Figure 8), is used. The first test was to take the remaining PCR product and ligate it into pGEM-

Figure 7. Gel electrophoresis of diagnostic

test: restriction digest with PstI within

pCR4-TOPO vector


electrophoresis for 35 minutes at 83 volt.

Lambda HindIII marker was used to



16

Haishan Gao

T. The ligation protocol was followed exactly and the transformation was done using new JM109

competent bacterial cells which were purchased.

Figure 8. pGEM-T easy vector map

If the transformation of the PCR product into pGEM-T was successful, there should be three

bands- 3.0 kb, 1.1 kb, and 0.7 kb because there is a EcoRI site inside STY46 gene at the location

of 1.1 kb and two EcoRI sites inside the vector beside the insertion point.

The result did not show there is recombination because there is a faint band of about 1.5 kb

(Figure 9) in the second lane (W2) which was close to the length of STY46 gene. This fragment

was purified it and sent it to the sequence facility to determine if it is our expected gene.

However, the sequence amplified did not match any gene in Arabidopsis genome database (data

not shown).

Figure 9 Gel electrophoresis of diagnostic test:

restriction digest with EcoRI within pGEM-T easy

vector




the DNA amplified.


17

Haishan Gao

A second hypothesis is that adenine tailing of the PCR product may be inefficient. Therefore

the instead of using the high fidelity Phusion polymerase, a basic non-proofreading DNA

polymerase called AmpliTaq was used. AmpliTaq is not as precise but the PCR product would

be automatically adenylated at the end of the PCR avoiding the need to perform the adenine

tailing in a separate step.

However, the repeated PCR with AmpliTaq failed: nothing was amplified (Figure 10).

Overall, a gene fragment of the length expected has been successfully amplified by the

designed primers and purified from the gel. However, subcloning of the gene did not go well.

The longer than average length of the modified primers may have complicated the PCR. To

improve the experiment, it is suggested to amplify the STY46 ORF with gene-specific primers

(without the modified ends) in order to obtain enough for successful subcloning. Once the

sequence is verified, modified primers could be used to conduct PCR on the recombinant

plasmid to engineer the ends to STY46 DNA fragment. Such a PCR, on a pure DNA template

Figure 10 Gel electrophoresis of gene

amplification by using AmpliTaq DNA

polymerase




the DNA amplified.


18

Haishan Gao

may be more successful than using a cDNA library with 1000s of different sequences which we

attempted here.

3.2 Determining the level of STY46 transcript in STY46-KO lines.

Another important goal of this research was to determine if the STY46-KO lines were

reduced in STY46 transcript, using Reverse Transcriptase-PCR. STY46 primers were used to

amplify the cDNA of the wild type. The primers were successfully used in other experiments.

The expected outcome was that there would be reduced or no transcript in the KO-lines but a

band of ~ 370 bp amplified in the wild type. The results (Figure 11) show that there was no

product in the mutants (expected), but, surprisingly, also not in the wild type. Thus the results

were inconclusive.

We asked if the reverse transcription failed because of the degradation of the extracted RNA.

To determine this, the RNA used for the RT-PCR was examined by agarose gel electrophoresis.

The result showed that the RNA was intact, with the three ribosomal RNA bands of the expected

Figure 11. Gel electrophoresis of reverse

transcription of RNA: no suppression gene in the

STY46 line




the DNA amplified.


19

Haishan Gao

sizes (Figure 12). Therefore the lack of amplification of the expected product was not due to

degraded RNA.

A second hypothesis is that the RNA was extracted from plants that did not express STY46

at sufficiently high level to permit easy detection under the RT-PCR conditions we used.

Therefore we extracted fresh RNA from another set of KO-line plants and the Col-1 control. The

figure shows that intact RNA was isolated from these lines with the three ribosomal bands of

expected size and lightness, which shows they are intact (Figure 13).

Figure 12. Gel electrophoresis for RNA. Lanes of plants containing wild type DNA are labeled “col” while the T-

DNA mutants of STY46 were labeled k3-1 to k7-15

Shown is an agarose gel 0.8% (w/v) after electrophoresis for 45 minutes at 83 volt.

Figure 13. Electrophoresis for RNA extracted from

STY46-KO line: no degradation



HindIII marker was used.


20

Haishan Gao

Then, the concentration of the RNA was determined by Nanodrop Spectrophotometer (Table

1) which indicated that the concentrations were good. The 260/280 and 260/230 ratios also

indicated that the RNA was not contaminated by carbohydrates, proteins or organic compounds

used during purification (Table 1).

Table 1. The concentration of the extracted RNA from different STY46-KO Arabidopsis lines as

well as the Col-1 control

After the concentrations of the samples were diluted so that they were all of the same

concentration, the reverse transcription was conducted to synthesize cDNA from the samples.

The settings of the PCR were also optimized to promote greater synthesis of the target fragment.

Col-1 and Col-2 (cDNA synthesized from previous extracted wild type RNA) were used as

control groups to testify the effectiveness of the primer.


21

Haishan Gao

Figure 14 showed that there are no bands amplified in the samples containing cDNA.

However, the last three lanes contained cDNA isolated from young seedlings of the wild-type

Arabidopsis amplified with other primers that were proven to work previously with the expected

length of 376 bp. The result shows the effectiveness of the primer.

The current hypothesis is that the amount of the cDNA synthesized was too little to be

detected during the RT-PCR because the plants from which RNA was extracted are not in the

ideal developmental state when STY46 is highly expressed. Far more RNA was needed (at least

2 micrograms) for each cDNA reaction from these older plants instead of the 700 ng we used

(Figure 14). Therefore, we may need to plant the KO line Arabidopsis seeds again to collect

leaves with highly expression of the protein.

4. Conclusion

The work started here acts as a good basis for continuing this project. Conditions for cloning

the STY46 ORF have been established and also the stage of development of the plants and the

Figure 14. Gel electrophoresis of PCR

amplification of STY46 using synthesized cDNA

from newly extracted RNA with previous

synthesized wild type cDNA as control group.

Lanes Col-1, Col-2 and N3 contained cDNA

extracted from another batch of wild type

Arabidopsis as a control.



HindIII marker and 1kb marker were used to



22

Haishan Gao

amount of RNA needed to detect STY46 in the KO lines. Young seedlings harvested during

extended dark when the STY46 is highly expressed will be used to extract RNA in the future.

When generating the STY46 overexpressing lines, we add restriction site and myc-tag

directly to the primer designed to amplify the full-length of STY46 open reading frame. The

complex modified primers may lead to the unsatisfied result of PCR. To improve the experiment,

we will use simple primers (without the modified ends) to clone the STY46 into vector and use

modified primers to amplify STY46 from the vector.

After verification of the effectiveness of the KO line in the Arabidopsis thaliana and

successfully transform the overexpression gene to Arabidopsis line, the plants (KO, OE, Col-0

lines) will be grown in nutrient solution in growth chamber (12h light/ 12h dark) to characterize

the differential phenotypic and metabolic response to SS.

Because this study is focused on the function of one specific protein STY46, we didn’t

research its relationship with other protein kinases in the STY family. There may be a

compensatory function from other STY proteins in the STY46-KO lines which may complicate

the result and influence the conclusion as to role of STY46. Therefore, further study could focus

on testing the function of the whole group of the protein kinases within the knock-out line to

check if the compensation phenomenon really exists.


23

Haishan Gao

References

Geigenberger P (2011) Regulation of Starch Biosynthesis in Response to a Fluctuating

Environment. Plant physiology 155 (4): 1566-1577.

Giorgia Lamberti (2011) The Cytosolic Kinases STY8, STY17, and STY46 Are Involved in

Chloroplast Differentiation in Arabidopsis. Plant Physiology, 157:70-85.

Arias MC, et al. (2014) From dusk till dawn: the Arabidopsis thaliana sugar starving responsive

network. Frontiers in plant science, 5:482.

Clough SJ & Bent AF (1998) Floral dip: a simplified method for Agrobacterium mediated

transformation of Arabidopsis thaliana. Plant Journal, 16(6): 735-743.

Acknowledgement

I would like to thank Janki Patel for her assistance in the lab.


24

Haishan Gao

Appendix

Oligonucleotide name Oligonucleotide sequence Experiment

STY46-s AGGTTGCAGACTTTGGGGTG Quantitative RT PCR

STY46-as TCCCTCTTCTCCTACCTCCTTG Quantitative RT PCR

actin2-s GGTGATGGTGTGTCT Quantitative RT PCR

actin2-as ACTGAGCACAATGTTAC Quantitative RT PCR

STY46 cDNA for

CGCGGATCCATGGTGATGGAGGACAAC

GAGAGT

cloning in pCAMBIA 1300

vector

STY46 cDNA rev

AAAACTGCAGCTACAGATCTTCTTCAGA

AATAAGTTTTTGTTCATGATGTGTGGTG

CTTCTCCTC

cloning in pCAMBIA 1300

vector

Table 2: the oligonucleotides used in the experiments.

Documents

Arabidopsis thaliana, a Candidate Protein Kinase Involved ... · Cloning Arabidopsis STY46 1 Haishan Gao Cloning and Preliminary Characterization of STY46 from Arabidopsis thaliana,