Research Communication

Aquaporin-9 is Expressed in Rat Sertoli Cells

and Interacts with the Cystic Fibrosis

Transmembrane Conductance Regulator

Tito T. Jesus1,2

Raquel L. Bernardino1,2

Ana D. Martins1,2

Ros�alia S�a2

M�ario Sousa2,3

Marco G. Alves1

Pedro F. Oliveira1,2*

1CICS-UBI, Health Sciences Research Centre, University of Beira Interior,Covilh~a, Portugal2Department of Microscopy, Laboratory of Cell Biology, MultidisciplinaryUnit for Biomedical Research, UMIB-FCT, Institute of Biomedical SciencesAbel Salazar (ICBAS), University of Porto, Portugal3Centre for Reproductive Genetics Alberto Barros, Porto, Portugal

Abstract

Men with mutations in the cystic fibrosis transmembrane con-

ductance regulator (CFTR) gene are usually subfertile/infertile.

Besides playing a role in Cl2/HCO32 transport, it has been pro-

posed that CFTR interacts with water membrane transport sys-

tems, particularly aquaporins, to control seminiferous tubular

secretion, which is regulated by the somatic Sertoli cells

(SCs). As aquaporin-9 (AQP9) is highly expressed throughout

the male reproductive tract, we hypothesized that it is also

present in rat SCs and that it physically interacts with CFTR.

To test this hypothesis, primary cultures of rat SCs were

established, and expression of CFTR and AQP9 was assessed

by RT-polymerase chain reactions (mRNA) and Western blot

analysis (protein). A coimmunoprecipitation assay was used to

evaluate the physical interaction between CFTR and AQP9.

Our results show that CFTR and AQP9 are expressed in rat

SCs. We were also able to detect a molecular interaction

between CFTR and AQP9 in rat SCs. This is the first report

describing the presence of AQP9, and its interaction with

CFTR, in rat SCs. Moreover, our results provide evidence that

CFTR is involved in water homeostasis of the seminiferous

tubular secretion. These mechanisms may open new insights

on therapeutic targets to counteract subfertility/infertility in

men with cystic fibrosis and mutations in the CFTR gene.

VC 2014 IUBMB Life, 66(9):639–644, 2014

Keywords: CFTR; aquaporin-9; Sertoli cells; water transport; male

fertility

IntroductionSpermatogenesis is a highly regulated process that occursthrough the close association between developing germ cellsand Sertoli cells (SCs) (1). The connection between adjacentSCs establishes the blood–testis barrier (BTB) and, in rats, isformed at the age of 15- to 18-day postpartum (2) and exerts a

strict control over the passage of substances (1, 3) Thus, SCsregulate the composition of the seminiferous tubular fluid(STF) and the physiochemical milieu where spermatogenesisoccurs (1, 4). Distinct types of water and ion transport proteinshave been identified in the plasmatic membrane of SCs (forreview, see ref. 4); however, their involvement on the estab-lishment of STF remains largely unknown.

The cystic fibrosis transmembrane conductance regulator(CFTR) is a cAMP-regulated membrane transporter of theATP-binding cassette superfamily (5), known to be widely dis-tributed in cells of the reproductive tract (6). Mutations inCFTR have been linked with numerous abnormalities on themale reproductive system, including the congenital bilateralabsence of the vas deferens and absence or abnormal produc-tion of sperm cells (7–9). CFTR is present mainly in the plas-matic membrane of SCs (10), playing a role in Cl2 and HCO3

2

transport (11). In addition, it has been reported that CFTR alsoplays an important role in epithelial cells fluid volume

VC 2014 International Union of Biochemistry and Molecular BiologyVolume 66, Number 9, September 2014, Pages 639–644

Address correspondence to: Pedro F. Oliveira, CICS-UBI, Health SciencesResearch Centre, University of Beira Interior, Av. Infante D. Henrique,6201-506 Covilh~a, Portugal. Tel: 1351-275-329077. Fax: 1351-275-329099.E-mail: pfobox@gmail.comReceived 22 July 2014; Accepted 5 September 2014DOI 10.1002/iub.1312Published online 1 October 2014 in Wiley Online Library(wileyonlinelibrary.com)

IUBMB Life 639

regulation (5) by interacting with water channel (aquaporins)(12). Aquaporins (AQPs) are crucial for water homeostasis asthey facilitate rapid and massive water movement across epi-thelia (for review, see ref. 13). During spermatogenesis, thereduction of volume of differentiating germ cells is remark-able, mainly due to the osmotically driven fluid efflux (14),being expectable that AQPs are implicated in this process. Sev-eral AQPs are expressed throughout the male reproductiveexcurrent ducts (15–18). Aquaporin-9 (AQP9) is an aquaglycer-oporin, which is also permeable to monocarboxylates, such aslactate, and various solutes (19). This AQP isoform is highlyexpressed in the brain, particularly in astrocytes (20), wheresolute transport regulation is critical. Astrocytes are constitu-ents of blood–brain barrier (BBB), which exhibits remarkablesimilarities with BTB (21). Herein, we propose to identify theexpression of CFTR and AQP9 in cultured rat SCs. Further-more, as it has been reported that CFTR can interact withAQPs to exert its physiological role and that AQP9 is one of themost predominant AQPs in male reproductive tract (17,22–24), we hypothesize that AQP9 and CFTR can establish amolecular interaction.

Experimental procedures

ChemicalsNZY M-MuLV reverse transcriptase, random hexamer primers,dNTPs and NZTaq 23 Green Master Mix, agarose, and DNAladder were obtained from NZYTech (Lisboa, Portugal). Pri-mers were obtained from STABVIDA (Oeiras, Portugal). Allother chemicals were purchased from Sigma-Aldrich (St.Louis, USA), unless stated otherwise.

AnimalsTwenty-day-old male Wistar rats (Rattus norvegicus) werehoused in our accredited animal facilities and maintainedunder a 12-h light/12-h darkness cycle and constant roomtemperature (20 �C 6 2 �C), with food and water ad libitum.The experiments were performed in accordance with nationaland international guidelines, following the “Guide for the Careand Use of Laboratory Animals,” available in the US National

Institutes of Health (NIH Publication no. 85-23, revised 1996),and the EU rules for the care and handling of laboratory ani-mals (Directive 2010/63/EU).

Rat Sertoli Cells Primary CulturesMale Wistar rats were sacrificed, the testes excised, andwashed in Hank’s balanced salt solution. SCs were isolatedusing standard methods as reported by Alves et al. (25). By theimmunoperoxidase detection of a specific protein marker,Vimentin, the purity of the cell cultures was assessed. Cultureswere examined by phase contrast microscopy, and only thecultures with cell contaminants below 5% were used asdescribed elsewhere (25).

RT-PCRTotal RNA (RNAt) was extracted from liver, lung, and SCsusing the E.Z.N.A. Total RNA Kit (Omega Bio-Tek, Norcross,USA) as indicated by the manufacturer. RNA concentrationand absorbance ratios (A260/A280) were determined by spec-trophotometry (NanophotometerTM, Implen, Germany). RNAtwas reversely transcribed using standard methods (26).

CFTR and AQP9 cDNA fragments were amplified usingspecific primer sets. Polymerase chain reactions (PCRs) werecarried out as described by Alves et al. (26). Primers sequen-ces, optimal annealing temperature, number of cycles requiredfor exponential amplification phase of fragments, fragmentssize, and positive control are indicated (Table 1). cDNA-freesample was used as negative control. Samples were run in 1%agarose gel electrophoresis and visualized using softwareMolecular Imager FX Pro Plus MultiImager (Biorad, Hercules,USA) coupled to an image acquisition system (Vilber Lourmat,Marne-la-Vall�ee, France). The size of the expected productswas compared with a DNA ladder.

Western BlottingWestern blot analysis was performed using standard methods(27), where protein samples (50 lg) were fractionated on a12% SDS-PAGE and transferred to polyvinylidene difluoride(PVDF) membranes. The membranes were then blocked andincubated overnight at 4 �C with rabbit anti-AQP9 (1:1,000;AQP91-A; Gentaur, Gdansk, Poland) or goat anti-CFTR (1:500;SC-8909; Santa Cruz Biotechnology, Heidelberg, Germany).

Oligonucleotides and cycling conditions for RT-PCR amplification of cystic fibrosis transmembrane conductance regulator

(CFTR) and aquaporin-9 (AQP9) mRNA

mRNA Sequence (5 0-3 0) AT (�C) Amplificon size (bp) C PtC

CFTR Sense: GTTGGGAATCAGCGATGGAG 65 156 40 Lung

AN: NM_031506.1 Anti-sense: TGACTGTGTAGGGAAGCACA

AQP9 Sense: CCCAGTTTTTGGGAGCCTTT 65 97 45 Liver

AN: NM_022960.2 Antisense: CCTACGACGAGCAGTTTTCC

Abbreviations: AN, Genebank Accession Number; AT, annealing temperature; C, number of cycles during exponential phase of amplification;

PtC, positive control; RT-PCR, reverse transcription polymerase chain reaction.

TABLE 1

IUBMB LIFE

640 Aquaporin-9 and CFTR In Sertoli Cells

The immunoreactive proteins were detected separately withgoat anti-rabbit IgG-AP (1:5,000; SC-2007; Santa Cruz Biotech-nology) or donkey anti-goat IgG-AP (1:5,000; SC-2020; SantaCruz Biotechnology). Membranes were reacted with ECFdetection system (GE Healthcare, Wessling, Germany) andread with the BioRad FX-Pro-plus (Bio-Rad, Hemel Hemp-stead, UK). The densities from each band were obtained usingthe Quantity One Software (Bio-Rad).

Co-immunoprecipitationCFTR was immunoprecipitated using the DynabeadsVR Coimmu-noprecipitation Kit (Life Technologies, Carlsbad, USA). Magneticbeads and anti-CFTR goat antibody were conjugated accordingto the manufacturer’s protocol. In brief, harvested SCs (up to50 mg) were lysed in extraction buffer (with 100 mM NaCl,1:400 Protease Inhibitor Cocktail) and centrifuged (2,500 3 gfor 5 min). The final supernatant contained the cell lysateready to be used immediately for coimmunoprecipitation. Forco-immunoprecipitation, CFTR antibody-coupled beads werewashed in extraction buffer. The supernatant was discarded,and the pelleted beads were resuspended in the cell lysate. Thissuspension was incubated at 4 �C for 30 min. The supernatantwas then removed, and the beads were washed three times inthe extraction buffer. The beads were then washed in the LastWash Buffer (with 0.02% Tween-20). Finally, the beads wereresuspended in the elution buffer and gently mixed. Proteinexpression was evaluated by Slot blot analysis after confirma-tion of antibodies specificity by Western blot analysis.

Slot BlottingProtein samples (5 lg) were diluted in PBS and transferred toactivated PVDF membranes using a Hybri-Slot manifold sys-

tem (Biometra, G€ottingen, Germany). The membranes werethen blocked and incubated overnight at 4 �C with rabbit anti-AQP9 antibody (1:1,000) or goat anti-CFTR antibody (1:500).The immunoreactive proteins were detected separately withgoat anti-rabbit IgG-AP (1:5,000) or donkey anti-goat IgG-AP(1:5,000). Membranes were then reacted with ECF and readusing a BioRad FX-Pro-plus. The specificity of the antibodiesused in this technique (anti-CFTR and anti-AQP9) was before-hand evaluated by using the Western blot technique and con-trol samples (lung and brain tissue and SCs protein extracts).The Slot blot technique was only executed if for each antibodya single band was present in the identification of the specificprotein in the control and SCs samples (by Western blotanalysis).

Results

Aquaporin-9 Is Expressed in Rat Sertoli CellsVarious AQP isoforms have been identified throughout themale reproductive tract, with AQP9 being one of the mostabundant isoforms. So far, AQP9 has only been described ininterstitial Leydig cells and in spermatocytes at early stages ofdevelopment (20). Thus, as AQP9 mediates water flux and sol-ute movement through BBB, which exhibits remarkable simi-larities with BTB, we evaluated the expression of AQP9 in cul-tured rat SCs. When we analyzed the expression of the mRNAtranscript of AQP9 in rat SCs, we were able to detect a 97-bpproduct (Fig. 1, lane A). Additionally, using a specific AQP9antibody, we further confirmed the protein expression of thisAQP in SCs, by noticing a single band with an apparent molec-ular weight of �32 kDa in the immunoblot analysis (Fig. 1,lane B).

Cultured Rat Sertoli Cells Express CFTRCFTR has already been identified in cultured SCs (7, 12), andit has been proposed that CFTR plays a crucial role in seminif-erous fluid secretion and ionic composition (11, 28). Thus, asexpected, we were also able to detect the presence of the 156-bp product of CFTR mRNA in cultured rat SCs (Fig. 1, lane D).Furthermore, using a specific anti-CFTR antibody, we wereable to detect a single specific staining of �165 kDa by West-ern blot analysis, which corresponds to the intact CFTR pro-tein (Fig. 1, lane E).

Aquaporin-9 Physically Interacts with CFTR in RatSertoli CellsCFTR has been reported to be present in germ cells of variousdevelopmental stages, indicating its role during spermatogene-sis (10, 29, 30). During this process, it has been suggested thatCFTR is involved in water fluxes regulation (29). Thus, asgerm cells are in close contact with adjacent SCs, which formthe BTB and are responsible for the formation of the intratub-ular fluid microenvironment, and are known to highly expressCFTR, we hypothesized that this membrane transporter maymodulate water movements in SCs by molecular interactions

Expression of aquaporin-9 (AQP9) and cystic fibrosis

transmembrane conductance regulator (CFTR) in cul-

tured rat Sertoli cells (SCs). Representative images of

AQP9 RT-PCR (lane A), AQP9 Western blot analysis

(lane B), AQP9 Slot blot analysis (lane C) and of

CFTR RT-PCR (lane D), CFTR Western blot analysis

(lane E), and CFTR Slot blot analysis (lane F). NtC,

no-template control; PtC, positive control brain

cDNA.

FIG 1

Jesus et al. 641

with AQPs. Given that AQP9 plays a key role in water trans-port through BBB, we hypothesized that it could be presentnot only in SCs (which form the BTB) but also interacts withCFTR in these cells. Herein and to test our hypothesis, weused a co-immunoprecipitation protocol. We were able to effi-ciently conjugate the anti-CFTR antibody to magnetic beadsand to precipitate the CFTR protein from cultured rat SCs bythe specific staining detected using the same anti-CFTR anti-body and the Slot blot technique (Fig. 2, panel C). Additionally,and using the same sample (obtained after conjugating theanti-CFTR goat antibody to magnetic beads and after theco-immunoprecipitation protocol), we were able to detect thepresence of a specific staining correspondent to the AQP9.Thus, these results clearly indicate that AQP9 co-immunopre-cipitated with CFTR in rat SCs (Fig. 2).

DiscussionSCs are responsible for creating the intraluminal environmentfor the occurrence of spermatogenesis. This process is highlyregulated, and the flux of water and electrolytes is dependenton several membrane transporters (4). Among those, CFTR isknown to be essential to spermatogenesis and is expressed inSCs in vivo (7). Mutations in CFTR have been reported to causeabnormalities of the male reproductive tract and germ celldevelopment (9, 10, 31). Moreover, 20% of men with infertilitydue to sperm abnormalities have a mutation in the CFTR gene(32), illustrating that normal CFTR expression is a requisite fora successful spermatogenesis. Thus, we confirmed the pres-

ence of CFTR mRNA in cultured rat SCs, and we identified aRT-PCR product with the predicted size consistent with theCFTR sequence and also immunoreactive bands in rat SCslysates using a specific antibody against CFTR. As expected,our results were conclusive and confirm the presence of CFTRin cultured rat SCs. Additionally, it has been described thatCFTR enhances osmotic water permeability in various cells ortissues (33, 34) and that CFTR establishes a synergistic inter-action with AQP9 in rat epididymis (35). Nevertheless, to ourknowledge, AQP9 has not been identified in rat SCs. As dis-cussed, these cells are responsible for STF ionic compositionand for the control of water movements, both essential for theestablishment of STF luminal environment (36). Thus, thepresence of specific water transporters, namely, AQPs, in SCsis expected. Some AQP isoforms have been consistentlydescribed in SCs (12, 17, 37). Herein, we focused on AQP9expression in cultured SCs as it is one of the most abundantAQPs in male reproductive ducts. AQP9 expression was previ-ously evaluated in whole testes by using immunocytochemistry(17) and in situ hybridization methods (20), being that so far ithas been described in spermatocytes at early stages of devel-opment, in the seminiferous tubule, and in Leydig cells; how-ever, to the best of our knowledge, it has never been reportedin rat SCs. Moreover, AQP9 is highly expressed in astrocytes,which support BBB (38), a structure similar to the BTB. Hence,we hypothesized that AQP9 could be present in rat SCs andevaluated the presence of AQP9 mRNA transcripts, by RT-PCR,and of AQP9 protein by immunoblot analysis. Our results pro-vide unequivocal evidence that AQP9 is present in rat SCs.

Model showing the molecular interaction of aquaporin-9 (AQP9) and cystic fibrosis transmembrane conductance regulator

(CFTR) in cultured rat Sertoli cells (SCs) (panel A) as determined by the co-immunoprecipitation technique (panel B). Rat SCs

lysates were incubated with magnetic beads functionalized with anti-CFTR antibody. Antibody-bound protein complexes con-

taining CFTR were eluted from the magnetic beads, and proteins were identified by the Slot blot technique. Immunoprecipi-

tated CFTR protein was detected, and coimmunoprecipitated AQP9 protein was derived from the SCs eluted (panel C). Panel C

represents six replicas of the detection by the Slot blot technique of CFTR and AQP9 protein obtained after the coimmunopreci-

pitation technique. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

FIG 2

IUBMB LIFE

642 Aquaporin-9 and CFTR In Sertoli Cells

Besides, recent studies showed that CFTR interacts withseveral AQPs in different cellular systems (33, 34), including inthe epididymal cells (35) and SCs (12). These interactionsbetween CFTR and AQPs have been implicated in the clinicaloutcome of cystic fibrosis, in which mutations of the CFTRgene led to fluid accumulation (39). Recently, we have shownthat CFTR is a molecular partner of AQP4 (12), illustratingthat water and ion movements can be a result of the interac-tion between CFTR and AQPs. Indeed, as in this work, weidentified for the first time the presence of AQP9 and as thisAQP is known to play a key role in epididymal cells (35), wehypothesized that it can also interact with CFTR in culturedSCs. Indeed, we observed a molecular interaction betweenAQP9 and CFTR in the current study using the co-immunopre-cipitation technique. This strongly suggests that CFTR mightserve as a regulator of AQPs and water homodynamics in SCs,as it was previously shown to occur in other cells of the malereproductive tract (24, 35).

In conclusion, our results show that AQP9 and CFTR areexpressed in rat SCs. Moreover, we were able to demonstratethat AQP9 and CFTR physically interact in cultured rat SCs.We have previously reported that AQP4 is also a molecularpartner of CFTR (12). Thus, our studies show that CFTR con-trols the STF in close association with AQPs. More studies willbe needed to characterize the functional relevance of theseinteractions. Moreover, the role of AQP9 in rat SCs alsoremains largely unknown. Nevertheless, it is well known thatAQP9 is highly expressed throughout the male reproductivetract and is responsible for water balance and ion homeostasisin the several tissues where it is expressed. To further disclosethe role of the mechanism now disclosed, in vivo studies witha fully intact BTB must be performed to confirm the relevanceof CFTR–AQP9 interaction.

Our results provide evidence that CFTR not only acts as anionic channel but can also act as a regulator of water perme-ability. This hypothesis raises the possibility that abnormal SCfunctioning in men with cystic fibrosis may involve not onlydefective Cl2/HCO3

2 transport but also water transport, whichmay result in severe alterations in STF and spermatogenesisarrest. Our results provide new information concerning malesubfertility/infertility in men with mutations in CFTR gene andraise new questions to future work. These mechanisms relatedwith water/ion transport are essential and may point towardpossible therapeutic targets to counteract male subfertility/infer-tility in men with cystic fibrosis and mutations in CFTR gene.

AcknowledgementsThis work was supported by FCT, Foundation for Science andTechnology, Portugal (PTDC/QUI-BIQ/121446/2010), cofundedby Fundo Europeu de Desenvolvimento Regional, FEDER viaPrograma Operacional Factores de Competitividade, COM-PETE/QREN. M. G. Alves (SFRH/BPD/80451/2011) was fundedby FCT, Portugal. P. F. Oliveira was funded by FCT (Portugal)through FSE and POPH funds (Programa Ciencia 2008). T. T.

Jesus and R. L. Bernardino were funded by Santander/Totta,UBI protocol (Portugal). The UMIB was funded by nationalfunds through FCT (Portugal) under the project Pest-OE/SAU/UI0215/2014.

References

[1] Mruk, D. D., and Cheng, C. Y. (2004) Sertoli–Sertoli and Sertoli–germ cell

interactions and their significance in germ cell movement in the seminiferous

epithelium during spermatogenesis. Endocr. Rev. 25, 747–806.

[2] Mruk, D. D., and Cheng, C. Y. (2008) Delivering non-hormonal contraceptives

to men: advances and obstacles. Trends Biotechnol. 26, 90–99.

[3] Alves, M. G., Rato, L., Carvalho, R. A., Moreira, P. I., Socorro, S., et al. (2013)

Hormonal control of Sertoli cell metabolism regulates spermatogenesis. Cell.

Mol. Life Sci. 70, 777–793.

[4] Rato, L., Socorro, S., Cavaco, J. E., and Oliveira, P. F. (2010) Tubular fluid

secretion in the seminiferous epithelium: ion transporters and aquaporins in

Sertoli cells. J. Membr. Biol. 236, 215–224.

[5] Liu, Y., Wang, D. K., and Chen, L. M. (2012) The physiology of bicarbonate

transporters in mammalian reproduction. Biol. Reprod. 86, 99.

[6] Quinton, P. M. (2007) Too much salt, too little soda: cystic fibrosis. Sheng Li

Xue Bao 59, 397–415.

[7] Boockfor, F. R., Morris, R. A., DeSimone, D. C., Hunt, D. M., and Walsh, K. B.

(1998) Sertoli cell expression of the cystic fibrosis transmembrane conduct-

ance regulator. Am. J. Physiol. 274, C922–C930.

[8] Wong, P. Y. (1998) CFTR gene and male fertility. Mol. Hum. Reprod. 4, 107–

110.

[9] Grangeia, A., Barro-Soria, R., Carvalho, F., Damas, A. M., Maur�ıcio, A. C.,

et al. (2008) Molecular and functional characterization of CBAVD-causing

mutations located in CFTR nucleotide-binding domains. Cell. Physiol. Bio-

chem. 22, 79–92.

[10] Teixeira, S., S�a, R., Grangeia, A., Silva, J., Oliveira, C., et al. (2013) Immuno-

histochemical analysis of CFTR in normal and disrupted spermatogenesis.

Syst. Biol. Reprod. Med. 59, 53–59.

[11] Xu, W. M., Chen, J., Chen, H., Diao, R. Y., Fok, K. L., et al. (2011) Defective

CFTR-dependent CREB activation results in impaired spermatogenesis and

azoospermia. PLoS One 6, e19120.

[12] Jesus, T. T., Bernardino, R. L., Martins, A. D., Sa, R., Sousa, M., et al. (2014)

Aquaporin-4 as a molecular partner of cystic fibrosis transmembrane con-

ductance regulator in rat Sertoli cells. Biochem. Biophys. Res. Commun.

446, 1017–1021.

[13] Agre, P., King, L. S., Yasui, M., Guggino, W. B., Ottersen, O. P., et al. (2002)

Aquaporin water channels—from atomic structure to clinical medicine. J.

Physiol. 542, 3–16.

[14] Huang, H. F., He, R. H., Sun, C. C., Zhang, Y., Meng, Q. X., et al. (2006) Func-

tion of aquaporins in female and male reproductive systems. Hum. Reprod.

Update 12, 785–795.

[15] Brown, D., Verbavatz, J. M., Valenti, G., Lui, B., and Sabolic I. (1993) Local-

ization of the CHIP28 water channel in reabsorptive segments of the rat

male reproductive tract. Eur. J. Cell Biol. 61, 264–273.

[16] Stevens, A. L., Breton, S., Gustafson, C. E., Bouley, R., Nelson, R. D., et al. (2000)

Aquaporin 2 is a vasopressin-independent, constitutive apical membrane pro-

tein in rat vas deferens. Am. J. Physiol. Cell Physiol. 278, C791–C802.

[17] Badran, H. H., and Hermo, L. S. (2002) Expression and regulation of aqua-

porins 1, 8, and 9 in the testis, efferent ducts, and epididymis of adult rats

and during postnatal development. J. Androl. 23, 358–373.

[18] Hermo, L., Schellenberg, M., Liu, L. Y., Dayanandan, B., Zhang, T., et al.

(2008) Membrane domain specificity in the spatial distribution of aquaporins

5, 7, 9, and 11 in efferent ducts and epididymis of rats. J. Histochem. Cyto-

chem. 56, 1121–1135.

[19] Badaut, J., and Regli, L. (2004) Distribution and possible roles of aquaporin

9 in the brain. Neuroscience 129, 971–981.

[20] Tsukaguchi, H., Shayakul, C., Berger, U. V., Mackenzie, B., Devidas, S., et al.

(1998) Molecular characterization of a broad selectivity neutral solute chan-

nel. J. Biol. Chem. 273, 24737–24743.

Jesus et al. 643

[21] Alves, M. G., Oliveira, P. F., Socorro, S., and Moreira, P. I. (2012) Impact of

diabetes in blood–testis and blood–brain barriers: resemblances and differ-

ences. Curr. Diabetes Rev. 8, 401–412.

[22] Elkjaer, M., Vajda, Z., Nejsum, L. N., Kwon, T., Jensen, U. B., et al. (2000)

Immunolocalization of AQP9 in liver, epididymis, testis, spleen, and brain.

Biochem. Biophys. Res. Commun. 276, 1118–1128.

[23] Pastor-Soler, N., Bagnis, C., Sabolic, I., Tyszkowski, R., McKee, M., et al.

(2001) Aquaporin 9 expression along the male reproductive tract. Biol.

Reprod. 65, 384–393.

[24] Pietrement, C., Da Silva, N., Silberstein, C., James, M., Marsolais, M., et al.

(2008) Role of NHERF1, cystic fibrosis transmembrane conductance regulator,

and cAMP in the regulation of aquaporin 9. J. Biol. Chem. 283, 2986–2996.

[25] Alves, M. G., Martins, A. D., Vaz, C. V., Correia, S., Moreira, P. I., et al.

(2014) Metformin and male reproduction: effects on Sertoli cell metabolism.

Br. J. Pharmacol. 171, 1033–1042.

[26] Alves, M. G., Neuhaus-Oliveira, A., Moreira, P. I., Socorro, S., and Oliveira,

P. F. (2013) Exposure to 2,4-dichlorophenoxyacetic acid alters glucose

metabolism in immature rat Sertoli cells. Reprod. Toxicol. 38, 81–88.

[27] Alves, M. G., Socorro, S., Silva, J., Barros, A., Sousa, M., et al. (2012) In

vitro cultured human Sertoli cells secrete high amounts of acetate that is

stimulated by 17b-estradiol and suppressed by insulin deprivation. Biochim.

Biophys. Acta 1823, 1389–1394.

[28] Ko, W. H., Chan, H. C., Chew, S. B., and Wong, P. Y. (1998) Regulated anion

secretion in cultured epithelia from Sertoli cells of immature rats. J. Physiol.

512 (Part 2), 471–480.

[29] Gong, X., Li, J., Cheung, K., Leung, G., Chew, S. B. C., et al. (2001) Expres-

sion of the cystic fibrosis transmembrane conductance regulator in rat sper-

matids: implication for the site of action of antispermatogenic agents. Mol.

Hum. Reprod. 7, 705–713.

[30] Hihnala, S., Kujala, M., Toppari, J., Kere, J., Holmberg, C., et al. (2006)

Expression of SLC26A3, CFTR and NHE3 in the human male reproductive

tract: role in male subfertility caused by congenital chloride diarrhoea. Mol.

Hum. Reprod. 12, 107–111.

[31] Grangeia, A., Sa, R., Carvalho, F., Martin, J., Girodon, E., et al. (2007) Molecu-

lar characterization of the cystic fibrosis transmembrane conductance regula-

tor gene in congenital absence of the vas deferens. Genet. Med. 9, 163–172.

[32] van der Ven, K., Messer, L., van der Ven, H., Jeyendran, R. S., and Ober, C.

(1996) Cystic fibrosis mutation screening in healthy men with reduced

sperm quality. Hum. Reprod. 11, 513–517.

[33] Schreiber, R., Nitschke, R., Greger, R., and Kunzelmann, K. (1999) The cystic

fibrosis transmembrane conductance regulator activates aquaporin 3 in air-

way epithelial cells. J. Biol. Chem. 274, 11811–11816.

[34] Schreiber, R., Pavenstadt, H., Greger, R., and Kunzelmann, K. (2000) Aqua-

porin 3 cloned from Xenopus laevis is regulated by the cystic fibrosis trans-

membrane conductance regulator. FEBS Lett. 475, 291–295.

[35] Cheung, K. H., Leung, C. T., Leung, G. P., and Wong, P. Y. (2003) Synergistic

effects of cystic fibrosis transmembrane conductance regulator and

aquaporin-9 in the rat epididymis. Biol. Reprod. 68, 1505–1510.

[36] Cho, Y. S., Svelto, M., and Calamita, G. (2003) Possible functional implica-

tions of aquaporin water channels in reproductive physiology and medically

assisted procreation. Cell. Mol. Biol. 49, 515–519.

[37] Hermo, L., Krzeczunowicz, D., and Ruz, R. (2004) Cell specificity of aquapor-

ins 0, 3, and 10 expressed in the testis, efferent ducts, and epididymis of

adult rats. J. Androl. 25, 494–505.

[38] Iacovetta, C., Rudloff, E., and Kirby, R. (2012) The role of aquaporin 4 in the

brain. Vet. Clin. Pathol. 41, 32–44.

[39] Levin, M., and Verkman, A. (2006) Aquaporins and CFTR in ocular epithelial

fluid transport. J. Membr. Biol. 210, 105–115.

IUBMB LIFE

644 Aquaporin-9 and CFTR In Sertoli Cells